[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-000822

Length: 1,000

Sequence [FASTA format sequence]
GAGACCTGGC AGGGATTTGG GACGCTGGAC AGGCAGTTTC TTCACGTAGC CAGAGTGCGA
ACGTGGGGTG CAAAACGGGT CCTTTGCGGC GCGGTGGGTT CGGGGCCCTG GCAGCCGTTT
TGCGGAGGTG CCACGCCCTA GGGGCTGGGC CGTGGTGGGC CCGGGGTCTA CTCCGACCAC
CTGGACCGCG AAGTGGCCTG GGAACTGGAA GGAAGATGTT CCCCGGGCGC TGTCCGCCGC
CCGCGCTACT GGGCCGAGGT CCCCATCTCA ACGTAGATTC TCTTTTTCCC CTCTTCTGCA
GGCTCGTTTC TGGCATGATG GCGCAAAGGG CCTTCCCGAA TCCTTATGCA GATTTTAACA
AATCCCTGGC CGAAGGCTAC TTTGATTCTG CTGGGAGGCT CACTCCTGAG TTCTCACAAC
GTGTGAACAA TAAGATTCGA GAGCTGCTTC AGCAAATGGA GAGAGGCCTA AAATCAGCAG
ACCCTCGCGA TGGCACTGCT TACACTGGAT GGGCAGGTAT CGCTGTGCTT TACTTACACC
TCTATGATGT GTTTGGGGAC CCTGCCTACC TGCAGATGGC ACATGGCTAT GCAAAGCAAA
GTCTGAACTG TTTGACCAAG CGTTCCATCA CCTTCCTGTG TGGTGATGCG GGCCCCCTGG
CAGTGGCTGC TGTGGTGCAT GACAAGATGA ACAATGAGAA GCAGGCAGAA GACTGTATCA
CCCGGCTAAT TCACCTAAAT AAGATTGACC CGCATGCTCC AAATGAAATG CTGTATGGAC
GAATGGGCTA CATCTATGCT CTTCTCTTTG TGAATAAGAA CTTTGGAGTA GAAAAGATTC
CTCGAAGCCA TATTCAGCAG ATTTGTGAAA CAGTCTTAAC CTCTGGAGAA AACCTAGCTA
GAAAAAAAAA CTTCCAGAAA AAACTCCCCT GATGTATGAA GGGAACAAAA AAATTATGTG
GGGGCTGCTC TGGGCCTGGC AGGAATTTAT TACTACCTGA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLANCL1LanC lantibiotic synthetase component C-like 1 (bacterial)392e-112O
Contig/Assembly ProteinLANCL2LanC lantibiotic synthetase component C-like 2 (bacterial)1751e-46O
Contig/Assembly ProteinLANCL3LanC lantibiotic synthetase component C-like 3 (bacterial)52.46e-07O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 3      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
OVRM10061G05OVRM1_0061_G05.bBP152815 
OVRM10082H02OVRM1_0082_H02.bBP153827 AK235446
UTR010058F08UTR01_0058_F08.bBP464284 

  

