[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-001157

Length: 1,470

Sequence [FASTA format sequence]
CTTTTTGCCC TAAACCGGGC TTTGGACTAC ATTTCCCAGA TGGCTTTGCT TCCCGGCCTG
TGCTACTTTA TCAGGGCGTG TCTTGGAAGA GAAGCCCAAT CCCCTAGCTA CGCTGGGACC
TCTCGCTGCG CTTCAGCAGC CGCAGCTGCC TCTAGGCAAG ATGATTGGGG TCCTGCTCCT
GCTCCTTCTT CTCCCTTTGC TCCTGTACAT CGCTGTACCC CAAATCAGGA AAATGCTGTC
CAGCGGGGTG TGTACATCAA CCGTCCAGCT TCCTGGGAAG GTCGCTGTGG TCACTGGAGC
CAACACAGGC ATTGGGAAGG AGACGGCCAA AGAGCTGGCT AAAAGAGGAG CCCGTGTATA
TTTAGCCTGC CGGGATGTGC AAAAGGGGGA ATCGGTGGCC AGAGAAATCC AGAACATGAC
AGGAAACCAA CAGGTATTGG TGCGGAAACT GGACCTGGCT GATACTAAAT CTATTCGAGC
TTTTGCTAAG GGCTTCTTAG CAGAAGAAAA GCATCTCCAC ATTTTGATCA ACAATGCAGG
AGTGATGATG TGTCCTTACT CCAAGACAGC AGACGGCTTT GAGACGCACA TGGGAGTCAA
CCACTTAGGT CACTTCCTCC TGACCCATCT GTTACTAGAG AAGCTGAAGG AATCAGCCCC
ATCAAGGGTA GTGAATGTGT CTTCCTTAGC ACATCACATG GGAAGGATCC ACTTCCATAA
CCTGCAGGGT GAGAAGTTCT ACCATGCGGG TCTGGCCTAC TGTAACAGCA AGTTAGCCAA
TGTTCTCTTC ACCCAGGAAC TGGCCCGGAG GCTAAAAGGC TCTGGCGTTA CAACATACTC
AGTACACCCT GGCACAGTTG ACTCTGAATT GGTTCGGCAC TCATCCCTCC TGAGATGGAT
TTGGTGGCTT TTCTCCTTCT TCATCAAGAC CCCTCAGCAG GGAGCCCAGA CCAGCCTGTA
CTGTGCCTTA ACAGAAGGTC TTGAGGTTCT AAGTGGAAAC CATTTCAGTG ACTGCCATGT
GGCATGGGTC TCTGCCCAGG CTCGTAACGA GACAGTAGCA AGGCGGCTAT GGGATGTCAG
CCGTGACCTG CTGGGCATCC CTATGGATTG ACGGGTGATG GCAGTTGGAC CAAGAGAAGC
CTGCAGCACA CTACTCAGTA CTCCCTGCCA AAATGATTCT CCTTCAGGAT GGCCAAAACC
TTGAGCACAA AGACTGCAAA CCTTCCATCC TTGCCTGCTT GATGTTGGAT AAAAGCCCAG
TGTACACTGC CAGACTCATC TAAACGCCTT GCATTTGTCT AGATGTATTT TGTTCCTATT
ACTGCCAGAG TTACCAGAGA TAATGTAGGA TAGGTGGACC CTCATATGCC TGCCACCATA
TGACCGCTTG TATTTTCCCT CTGAAACCTA CTACCTANGA GAGCCCTAGC TATGGCAGGG
TTGATTTACA GCACTTTAGA TTTGTTTCTG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH11retinol dehydrogenase 11 (all-trans/9-cis/11-cis)530e-150O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 (all-trans/9-cis/11-cis)415e-116O
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 (all-trans/9-cis/11-cis)2293e-60O
Contig/Assembly ProteinMGC23280hypothetical protein MGC232802025e-52O
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 (all-trans/9-cis)1881e-47O
Contig/Assembly ProteinWWOXWW domain containing oxidoreductase1797e-45
Contig/Assembly ProteinDHRSXdehydrogenase/reductase (SDR family) X-linked1681e-41O
Contig/Assembly ProteinLOC388963similar to short-chain dehydrogenase/reductase 191.32e-18
Contig/Assembly ProteinLOC388963similar to short-chain dehydrogenase/reductase 191.32e-18
Contig/Assembly ProteinFLJ13639hypothetical protein FLJ1363971.22e-12O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 14      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010013A01ADR01_0013_A01.bDB782640 
ADR010053F01ADR01_0053_F01.bDB786231 
AMP010069H02AMP01_0069_H02.bBW960049 
DCI010098H10DCI01_0098_H10.bDB798311 
LVR010012B01LVR01_0012_B01.bBP441867 
LVRM10070F12LVRM1_0070_F12.bBP452920 
LVRM10180D01LVRM1_0180_D01.bCJ005446 
OVRM10052H07OVRM1_0052_H07.bBP154358 
OVRM10053F06OVRM1_0053_F06.bBP151684 AK235148
OVRM10128G04OVRM1_0128_G04.bBP152767 
OVRM10135F04OVRM1_0135_F04.bBP151547 
OVRM10138C03OVRM1_0138_C03.bBP147684 
OVRM10187E05OVRM1_0187_E05.bBP458812 
OVRM10222B07OVRM1_0222_B07.bBP456134 

  

Alignment:      TOP

20060611C-001157 : ..........................................................CT
---------+---------+---------+---------+---------+---------+ 2
OVRM1_0053_F06.b : cgttgaccaaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
OVRM1_0052_H07.b : acgtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
