[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-001748

Length: 955

Sequence [FASTA format sequence]
GGGGACGACA GGCCGCGCCC CAGAGTTCTT TGCGTACAGG TGGCTGCCTT AGCTCCGGGA
GCGCGGCGGC TCCGGAAATC CTGCGAGGGG GACGGTGGGC CCTCGGCCCG GGCGGCTATG
GCAGTGGCTA CAGTGGCGGC ATTTCTGGCC GCACTGGGTG GGGCCCTGTG GCTGGCGGCC
CGACGGTTTG TGGGGCCTAG TGTCCAGCGG TTGCACCGAG GCGGGGACTC CGGCCTCATG
CACGGGAAGA CCGTGCTGAT CACGGGGGCT AACAGCGGCC TGGGCCGCGC CACGGCCGCC
GAGCTGCTAC GCTTGGGGGC GCGAGTGATC ATGGGCTGCC GGGACCGCGC GCGCGCCGAG
GAGGCGGCGG GTCAGCTCCG CCGCGAGCTC CGCCAGACCG AGGGCCCCGA GGAGGGGCCC
AACTCCGGAG GGGCCGGCGA GCTCGTCGTC CGGGAGTTGG ACCTCGCCTC GCTGCGCTCG
GTGCGCGCCT TCTGTCAGGA GATGCTCCAG GAAGAGCCTA GACTGGATGT TCTGATCAAT
AATGCAGGGA TCTTCCAGTG CCCTTACATG AAGACCGAAG ATGGGTTTGA GATGCAGTTT
GCAGTGAACC ATCTGGGGCA CTTCCTACTC ACCAATCTTC TCCTTGGACT CCTTAAAAGT
TCAGCTCCCA GCAGGATTGT GGTAGTTTCT TCCAAACTTT ATAAATATGG AGACATCAAC
TTTGAAGACT TGAACAGTGA ACAAAGCTAT AATAAAAGCT TCTGTTACAG TCGGAGCAAA
CTGGCTAACA TTCTTTTTAC CAGAGAACTA GCCCGCCCGC TTAGAAGGCA CAAATGTCAC
TGTCAACGTA TTGCACCCCG GCATCGTGCG GACTAACCTG GGGAGGCACA TACACATCCC
ACTCTTAGTC AGGCCACTTT TCAATTTAGT GGTCATGGGG TTTTTTTCAA AACTC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 (all-trans/9-cis/11-cis)345e-113O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 (all-trans/9-cis/11-cis)1668e-46O
Contig/Assembly ProteinRDH11retinol dehydrogenase 11 (all-trans/9-cis/11-cis)1586e-39O
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 (all-trans/9-cis)1182e-33O
Contig/Assembly ProteinWWOXWW domain containing oxidoreductase1087e-24
Contig/Assembly ProteinMGC23280hypothetical protein MGC232801071e-23O
Contig/Assembly ProteinDHRSXdehydrogenase/reductase (SDR family) X-linked992e-24O
Contig/Assembly ProteinLOC388963similar to short-chain dehydrogenase/reductase 178.67e-15
Contig/Assembly ProteinLOC388963similar to short-chain dehydrogenase/reductase 178.67e-15
Contig/Assembly ProteinHSD17B8hydroxysteroid (17-beta) dehydrogenase 853.53e-07O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 8      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVRM10110B08LVRM1_0110_B08.bBP449413 AK233249
OVR010043A05OVR01_0043_A05.bBP141431 
OVR010097F01OVR01_0097_F01.bBW967919 
OVRM10162G05OVRM1_0162_G05.bBP460753 
OVRM10184D08OVRM1_0184_D08.bBP458085 
OVRM10206H07OVRM1_0206_H07.bBP461880 AK236595
SKNB10044F08SKNB1_0044_F08.bDB802494 
TCH010032C01TCH01_0032_C01.bCJ024800 AK399319

  

Alignment:      TOP

20060611C-001748 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0032_C01.b : nnnncctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0162_G05.b : nagttgtcxxxxxxxxx
OVR01_0097_F01.b : nggctagtgacttnacxxxxxxxxxxxxxxxxxxx
LVRM1_0110_B08.b : nagttg
OVRM1_0206_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_D08.b : gagtttg
OVR01_0043_A05.b : gggagctaxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0044_F08.b :
20060611C-001748 : .....................GGGGACGACAGGCCGCGCCCCAGAGTTCTTTGCGTACAG
---------+---------+---------+---------+---------+---------+ 39