Alignment:      TOP

20060611C-000822 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0082_H02.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0061_G05.b : agttgtcxxxxxxxxxxxxxxxxxx
UTR01_0058_F08.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20060611C-000822 : GAGACCTGGCAGGGATTTGGGACGCTGGACAGGCAGTTTCTTCACGTAGCCAGAGTGCGA
---------+---------+---------+---------+---------+---------+ 60
OVRM1_0082_H02.b : GAGACCTGGCAGGGATTTGGGACGCTGGACAGGCAGTTTCTTCACGTAGCCAGAGTGCGA
OVRM1_0061_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCTTCACGTAGCCCGAGTGCGA
UTR01_0058_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAGCCAGAGTGCGA
20060611C-000822 : ACGTGGGGTGCAAAACGG*GTCCTTTGCGGCGCGGTGGGTTCGGGGCCCTGGCAGCCGTT
---------+---------+---------+---------+---------+---------+ 119
OVRM1_0082_H02.b : ACGTGGGGTGCAAAACGGAGTCCTTTGCGGCGCGGTGGGTTCGGGGCCCTGGCAGCCGTT
OVRM1_0061_G05.b : ACGTGGGGTGCAAAACGG*GTCCTTTGCGGCGCGGTGGGTTCGGGGCCCTGGCAGCCGTT
UTR01_0058_F08.b : ACGTGGGGTGCAAAACGG*GTCCTTTGCGGCGCGGTGGGTTCGGGGCCCTGGCAGCCGTT
20060611C-000822 : TTGCGGAGGTGCCACGCCCTAGGGGCTGGGCCGTGGTGGGCCCGGGGTCTACTCCGACCA
---------+---------+---------+---------+---------+---------+ 179
OVRM1_0082_H02.b : TTGCGGAGGTGCCACGCCCTAGGGGCTGGGCCGTGGTGGGCCCGGGGTCTACTCCGACCA
OVRM1_0061_G05.b : TTGCGGAGGTGCCACGCCCTAGGGGCTGGGCCGTGGTGGGCCCGGGGTCTACTCCGACCA
UTR01_0058_F08.b : TTGCGGAGGTGCCACGCCCTAGGGGCTGGGCCGTGGTGGGCCCGGGGTCTACTCCGACCA
20060611C-000822 : CCTGGACCGCGAAGTGGCCTGGGAACTGGAAGGAAGATGTTCCCCGGGCGCTGTCCGCCG
---------+---------+---------+---------+---------+---------+ 239
OVRM1_0082_H02.b : CCTGGACCGCGAAGTGGCCTGGGAACTGGAAGGAAGATGTTCCCCGGGCGCTGTCCGCCG
OVRM1_0061_G05.b : CCTGGACCGCGAAGTGGCCTGGGAACTGGAAGGAAGATGTTCCCCGGGCGCTGTCCGCCG
UTR01_0058_F08.b : CCTGGACCGCGAAGTGGCCTGGGAACTGGAAGGAAGATGTTCCCCGGGCGCTGTCCGCCG
20060611C-000822 : CCCGCGCTACTGGGCCGAGGTCCCCATCTCAACGTAGATTCTCTTTTTCCCCTCTTCTGC
---------+---------+---------+---------+---------+---------+ 299
OVRM1_0082_H02.b : CCCGCGCTACTGGGCCGAGGTCCCCATCTCAACGTAGATTCTCTTTTTCCCCTCTTCTGC
OVRM1_0061_G05.b : CCCGCGCTACTGGGCCGAGGTCCCCATCTCAACGTAGATTCTCTTTTTCCCCTCTTCTGC
UTR01_0058_F08.b : CCCGCGCTACTGGGCCGAGGTCCCCATCTCAACGTAGATTCTCTTTTTCCCCTCTTCTGC
20060611C-000822 : AGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
---------+---------+---------+---------+---------+---------+ 359
OVRM1_0082_H02.b : AGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
OVRM1_0061_G05.b : AGGCTCGTTTCTGGCATGATGGCGCANAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
UTR01_0058_F08.b : AGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
20060611C-000822 : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
---------+---------+---------+---------+---------+---------+ 419
OVRM1_0082_H02.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
OVRM1_0061_G05.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
UTR01_0058_F08.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
20060611C-000822 : CGTGTGAACAATAAGATTCGAGAGCTGCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
---------+---------+---------+---------+---------+---------+ 479
OVRM1_0082_H02.b : CGTGTGAACAATAAGATTCGAGAGCTGCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
OVRM1_0061_G05.b : CGTGTGAACAATAAGATTCGAGAGCTGCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
UTR01_0058_F08.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
20060611C-000822 : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
---------+---------+---------+---------+---------+---------+ 539
OVRM1_0082_H02.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
OVRM1_0061_G05.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
UTR01_0058_F08.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
20060611C-000822 : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
---------+---------+---------+---------+---------+---------+ 599
OVRM1_0082_H02.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAN
OVRM1_0061_G05.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAN
UTR01_0058_F08.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
20060611C-000822 : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
---------+---------+---------+---------+---------+---------+ 659
OVRM1_0082_H02.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
OVRM1_0061_G05.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
UTR01_0058_F08.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
20060611C-000822 : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
---------+---------+---------+---------+---------+---------+ 719
OVRM1_0082_H02.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCCAGCAGAAGACTGTATC
OVRM1_0061_G05.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
UTR01_0058_F08.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
20060611C-000822 : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
---------+---------+---------+---------+---------+---------+ 779
OVRM1_0082_H02.b : ACC
OVRM1_0061_G05.b : ACCCGGCTAATTCACCTNAATNAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
UTR01_0058_F08.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
20060611C-000822 : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
---------+---------+---------+---------+---------+---------+ 839
OVRM1_0082_H02.b :
OVRM1_0061_G05.b : CGAATGGGCTACATCTATGCTCT
UTR01_0058_F08.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
20060611C-000822 : CCTCGAAGCCATATTCAGCAGATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTAGCT
---------+---------+---------+---------+---------+---------+ 899
OVRM1_0082_H02.b :
OVRM1_0061_G05.b :
UTR01_0058_F08.b : CCTCGAAGCCATATTCAGCAGATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTAGCT
20060611C-000822 : AGAAAAAAAAACTTCCAGAAAAAACTCCCCTGATGTATGAAGGGAACAAAAAAATTATGT
---------+---------+---------+---------+---------+---------+ 959
OVRM1_0082_H02.b :
OVRM1_0061_G05.b :
UTR01_0058_F08.b : AGAAAAAAAAACTTCCAGAAAAAACTCCCCTGATGTATGAAGGGAACAAAAAAATTATGT
20060611C-000822 : GGGGGCTGCTCTGGGCCTGGCAGGAATTTATTACTACCTGA...................
---------+---------+---------+---------+---------+---------+ 1000
OVRM1_0082_H02.b :
OVRM1_0061_G05.b :
UTR01_0058_F08.b : GGGGGCTGCTCTGGGCCTGGCAGGAATTTATTACTACCTGAatgcaccccaccctccagt
20060611C-000822 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
OVRM1_0082_H02.b :
OVRM1_0061_G05.b :
UTR01_0058_F08.b : tgacccttgcaaaagtacaaaatttgggtaaacccaattggtaaattatgtctgcccacc
20060611C-000822 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
OVRM1_0082_H02.b :
OVRM1_0061_G05.b :
UTR01_0058_F08.b : tgaaaattccctttcgggcaatttccccttccttgtgggggaaaaaaactccaaaatttt
20060611C-000822 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
OVRM1_0082_H02.b :
OVRM1_0061_G05.b :
UTR01_0058_F08.b : gcctattcccatttgggggcccccgggtttccccctgggggggaaaaatcctaaattgcc
20060611C-000822 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
OVRM1_0082_H02.b :
OVRM1_0061_G05.b :
UTR01_0058_F08.b : tcctttttccggggcccact