ADR01_0013_A01.b :
OVRM1_0187_E05.b :
ADR01_0053_F01.b :
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b : gataatctatagggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b :
20060611C-001157 : TTTTGCCCTAAACCGGGCTTTGGACTACATTTCCCAGATGGCTTTGCTTCCCGGCCTGTG
---------+---------+---------+---------+---------+---------+ 62
OVRM1_0053_F06.b : TTTTGCCCTAAACCGGGCTTTGGACTACATTTCCCAGATGGCTTTGCTTCCCGGCCTGTG
OVRM1_0052_H07.b : TTTTGCCCTAAACCGGGCTTTGGACTACATTTCCCAGATGGCTTTGCTTCCCGGCCTGTG
ADR01_0013_A01.b : nnnaatgaacaxxxxxxxxxxxx
OVRM1_0187_E05.b : tagttgtcxxxxxxxxxxxxxxxxxx
ADR01_0053_F01.b : agggnnatgagtaacaxxxxxxxxx
LVRM1_0180_D01.b : tcxxxxxxxxxxx
OVRM1_0135_F04.b : tagttgtcxxxxxxxxxxxxxxxxx
OVRM1_0222_B07.b : ttgtcxxxxxxxxxxxxxxxxx
LVR01_0012_B01.b : gttttttttgatactgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_F12.b : nagttgtcxxxxxxxxx
AMP01_0069_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b :
20060611C-001157 : CTACTTTATCAGGGCGTGTCTTGGAAGAGAAGCCCAATCCCCTAGCTACGCTGGGACCTC
---------+---------+---------+---------+---------+---------+ 122
OVRM1_0053_F06.b : CTACTTTATCAGGGCGTGTCTTGGAAGAGAAGCCCAATCCCCTAGCTACGCTGGGACCTC
OVRM1_0052_H07.b : CTACTTTATCAGGGCGTGTCTTGGAAGAGAAGCCCAATCCCCTAGCTACGCTGGGACCTC
ADR01_0013_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcccaGTCCCCTAGCTACGCTGGGACCTC
OVRM1_0187_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCCCTAGCTACGCTGGGACCTC
ADR01_0053_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCCCCTAGCTACGCTGGGACCTC
LVRM1_0180_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaTCCCCTAGCTACGCTGGGACCTC
OVRM1_0135_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCCCTAGCTACGCTGGGACCTC
OVRM1_0222_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCCCTAGCTACGCTGGGACCTC
LVR01_0012_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTCCCCTAGCTACGCTGGGACCTC
LVRM1_0070_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTACGCTGGGACCTC
AMP01_0069_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTC
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b :
20060611C-001157 : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
---------+---------+---------+---------+---------+---------+ 182
OVRM1_0053_F06.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
OVRM1_0052_H07.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
ADR01_0013_A01.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
OVRM1_0187_E05.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
ADR01_0053_F01.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
LVRM1_0180_D01.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
OVRM1_0135_F04.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
OVRM1_0222_B07.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
LVR01_0012_B01.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
LVRM1_0070_F12.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
AMP01_0069_H02.b : TCGCTGCGCTTCAGCAGCCGCAGCTGCCTCTAGGCAAGATGATTGGGGTCCTGCTCCTGC
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b :
20060611C-001157 : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
---------+---------+---------+---------+---------+---------+ 242
OVRM1_0053_F06.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
OVRM1_0052_H07.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
ADR01_0013_A01.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
OVRM1_0187_E05.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
ADR01_0053_F01.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
LVRM1_0180_D01.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
