[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-005957

Length: 1,051

Sequence [FASTA format sequence]
GGCGCGCTCG ATTGCTCGGG TCTGGCGGCG GCAGCATGGC GGCGGGGGCG GCCGAGGCGG
CGGCGGCTGT GGTGGAGGTC GGCTCCGCCG GGCAGTTTGA GGAGCTGCTG CGCCTAAGAG
CCAAGTCCCT GCTGGTGGTC CATTTCTGGG CACCATGGGC CCCACAGTGT GCTCAGATGA
ACGATGTGAT GGCCGAGTTA GCCAAGGAGC ACCCGCAAGT TTCCTTTGTG AAGTTGGAGG
CTGAAGCTGT TCCTGAAGTG TCTGAAAAAT ACGGAATTAG TTCTGTACCC ACCTTTCTGT
TTTTCAAGAA TTCTCAGAGC ATTGACCGGT TAGATGGTGC ACATGCCCCA GAGTTGACCA
AAAAGGTTCA GCGACATGCG TCCAGCAGCT CTTTCCCATC TGGCGGTAGC GAGCACCTGA
AAGAAGACCT CAGCCTTCGC CTGAAGAAGC TGACCCACGC TGCCCCCTGC ATGCTGTTCA
TGAAGGGAAC ACCCCAGGAG CCGCGCTGCG GTTTCAGCAA GCAGATGGTG GAAATTCTTA
ACAAACATAA TATCCAGTTT AGCAGTTTTG ATATCTTCTC AGATGAAGAA GTTCGCCAAG
GCCTCAAAAC CTATTCCAAT TGGCCCACCT ACCCCCAGCT CTATGTTTCT GGAGAGCTCA
TAGGAGGACT TGATATAATC AAGGAGCTAG AAGCATCTAA AGAACTAGAT ACAATTTGCC
CCAAAGCTCC CAAATTAGAG GAAAGGCTCA AAGTACTGAC AAATAAAGCT TCTGTGATGC
TCTTTATGAA GGGAAACAAA CAGGAAGCCA AGTGTGGTTT CAGCAGACAA ATCCTGGAAA
TTCTAAATAG TACTGGTGTC GACTACGAGA CGTTCGACAT ACTGGAGGAT GAGGAAGTCC
GGCAGGGGTT GAAAACCTAC TCCAACTGGC CGACGTACCC TCAGCTGTAT GTGAAAGGGG
AGCTGGTCGG AAGCCTGGAT ATTGTTAAGG AACTAAAAAA AAACGGTGAG CTGCTGCCTA
TCCTGAAAGG AGAAAACTAA ATCAGTGGGG G


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNL2thioredoxin-like 2581e-166O
Contig/Assembly ProteinGLRX5glutaredoxin 5 homolog (S. cerevisiae)1011e-21O
Contig/Assembly ProteinLOC649622similar to thioredoxin domain-containing 252.85e-07
Contig/Assembly ProteinTXNDC2thioredoxin domain containing 2 (spermatozoa)52.85e-07
Contig/Assembly ProteinLOC649622similar to thioredoxin domain-containing 252.85e-07
Contig/Assembly ProteinLOC649622similar to thioredoxin domain-containing 252.85e-07
Contig/Assembly ProteinTXNL1thioredoxin-like 1528e-07O
Contig/Assembly ProteinTXNthioredoxin51.61e-06O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 32      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010022C02ADR01_0022_C02.bDB783409 
ADR010029E05ADR01_0029_E05.bDB784059 
ADR010052A06ADR01_0052_A06.bDB786090 
ADR010055A01ADR01_0055_A01.bDB786355 
ADR010070A06ADR01_0070_A06.bDB787684 
ITT010040B07ITT01_0040_B07.bBW979579 
LNG010022B04LNG01_0022_B04.bBP434232 
LVR010097A08LVR01_0097_A08.bBP441552 
MLN010065D02MLN01_0065_D02.bCJ012760 
MLN010091F11MLN01_0091_F11.bCJ014954 
OVR010040E01OVR01_0040_E01.bBP143064 
OVR010057E01OVR01_0057_E01.bBW964701 AK347564
OVRM10161E07OVRM1_0161_E07.bBP458957 
PBL010036C05PBL01_0036_C05.bBW970199 
PBL010082F06PBL01_0082_F06.bBW973476 
SKNB10003C01SKNB1_0003_C01.bDB800218 
SPL010050C04SPL01_0050_C04.bCJ017499 
TCH010034A04TCH01_0034_A04.bCJ024927 
TCH010039E07TCH01_0039_E07.bCJ025351 
TCH010068E11TCH01_0068_E11.bCJ027316 
TCH010097H09TCH01_0097_H09.bCJ029566 
TES010011A05TES01_0011_A05.b  
TES010017H09TES01_0017_H09.bCJ031177 
TES010025H03TES01_0025_H03.b  
TES010035D02TES01_0035_D02.bCJ032305 
TES010037A11TES01_0037_A11.bCJ032424 
TES010042H04TES01_0042_H04.bCJ032747 
THY010022H06THY01_0022_H06.bBP168650 AK238735
THY010097A01THY01_0097_A01.bBP159434 
UTR010023G11UTR01_0023_G11.bBP173025 
UTR010071E10UTR01_0071_E10.bBP464054 
UTR010072E10UTR01_0072_E10.bBP464055 

  

Alignment:      TOP

20060611C-005957 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
ADR01_0052_A06.b : nnnnttcgaannaaagctgaagcagcggtxxxxxxxxxxxxxxx
ADR01_0070_A06.b : aaaacggatgaacaxxxxxxxxxxxxxxxxxx
THY01_0022_H06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0091_F11.b : nngctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0068_E11.b : ttttttccatgtgactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0035_D02.b :
TES01_0042_H04.b :
TES01_0025_H03.b :
OVR01_0057_E01.b : nnncctgctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0036_C05.b : nnggtgaacaxxxxxxxxxxxxxxxxxxx
LVR01_0097_A08.b : tatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0011_A05.b :
ITT01_0040_B07.b : nnnggtgaaacaxxxxxxxxxxxxx
ADR01_0029_E05.b : nnnnnnggctgaacaxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0034_A04.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0022_B04.b : ggctttacgtgcntatanngacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_E01.b : ccgaggatctagctccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0055_A01.b : ggccnnnggatgaacaxxxxxxxxx
