[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-000823

Length: 1,231

Sequence [FASTA format sequence]
AAGTGAAAGC GTCGCTTCTG TTATTGTCCA GAAGCTGCAG GGCTCGTTTC TGGCATGATG
GCGCAAAGGG CCTTCCCGAA TCCTTATGCA GATTTTAACA AATCCCTGGC CGAAGGCTAC
TTTGATTCTG CTGGGAGGCT CACTCCTGAG TTCTCACAAC GCGTGAACAA TAAGATTCGA
GAGCTTCTTC AGCAAATGGA GAGAGGCCTA AAATCAGCAG ACCCTCGCGA TGGCACTGCT
TACACTGGAT GGGCAGGTAT CGCTGTGCTT TACTTACACC TCTATGATGT GTTTGGGGAC
CCTGCCTACC TGCAGATGGC ACATGGCTAT GCAAAGCAAA GTCTGAACTG TTTGACCAAG
CGTTCCATCA CCTTCCTGTG TGGTGATGCG GGCCCCCTGG CAGTGGCTGC TGTGGTGCAT
GACAAGATGA ACAATGAGAA GCAGGCAGAA GACTGTATCA CCCGGCTAAT TCACCTAAAT
AAGATTGACC CGCATGCTCC AAATGAAATG CTGTATGGAC GAATGGGCTA CATCTATGCT
CTTCTCTTTG TGAATAAGAA CTTTGGAGTA GAAAAGATTC CTCGAAGCCA TATTCAGCAG
ATTTGTGAAA CAGTCTTAAC CTCTGGAGAA AACCTAGCTA GAAAAAGAAA CTTCACAGAA
AAAACTCCAC TGATGTATGA ATGGTACCAA GAATATTATG TGGGGGCTGC TCATGGCCTG
GCAGGAATTT ATTACTACCT GATGCAGCCC AGCCTTCAAG TGAGCCATGC GAAGTTACAG
AGTTTGGTCA AGCCTAGTGT AGATTATGTC TGCCAGCTGA AATTCCCTTC AGGCAATTAC
CCTCCTTGTG TGGACGACAC TCGAGATCTG CTAGTCCATT GGTGCCACGG TTCCCCTGGG
GTAATCTACA TGCTCATTCA GGCCTATAAG GTGTTCAGAG AAGAACGGTA TCTCAATGAT
GCCTACCAGT GTGCCGATGT GATCTGGAAG TACGGGTTGC TGAAGAAGGG GTACGGGCTG
TGCCACGGCA CTGCGGGGAA CGCCTATGCC TTCCTGACCC TGTTCAACCT CACGCAGGAC
ATGAAGTACC TATATAGGGC TTGTAAGTTT GCTGAGTGGT GTCTAGATTA TGGAGAACAT
GGATGCAGAA CACCGGACAC TCCTTTCTCC CTCTTTGAAA GGAATGGCTG GAACAATATA
TTTCCTGGCT GACCTGCTAA TGCCCACAAA A


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLANCL1LanC lantibiotic synthetase component C-like 1 (bacterial)7420.0O
Contig/Assembly ProteinLANCL2LanC lantibiotic synthetase component C-like 2 (bacterial)442e-125O
Contig/Assembly ProteinLANCL3LanC lantibiotic synthetase component C-like 3 (bacterial)1712e-42O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 23      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010003C06AMP01_0003_C06.bBW955147 AK343625
LNG010014A08LNG01_0014_A08.bBP433594 
LNG010019C08LNG01_0019_C08.bBP435546 
LNG010026D01LNG01_0026_D01.bBP435962 
LNG010080C10LNG01_0080_C10.bBP435752 
PBL010010B05PBL01_0010_B05.bBW969086 
PBL010054E05PBL01_0054_E05.bBW971294 
SKNB10006C01SKNB1_0006_C01.bDB800420 
SKNB10032G06SKNB1_0032_G06.bDB801751 
SKNB10038G11SKNB1_0038_G11.bDB802104 
SKNB10047C02SKNB1_0047_C02.bDB802675 
SKNB10063C07SKNB1_0063_C07.bDB803811 
SKNB10086D01SKNB1_0086_D01.bDB805248 
TCH010009G03TCH01_0009_G03.bCJ023140 AK397861
TCH010095A11TCH01_0095_A11.bCJ029349 
TES010016H06TES01_0016_H06.bCJ031110 
TES010032H05TES01_0032_H05.bCJ032146 
TES010064D09TES01_0064_D09.bCJ034126 
TES010065H06TES01_0065_H06.bCJ034217 
TES010087E07TES01_0087_E07.bCJ035637 
TES010111C01TES01_0111_C01.bCJ037307 
THY010098B01THY01_0098_B01.bBP160651 
THY010114B04THY01_0114_B04.bBP160977 AK239582

  

Alignment:      TOP

20060611C-000823 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0009_G03.b :
PBL01_0010_B05.b :
PBL01_0054_E05.b :
LNG01_0026_D01.b : cctx
THY01_0098_B01.b : gagc
SKNB1_0047_C02.b :
TCH01_0095_A11.b :
SKNB1_0006_C01.b :
SKNB1_0038_G11.b :
AMP01_0003_C06.b : ttttggaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0016_H06.b :
SKNB1_0032_G06.b :
LNG01_0080_C10.b :
TES01_0032_H05.b :
TES01_0064_D09.b :
SKNB1_0086_D01.b :
LNG01_0014_A08.b :
TES01_0111_C01.b :
THY01_0114_B04.b :
TES01_0087_E07.b :
TES01_0065_H06.b :
SKNB1_0063_C07.b :
LNG01_0019_C08.b :
20060611C-000823 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0009_G03.b : nntttggtaggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0010_B05.b : naagtttcnnnnggatatacagcggtaxxxxxxxxxxxxx
PBL01_0054_E05.b : nnnggatacacaxxxxxxxxxxxxxxxxxxxxx
LNG01_0026_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0098_B01.b : atttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0047_C02.b :
TCH01_0095_A11.b : tttaagataggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0006_C01.b :
SKNB1_0038_G11.b :
AMP01_0003_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0016_H06.b :
SKNB1_0032_G06.b :
LNG01_0080_C10.b : nnntttgcatggacttgacxxxxxxxxxxxxxxxx
TES01_0032_H05.b :
TES01_0064_D09.b :
SKNB1_0086_D01.b :
LNG01_0014_A08.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0111_C01.b :
THY01_0114_B04.b : gtgtcaa
TES01_0087_E07.b :
TES01_0065_H06.b :
SKNB1_0063_C07.b : tttgggttcgacgttggctagggt
LNG01_0019_C08.b :
20060611C-000823 : .....................AAGTGAAAGCGTCGCTTCTGTTATTGTCCAGAAGCTGCA
---------+---------+---------+---------+---------+---------+ 39
TCH01_0009_G03.b : xxxxxxxxxxxxxxxxxxxxxAAGTGAAAGCGTCGCTTCTGTTATTGTCCAGAAGCTGCA
PBL01_0010_B05.b : xxxxxxxxxxxxxxxxxxxxxxxGTGAAAGCGTCGCTTCTGTTATTGTCCAGAAGCTGCA
PBL01_0054_E05.b : xxxxxxxxxxxxxxxxxxxxxxxGTGAAAGCGTCGCTTCTGTTATTGTCCAGAAGCTGCA
LNG01_0026_D01.b : xxxxxxxxxxxxxxxxxxxxxxxGTGAAAGCGTCGCTTCTGTTATTGTCCAGAAGCTGCA
THY01_0098_B01.b : xxxxxxxxxxxxxxxxxxxxxxxGTGAAAGCGTCGCTTCTGTTATTGTCCAGAAGCTGCA
SKNB1_0047_C02.b : aaanncctgcgttgctatggatgAGCGTCGCTTCTGTTATTGTCC*GAAGCTGCA
TCH01_0095_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGTCGCTTCTGTTATTGTCCAGAAGCTGCA
SKNB1_0006_C01.b : nccacggtggctacggagtgaaCGTCGCTTCTGT*ATTGTC*AGAAGCTGCA
SKNB1_0038_G11.b : nnnttactgacggtggcagtgaacgtcCTTCTGTT*TTGTCC*GAAGCTGCA
AMP01_0003_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTATTGTCCAGAAGCTGCA
TES01_0016_H06.b : nnnnncctgcgttggctctgaTATTGTC*AGAAGCTGCA
SKNB1_0032_G06.b : nnnccctttnnnttaacctgcgttggctatggaTATTGTCC*GAAGCTGCA
LNG01_0080_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGTCCAGAAGCTGCA
TES01_0032_H05.b : tcacgttggctatggaTGTCC*GAAGCTGCA
TES01_0064_D09.b : tttttgctacgtggctatgggtCAGAAGCTGCA
SKNB1_0086_D01.b : nnnttttcgcgtggctatgGAAGCTGC*
LNG01_0014_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCTGCA
TES01_0111_C01.b : ttttcccgctgttgctctggcAAGCTGCA
THY01_0114_B04.b : aagcagcggtacggtccggaatcctcagcacgttggctacgggtattgtccagaaCTGCA
TES01_0087_E07.b : gcgttggctctggatgtccgaaCTGCA
TES01_0065_H06.b : nctgcgttggctctgagCTGC*
SKNB1_0063_C07.b : gagggcccgagacctggcagggatttgggacgctggacaggcagtttcttcacgtagcca
LNG01_0019_C08.b :
20060611C-000823 : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