OVRM1_0135_F04.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
OVRM1_0222_B07.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
LVR01_0012_B01.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
LVRM1_0070_F12.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
AMP01_0069_H02.b : TCCTTCTTCTCCCTTTGCTCCTGTACATCGCTGTACCCCAAATCAGGAAAATGCTGTCCA
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b :
20060611C-001157 : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
---------+---------+---------+---------+---------+---------+ 302
OVRM1_0053_F06.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
OVRM1_0052_H07.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
ADR01_0013_A01.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
OVRM1_0187_E05.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAAGTCGCTGTGGTCACTGGAGCCA
ADR01_0053_F01.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
LVRM1_0180_D01.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
OVRM1_0135_F04.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
OVRM1_0222_B07.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
LVR01_0012_B01.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAAGTCGCTGTGGTCACTGGAGCCA
LVRM1_0070_F12.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAAGTCGCTGTGGTCACTGGAGCCA
AMP01_0069_H02.b : GCGGGGTGTGTACATCAACCGTCCAGCTTCCTGGGAAGGTCGCTGTGGTCACTGGAGCCA
OVRM1_0138_C03.b : cxxxxx
OVRM1_0128_G04.b :
DCI01_0098_H10.b :
20060611C-001157 : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
---------+---------+---------+---------+---------+---------+ 362
OVRM1_0053_F06.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
OVRM1_0052_H07.b : ACACAGGCNTTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
ADR01_0013_A01.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
OVRM1_0187_E05.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
ADR01_0053_F01.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTAGCTAAAAGAGGAGCCCGTGTATATT
LVRM1_0180_D01.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
OVRM1_0135_F04.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
OVRM1_0222_B07.b : ACACAGGTATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
LVR01_0012_B01.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
LVRM1_0070_F12.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
AMP01_0069_H02.b : ACACAGGCATTGGGAAGGAGACGGCCAAAGAGCTGGCTAAAAGAGGAGCCCGTGTATATT
OVRM1_0138_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATT
OVRM1_0128_G04.b : nagt
DCI01_0098_H10.b :
20060611C-001157 : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
---------+---------+---------+---------+---------+---------+ 422
OVRM1_0053_F06.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
OVRM1_0052_H07.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
ADR01_0013_A01.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
OVRM1_0187_E05.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCAGTGGCCAGAGAAATCCAGAACATGACAG
ADR01_0053_F01.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
LVRM1_0180_D01.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
OVRM1_0135_F04.b : TAGCCTGCCGGGATGTGCAAAAAGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
OVRM1_0222_B07.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
LVR01_0012_B01.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCAGTGGCCAGAGAAATCCAGAACATGACAG
LVRM1_0070_F12.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCAGTGGCCAGAGAAATCCAGAACATGACAG
AMP01_0069_H02.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTAGCCGGAGAAATCCAGAACATGACAG