TCH01_0032_C01.b : xxxxxxxxxxxxxxxxxxxxxGGGGACGACAGGCCGCGCCCCAGAGTTCTTTGCGTACAG
OVRM1_0162_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgttcTTTGCGTACAG
OVR01_0097_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgctttTTTGCCTACAG
LVRM1_0110_B08.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTACAG
OVRM1_0206_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTACAG
OVRM1_0184_D08.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTACAG
OVR01_0043_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTACAG
SKNB1_0044_F08.b : nnnnggggggnngnnnccaacgtttgcanggcgtaAG
20060611C-001748 : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCGGAAATCCTGCGAGGGGGACGGTGGG
---------+---------+---------+---------+---------+---------+ 99
TCH01_0032_C01.b : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCGGAAATCCTGCGAGGGGGACGGTGGG
OVRM1_0162_G05.b : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCGGAAATCCTGCGAGGGGGACGGTGGG
OVR01_0097_F01.b : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCCGAAATCCTGCGAGGGGGACGGTGGG
LVRM1_0110_B08.b : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCGGAAATCCTGCGAGGGGGACGGTGGG
OVRM1_0206_H07.b : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCGGAAATCCTGCGAGGGGGACGGTGGG
OVRM1_0184_D08.b : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCGGAAATCCTGCGAGGGGGACGGTGGG
OVR01_0043_A05.b : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCGGAAATCCTGCGAGGGGGACGGTGGG
SKNB1_0044_F08.b : GTGGCTGCCTTAGCTCCGGGAGCGCGGCGGCTCCGGAAATCCTGCGAGGGGGACGGTGGG
20060611C-001748 : CCCTCGGCCCGGGCGGCTATGGCAGTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
---------+---------+---------+---------+---------+---------+ 159
TCH01_0032_C01.b : CCCTCGGCCCGGGCGGCTATGGCAGTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
OVRM1_0162_G05.b : CCCTCGGCCCGGGCGGCTATGGCAGTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
OVR01_0097_F01.b : CCCTCGGCCCGGGCGGCTATGGCACTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
LVRM1_0110_B08.b : CCCTCGGCCCGGGCGGCTATGGCAGTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
OVRM1_0206_H07.b : CCCTCGGCCCGGGCGGCTATGGCAGTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
OVRM1_0184_D08.b : CCCTCGGCCCGGGCGGCTATGGCAGTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
OVR01_0043_A05.b : CCCTCGGCCCGGGCGGCTATGGCAGTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
SKNB1_0044_F08.b : CCCTCGGCCCGGGCGGCTATGGCAGTGGCTACAGTGGCGGCATTTCTGGCCGCACTGGGT
20060611C-001748 : GGGGCCCTGTGGCTGGCGGCCCGACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
---------+---------+---------+---------+---------+---------+ 219
TCH01_0032_C01.b : GGGGCCCTGTGGCTGGCGGCCCGACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
OVRM1_0162_G05.b : GGGGCCCTGTGGCTGGCGGCCCGACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
OVR01_0097_F01.b : GGGGCCCTGTGGCTGGCGGCCCCACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
LVRM1_0110_B08.b : GGGGCCCTGTGGCTGGCGGCCCGACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
