[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-000853

Length: 995

Sequence [FASTA format sequence]
TAGGTGTGGC CCACTGACGA TCGGTGGGAG TCGTGCGTGG GGTTGGGAGT TGACTCCGGG
TGTACTTCTG TGTTTCTGCT CATCCTTTCC GTAGATGTCT CATATGGAGC TGGGGTTGGA
CTCGGGTGAC GATGACTTGC TGGGCTTCCT GTTAGAGGAA AGCGGAGGTC TGGGGGCGGC
GCCGGACGAA GCCTTGGAGG CGCCCCTGGA TTGGGAGCTA CCACTTTCCG AGGCATTGAG
CGATTGGGAC GTAGAGGATT TCCTGAGCTG CCTGTCGAGT CCCCCAGCAT CGTTGACCGA
TTTTAGCCAC TCTGACCCCT ATCTTGTCCA CCATGATCAC ACCTATTCCC TGTCACAGGA
GTATGTCTCC ATAGATCTAG ATAATGAGGA TTATGAGAAG GAAGGGGCCC AAATGACTTC
CCTGCGTGTG GAGGCGCCCG CAGAGCAGGA GATTGGTGAG CTGATACTGA CGGAGGAGGA
GAAGAGGCTT TTGGAGAAGG AGGGGCTTAC TCTGCCCGGG ACACTTCCTC TCACTAAGAT
GGAGGAACAA GTTCTGAGAC GAGTGCGAAG GAAGATTCGA AACAAAAAGT CTGCTCAAGA
GAGCCGCAGG AAGAAGAAGG TGTATGTGGG GAGTTTAGAG AGCAGGGTCC TGAAATACTC
GGCCCAGAAT CTGGAGCTAC AGAACAAAGT ACAGCTCCTG GAGGAGCAGA ATCTGTCCCT
TTTGGATCAG TTGAGGAGGC TGCAGTCCAT GGTGATTCAG ACGGCAAACA AAGCCAGCAG
CAGCAGCACC TGCATCTTGG TCCTGCTCTT CTCCTTCTGT CTCCTCTTCG TACCTGCCAT
GTACTCCTCG GACACAAGGG GGAGCCCGCC AGCCGAGCAT GGAGTGTTGT CCCGCCAGCT
TCGTGCCCTC CCCAGCGAGG ACGTTCCCCA GCGGGACCTG CCTGCACTGC AGTCAGAGGT
ACCACAGGGA AGCTCAACCC ACGAGCTCCA GGCTC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCREB3cAMP responsive element binding protein 33001e-81O
Contig/Assembly ProteinCREB3L4cAMP responsive element binding protein 3-like 41002e-21
Contig/Assembly ProteinCREB3L3cAMP responsive element binding protein 3-like 385.95e-17
Contig/Assembly ProteinCREB3L2cAMP responsive element binding protein 3-like 271.21e-12
Contig/Assembly ProteinCREB3L1cAMP responsive element binding protein 3-like 168.68e-12


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 4      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ITT010055E01ITT01_0055_E01.bBW980891 
ITT010055F01ITT01_0055_F01.bBW980902 
OVRM10110G06OVRM1_0110_G06.bBP152968 AK235744
UTR010016G11UTR01_0016_G11.bBP173018 

  

Alignment:      TOP

20060611C-000853 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
UTR01_0016_G11.b : ggggggccctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_G06.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0055_E01.b :
ITT01_0055_F01.b :
20060611C-000853 : ......................TAGGTGTGGCCCACTGACGATCGGTGGGAGTCGTGCGT
---------+---------+---------+---------+---------+---------+ 38
UTR01_0016_G11.b : xxxxxxxxxxxxxxxxxxxxxxTAGGTGTGGCCCACTGACGATCGGTGGGAGTCGTGCGT