OVRM1_0138_C03.b : TAGCCTGCCGGGATGTGCAAAAGGGGGAATCGGTGGCCAGAGAAATCCAGAACATGACAG
OVRM1_0128_G04.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATGACAG
DCI01_0098_H10.b :
20060611C-001157 : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
---------+---------+---------+---------+---------+---------+ 482
OVRM1_0053_F06.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
OVRM1_0052_H07.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
ADR01_0013_A01.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
OVRM1_0187_E05.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCCT
ADR01_0053_F01.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
LVRM1_0180_D01.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
OVRM1_0135_F04.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
OVRM1_0222_B07.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
LVR01_0012_B01.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCCT
LVRM1_0070_F12.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCCT
AMP01_0069_H02.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
OVRM1_0138_C03.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
OVRM1_0128_G04.b : GAAACCAACAGGTATTGGTGCGGAAACTGGACCTGGCTGATACTAAATCTATTCGAGCTT
DCI01_0098_H10.b : nnaaaacg
20060611C-001157 : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
---------+---------+---------+---------+---------+---------+ 542
OVRM1_0053_F06.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
OVRM1_0052_H07.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCACGAG
ADR01_0013_A01.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
OVRM1_0187_E05.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAAGAG
ADR01_0053_F01.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
LVRM1_0180_D01.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
OVRM1_0135_F04.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
OVRM1_0222_B07.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
LVR01_0012_B01.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
LVRM1_0070_F12.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
AMP01_0069_H02.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
OVRM1_0138_C03.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCACGAG
OVRM1_0128_G04.b : TTGCTAAGGGCTTCTTAGCAGAAGAAAAGCATCTCCACATTTTGATCAACAATGCAGGAG
DCI01_0098_H10.b : atactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20060611C-001157 : TGATGATGTGTCCTTACTCCAAGACAGCAGACGGCTTTGAGACGCACATGGG*AGTCAAC
---------+---------+---------+---------+---------+---------+ 601
OVRM1_0053_F06.b : TGATGATGTGTCCTTACTCCAAGACAGCAGACGGCTTTGAGACGCACATGGGGAGTC*AC
OVRM1_0052_H07.b : TGATGATGTGTCCTTACTCCNAGACAGCAGACGGCTTTGAGACGCACATGGG*AGTCAAC
ADR01_0013_A01.b : TGATGATGTGTCCTTACTCCAAGACAGCAGATGGCTTTGAGACGCACATAGG*AGTCAAC
OVRM1_0187_E05.b : TGATGATGTGTCCTTACTCCAAGACAGCAGATGGCTTTGAGACGCACATAGG*AGTCAAC
ADR01_0053_F01.b : TGATGATGTGTCCTTACTCCAAGACAGCAGATGGCTTTGAGACGCACATAGG*AGTCAAC
LVRM1_0180_D01.b : TGATGATGTGTCCTTACTCCAAGACAGCAGACGGCTTTGAGACGCACATGGG*AGTCAAC
OVRM1_0135_F04.b : TGATGATGTGTCCTTACTCCAAGACAGCAGACGGCTTTGATACGCACATGGG*AGTCAAC
OVRM1_0222_B07.b : TGATGATGTGTCCTTACTCCAAGACAGCAGACGGCTTTGAGACGCACATGGG*AGTCAAC
LVR01_0012_B01.b : TGATGATGTGTCCTTACTCCAAGACAGCAGATGGCTTTGAGACGCACATAGG*AGTCAAC
LVRM1_0070_F12.b : TGATGATGTGTCCTTACTCCAAGACAGCAGATGGCTTTGAGACGCACATAGG*AGTCAAC
AMP01_0069_H02.b : TGATGATGTGTCCTTACTCCAAGACAGCAGACGGCTTTGAGACGCACATGGG*AGTCAAC
OVRM1_0138_C03.b : TGATGATGTGTCCTTACTCCAAGACAGCAGACTGCTTTGAGACGCACATGGG*AGTCAAC