---------+---------+---------+---------+---------+---------+ 99
TCH01_0009_G03.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
PBL01_0010_B05.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
PBL01_0054_E05.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
LNG01_0026_D01.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
THY01_0098_B01.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
SKNB1_0047_C02.b : GGGCTCGTCTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
TCH01_0095_A11.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
SKNB1_0006_C01.b : GGGCTCGTCTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
SKNB1_0038_G11.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
AMP01_0003_C06.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
TES01_0016_H06.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
SKNB1_0032_G06.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
LNG01_0080_C10.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
TES01_0032_H05.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
TES01_0064_D09.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
SKNB1_0086_D01.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
LNG01_0014_A08.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
TES01_0111_C01.b : GG*CTCGTTTCTGGCATGATGGCGCAGAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
THY01_0114_B04.b : G*GCTCGTT*CTGGCATGATGGCGCA*AGGGCCN*CCCGAATCCTTATGCAGATTT*AAC
TES01_0087_E07.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGGTTTTAAC
TES01_0065_H06.b : GGGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
SKNB1_0063_C07.b : gaGCTCGTTTCTGGCATGATGGCGCAAAGGGCCTTCCCGAATCCTTATGCAGATTTTAAC
LNG01_0019_C08.b :
20060611C-000823 : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
---------+---------+---------+---------+---------+---------+ 159
TCH01_0009_G03.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
PBL01_0010_B05.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
PBL01_0054_E05.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
LNG01_0026_D01.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
THY01_0098_B01.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
SKNB1_0047_C02.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
TCH01_0095_A11.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
SKNB1_0006_C01.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
SKNB1_0038_G11.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
AMP01_0003_C06.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
TES01_0016_H06.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
SKNB1_0032_G06.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
LNG01_0080_C10.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
TES01_0032_H05.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
TES01_0064_D09.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
SKNB1_0086_D01.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
LNG01_0014_A08.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
TES01_0111_C01.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
THY01_0114_B04.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
TES01_0087_E07.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
TES01_0065_H06.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
SKNB1_0063_C07.b : AAATCCCTGGCCGAAGGCTACTTTGATTCTGCTGGGAGGCTCACTCCTGAGTTCTCACAA
LNG01_0019_C08.b :
20060611C-000823 : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
---------+---------+---------+---------+---------+---------+ 219
TCH01_0009_G03.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
PBL01_0010_B05.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
PBL01_0054_E05.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
LNG01_0026_D01.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
THY01_0098_B01.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
SKNB1_0047_C02.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
TCH01_0095_A11.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
SKNB1_0006_C01.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
SKNB1_0038_G11.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
AMP01_0003_C06.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
TES01_0016_H06.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAGATCAGCA
SKNB1_0032_G06.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
LNG01_0080_C10.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
TES01_0032_H05.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
TES01_0064_D09.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
SKNB1_0086_D01.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
LNG01_0014_A08.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
TES01_0111_C01.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
THY01_0114_B04.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
TES01_0087_E07.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
TES01_0065_H06.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
SKNB1_0063_C07.b : CGCGTGAACAATAAGATTCGAGAGCTTCTTCAGCAAATGGAGAGAGGCCTAAAATCAGCA
LNG01_0019_C08.b : agcatttcgtgaacxxxxxxxxxxxxxxx
20060611C-000823 : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
---------+---------+---------+---------+---------+---------+ 279
TCH01_0009_G03.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
PBL01_0010_B05.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
PBL01_0054_E05.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
LNG01_0026_D01.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
THY01_0098_B01.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
SKNB1_0047_C02.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
TCH01_0095_A11.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
SKNB1_0006_C01.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
SKNB1_0038_G11.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
AMP01_0003_C06.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
TES01_0016_H06.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