OVRM1_0110_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxGGTGTGGCCCACTGACGATCGGTGGGAGTCGTGCGT
ITT01_0055_E01.b : nttgatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0055_F01.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
20060611C-000853 : GGGGTTGGGAGTTGACTCCGGGTGTACTTCTGTGTTTCTGCTCATCCTTTCCGTAGATGT
---------+---------+---------+---------+---------+---------+ 98
UTR01_0016_G11.b : GGGGTTGGGAGTTGACTCCGGGTGTACTTCTGTGTTTCTGCTCATCCTTTCCGTAGATGT
OVRM1_0110_G06.b : GGGGTTGGGAGTTGACTCCGGGTGTACTTCTGTGTTTCTGCTCATCCTTTCCGTAGATGT
ITT01_0055_E01.b : xxxxxxxxxxxxxGACTCCGGGTGTACTTCTGTGTTTCTGCTCATCCTTTCCGTAGATGT
ITT01_0055_F01.b : xxxxxxxxxxxxxGACTCCGGGTGTACTTCTGTGTTTCTGCTCATCCTTTCCGTAGATGT
20060611C-000853 : CTCATATGGAGCTGGGGTTGGACTCGGGTGACGATGACTTGCTGGGCTTCCTGTTAGAGG
---------+---------+---------+---------+---------+---------+ 158
UTR01_0016_G11.b : CTCATATGGAGCTGGGGTTGGACTCGGGTGACGATGACTTGCTGGGCTTCCTGTTAGAGG
OVRM1_0110_G06.b : CTCATATGGAGCTGGGGTTGGACTCGGGTGACGATGACTTGCTGGGCTTCCTGTTAGAGG
ITT01_0055_E01.b : CTCATATGGAGCTGGGGTTGGACTCGGGTGACGATGACTTGCTGGGCTTCCTGTTAGAGG
ITT01_0055_F01.b : CTCATATGGAGCTGGGGTTGGACTCGGGTGACGATGACTTGCTGGGCTTCCTGTTAGAGG
20060611C-000853 : AAAGCGGAGGTCTGGGGGCGGCGCCGGACGAAGCCTTGGAGGCGCCCCTGGATTGGGAGC
---------+---------+---------+---------+---------+---------+ 218
UTR01_0016_G11.b : AAAGCGGAGGTCTGGGGGCGGCGCCGGACGAAGCCTTGGAGGCGCCCCTGGATTGGGAGC
OVRM1_0110_G06.b : AAAGCGGAGGTCTGGGGGCGGCGCCGGACGAAGCCTTGGAGGCGCCCCTGGATTGGGAGC
ITT01_0055_E01.b : AAAGCGGAGGTCTGGGGGCGGCGCGGGACGAAGCCTTGGAGGCGCCCCTGGATTGGGAGC
ITT01_0055_F01.b : AAAGCGGAGGTCTGGGGGCGGCGCGGGACGAAGCCTTGGAGGCGCCCCTGGATTGGGAGC
20060611C-000853 : TACCACTTTCCGAGGCATTGAGCGATTGGGACGTAGAGGATTTCCTGAGCTGCCTGTCGA
---------+---------+---------+---------+---------+---------+ 278
UTR01_0016_G11.b : TACCACTTTCCGAGGCATTGAGCGATTGGGACGTAGAGGATTTCCTGAGCTGCCTGTCGA
OVRM1_0110_G06.b : TACCACTTTCCGAGGCATTGAGCGATTGGGACGTAGAGGATTTCCTGAGCTGCCTGTCGA
ITT01_0055_E01.b : TACCACTTTCCGAGGCATTGAGCGATTGGGACGTAGAGGATTTCCTGAGCTGCCTGTCGA
ITT01_0055_F01.b : TACCACTTTCCGAGGCATTGAGCGATTGGGACGTAGAGGATTTCCTGAGCTGCCTGTCGA
20060611C-000853 : GTCCCCCAGCATCGTTGACCGATTTTAGCCACTCTGACCCCTATCTTGTCCACCATGATC
---------+---------+---------+---------+---------+---------+ 338
UTR01_0016_G11.b : GTCCCCCAGCATCGTTGACCGATTTTAGCCACTCTGACCCCTATCTTGTCCACCATGATC
OVRM1_0110_G06.b : GTCCCCCAGCATCGTTGACCGATTTTAGCCACTCTGACCCCTATCTTGTCCACCATGATC