OVRM1_0128_G04.b : TGATGATGTGTCCTTACTCCAAGACAGCAGACGGCTTTGAGACGCACATGGG*AGTCAAC
DCI01_0098_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20060611C-001157 : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
---------+---------+---------+---------+---------+---------+ 660
OVRM1_0053_F06.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
OVRM1_0052_H07.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
ADR01_0013_A01.b : CACTTANGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
OVRM1_0187_E05.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAAACAAGCTGAAGGAATCAACCCC*
ADR01_0053_F01.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
LVRM1_0180_D01.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
OVRM1_0135_F04.b : CACTTATGTCACTTCCTCCTGACCCATCTGTTACTATAGAAGCTGAAGGAATCAGCCCC*
OVRM1_0222_B07.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
LVR01_0012_B01.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGGATCAGCCCC*
LVRM1_0070_F12.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
AMP01_0069_H02.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
OVRM1_0138_C03.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCCC
OVRM1_0128_G04.b : CACTTAGGTCACTTCCTCCTGACCCATCTGTTACTAGAGAAGCTGAAGGAATCAGCCCC*
DCI01_0098_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTAGAGAAGCTGAAGGAATCAGCCCC*
20060611C-001157 : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
---------+---------+---------+---------+---------+---------+ 719
OVRM1_0053_F06.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
OVRM1_0052_H07.b : CTCCAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*GAGGATCCACTTCTATA
ADR01_0013_A01.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
OVRM1_0187_E05.b : ATCAACGGTAGTGAATGTGTCTTCTCTAGCACATCACATGGG*AAGGATCCACTTCCACA
ADR01_0053_F01.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
LVRM1_0180_D01.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
OVRM1_0135_F04.b : ATCAAGGGTAGTGAATGTGTCTTCCTTATCACATCACATGGGGAAGGATCCACTTCCATA
OVRM1_0222_B07.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
LVR01_0012_B01.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
LVRM1_0070_F12.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAAGATCCACTTCCATA
AMP01_0069_H02.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
OVRM1_0138_C03.b : ATC*AGGGTAGTGAATGTGTCTTCCCTAGTACATCACATGGG*AAGGATCCACTTCCATA
OVRM1_0128_G04.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
DCI01_0098_H10.b : ATCAAGGGTAGTGAATGTGTCTTCCTTAGCACATCACATGGG*AAGGATCCACTTCCATA
20060611C-001157 : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAACAGCAAGTTAGC
---------+---------+---------+---------+---------+---------+ 777
OVRM1_0053_F06.b : ACCTGCGGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAn
OVRM1_0052_H07.b : ACCTGCGCGGTG*AGAAGTTCTACCACGCGGGGCTGG*GCTACTGATAAAGCAAGTTAtn
ADR01_0013_A01.b : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGCCTTG*GCTACTGTACCAACAAGTTAGC
OVRM1_0187_E05.b : ACCTGCAAGGTGAAAAAGTCCTAC*ATGCGGGCCTGG*CCTACTcgcaaagcttgtatac
ADR01_0053_F01.b : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAACAGCAAGTTAGC
LVRM1_0180_D01.b : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAACAACAAGTTAGC
OVRM1_0135_F04.b : TACTGCAGGGTGGAAAATTTCTACCATGCCGGTCTTGTCCTACTGTTACAACAAGTTGAC
OVRM1_0222_B07.b : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAACAGCAAGTTAGC
LVR01_0012_B01.b : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAACAGCAAGTTAGC
LVRM1_0070_F12.b : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAACAACAAGTTAGC
AMP01_0069_H02.b : ACCTGCANGGTG*AGAAGTTCTACCATGCGGGTCTGG*TCTACTGTAACAGCAAAGTAGT