SKNB1_0032_G06.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
LNG01_0080_C10.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
TES01_0032_H05.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
TES01_0064_D09.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
SKNB1_0086_D01.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
LNG01_0014_A08.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
TES01_0111_C01.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
THY01_0114_B04.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
TES01_0087_E07.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
TES01_0065_H06.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
SKNB1_0063_C07.b : GACCCTCGCGATGGCACTGCTTACACTGGATGGGCAGGTATCGCTGTGCTTTACTTACAC
LNG01_0019_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTTACAC
20060611C-000823 : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
---------+---------+---------+---------+---------+---------+ 339
TCH01_0009_G03.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
PBL01_0010_B05.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
PBL01_0054_E05.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
LNG01_0026_D01.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
THY01_0098_B01.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
SKNB1_0047_C02.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
TCH01_0095_A11.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
SKNB1_0006_C01.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
SKNB1_0038_G11.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
AMP01_0003_C06.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
TES01_0016_H06.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
SKNB1_0032_G06.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
LNG01_0080_C10.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
TES01_0032_H05.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
TES01_0064_D09.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCCATGCAAAGCAA
SKNB1_0086_D01.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
LNG01_0014_A08.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
TES01_0111_C01.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
THY01_0114_B04.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
TES01_0087_E07.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
TES01_0065_H06.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
SKNB1_0063_C07.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
LNG01_0019_C08.b : CTCTATGATGTGTTTGGGGACCCTGCCTACCTGCAGATGGCACATGGCTATGCAAAGCAA
20060611C-000823 : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
---------+---------+---------+---------+---------+---------+ 399
TCH01_0009_G03.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
PBL01_0010_B05.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
PBL01_0054_E05.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
LNG01_0026_D01.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
THY01_0098_B01.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
SKNB1_0047_C02.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
TCH01_0095_A11.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
SKNB1_0006_C01.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
SKNB1_0038_G11.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
AMP01_0003_C06.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
TES01_0016_H06.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
SKNB1_0032_G06.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
LNG01_0080_C10.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
TES01_0032_H05.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
TES01_0064_D09.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
SKNB1_0086_D01.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
LNG01_0014_A08.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
TES01_0111_C01.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
THY01_0114_B04.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
TES01_0087_E07.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
TES01_0065_H06.b : AGTCTGAACTGTTTGACCAAGCGTTCCGTCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
SKNB1_0063_C07.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
LNG01_0019_C08.b : AGTCTGAACTGTTTGACCAAGCGTTCCATCACCTTCCTGTGTGGTGATGCGGGCCCCCTG
20060611C-000823 : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
---------+---------+---------+---------+---------+---------+ 459
TCH01_0009_G03.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
PBL01_0010_B05.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
PBL01_0054_E05.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
LNG01_0026_D01.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
THY01_0098_B01.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
SKNB1_0047_C02.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
TCH01_0095_A11.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
SKNB1_0006_C01.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
SKNB1_0038_G11.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
AMP01_0003_C06.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
TES01_0016_H06.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
SKNB1_0032_G06.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
LNG01_0080_C10.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
TES01_0032_H05.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
TES01_0064_D09.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
SKNB1_0086_D01.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
LNG01_0014_A08.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
TES01_0111_C01.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
THY01_0114_B04.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
TES01_0087_E07.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
TES01_0065_H06.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
SKNB1_0063_C07.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
LNG01_0019_C08.b : GCAGTGGCTGCTGTGGTGCATGACAAGATGAACAATGAGAAGCAGGCAGAAGACTGTATC