ITT01_0055_E01.b : GTCCCCCAGCATCGTTGACCGATTTTAGCCACTCTGACCCCTATCTTGTCCACCATGATC
ITT01_0055_F01.b : GTCCCCCAGCATCGTTGACCGATTTTAGCCACTCTGACCCCTATCTTGTCCACCATGATC
20060611C-000853 : ACACCTATTCCCTGTCACAGGAGTATGTCTCCATAGATCTAGATAATGAGGATTATGAGA
---------+---------+---------+---------+---------+---------+ 398
UTR01_0016_G11.b : ACACCTATTCCCTGTCACAGGAGTATGTCTCCATAGATCTAGATAATGAGGATTATGAGA
OVRM1_0110_G06.b : ACACCTATTCCCTGTCACAGGAGTATGTCTCCATAGATCTAGATAATGAGGATTATGAGA
ITT01_0055_E01.b : ACACCTATTCCCTGTCACAGGAGTATGTCTCCATAGATCTAGATAATGAGGATTATGAGA
ITT01_0055_F01.b : ACACCTATTCCCTGTCACAGGAGTATGTCTCCATAGATCTAGATAATGAGGATTATGAGA
20060611C-000853 : AGGAAGGGGCCCAAATGACTTCCCTGCGTGTGGAGGCGCCCGCAGAGCAGGAGATTGGTG
---------+---------+---------+---------+---------+---------+ 458
UTR01_0016_G11.b : AGGAAGGGGCCCAAATGACTTCACTGCGTGTGGAGGCGCCCGCAGAGCAGGAGATTGGTG
OVRM1_0110_G06.b : AGGAAGGGGCCCAAATGACTTCACTGCGTGTGGAGGCGCCCGCAGAGCAGGAGATTGGTG
ITT01_0055_E01.b : AGGAAGGGGCCCAAATGACTTCCCTGCGTGTGGAGGCGCCCGCAGAGCAGGAGATTGGTG
ITT01_0055_F01.b : AGGAAGGGGCCCAAATGACTTCCCTGCGTGTGGAGGCGCCCGCAGAGCAGGAGATTGGTG
20060611C-000853 : AGCTGATACTGACGGAGGAGGAGAAGAGGCTTTTGGAGAAGGAGGGGCTTACTCTGCCCG
---------+---------+---------+---------+---------+---------+ 518
UTR01_0016_G11.b : AGCTGATACTGACGGAGGAGGAGAAGAGGCTTTTGGAGAAGGAGGGGCTTACTCTGCCCG
OVRM1_0110_G06.b : AGCTGATACTGACGGAGGAGGAGAAGAGGCTTTTGGAGAAGGAGGGGCTTACTCTGCCCG
ITT01_0055_E01.b : AGCTGATACTGACGGAGGAGGAGAAGAGGCTTTTGGAGAAGGAGGGGCTTACTCTGCCCG
ITT01_0055_F01.b : AGCTGATACTGACGGAGGAGGAGAAGAGGCTTTTGGAGAAGGAGGGGCTTACTCTGCCCG
20060611C-000853 : GGACACTTCCTCTCACTAAGATGGAGGAACAAGTTCTGAGACGAGTGCGAAGGAAGATTC
---------+---------+---------+---------+---------+---------+ 578
UTR01_0016_G11.b : GGACACTTCCTCTCACTAAGATGGAGGAACAAGTTCTGAGACGAGTGCGAAGGAAGATTC
OVRM1_0110_G06.b : GGACACTTCCTCTCACTAAGATGGAGGAACAAGTTCTGAGACGAGTGCGAAGGAAGATTC
ITT01_0055_E01.b : GGACACTTCCTCTCACTAAGATGGAGGAACAAGTTCTGAGACGAGTGCGAAGGAAGATTC
ITT01_0055_F01.b : GGACACTTCCTCTCACTAAGATGGAGGAACAAGTTCTGAGACGAGTGCGAAGGAAGATTC
20060611C-000853 : GAAACAAAAAGTCTGCTCAAGAGAGCCGCAGGAAGAAGAAGGTGTATGTGGGGAGTTTAG
---------+---------+---------+---------+---------+---------+ 638
UTR01_0016_G11.b : GAAACAAAAAGTCTGCTCAAGAGAGCCGCAGGAAGAAGAAGGTGTATGTGGGGAGTTTAG
OVRM1_0110_G06.b : GAAACATAAAGTCTGCTNCAGAGAGCCGCAGGAAGAAGAAGGTGTATGTGGGGAGTTTAG
ITT01_0055_E01.b : GAAACAAAAAGTCTGCTCAAGAGAGCCGCAGGAAGAAGAAGGTGTATGTGGGGAGTTTAG