OVRM1_0138_C03.b : ACCTGCAGGGTG*AGAAGTTCTTCCATGCGGGTCTGG*GCTACTGTAACAGCAAGTTAGC
OVRM1_0128_G04.b : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAACAGCAAGTTAGC
DCI01_0098_H10.b : ACCTGCAGGGTG*AGAAGTTCTACCATGCGGGTCTGG*CCTACTGTAACAGCAAGTTAGC
20060611C-001157 : CAATGTTC*TCTTCACCCA*GGAACTGGC*CCGGAGGCTAAAAGG*CTCT*GGCGTTACA
---------+---------+---------+---------+---------+---------+ 832
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : CAATGTTC*TCTTCACCCA*GAAACTGGC*CCNGAAGCTAAAAGG*CTCT*GGCGTTtac
OVRM1_0187_E05.b : cacctttctcctcacccaaggaactggcccagaagcaaaaaggcactggcgctacaacat
ADR01_0053_F01.b : CAATGTTC*TCTTCACCCA*GGAACTGGC*CCGGAGGCTAAAAGgctctggcgttacaac
LVRM1_0180_D01.b : CAATGTTC*TCTTCACCCA*GGAACTGGG*CCGGAGGCTAAAAAG*CTCT*CGCGTTACA
OVRM1_0135_F04.b : CAATGTTC*TCTTCACTCAAGGAATGTGC*CCGGAGGCTAAAAAGGCTCT*GGgggttac
OVRM1_0222_B07.b : CAATGTTCCTCTTCA*CCA*GGAACTGGA*CCGGAGGCTAAAAAG*CTCT*GGCGTTACA
LVR01_0012_B01.b : CAACGTTC*TCTTCACCCA*GGAACTGGC*CCGGAGGCTAanagatgcagaaactaagtc
LVRM1_0070_F12.b : CAACGTTC*TCTTCACCA**GAGACTGGC*CCGGAAGCTAAAAGG*CTCT*GGCGTTAC
AMP01_0069_H02.b : CAATGTTC*TCTTCACCAA**GAACTGGC*CCGAANGCTAAAAGG*CTCT*GGCGTTACA
OVRM1_0138_C03.b : CAATGTTC*TCTTCACCCA*TGAACTGGCCCCGGAGGCTATAAGG*CTCTTGGCGTTACA
OVRM1_0128_G04.b : CAATGTTC*TCTTCACCCA*GGAACTGGC*CCGGAGGCTAAAAGG*CTCT*GGCGTTACA
DCI01_0098_H10.b : CAATGTTC*TCTTCACCCA*GGAACTGGC*CCGGAGGCTAAAAGG*CTCT*GGCGTTACA
20060611C-001157 : ACATACTCAGT*ACACCCTGGCACAGTTG*ACTCTGAATTGGTT**CGGCACTCATCCCT
---------+---------+---------+---------+---------+---------+ 888
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : actaactcataaacacttggccaagttaaccctaaattggtccgccaccatcctttccga
OVRM1_0187_E05.b : accccaacacactg
ADR01_0053_F01.b : atactcagtacaccctggcacagttgactctgaattggttcggcactcatccctcctgag
LVRM1_0180_D01.b : Aa
OVRM1_0135_F04.b : aaataaccaa
OVRM1_0222_B07.b : ACATAATCAatat
LVR01_0012_B01.b : acaacatcaggaacttgcccaaggtcacacagcaataaagctgagatttgaaactgggca
LVRM1_0070_F12.b :
AMP01_0069_H02.b : ACATACTCAGT*ACACCCTGGCACAGTTG*ACTCTGAAATGGNT**CGGCACTCATCCCT
OVRM1_0138_C03.b : CCATACTCAGTTANCACCTGGCACAGTTGCACTCTGAAATTGGTTCGGGTGCTCATCCCC
OVRM1_0128_G04.b : ACATACTCAGT*ACACCCTGGCACAGTTG*ACTCTGAATTGGTT**CGGCACTCATCCCT
DCI01_0098_H10.b : ACATACTCAGT*ACACCCTGGCACAGTTG*ACTCTGAATTGGTT**CGGCACTCATCCCT
20060611C-001157 : CCTGAGATGGATT*TGGTGGCTTTTCTCCTTCTTCATCAAGACCCCTCAGCAGGGAGCCC
---------+---------+---------+---------+---------+---------+ 947
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : aaaagaattgggggcttttccccttcttaataaaaaccctaaaagggaacccaaacaacc
OVRM1_0187_E05.b :
ADR01_0053_F01.b : atggatttggtggcttttctcctttcttcatcagacccctcagcagggagcccagacagc
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b : gtctgacggcaaaagctctggcgttacaacatactcagtacaccctggcacagttgactc
LVRM1_0070_F12.b :
AMP01_0069_H02.b : *CTGAGATGGATTGGNTGGGCTTTTCTCCTTCTTCACCAG*ACCCCTCANCAGGAAGCCC
OVRM1_0138_C03.b : CCTGGAATGGTATATTGTGGCTTTTCTCCTTCTCCATCAAgaccccctcagccggggacc
OVRM1_0128_G04.b : CCTGAGATGGATT*TGGTGGCTTTTCTCCTTCTTCATCAAGACCCCTCAGCAGGGAGCCC
DCI01_0098_H10.b : CCTGAGATGGATT*TGGTGGCTTTTCTCCTTCTTCATCAAGACCCCTCAGCAGGGAGCCC
20060611C-001157 : AGACCAGCCTGTACTGTGCCTTAACAGAAGGTCTTGAGGTTCTAAGTGGAAACCATTTCA
---------+---------+---------+---------+---------+---------+ 1007
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : ctgaattggccttaaacaaaggtttagggttcaaatggaaaccttttcaaggcaggcaat
OVRM1_0187_E05.b :
ADR01_0053_F01.b : ctgtactgtgccttaacagaaagtcttgaggttctaaatggaaaccatttcagtgactgc
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b : tgaaatggttcngcactcatccctcctgagatggattttggtggcttttctccttctttc