20060611C-000823 : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
---------+---------+---------+---------+---------+---------+ 519
TCH01_0009_G03.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
PBL01_0010_B05.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
PBL01_0054_E05.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
LNG01_0026_D01.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
THY01_0098_B01.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
SKNB1_0047_C02.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
TCH01_0095_A11.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
SKNB1_0006_C01.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
SKNB1_0038_G11.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
AMP01_0003_C06.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
TES01_0016_H06.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
SKNB1_0032_G06.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
LNG01_0080_C10.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
TES01_0032_H05.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
TES01_0064_D09.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
SKNB1_0086_D01.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
LNG01_0014_A08.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
TES01_0111_C01.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
THY01_0114_B04.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
TES01_0087_E07.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
TES01_0065_H06.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
SKNB1_0063_C07.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
LNG01_0019_C08.b : ACCCGGCTAATTCACCTAAATAAGATTGACCCGCATGCTCCAAATGAAATGCTGTATGGA
20060611C-000823 : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
---------+---------+---------+---------+---------+---------+ 579
TCH01_0009_G03.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
PBL01_0010_B05.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
PBL01_0054_E05.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
LNG01_0026_D01.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
THY01_0098_B01.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
SKNB1_0047_C02.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGGTT
TCH01_0095_A11.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
SKNB1_0006_C01.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
SKNB1_0038_G11.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
AMP01_0003_C06.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
TES01_0016_H06.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
SKNB1_0032_G06.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
LNG01_0080_C10.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
TES01_0032_H05.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
TES01_0064_D09.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
SKNB1_0086_D01.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
LNG01_0014_A08.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
TES01_0111_C01.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
THY01_0114_B04.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGgggttaaaaaaat
TES01_0087_E07.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
TES01_0065_H06.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
SKNB1_0063_C07.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
LNG01_0019_C08.b : CGAATGGGCTACATCTATGCTCTTCTCTTTGTGAATAAGAACTTTGGAGTAGAAAAGATT
20060611C-000823 : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
---------+---------+---------+---------+---------+---------+ 636
TCH01_0009_G03.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
PBL01_0010_B05.b : CCTCGAAGCCATATTCAGCAGGTAATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
PBL01_0054_E05.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
LNG01_0026_D01.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
THY01_0098_B01.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
SKNB1_0047_C02.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
TCH01_0095_A11.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
SKNB1_0006_C01.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
SKNB1_0038_G11.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
AMP01_0003_C06.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAAAAAACCTA
TES01_0016_H06.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
SKNB1_0032_G06.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
LNG01_0080_C10.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
TES01_0032_H05.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
TES01_0064_D09.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
SKNB1_0086_D01.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
LNG01_0014_A08.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
TES01_0111_C01.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGACAACCTA
THY01_0114_B04.b : tccccaagcccttttcagcagatggtgaacagccttaccctggggaaaaccggggggggg
TES01_0087_E07.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
TES01_0065_H06.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
SKNB1_0063_C07.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
LNG01_0019_C08.b : CCTCGAAGCCATATTCAGCAG***ATTTGTGAAACAGTCTTAACCTCTGGAGAAAACCTA
20060611C-000823 : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
---------+---------+---------+---------+---------+---------+ 694
TCH01_0009_G03.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
PBL01_0010_B05.b : GCTAGAAAAAGAAACTTTACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCCAGAAT
PBL01_0054_E05.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
LNG01_0026_D01.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
THY01_0098_B01.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
SKNB1_0047_C02.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
TCH01_0095_A11.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
SKNB1_0006_C01.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