ITT01_0055_F01.b : GAAACAAAAAGTCTGCTCAAGAGAGCCGCAGGAAGAAGAAGGTGTATGTGGGGAGTTTAG
20060611C-000853 : AGAGCAGGGTCCTGAAATACTCGGCCCAGAATCTGGAGCTACAGAACAAAGTACAGCTCC
---------+---------+---------+---------+---------+---------+ 698
UTR01_0016_G11.b : AGAGCAGGGTCCTGAAATACTCGGCCCAGAATCTGGAGCTACAGAACAAAGTACAGCTCC
OVRM1_0110_G06.b : AGAGCAGGTTCCTGAAATACTCGGCCCAGAATCTGGAGCTACAGAACAAAGTACAGCTCC
ITT01_0055_E01.b : AGAGCAGGGTCCTGAAATACTCGGCCCAGAATCTGGAGCTACAGAACAAAGTACAGCTCC
ITT01_0055_F01.b : AGAGCAGGGTCCTGAAATACTCGGCCCAGAATCTGGAGCTACAGAACAAAGTACAGCTCC
20060611C-000853 : TGGAGGAGCAGAATCTGTCCCTTTTGGATCAGTTGAGGAGGCTGCAGTCCATGGTGATTC
---------+---------+---------+---------+---------+---------+ 758
UTR01_0016_G11.b : TGGAGGAGCAGAATCTGTCCCTTTTGGATCAGTTGAGGAGGCTGCAGTCCATGGTGATTC
OVRM1_0110_G06.b : TGGAGGAGCAGAATCTGTCCCTTTTGGATCAGTTGAGGAAGCTGCAGTCCATGTTGATTC
ITT01_0055_E01.b : TGGAGGAGCAGAATCTGTCCCTTTTGGATCAGTTGAGGAGGCTGCAGTCCATGGTGATTC
ITT01_0055_F01.b : TGGAGGAGCAGAATCTGTCCCTTTTGGATCAGTTGAGGAGGCTGCAGTCCATGGTGATTC
20060611C-000853 : AGACGGCAAACAAAGCCAGCAGCAGCAGCACCTGCATCTTGGTCCTGCTCTTCTCCTTCT
---------+---------+---------+---------+---------+---------+ 818
UTR01_0016_G11.b : AGACGGCAAACAAAGCCAGCAGCAGCAGCACCTGCATCTTGGTCCTGCTCTTCTCCTTCT
OVRM1_0110_G06.b : AGACTGCAAATCAAGCCAGCAACAGCAGCccc
ITT01_0055_E01.b : AGACGGCAAACAAAGCCAGCAGCAGCAGCACCTGCATCTTGGTCCTGCTCTTCTCCTTCT
ITT01_0055_F01.b : AGACGGCAAACAAAGCCAGCAGCAGCAGCACCTGCATCTTGGTCCTGCTCTTCTCCTTCT
20060611C-000853 : GTCTCCTCTTCGTACCTGCCATGTACTCCTCGGACACAAGGGGGAGCCCGCCAGCCGAGC
---------+---------+---------+---------+---------+---------+ 878
UTR01_0016_G11.b : GTCTCCTCTTCGTACCTGCCATG
OVRM1_0110_G06.b :
ITT01_0055_E01.b : GTCTCCTCTTCGTACCTGCCATGTACTCCTCGGACACAAGGGGGAGCCCGCCAGCCGAGC
ITT01_0055_F01.b : GTCTCCTCTTCGTACCTGCCATGTACTCCTCGGACACAAGGGGGAGCCCGCCAGCCGAGC
20060611C-000853 : ATGGAGTGTTGTCCCGCCAGCTTCGTGCCCTCCCCAGCGAGGACGTTCCCCAGCGGGACC
---------+---------+---------+---------+---------+---------+ 938
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b : ATGGAGTGTTGTCCCGCCAGCTTCGTGCCCTCCCCAGCGAGGACGTTCCCCAGCGGGACC
ITT01_0055_F01.b : ATGGAGTGTTTGTCCGCCAGCTTCGTGCCCTCCCCAGCGAGGACGTTCCCCAGCGGNACC
20060611C-000853 : TGCCTGCACTGCAGTCAGAGGTACCACAGGGAAGCTCAACCCACGAGCTCCAGGCTC...
---------+---------+---------+---------+---------+---------+ 995
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b : TGCCTGCACTGCAGTCAGAGGTACCACAGGACAGCTCAACCCACGAGCTCCcagctcctg