LVRM1_0070_F12.b :
AMP01_0069_H02.b : AAACCAGCCTGGACTGTACCTTAccgaaagtctgangttcctaatgggaaccatttccgt
OVRM1_0138_C03.b : cgataacctccctggactgtggccttatcacacaggcttctaggctcttcatcggcaacc
OVRM1_0128_G04.b : AGACCAGCCTGTACTGTGCCTTAACAGAAGGTCTTGAGGTTCTAAGTGGAAACCATTTCA
DCI01_0098_H10.b : AGACCAGCCTGTACTGTGCCTTAACAGAAGGTCTTGAGGTTCTAAGTGGAAACCATTTCA
20060611C-001157 : GTGACTGCCATGTGGCATGGGTCTCTGCCCAGGCTCGTAACGAGACAGTAGCAAGGCGGC
---------+---------+---------+---------+---------+---------+ 1067
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : gggaaagggccttgcccagtcccaaaaaaaaaaatacaaggggcgttgggaattccccct
OVRM1_0187_E05.b :
ADR01_0053_F01.b : catgtggcatgggtctctgccccagctcgtaacgagacagtagcaggggcgctatgggat
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b : atcagacccctcagcagggagcccagaccagcctgtactgtgccttaacagaaggtcttg
LVRM1_0070_F12.b :
AMP01_0069_H02.b : ggatgcccatgtggcatgggtctctgccccgcctcgaaccagaaagtagcagggcgctat
OVRM1_0138_C03.b : cactctccttgactgccatgtggtctgggctccctgctctcggtcctgctacgcgacacc
OVRM1_0128_G04.b : GTGACTGCCATGTGGCATGGGTCTCTGCCCAGGCTCGTAACGAGACAGTAGCAAGGCGGC
DCI01_0098_H10.b : GTGACTGCCATGTGGCATGGGTCTCTGCCCAGGCTCGTAACGAGACAGTAGCAAGGCGGC
20060611C-001157 : TATGGGATGTCAGCCGTGACCTGCTGGGCATCCCTATGGATTGACGGGTGATGGCAGTTG
---------+---------+---------+---------+---------+---------+ 1127
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : gaacccgctgcaccccctagatttaaggggaaatgcattggacaaaaaaacccgccgcaa
OVRM1_0187_E05.b :
ADR01_0053_F01.b : gtcagctgttgactgctgggcatccctatggattgacgggtggaagccanttggaaccaa
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b : aagttctaagtgaaacccatttcattgactgccatggtggcaggggtctctgcccaggcc
LVRM1_0070_F12.b :
AMP01_0069_H02.b : ggaatgtcaccttgaactgcaggccatcctatggatgacggtgaatgcattgaacaaaag
OVRM1_0138_C03.b : tcccacgtcgtctatgggattgccagcc
OVRM1_0128_G04.b : TATGGGATGTCAGCTGTGACCTGCTGGGCATCCCTATGGATTGACGGGTGATGGCAGTTG
DCI01_0098_H10.b : TATGGGATGTCAGCCGTGACCTGCTGGGCATCCCTATGGATTGACGGGTGATGGCAGTTG
20060611C-001157 : GACCAAGAGAAGCCTGCAGCACACTACTCAGTACTCCCTGCCAAAATGATTCTCCTTCAG
---------+---------+---------+---------+---------+---------+ 1187
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : ctatcatattcccgccaaaagatcccctccagaaggccaaacttggaccaaaaatgaaaa
OVRM1_0187_E05.b :
ADR01_0053_F01.b : aaaaaccctgcaacaaactaatcaatattccggccaaaagtatcctcttcaggatgcgca
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b : tcttaaccaaaacattaaccaaggcgggcctatgggaatgttcaaccttgttaacctggc
LVRM1_0070_F12.b :
AMP01_0069_H02.b : aacctgaanaaattactcgtaatcctggcaaaggattccctccggaggccaaacttaaca
OVRM1_0138_C03.b :
OVRM1_0128_G04.b : GACACAGA*AAACCTGCAGCACACTACTCAGTACTCCCTGCCAAAATGATTCTCCT
DCI01_0098_H10.b : GACCAAGAGAAGCCTGCAGCACACTACTCAGTACTCCCTGCCAAAATGATTCTCCTTCAG
20060611C-001157 : GATGGCCAAAACCTTGAGCACAAAGACTGCAAACCTTCCATCCTTGCCTGCTTGATGTTG
---------+---------+---------+---------+---------+---------+ 1247
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : ctccaccctgccgctgtgagttaaaaaaacccggttacttcccaaactctaaaccctgta
OVRM1_0187_E05.b :
ADR01_0053_F01.b : aaacttggacacaaaaatggaaaccttcacccttgcgggttaattgggaaaaaacccagt
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b : ctggggccatccccctatggggaattttgacgggggggggaaaggggggacgtttttggg
LVRM1_0070_F12.b :
AMP01_0069_H02.b : caaaagtaaaacttcctccttgtcgcttagttggaaaaacccctgtacacccaaccc
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : GATGGCCAAAACCTTGAGCACAAAGACTGCAAACCTTCCATCCTTGCCTGCTTGATGTTG
20060611C-001157 : GATAAAAGCCCAGTGTACACTGCCAGACTCATCTAAACGCCTTGCATTTGTCTAGATGTA
---------+---------+---------+---------+---------+---------+ 1307