SKNB1_0038_G11.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
AMP01_0003_C06.b : GCTAGAAAAAGAAACTTCCCAGAAAAAA*CTCCACTGATGTATGAATGGGTACCA*GAAA
TES01_0016_H06.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
SKNB1_0032_G06.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
LNG01_0080_C10.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
TES01_0032_H05.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
TES01_0064_D09.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
SKNB1_0086_D01.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
LNG01_0014_A08.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
TES01_0111_C01.b : GCTAGAGAAAGAGACTTCACAGATAAAA*CTCCACTGATGTATGAATGG*TACCTAGAAT
THY01_0114_B04.b : aaaaagaaagtctgggaaaaaccgccgg
TES01_0087_E07.b : GCTAGNAAAAGAAACTTCACAGAAAAAAACTCCACTGATGTATGAATGG*TACCAAGAAT
TES01_0065_H06.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
SKNB1_0063_C07.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
LNG01_0019_C08.b : GCTAGAAAAAGAAACTTCACAGAAAAAA*CTCCACTGATGTATGAATGG*TACCAAGAAT
20060611C-000823 : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
---------+---------+---------+---------+---------+---------+ 754
TCH01_0009_G03.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
PBL01_0010_B05.b : ATTATGTGGGGGCTGCTCATGGCCTGCCAGGAATTT*TTACTACCTGAGGCAGCCCAGCC
PBL01_0054_E05.b : ATTATGTGGGGGCTGCTCATGGCCTGNCAGGAATTTATTACTACCTGATGCAGCCCAGCC
LNG01_0026_D01.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
THY01_0098_B01.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
SKNB1_0047_C02.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
TCH01_0095_A11.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
SKNB1_0006_C01.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
SKNB1_0038_G11.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
AMP01_0003_C06.b : ATTATGTGGGGGCTGCTCCTGGGCTGGCAGGAATTTATAAC*ACCTGAagccaccccacc
TES01_0016_H06.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
SKNB1_0032_G06.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
LNG01_0080_C10.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
TES01_0032_H05.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
TES01_0064_D09.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTAATACTACCTGATGCACCCCACCC
SKNB1_0086_D01.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
LNG01_0014_A08.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
TES01_0111_C01.b : ATTATGTGGGGGCTGCTCATGGGCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
THY01_0114_B04.b :
TES01_0087_E07.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAAGAATTTATTACTACCTGATGCAGCCCAGCC
TES01_0065_H06.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
SKNB1_0063_C07.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
LNG01_0019_C08.b : ATTATGTGGGGGCTGCTCATGGCCTGGCAGGAATTTATTACTACCTGATGCAGCCCAGCC
20060611C-000823 : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
---------+---------+---------+---------+---------+---------+ 813
TCH01_0009_G03.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
PBL01_0010_B05.b : T*CAAGTGAACCATG*CGAAGTTACAAAATTTGGTCCACCCTAGTGGAAATTATGTCTGC
PBL01_0054_E05.b : TTCAAATGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
LNG01_0026_D01.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
THY01_0098_B01.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
SKNB1_0047_C02.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
TCH01_0095_A11.b : TTNCAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
SKNB1_0006_C01.b : TTCCAGTGAGCCATG*CGAAATTACAGAGTTGGNTCAAGCCTAATGTAGATTATGTCTGC
SKNB1_0038_G11.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTNCAGCCTAGTGTAGATTATGTCTGC
AMP01_0003_C06.b : cttcagtgagccagccaagttaagagtttgttcgacctaaggaaaatatttctggccact
TES01_0016_H06.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
SKNB1_0032_G06.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
LNG01_0080_C10.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
TES01_0032_H05.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGAATATGTCTGC
TES01_0064_D09.b : T*CAAGTGAGCCCTG*CGAAGTTACCGATTTTGGTCAAGCCAAATGAAAATTATGTCTGC
SKNB1_0086_D01.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
LNG01_0014_A08.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
TES01_0111_C01.b : TTCAAGTGAGCCATGGCAAATTTACAGAGTTTGGTCAAGCCTATTGTAGATTATGTCTGC
THY01_0114_B04.b :
TES01_0087_E07.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCCAGGGTAGATTATGTCTGC
TES01_0065_H06.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
SKNB1_0063_C07.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
LNG01_0019_C08.b : TTCAAGTGAGCCATG*CGAAGTTACAGAGTTTGGTCAAGCCTAGTGTAGATTATGTCTGC
20060611C-000823 : CAGCTGAAATTCCCTTCAGGCAATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
---------+---------+---------+---------+---------+---------+ 872
TCH01_0009_G03.b : CAGCTGAAATTCCCTTCANNGCATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
PBL01_0010_B05.b : CAGCGAAAATTTCCTccggcaatacccctccttgtggggaacaactccaaatttccaatc
PBL01_0054_E05.b : CAGCTGAAATTTCCTTCANNGCA*TAC*CCCTCTTGTGTGGACGACACTCGAGATCTGCT
LNG01_0026_D01.b : CAGCTGAAATTCCCTTCANGCAATTAC*CCCTCTTGTGTGGACGACACTCGAGATCTGCT
THY01_0098_B01.b : CAGCTGAAATTCCCTTCAGGCAATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
SKNB1_0047_C02.b : CAGCTGAAATTCCCTTCAGGCAATTACCCCTCCTTGTGTGGACGACACTCGAGATCTGCT
TCH01_0095_A11.b : CAGCTGAAATTCCCTTCANNGCATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
SKNB1_0006_C01.b : CAGCTGAAATTCCCCTCAGGCAATTACCCTCCCTTGTGTGGACGACACTCGAGATCTGCT
SKNB1_0038_G11.b : CAGCTGAAATTTCCTTCANGCAATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
AMP01_0003_C06.b : aaattccctttagcaattacccctcctttgggagaaaacactcgaaatcttccaatacct
TES01_0016_H06.b : CAGCTGAAATTCCCTTCAGGCAATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
SKNB1_0032_G06.b : CAGCTGAAATTCCCTTCAGGCAATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
LNG01_0080_C10.b : CAGCTGAAATTCCCTTCANNGCATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
TES01_0032_H05.b : CAGCTGAAATTCCCTTCAAGCAATTACCCCCCCTTGTGTGGACGACACTCAAGATCTGCT