OVRM1_0206_H07.b : GGGGCCCTGTGGCTGGCGGCCCGACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
OVRM1_0184_D08.b : GGGGCCCTGTGGCTGGCGGCCCGACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
OVR01_0043_A05.b : GGGGCCCTGTGGCTGGCGGCCCGACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
SKNB1_0044_F08.b : GGGGCCCTGTGGCTGGCGGCCCGACGGTTTGTGGGGCCTAGTGTCCAGCGGTTGCACCGA
20060611C-001748 : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
---------+---------+---------+---------+---------+---------+ 279
TCH01_0032_C01.b : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
OVRM1_0162_G05.b : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
OVR01_0097_F01.b : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
LVRM1_0110_B08.b : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
OVRM1_0206_H07.b : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
OVRM1_0184_D08.b : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
OVR01_0043_A05.b : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
SKNB1_0044_F08.b : GGCGGGGACTCCGGCCTCATGCACGGGAAGACCGTGCTGATCACGGGGGCTAACAGCGGC
20060611C-001748 : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
---------+---------+---------+---------+---------+---------+ 339
TCH01_0032_C01.b : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
OVRM1_0162_G05.b : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
OVR01_0097_F01.b : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
LVRM1_0110_B08.b : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
OVRM1_0206_H07.b : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
OVRM1_0184_D08.b : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
OVR01_0043_A05.b : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
SKNB1_0044_F08.b : CTGGGCCGCGCCACGGCCGCCGAGCTGCTACGCTTGGGGGCGCGAGTGATCATGGGCTGC
20060611C-001748 : CGGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
---------+---------+---------+---------+---------+---------+ 399
TCH01_0032_C01.b : CGGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
OVRM1_0162_G05.b : CGGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
OVR01_0097_F01.b : CGGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
LVRM1_0110_B08.b : CGGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
OVRM1_0206_H07.b : CGGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
OVRM1_0184_D08.b : CGGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
OVR01_0043_A05.b : CGGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
SKNB1_0044_F08.b : CAGGACCGCGCGCGCGCCGAGGAGGCGGCGGGTCAGCTCCGCCGCGAGCTCCGCCAGACC
20060611C-001748 : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
---------+---------+---------+---------+---------+---------+ 459
TCH01_0032_C01.b : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
OVRM1_0162_G05.b : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
OVR01_0097_F01.b : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
LVRM1_0110_B08.b : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
OVRM1_0206_H07.b : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