THY01_0097_A01.b : gcatatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0097_H09.b : nnttgctaggactataacxxxxxxxxxxxxxxxxxxxxx
SKNB1_0003_C01.b :
TCH01_0039_E07.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0022_C02.b : aaacaxxxxxx
MLN01_0065_D02.b : nncctagtgacttgacxxxxxxxxxxxxxxxxxx
TES01_0017_H09.b :
OVRM1_0161_E07.b : nagttg
SPL01_0050_C04.b : nttatttnnnnngcttgtgacttnacxxxxxxxx
UTR01_0023_G11.b : tttxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0082_F06.b :
TES01_0037_A11.b :
UTR01_0071_E10.b :
UTR01_0072_E10.b :
20060611C-005957 : .....................GGCGCGCTCG*ATTGCTCGGGTCTGGCGGCGGCAGCATG
---------+---------+---------+---------+---------+---------+ 38
ADR01_0052_A06.b : xxxxxxxxxxxxxxxxxxxxxGGCGCGCTCG*ATTGCTCGGGTCTggcggcggcagcatg
ADR01_0070_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxGCGCTCG*ATTGCTCGGGTCTggcggcggcagcatg
THY01_0022_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxGCGCTCG*ATTGCTCGGGTCTggcggcggcagcatg
MLN01_0091_F11.b : xxxxxxxxxxxxxxxxxxxxxxggGCGCTCG*ATTGCTCGGGTCTggcggcggcagcatg
TCH01_0068_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCGCTCG*ATTGCTCGGGTCTggcggcggcagcatg
TES01_0035_D02.b : ctgttggctCTGGGATTGCTCGGGTCTggcggcggcagcatg
TES01_0042_H04.b : tggctaTGGGATTGCTCGGGTCTggcggcggcagcatg
TES01_0025_H03.b : tgtggctatgggcCG*ATTGCTCGGGTCTggcggcggcagcatg
OVR01_0057_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG*ATTGCTCGGGTCTggcggcggcagcatg
PBL01_0036_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxgggtggG*ATTGCTCGGGTCTggcggcggcagcatg
LVR01_0097_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG*ATTGCTCGGGTCTggcggcggcagcatg
TES01_0011_A05.b : ccgctgtggctctGGGATGCTCGGGTCTggcggcggcagcatg
ITT01_0040_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG*ATTGCTCGGGTCTggcggcggcagcatg
ADR01_0029_E05.b : xxxxxxxxxxxxxxxxxxxggggcctactgGGGGTGCTCGGGTCTggcggcggcagcatg
TCH01_0034_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCTCGGGTCTggcggcggcagcatg
LNG01_0022_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCTCGGGTCTggcggcggcagcatg
OVR01_0040_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCTCGGGTCTggcggcggcagcatg
ADR01_0055_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCTCGGGTCTggcggcggcagcatg
THY01_0097_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCTCGGGTCTggcggcggcagcatg
TCH01_0097_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCGGGTCTggcggcggcagcatg
SKNB1_0003_C01.b : nncctcacgttggcactggattCTCGGGTCTggcggcggcagcatg
TCH01_0039_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGGTCTggcggcggcagcatg
ADR01_0022_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctactggCTggcggcggcagcatg
MLN01_0065_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTggcggcggcagcatg
TES01_0017_H09.b : nacgcgttggctatggAGCATg
OVRM1_0161_E07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATg
SPL01_0050_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATg
UTR01_0023_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATg
PBL01_0082_F06.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATg
TES01_0037_A11.b : cgttggctctggagcTg
UTR01_0071_E10.b :
UTR01_0072_E10.b :
20060611C-005957 : GCGGCGGGGGCGGCCGAGGCGGCGGCGGCTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
---------+---------+---------+---------+---------+---------+ 97
ADR01_0052_A06.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
ADR01_0070_A06.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
THY01_0022_H06.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
MLN01_0091_F11.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TCH01_0068_E11.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TES01_0035_D02.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TES01_0042_H04.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TES01_0025_H03.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
OVR01_0057_E01.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
PBL01_0036_C05.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
LVR01_0097_A08.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TES01_0011_A05.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