TES01_0064_D09.b : CAGCTGAAATTCCCTTCA*GGCATTAA*CCTCCTTGgtggaacaaaatcaagaatggcta
SKNB1_0086_D01.b : CAGCTGAAATTCCCTTCAGGCAATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
LNG01_0014_A08.b : CAGCTGAAATTCCCTTCAGGCAATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
TES01_0111_C01.b : CAGCTGAATTTCCCTGCA*GCATTTAC*CCTCTTTGTGTGGACGAACCTCCAAATTGGCT
THY01_0114_B04.b :
TES01_0087_E07.b : CCACTGAAATTCCCCTCAGGGCATTAC*CCTCCTTGTGGGGAAGACACTCGAGATCTGGC
TES01_0065_H06.b : CAGCTGAAATTCCCTTCAGGCAATTACCCCTCCTTGTGTGGACGACACTCGAGATCTGCT
SKNB1_0063_C07.b : CAGCTGAAATTCCCTTCANGGCATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
LNG01_0019_C08.b : CAGCTGAAATTCCCTTCAGGCAATTAC*CCTCCTTGTGTGGACGACACTCGAGATCTGCT
20060611C-000823 : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGTAATCTACATGCTCATTCAGGCCTATAAG
---------+---------+---------+---------+---------+---------+ 930
TCH01_0009_G03.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGTAATCTACATGCTCATTCAAGCCTATAAG
PBL01_0010_B05.b : ctttggtgcccggttcccctggggaaactaaagccctttcaggccaaaagggggttcaaa
PBL01_0054_E05.b : AGTCCAT*TGGTGTCACGG*TCCCC*TGGGGT*ATCTACATGCTCATTCGGCCCTATA*G
LNG01_0026_D01.b : AGTCCAT*TGGTGCCACCGTTCCCC*TGGGGTAATCTACATGCTCATTCAGGCCTATAAG
THY01_0098_B01.b : AGTCCAT*TGGTGCCACGGTTCCCC*GGGGGTAATCCACATGCTCATTCAGGCCTATAAG
SKNB1_0047_C02.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGTAATCTACATGCTCATTCAGGCCTATNAG
TCH01_0095_A11.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGGTATCTACATGCTCATTCAGGCCTATAAG
SKNB1_0006_C01.b : AGTTCAT*TGGTGCCACGGGTCCCCTGGGGGTAATCTACATGCTCATTTCAGCCTATAAG
SKNB1_0038_G11.b : AGTCCAT*TGGTGGCACGGGTTCCCCTGGGGTAATCTACATGCTCATTCANGCCTAATAG
AMP01_0003_C06.b : tgatgatcccggtcccctcggggaaatttaatgctcattcgagccaataaggtttcataa
TES01_0016_H06.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGTAATCTACATGCTCATTCAGGCCTATAAG
SKNB1_0032_G06.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGGTATCTACATGCTCATTCAGGCCTATNAN
LNG01_0080_C10.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGT*ATCTACATGCTCATTCAGGCCTATAAG
TES01_0032_H05.b : AGTCCAT*TGGTGCCACGGTTCCCCCTGGGGTAATCTACATGCTCctttcagcctataaa
TES01_0064_D09.b : ttccatggggccagggtcccctggggtaaccaattgcccatcaggcctaaaggggttcaa
SKNB1_0086_D01.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGTAATCTACATGCTCATTCA*GCCTATNAG
LNG01_0014_A08.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGGTATCTACATGCTCATTCAGGCCTATAAG
TES01_0111_C01.b : AGTCCCA*TGGGGCCCCGGTTCCC**TGGGGTAATCTAaagccccattcaggcttaaagg
THY01_0114_B04.b :
TES01_0087_E07.b : AATCCCTTTGGTGCCCCGGTTCCCCCTGGGGTAACCTACtggctctttccagcctaaaag
TES01_0065_H06.b : AGTCCAT*TGTTGCCACGGTTCCCC*CGGGGGAATCTACCTGCTCATTCAGGCCTATAAG
SKNB1_0063_C07.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGGTATCTACATGCTCATTCAGGCCTATNAG
LNG01_0019_C08.b : AGTCCAT*TGGTGCCACGGTTCCCC*TGGGGTAATCTACATGCTCATTCAGGCCTATAAG
20060611C-000823 : G*TGTTCAGAGAAGAA*CGGTATCTCAATGATGCCTACCAGTGTGCCGATGTGATCTGGA
---------+---------+---------+---------+---------+---------+ 988
TCH01_0009_G03.b : G*TGTTCAGAGAAGAAACGGTATCTC*ATGATGCCTACCAGTGTGCCGATGTGATCTGGA
PBL01_0010_B05.b : aaaaagggattccatggagcctaccccggggcccattgattcggaataacggtttccaaa
PBL01_0054_E05.b : G*TG*TCAGAGA*GAAAC*GTATCTC*ATGATGCCTAC*AGTGTGCCGAT*TGATCTGGA
LNG01_0026_D01.b : GGTGTCCAGAGAAGAA*CGGTATCTCAATGATGCCctaccgttgtgcccatgttatcctg
THY01_0098_B01.b : G*TGTTCAGAAAA*AAACGGGATCTCAATGATGCCTACCAGTGTGCCGATGTGATTTGGA
SKNB1_0047_C02.b : G*TGTTCAGAGAAGAACGGGTATCTC*ATGATGCCTACCAGTGTGCCGATGTGATCTGGA
TCH01_0095_A11.b : G*TGTTCAGAAGAGAACGGGTATCTC*ATGATGCCTACCANTGTGCCNATGTGATCTGGA
SKNB1_0006_C01.b : GGGGTTCAAAAAAGAA*CGGGATCTCAATGATGCCTAaccatgggcccaatgtgatctgg
SKNB1_0038_G11.b : G*TGTTCAGAGAA*AAACGGTATCTCATTGATGCCTACCANTGTGCCGATGTGATCTGGA
AMP01_0003_C06.b : aaaaacggtttctctaatagtccccccacttgtccaaattactttgaatttcagtctctt
TES01_0016_H06.b : G*TGTTCAGAGAAGAA*CGGTATCTCAATGATGCCTACCAGTGTGCCGATGTGATCTGGA
SKNB1_0032_G06.b : G*TGTTCAGAAGAAGAANCGTATCTNCATGATGCCTACCANTGTGCCGATGTGATTCTGA
LNG01_0080_C10.b : G*TG*TCAGAGAAGAA*CGGTATCCTCATGATGCCTACCAGTGTGCCCATGTGATCTGGA
TES01_0032_H05.b : gggtttgaaaaaaaacgtttttccatgaatgcctaccatgtgcccaatgtgatctgggaa
TES01_0064_D09.b : aaaaaacgggttctcatgatgctaccatgggcaattgatcggaaatacgggtgctgaaaa
SKNB1_0086_D01.b : G*TGTTCAGAGAAAGACGGGTATCTC*ATGATGCCCAC*AGTGTGCCGATGGGATCTGAA
LNG01_0014_A08.b : G*TGTTCAGAGAAGAA*CGGTATCTCAATGATGCCTACCAGTGTGCCGATGTGATCTGGA
TES01_0111_C01.b : gggttcaaaaaaaccgggttcccttgatgcccacccatgggccaatgtaattggaaatac
THY01_0114_B04.b :
TES01_0087_E07.b : gggtgtcaaaaaaaaacgggaatcccatggatgccctcccctggggcccaatggattctg
TES01_0065_H06.b : G*TGTTCAGAGAA*AAACGGTATCTCATTGATGCCTACCA*TGTGCCGATGGGATTTGGA
SKNB1_0063_C07.b : G*TGGTCAGAGAAGAA*CGGTATCTNCATGATGCCTACCANTGTGCCGATGTGATCTGGA
LNG01_0019_C08.b : G*TGTTCAGAGAAGAA*CGGTATCTCAATGATGCCTACCAGTGTGCCGATGTGATCTGGA
20060611C-000823 : AGT*ACGGGTTGCTGAAG*AAGGGGTACGGG*CTGTGCCAC*GGCACTGCGGGGA*ACGC
---------+---------+---------+---------+---------+---------+ 1043
TCH01_0009_G03.b : AGT*ACGGGTTGCtgaanaaggggtacggnctgtgccacggcactgtcgggaacgctatg
PBL01_0010_B05.b : aaagggtaagggcgtgcccccgccttcgggaaaacctttcctccctgaccgtgttccccc
PBL01_0054_E05.b : gtacggttgctgaaaagggtacggctgtgcaccgcatgcgggaacgctatgcctctgacc
LNG01_0026_D01.b : gaaagtacgggtttgctgaaaaaagggggtacgggcctggggcccacggccacttgcggg
THY01_0098_B01.b : AGTAACGGGTTGCttaaaaaagggggtacgggctgggcccccgcccttgccgggggaaac
SKNB1_0047_C02.b : AGT*ACGGGTTGCtgaaaaangggtacgggctgtgccacggcactgccgggaacgcctaa
TCH01_0095_A11.b : AAT*ACGGGTTGCtgaanaaaggggtacgggctgtgccacgncactgcgggggacgccca
SKNB1_0006_C01.b : aaataccgggttcttaaaaaaagggtaagggcttggcccccggccctgcggggaacgcct
SKNB1_0038_G11.b : AGT*ACCGGTTGCtgaaaaaggggttacggctgtgccacggcactggcgggaagcctatg
AMP01_0003_C06.b : ataataagggcaagacaaggtcacagtaatgttgagtaaaccaagtctcccatatcctgt
TES01_0016_H06.b : AGT*ACGGGTTGCtgaanaaagggtacgggctgtgcacggcactgcggggaacgctatgc
SKNB1_0032_G06.b : AAT*ACGGGTTGCtgaaaaaagnatacgggctgtgccacggcactgcggggaacgcctat
LNG01_0080_C10.b : AGT*ACGGGTTGCtgaaaanggggtacgggctgtgccacgcactgcggggacccctatgc
TES01_0032_H05.b : tacgggttggttaaaaaaggggtaacgggtgtggcaccggaatgccggggaacccctaag