OVRM1_0184_D08.b : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
OVR01_0043_A05.b : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
SKNB1_0044_F08.b : GAGGGCCCCGAGGAGGGGCCCAACTCCGGAGGGGCCGGCGAGCTCGTCGTCCGGGAGTTG
20060611C-001748 : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAGGAGATGCTCCAGGAAGAGCCT
---------+---------+---------+---------+---------+---------+ 519
TCH01_0032_C01.b : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAGGAGATGCTCCAG****AGCCT
OVRM1_0162_G05.b : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAGGAGATGCTCCAGGAAGAGCCT
OVR01_0097_F01.b : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAGGAGATGCTCCAGGAAGAGCCT
LVRM1_0110_B08.b : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAGGAGATGCTCCAGGAAGAGCCT
OVRM1_0206_H07.b : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAGGAGATGCTCCAGGAAGAGCCT
OVRM1_0184_D08.b : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAGGAGATGCTCCAGGAAGAGCCT
OVR01_0043_A05.b : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAGGAGATGCTCCAGGAAGAGCCT
SKNB1_0044_F08.b : GACCTCGCCTCGCTGCGCTCGGTGCGCGCCTTCTGTCAAGAGATGCTCCAGGAAGAGCCT
20060611C-001748 : AGACTGGATGTTCTGATCAATAATGCAGGGATCTTCCAGTGCCCTTACATGAAGACCGAA
---------+---------+---------+---------+---------+---------+ 579
TCH01_0032_C01.b : AGACTGGATGTTCTGATCAATAATGCAGGGATCTTCCAGTGCCCTTACATGAAGACCGAA
OVRM1_0162_G05.b : AGACTGGATGTTCTGATCAATAATGCAGGGATCTTCCAGTGCCCTTACATGAAGACCGAA
OVR01_0097_F01.b : AGACTGGATGTTCTGATCAATAATGCACGGATCTTCCAGTGCCCTTACATGAAGACCGAA
LVRM1_0110_B08.b : AGACTGGATGTTCTGATCAATAATGCAGGGATCTTCCAGTGCCCTTACATGAAGACCGAA
OVRM1_0206_H07.b : AGACTGGATGTTCTGATCAATAATGCAGGGATCTTCCAGTGCCCTTACATGAAGACCGAA
OVRM1_0184_D08.b : AGACTGGATGTTCTGATCAATAATGCAGGGATCTTCCAGTGCCCTTACATGAAGACCGAA
OVR01_0043_A05.b : AGACTGGATGTTCTGATCAATAATGCAGGGATCTTCCAGTGCCCTTACATGAAGACCGAA
SKNB1_0044_F08.b : AGACTGGATGTTCTGATCAATAATGCACGGATCTTCCAGTGCCCTTACATGAAGACTGAA
20060611C-001748 : GATGGGTTTGAGATGCAGTTTGCAGTGAACCATCTGGGGCACTTCCTACTCACCAATCTT
---------+---------+---------+---------+---------+---------+ 639
TCH01_0032_C01.b : GATGGGTTTGAGATGCAGTTTGCAGTGAACCATCTGGGGCACTTCCTACTCACCAATCTT
OVRM1_0162_G05.b : GATGGGTTTGAGATGCAGTTTGCAGTGAACCATCTGGGGCACTTCCTACTCACCAATCTT
OVR01_0097_F01.b : GATGGGTTTGAGATGCAGTTTGCAGTGAACCATCTGGGGCACTTCCTACTCACCAATCTT
LVRM1_0110_B08.b : GATGGGGTTGAGATGCAATTTGGAGTGAACCATCTGGGGCACTTCCTACTCAACAATATT
OVRM1_0206_H07.b : GATGGGTTTGAGATGCAGTTTGCAGTGAACCATCTGGGGCACTTCCTACTCACCAATCTT
OVRM1_0184_D08.b : GATGGGTTTGAGATGCAGTTTGCAGTGAACCATCTGGGGCACTTCCTACTCACCAATCTT
OVR01_0043_A05.b : GATGGGTTTGAGATGCAGTTTGCAGTGAACCATCTGGGGCACTTCCTACTCACCAATCTT
SKNB1_0044_F08.b : GATGGGTTTGAGATGCAGTTTGCAGTGAACCATCTGGGGCACTTCCTACTCACCAATCTT
20060611C-001748 : CTCCTTGGACTCCTTAAAAGTTCAGCTCCCAGCAGGATTGTGGTAGTTTCTTCCAAACTT
---------+---------+---------+---------+---------+---------+ 699
TCH01_0032_C01.b : CTCCTTGGACTCCTTAAAAGTTCAGCTCCCAGCAGGATTGTGGTAGTTTCTTCCAAACTT
OVRM1_0162_G05.b : CTCCTTGGACTCGTTAAAGATTCAGCTCCCACCAGGATTCTGGTAGTTTCTTCCAAACTT