ITT01_0055_F01.b : TGGCTGCACTGCAGTCAGAGGTACCACAGGGACACTCAACCCACGAGCCTCAGGCTCctg
20060611C-000853 : ............................................................
---------+---------+---------+---------+---------+---------+ 995
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b : gcaactcttgctgcctgttncaccacatggcttgggctcctggggcagaatcgcccatga
ITT01_0055_F01.b : gcaactcttgctgcctgttccaccacatggcttgggctcctgggggcaaatccgcccagg
20060611C-000853 : ............................................................
---------+---------+---------+---------+---------+---------+ 995
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b : agctgccactgcccgaccgcttctcaaggtctctagccaaggtccaatctccccctgctg
ITT01_0055_F01.b : aagcttgcactgcccgacggcttctcagggtcttctacccaggtcccatcttcccccggc
20060611C-000853 : ............................................................
---------+---------+---------+---------+---------+---------+ 995
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b : caatctcacagaagaggaagatgctccctacccccacccattttggttacttgcagggca
ITT01_0055_F01.b : atgcaaatctcacagaagaggaaggatgctcccttcccaagcccccaatctgtttacttg
20060611C-000853 : ............................................................
---------+---------+---------+---------+---------+---------+ 995
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b : agtacccggctaaattgagaaggcgggggcctcaccgaagctggtgccccattttggttc
ITT01_0055_F01.b : ccaggcagttctccgggttaaatttgaaatggcaggggcccccccaaaactggtgccccc
20060611C-000853 : ............................................................
---------+---------+---------+---------+---------+---------+ 995
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b : aaggaaaggaagggggaaggggagccctgctcctcccctgttggaacctgtgggccaaac
ITT01_0055_F01.b : atttggtttaaaggaaaggagtggaaaggtgacccttggcctgcccctgtggaaccctgg
20060611C-000853 : ............................................................
---------+---------+---------+---------+---------+---------+ 995
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b : ccccccttcggggttttggggttatttgtcccggttgtgtttttcctattgggcggga
ITT01_0055_F01.b : ggcaaaccccccccttgggtttctgggttttttgccccgttttcgttgttccttaggctg
20060611C-000853 : ............................................................
---------+---------+---------+---------+---------+---------+ 995
UTR01_0016_G11.b :
OVRM1_0110_G06.b :
ITT01_0055_E01.b :
ITT01_0055_F01.b : ggagacccgtactttagattt