ITT01_0040_B07.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
ADR01_0029_E05.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TCH01_0034_A04.b : gcggcgggggcggccgaggcggcggcggctgtggcg*gAGGTCGGCTCCGCCGGGCAGTT
LNG01_0022_B04.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
OVR01_0040_E01.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
ADR01_0055_A01.b : gcggcgggggcggccgagacggcggcggctgcggtg*gAGGTCGGCTCCGCCGGGCAGTT
THY01_0097_A01.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TCH01_0097_H09.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
SKNB1_0003_C01.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TCH01_0039_E07.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
ADR01_0022_C02.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
MLN01_0065_D02.b : gcggcgggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TES01_0017_H09.b : gcggcgggggcggccgaggcggcggcggctgtggtgAGAGGTCGGCTCCGCCGGGCAGTT
OVRM1_0161_E07.b : gcggcgggggcggccgaggcggcggcggctgtggtg*gaggtcggcTCCGCCGGGCAGTT
SPL01_0050_C04.b : gcggcgggggcggccgaggcggcggcggctgtggtg*gaggtcggcTCCGCCGGGCAGTT
UTR01_0023_G11.b : gcggcgggggcggccgaggcggcggcggctgtggtg*gaggtcggcTCCGCCGGGCAGTT
PBL01_0082_F06.b : gcggggggggcggccgaggcggcggcggcTGTGGTG*GAGGTCGGCTCCGCCGGGCAGTT
TES01_0037_A11.b : gcggcgggggcggccgaggcggcggcggctgtggtg*gaggtcggcTCCGCCGGGCAGTT
UTR01_0071_E10.b :
UTR01_0072_E10.b :
20060611C-005957 : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
---------+---------+---------+---------+---------+---------+ 157
ADR01_0052_A06.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
ADR01_0070_A06.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
THY01_0022_H06.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
MLN01_0091_F11.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TCH01_0068_E11.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TES01_0035_D02.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TES01_0042_H04.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TES01_0025_H03.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
OVR01_0057_E01.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
PBL01_0036_C05.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
LVR01_0097_A08.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TES01_0011_A05.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
ITT01_0040_B07.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
ADR01_0029_E05.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TCH01_0034_A04.b : TGAGGAGCTGCTGCGCCTAAGGGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
LNG01_0022_B04.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
OVR01_0040_E01.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
ADR01_0055_A01.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
THY01_0097_A01.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TCH01_0097_H09.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
SKNB1_0003_C01.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TCH01_0039_E07.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
ADR01_0022_C02.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
MLN01_0065_D02.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TES01_0017_H09.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
OVRM1_0161_E07.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
SPL01_0050_C04.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
UTR01_0023_G11.b : TGAGGAGCTGCTGCGCCTCAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
PBL01_0082_F06.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
TES01_0037_A11.b : TGAGGAGCTGCTGCGCCTAAGAGCCAAGTCCCTGCTGGTGGTCCATTTCTGGGCACCATG
UTR01_0071_E10.b :
UTR01_0072_E10.b : cxxxxxxx
20060611C-005957 : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
---------+---------+---------+---------+---------+---------+ 217
ADR01_0052_A06.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
ADR01_0070_A06.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
THY01_0022_H06.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