OVR01_0097_F01.b : CTCCTTGGACTCCTTAAAAGTTCAGCTCCCAGCAGGATTGTGGTAGTTTCTTTCAAACTT
LVRM1_0110_B08.b : CTCCTTGGACTCCTTAATAATTCAACTCCCAACCAGATTGGGAATAATTCTTCCAACCTT
OVRM1_0206_H07.b : CTCCTTGGACTCCTTAAAAGTTCAGCTCCCAGCAGGATTGTGGTAGTTCCTTCCCAACTT
OVRM1_0184_D08.b : CTCCTTGGACTCCTTAAAAGTTCAGCTCCCAGCAGGATTGTGGTAGTTTCTTCCAAACTT
OVR01_0043_A05.b : CTCCTTGGACTCCTTAAAAGTTCAGCTCCCAGCAGGATTGTGGTAGTTTCTTCCAAACTT
SKNB1_0044_F08.b : CTCCTTGGACTCCTTAAAAGCTCAGCTCCCAGCAGGATTGTGGTAGTTTCTTCCAAACTT
20060611C-001748 : TATAAATATGGAGACATCAACTTTGAAGACTTGAACAGTGAACAAA*GCTATAATAAAAG
---------+---------+---------+---------+---------+---------+ 758
TCH01_0032_C01.b : TATAAATATGGAGACATCAACTTTGAAGACTTGAACAGTGAACAAA*GCTATAATAAAAG
OVRM1_0162_G05.b : *ATAAATATGGAGACATCCACTTTGAAGACTTGAACAGg
OVR01_0097_F01.b : TATAAATATGGAGACATCAACTTTGAAGACTTGAACAGTGAACAAA*GCTATTATTAAAG
LVRM1_0110_B08.b : TATAAATATGGGGACATCATCTTTagaacttggacaggtgaccaacctatataaaagcct
OVRM1_0206_H07.b : TATAAATATGGAGACATCAACTTTGAAGACTTGGACAGTGAACAA**GCTATTATAAAAG
OVRM1_0184_D08.b : TATAAATATGGAGACATCAACTTTGAAGACTTGAACAGTGAACAAA*GCTATAATAAAAG
OVR01_0043_A05.b : TATAAATATGGAGACATCAACTTTGAAGACTTGAACAGTGAACAAA*GCTATAATAAAAG
SKNB1_0044_F08.b : TATAAATATGGAGACATCAACTTTGAAGACTTGAACAGTGAACAAATGCTATAATAAAAG
20060611C-001748 : CTTCTGTTACAGTCGGAGCAAACTGGCTAACATTCTTTTTACCAGA*GAACTAGCCCGCC
---------+---------+---------+---------+---------+---------+ 817
TCH01_0032_C01.b : CTTCTGTTACAGTCGGAACAAACTGGCTAACATTCTTTTTACCAgaaaactaacccgccg
OVRM1_0162_G05.b :
OVR01_0097_F01.b : CTTCTGTTACAGTCGGAGCCAACTGGCTAACATTCTTTTCACCAgaaaactagcccgccc
LVRM1_0110_B08.b : ctgtttaagtcgaaacaacc
OVRM1_0206_H07.b : CTTCTGTTACAG
OVRM1_0184_D08.b : CTTCTGTTACAGTCGGAAGCAACTGGCTAACATTCTTTTTACCAggagaactacccgccg
OVR01_0043_A05.b : CTTCTGTTACAGTCGGAGCGAACTGGCTAACATTCTTTTTACCAGAAGAACTAGCCCGCC
SKNB1_0044_F08.b : CTTCTGTTACAGTCGGAGCAAACTGGCTAACATTCTTTTTACCAGA*GAACTAGCCCGCC
20060611C-001748 : CGCTTAGAAGGCACAAATGTCACTGTCAACGTATTGCAC*CCCGGCATCGTGCGGACTAA
---------+---------+---------+---------+---------+---------+ 876
TCH01_0032_C01.b : cttaaaaggacaaatgtcactgttcacgtattgccccccggcatcgtgcggaataccctg
OVRM1_0162_G05.b :
OVR01_0097_F01.b : gcttaaaaggcaccaaatgttactgtccaacttattggcaccccggcatcggggcggaac
LVRM1_0110_B08.b :
OVRM1_0206_H07.b :
OVRM1_0184_D08.b : ctta
OVR01_0043_A05.b : CGCTTAGAAGGGACAAATGTCACTGTCAACGTATTGCACCCCCGGCATCGTGCGGACTAA
SKNB1_0044_F08.b : *GCTTACAAGGCACGAATGTCACTGTCAACGTATTGCAC*CCCGGCATCGTGCGGACTAA
20060611C-001748 : CCTGGGGAGGCACATA*CAC*ATCCCACTCTTAGTCAGGCCACTTTTCAATTTAGTGGTC
---------+---------+---------+---------+---------+---------+ 934
TCH01_0032_C01.b : gggaggcacataccccatccactcttaatcagggcacttttcaatttaatggtcaggggc
OVRM1_0162_G05.b :
OVR01_0097_F01.b : aaaccttggggagagcacatacacatcccaactctcttagctagggccactttttccatt
LVRM1_0110_B08.b :
OVRM1_0206_H07.b :
OVRM1_0184_D08.b :
OVR01_0043_A05.b : CCTGGGGAGGAACATAACACCATCCCACTCTTATTCAGGGCCCTTTTttcattttaatgt
SKNB1_0044_F08.b : CCTGAGGAGGCACATA*CAC*ATCCCACTCTTAGTCAGGCCACTTTTCAATTTAGTGGTC
20060611C-001748 : ATGGGGTTTTTTTCAAAACTC.......................................