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : ttgcaaaatattttttcccttttggccattctccaaaatggggagggggccctcttccgc
OVRM1_0187_E05.b :
ADR01_0053_F01.b : gtaatgccaaaatctttaaaccctggatttttaaaattttttggttccatatcccccaat
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b : aaacccacaaaaaaaaaaaaaaac
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : GATAAAAGCCCAGTGTACACTGCCAGACTCATCTAAACGCCTTGCATTTGTCTAGATGTA
20060611C-001157 : TTTTGTTCCTATTACTGCCAGAGTTACCAGAGATAATGTAGGATAGGTGGACCCTCATAT
---------+---------+---------+---------+---------+---------+ 1367
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : ccccaaaaccgtttttccctaaaccacaccgagaaaaatagggggggttaacaccttatt
OVRM1_0187_E05.b :
ADR01_0053_F01.b : tcccaaaaaaggggaaaggggaccccccttct
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : TTTTGTTCCTATTACTGCCAGAGTTACCAGAGATAATGTAGGATAGGTGGACCCTCATAT
20060611C-001157 : GCCTGCCACCATATGACCGCTTGTATTTTCCCTCTGAAACCTACTACCTANGAGAGCCCT
---------+---------+---------+---------+---------+---------+ 1427
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : ttttcttcttccaaaagttcccacaaataaaggacggccccccacccccaaggggtgaga
OVRM1_0187_E05.b :
ADR01_0053_F01.b :
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : GCCTGCCACCATATGACCGCTTGTATTTTCCCTCTGAAACCTACTACCTANGAGAGCCCT
20060611C-001157 : AGCTATGGCAGGGTTGATTTACAGCACTTTAGATTTGTTTCTG.................
---------+---------+---------+---------+---------+---------+ 1470
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b : aatactttttaaacgaaccgcggtataaaatatgg
OVRM1_0187_E05.b :
ADR01_0053_F01.b :
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : AGCTATGGCAGGGTTGATTTACAGCACTTTAGATTTGTTTCTGtccnttctgtcccacat
20060611C-001157 : ............................................................
---------+---------+---------+---------+---------+---------+ 1470
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b :
OVRM1_0187_E05.b :
ADR01_0053_F01.b :
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : gtagttcctctcgaccaaccacctttcaaggggcacgctgcagcctcagctaagctcagg
20060611C-001157 : ............................................................
---------+---------+---------+---------+---------+---------+ 1470
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b :
OVRM1_0187_E05.b :
ADR01_0053_F01.b :
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : agtcccatggcttggctcagagcaagattttcctttacccttaaaaaaacctctgggacc
20060611C-001157 : ............................................................
---------+---------+---------+---------+---------+---------+ 1470
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b :
OVRM1_0187_E05.b :
ADR01_0053_F01.b :
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : cactctgaggctttgaaaaaactctaatgaaacgggttgtgcggggcttctccttgaacc
20060611C-001157 : ............................................................
---------+---------+---------+---------+---------+---------+ 1470
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b :
OVRM1_0187_E05.b :
ADR01_0053_F01.b :
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : gcctttaaaacttttcctgtccaaacccaaaaaactccctttctaaagggaaaaggtttt
20060611C-001157 : ............................................................
---------+---------+---------+---------+---------+---------+ 1470
OVRM1_0053_F06.b :
OVRM1_0052_H07.b :
ADR01_0013_A01.b :
OVRM1_0187_E05.b :
ADR01_0053_F01.b :
LVRM1_0180_D01.b :
OVRM1_0135_F04.b :
OVRM1_0222_B07.b :
LVR01_0012_B01.b :
LVRM1_0070_F12.b :
AMP01_0069_H02.b :
OVRM1_0138_C03.b :
OVRM1_0128_G04.b :
DCI01_0098_H10.b : gggaagggagaattttgggaaggaggaaaaaataaat