TES01_0064_D09.b : aggtacggctgtccaggcctgcgggaaccccagcctccgaacttgtcacctccccggaat
SKNB1_0086_D01.b : AGT*ACNGGTggctgaanaaaggggtacgggctgtgcacggcactgcggggaacgcctat
LNG01_0014_A08.b : AGT*ACGGGTTGCTGAAGAAAGGGGTACGGGGCTGTGGCACCGGCACTGCGGGGAAACGC
TES01_0111_C01.b : cggttgcctaaaaagggtccggtttgggcccggaccttgggaaaacccatgcctttccga
THY01_0114_B04.b :
TES01_0087_E07.b : gaaataacggggtggctgaaaaaaggggttacggcttgtgccccggcattgcggggaaaa
TES01_0065_H06.b : AGT*ACGGGTTGCtgaaaaagggtaccggctgtgccccgcccttccgggaaagcccagcc
SKNB1_0063_C07.b : AGT*ACGGGTTGCtgaanaaggggtacgggctgtgccacgcactgcgggggacgcctatg
LNG01_0019_C08.b : AGT*ACGGGTTGCTGAAG*AAGGGGTACGGG*CTGTGCCAC*GGCACTGCGGGGA*ACGC
20060611C-000823 : CTATGCCTTCCTGACCCTGTTCAACCTCACGCAGGACATGAAGTACCTATATAGGGCTTG
---------+---------+---------+---------+---------+---------+ 1103
TCH01_0009_G03.b : ccttcctgacntggtcaactcacgccaggaatgaagtaccattttagggctgtaattttg
PBL01_0010_B05.b : cccggggaatgaggaccttttaaggctggtaattttcgaaagggtccaaaatagggaaac
PBL01_0054_E05.b : ctgtcactcagcagactgagtactaataggctgtagttgctgatgtgtcaatatgagact
LNG01_0026_D01.b : gggaaacccccatatggcctttccccggacccctggtttccacccccctcccccccaggg
THY01_0098_B01.b : ccctagcccttccctgaccctgtttccaccccccccccaggaaatgaaaataacttattt
SKNB1_0047_C02.b : tgcttcctgaccctgttcaactcangcaggaaatggagtacttatataggggcttgaaat
TCH01_0095_A11.b : tgccctcctgaacttggtcacctccgccaggaatggagtacctaaaaggggcttgtaatt
SKNB1_0006_C01.b : atagccttcctgaccctggtcaaccccccgccgggaaatgaaagaacttatttggggctt
SKNB1_0038_G11.b : ccttctgaccctgttcaactcacgcagacatgagtacctattagggctggaattttgctg
AMP01_0003_C06.b : tttatctatcacctgagatttatttattatattttg
TES01_0016_H06.b : cttctgaccctggtcacctcccgcaagacatgaagtacccattagggctgtaatttgctg
SKNB1_0032_G06.b : gccttcctgaacctgctcaacctacgcaggaaatgagtacttattaggggcttgaaattt
LNG01_0080_C10.b : cttcctgaccctgtccactcccccaggaatgaagtacctattagggctggaatttgctga
TES01_0032_H05.b : cccttccgaacctgtttaactctcccgcggaaatgaaaaaccctttatagggcttggaaa
TES01_0064_D09.b : gagaccctttaggctggaatttgcgaggggcccatttggaaaaggtgggaaaccggaccc
SKNB1_0086_D01.b : gcccttctgacccctgtcanctccgcangaaatgagtactaattaggggctgggagattt
LNG01_0014_A08.b : CTATGCCcttccctgacccctgttccaacccttcacccaaggaaaattgaagttacctta
TES01_0111_C01.b : ccgtgttaaccccccccgggaaagaaaaacctttttggggttgaaaattcccaaaggggg
THY01_0114_B04.b :
TES01_0087_E07.b : ccctatgcccttcctaaaccgggtttaaccccccccgggaaatgaaggaccccttttagg
TES01_0065_H06.b : tttccggacctgttctacctcccccgggacagaagtacctttttggggttgtaatttgcc
SKNB1_0063_C07.b : cctccntgaccntgttnacctccagcaggaatgaatacccattaagggctggaaatttgc
LNG01_0019_C08.b : CTATGCCTTCCTGACCCTGTTCAACCTCACGCAGGACATGAAGTACCTATATAGGGCTTG
20060611C-000823 : TAAGTTTGCTGAGTGGTGTCTAGATTATGGAGAACATGGATGCAGAACACCGGACACTCC
---------+---------+---------+---------+---------+---------+ 1163
TCH01_0009_G03.b : ctgatggggtccaaatttggaaacatgaatccaaaacccgaaactcctttccccccttga
PBL01_0010_B05.b : aggtgtaaaaaccgaacccttttccccttttaaggggggggaaaaaaaattctggggaac
PBL01_0054_E05.b : gagcaaaacggaccctttccctctgaggtgcggaaataattctgctacgcaagcccaaaa
LNG01_0026_D01.b : aaaaattgaaaaatttaccccaataatatatgggggggcttttggttaaaaagttttttt
THY01_0098_B01.b : taggggggctttgtaaatttttgg
SKNB1_0047_C02.b : tttgctgagtgggggctaaattaggagaaacttgatccaaaaaccgggacctccttttcc
TCH01_0095_A11.b : tgcggaagggggcccaattttggaaaactggtggcaaaacccggaaccccctttcccccc
SKNB1_0006_C01.b : gaaaatttgcctaaaggggggcca
SKNB1_0038_G11.b : aaggggttcaaatagggaaaactggatcgaaaaccggaactccttctcctccttaaagaa
AMP01_0003_C06.b :
TES01_0016_H06.b : agggggtctaattatgggaaaatggatgcaaaaaccgaaactccttcttcccctttagga
SKNB1_0032_G06.b : ttccgaatggggcccaaattatggaaaacattgatgcaaaaacccgaaactcctttcccc
LNG01_0080_C10.b : gtgtgtctaaataggaaaaatggatcaaacccggaactctttccctcttgaaggatggtg
TES01_0032_H05.b : ttttccgaatgggggtcctaaatttgggaaaaatgggttgtaaaaaccgggaactccttt
TES01_0064_D09.b : ctttccccttgagaaaggggaaacaatttccggggaaggtaggcccaaaacattcccgtt
SKNB1_0086_D01.b : gcgaagggggcccaaataagggaaaaatggggggggaaaacgggaaaccctttttcctct
LNG01_0014_A08.b : tttttaggggcttggtaaagttttttgccttgtaaagtgggggggttctttaaaatttaa
TES01_0111_C01.b : cccaaaatgggaaaaaatgggtgcaaaacccggaaccccttttcccctcttgaagaaagg
THY01_0114_B04.b :
TES01_0087_E07.b : gcctgttaaatttctcgaaggggggtccaaatttagggaaaacggggtggccaaaaaccg
TES01_0065_H06.b : aaaggcgttctaatttgggaaaactggaggcaaaacccggaaaccctttttcccctttta
SKNB1_0063_C07.b : gaaagggggccaattatgggaacatggaggcaaaaccggaacctcctttccccctttgag
LNG01_0019_C08.b : TAAGTTTGCTGAGTGGTGTCTAGATTATGGAGAACATGGATGCAGAACACCGGACACTCC
20060611C-000823 : TTTCTCCCTCTTTGAAAGGAATGGCTGGAACAATATATTTCCTGGCTGACCTGCTAATGC
---------+---------+---------+---------+---------+---------+ 1223
TCH01_0009_G03.b : aggatggctggaaaaatatttccgggtgaccggattggcccaaaaccatttcctgctttt
PBL01_0010_B05.b : cgcaggcccacaaaccatatccgtttttaattaaaaaaaagccccgcccccccgcgaatt
PBL01_0054_E05.b : cattctgcttaataaggaatcgcccgacccgcgggttttttaccgttacccggaacaaaa
LNG01_0026_D01.b : ttgctctttggaaaaaggggggtggggggg
THY01_0098_B01.b :
SKNB1_0047_C02.b : ctctttaaagaagggcggaacaaatatttcctc
TCH01_0095_A11.b : ttttaggaagggcggaaaaaaatttttggggggaaacgctgtggccccaaaaccc
SKNB1_0006_C01.b :
SKNB1_0038_G11.b : tggggggacaaaatttccggctggctgctag
AMP01_0003_C06.b :
TES01_0016_H06.b : aggcgggaacaaaattccggcgaactgctatggcccaaaacaatttctccttgaataaaa
SKNB1_0032_G06.b : ctctttaaagaaggctggaaaataaaattcctggctgaactgctatgcccaaaaaccaat
LNG01_0080_C10.b : gacaatattccgggtgactgctatgccccaaaccaatccctgcttaattaaaggaagttg
TES01_0032_H05.b : tttcccttctttaaggaagggggggaaaatatatttcctggaggaaacgctatggtgcca
TES01_0064_D09.b : taaaaaaaagaaggcccccccccccgggtttttttccccgtttgccncngtcaaaaaaaa
SKNB1_0086_D01.b : tttaaggaaagggggaacaaaaaatttcggggggacggcgtaggccccaaaacaatttcc
LNG01_0014_A08.b : accgggagaaaaaaacaatttgggggaaattggccacaaaaaaaaaacccccac
TES01_0111_C01.b : cggggaaaaaattttcgggagaaattttaagcccaaaaaaaaagttcccttttttaataa
THY01_0114_B04.b :
TES01_0087_E07.b : ggaacccccctttctcccccttttagaagagaagggggggaaacaaattttttccgggct
TES01_0065_H06.b : aagaaggggggaaaaataattttcgggggaccggtatggcccaaaagacaagttcccgca
SKNB1_0063_C07.b : gaagggggaaaaaaaattctgggggaccggagggccccaaaaaaattcctggtttaaata
LNG01_0019_C08.b : TTTCTCCCTCTTTGAAAGGAATGGCTGGAACAATATATTTCCTGGCTGACCTGCTAATGC
20060611C-000823 : CCACAAAA....................................................