---------+---------+---------+---------+---------+---------+ 955
TCH01_0032_C01.b : tttttttaaaactcccgccaaaaggggccccaaatttcatttttattagccccttcccct
OVRM1_0162_G05.b :
OVR01_0097_F01.b : ttaatggtccatgggcctttttttcaaaaacctcccgccaaaaagggggcccccaaactt
LVRM1_0110_B08.b :
OVRM1_0206_H07.b :
OVRM1_0184_D08.b :
OVR01_0043_A05.b : cattgggctttttttcaaactccaacaaaaaggggccccaaacttcagtttaatttaccc
SKNB1_0044_F08.b : ATGGGGTTTTTTTCAAAACTCcagcagaaagggcccagaactcagtttatttagcctctt
20060611C-001748 : ............................................................
---------+---------+---------+---------+---------+---------+ 955
TCH01_0032_C01.b : gaggtaaaaagggtggccacggaaataacttgtgggactggcaaaaagaaaaaacctttg
OVRM1_0162_G05.b :
OVR01_0097_F01.b : tctcttttaattttagccctccttccccctgaaggtaaaaaggggggtgttccggaaaaa
LVRM1_0110_B08.b :
OVRM1_0206_H07.b :
OVRM1_0184_D08.b :
OVR01_0043_A05.b : cccttcacctgaagggaaaaggggggtcagggaaagaaactttggggaattgccaaaaag
SKNB1_0044_F08.b : cacgtgaggtagaaagtgtgtcaggaaaatactttgggggactgcaaagaggaagaactc
20060611C-001748 : ............................................................
---------+---------+---------+---------+---------+---------+ 955
TCH01_0032_C01.b : gcccaaggcctttggatgaatctgttttcagaaaaacctggggaaattctgtggagtctg
OVRM1_0162_G05.b :
OVR01_0097_F01.b : aaactttttgggggaaaccgg
LVRM1_0110_B08.b :
OVRM1_0206_H07.b :
OVRM1_0184_D08.b :
OVR01_0043_A05.b : gaaaaaaactcttttccccaaagccttttgggatgaactcttttttgccaaaaaaaacct
SKNB1_0044_F08.b : ttgccaaagctatggatgactcctgttgcagaaactctggaaaatcaggtgagtcatggt
20060611C-001748 : ............................................................
---------+---------+---------+---------+---------+---------+ 955
TCH01_0032_C01.b : ggttgggttttttataaatggaaaggggtgtgcgcccctttttttaaacggggtatctcc
OVRM1_0162_G05.b :
OVR01_0097_F01.b :
LVRM1_0110_B08.b :
OVRM1_0206_H07.b :
OVRM1_0184_D08.b :
OVR01_0043_A05.b : tctggggaaattttaaggggaaaagtcacggtgtgagggcgcatatttttaaaaaaaaaa
SKNB1_0044_F08.b : aggctattaaaaaaagaaatgaggtgtggacgcttattttaaaactggatccacctcttc
20060611C-001748 : ............................................................
---------+---------+---------+---------+---------+---------+ 955
TCH01_0032_C01.b : ccccttcttttatatagaaaatgtgggggtggggttttatattggaaaatgattccttg
OVRM1_0162_G05.b :
OVR01_0097_F01.b :
LVRM1_0110_B08.b :
OVRM1_0206_H07.b :
OVRM1_0184_D08.b :
OVR01_0043_A05.b : aggaaaaaagggggaggggggggggggggccgaccgccctttattttttttttaaaaata
SKNB1_0044_F08.b : tgataaggaaaaaaggggggtggggctttacacttgaaaaggcaatccggttttcaatgt
20060611C-001748 : ............................................................
---------+---------+---------+---------+---------+---------+ 955
TCH01_0032_C01.b :
OVRM1_0162_G05.b :
OVR01_0097_F01.b :
LVRM1_0110_B08.b :
OVRM1_0206_H07.b :
OVRM1_0184_D08.b :
OVR01_0043_A05.b : taaaa
SKNB1_0044_F08.b : actggtgaaaggaaa