---------+---------+---------+---------+---------+---------+ 1231
TCH01_0009_G03.b : aactaaaaggaatt
PBL01_0010_B05.b : tttttttnacgtttaagcccgaaaaaaaaaaaaaagactcttctgcgggc
PBL01_0054_E05.b : aaaagcctgtcctgggggccctaaccgggccctccccttttaggccgggttagccgcctt
LNG01_0026_D01.b :
THY01_0098_B01.b :
SKNB1_0047_C02.b :
TCH01_0095_A11.b :
SKNB1_0006_C01.b :
SKNB1_0038_G11.b :
AMP01_0003_C06.b :
TES01_0016_H06.b : aagaagtgcccccccccatgcggggcttttttttacctggtagcccgtaacaaaaaaaaa
SKNB1_0032_G06.b : tccctgatttaacttaaaagaaaactacccccgcctccccccta
LNG01_0080_C10.b : ccccgaaacctggtgaattttcgttttaacctgttaacaccgtaacaaaaaaaaaaaagg
TES01_0032_H05.b : acaaaaccaagttctccggctttataataataaaagagagatatgcgccccgtaacctct
TES01_0064_D09.b : aggctttccccgggcggcaatataaaaaccccccccacaaaaaaaggtgttgtgtttgtg
SKNB1_0086_D01.b : tggtttttattaaaaaaggaaaaggcccccggccccctcccggaattttttatataaa
LNG01_0014_A08.b :
TES01_0111_C01.b : aagagagaaattccccccacacataa
THY01_0114_B04.b :
TES01_0087_E07.b : acacctcctttgcccccacaaaaaccaaattcccccggatttacacataaaagggaaaac
TES01_0065_H06.b : ttataaaaaaagggaattgccccccgaaaccctgggtggaatttgtgtttacaccggtta
SKNB1_0063_C07.b : aaaaaggaa
LNG01_0019_C08.b : CCACAAAAagccaagttccctgcatttgaactataaaaaggaaagtctgcccccctgcaa
20060611C-000823 : ............................................................
---------+---------+---------+---------+---------+---------+ 1231
TCH01_0009_G03.b :
PBL01_0010_B05.b :
PBL01_0054_E05.b : ccgggaaggtttgactgggagaccaaaaaattaaccgcgtttaaagttttccctactatt
LNG01_0026_D01.b :
THY01_0098_B01.b :
SKNB1_0047_C02.b :
TCH01_0095_A11.b :
SKNB1_0006_C01.b :
SKNB1_0038_G11.b :
AMP01_0003_C06.b :
TES01_0016_H06.b : ggcctgtgccccctgtcggccccacctaaaaaaccccccccacaacaaagaatttatttt
SKNB1_0032_G06.b :
LNG01_0080_C10.b : cctggtcccatcggtccgccccttatttcccggccaccctccccctttttaaagcctttg
TES01_0032_H05.b : atggtagaaatttttgttatctaaaccgtttaataacccccgtgaaaatacaaaaataaa
TES01_0064_D09.b : aaaaaaccaaccttctt
SKNB1_0086_D01.b :
LNG01_0014_A08.b :
TES01_0111_C01.b :
THY01_0114_B04.b :
TES01_0087_E07.b : tcctcccccc
TES01_0065_H06.b : agccccgtaaaacaaaaaaaaaaaaggccctgtttttcattagggcgggcctctataaat
SKNB1_0063_C07.b :
LNG01_0019_C08.b : ctcactggctgaaccattttctgtattatcaaatcattgaataaaagcaaacaattaaaa
20060611C-000823 : ............................................................
---------+---------+---------+---------+---------+---------+ 1231
TCH01_0009_G03.b :
PBL01_0010_B05.b :
PBL01_0054_E05.b : tnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0026_D01.b :
THY01_0098_B01.b :
SKNB1_0047_C02.b :
TCH01_0095_A11.b :
SKNB1_0006_C01.b :
SKNB1_0038_G11.b :
AMP01_0003_C06.b :
TES01_0016_H06.b : gctgttaaaaactcaattcttgtttgttct
SKNB1_0032_G06.b :
LNG01_0080_C10.b : tgttaaaacacggccttttccgggggaaacctggtt
TES01_0032_H05.b : agagggcgcc
TES01_0064_D09.b :
SKNB1_0086_D01.b :
LNG01_0014_A08.b :
TES01_0111_C01.b :
THY01_0114_B04.b :
TES01_0087_E07.b :
TES01_0065_H06.b : taaaaaaccccccctccccgagtacaataaagaacagtgggttactctttatgccttaga
SKNB1_0063_C07.b :
LNG01_0019_C08.b : atcaaaacttaaaaaaaaaaaaaaaaaaaaaaaaaagggcccccattggtggccttcaaa
20060611C-000823 : ............................................................
---------+---------+---------+---------+---------+---------+ 1231
TCH01_0009_G03.b :
PBL01_0010_B05.b :
PBL01_0054_E05.b : nnnnnnnnnnnnnnnnnnnnn
LNG01_0026_D01.b :
THY01_0098_B01.b :
SKNB1_0047_C02.b :
TCH01_0095_A11.b :
SKNB1_0006_C01.b :
SKNB1_0038_G11.b :
AMP01_0003_C06.b :
TES01_0016_H06.b :
SKNB1_0032_G06.b :
LNG01_0080_C10.b :
TES01_0032_H05.b :
TES01_0064_D09.b :
SKNB1_0086_D01.b :
LNG01_0014_A08.b :
TES01_0111_C01.b :
THY01_0114_B04.b :
TES01_0087_E07.b :
TES01_0065_H06.b : gaaa
SKNB1_0063_C07.b :
LNG01_0019_C08.b : gcctttccggggttcccccggggcccccccccctcttttaaaaaataatatattcccccc