MLN01_0091_F11.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TCH01_0068_E11.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TES01_0035_D02.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TES01_0042_H04.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TES01_0025_H03.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
OVR01_0057_E01.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
PBL01_0036_C05.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
LVR01_0097_A08.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TES01_0011_A05.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
ITT01_0040_B07.b : GGCCCCACAGTATGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
ADR01_0029_E05.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TCH01_0034_A04.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
LNG01_0022_B04.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
OVR01_0040_E01.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
ADR01_0055_A01.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
THY01_0097_A01.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TCH01_0097_H09.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
SKNB1_0003_C01.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCACA
TCH01_0039_E07.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
ADR01_0022_C02.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
MLN01_0065_D02.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TES01_0017_H09.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
OVRM1_0161_E07.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
SPL01_0050_C04.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
UTR01_0023_G11.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
PBL01_0082_F06.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
TES01_0037_A11.b : GGCCCCACAGTGTGCTCAGATGAACGATGTGATGGCCGAGTTAGCCAAGGAGCACCCGCA
UTR01_0071_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0072_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20060611C-005957 : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
---------+---------+---------+---------+---------+---------+ 277
ADR01_0052_A06.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
ADR01_0070_A06.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
THY01_0022_H06.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
MLN01_0091_F11.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAGAAATACGGAAT
TCH01_0068_E11.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TES01_0035_D02.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TES01_0042_H04.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TES01_0025_H03.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
OVR01_0057_E01.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
PBL01_0036_C05.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
LVR01_0097_A08.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TES01_0011_A05.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
ITT01_0040_B07.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
ADR01_0029_E05.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TCH01_0034_A04.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
LNG01_0022_B04.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
OVR01_0040_E01.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
ADR01_0055_A01.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
THY01_0097_A01.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TCH01_0097_H09.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
SKNB1_0003_C01.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TCH01_0039_E07.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
ADR01_0022_C02.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
MLN01_0065_D02.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TES01_0017_H09.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
OVRM1_0161_E07.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
SPL01_0050_C04.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
UTR01_0023_G11.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
PBL01_0082_F06.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
TES01_0037_A11.b : AGTTTCCTTTGTGAAGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
UTR01_0071_E10.b : nnnnnnnnnnnncggGTTGGAGGCTGAAGNCGTTCCTGAAGTGTNCGAAAAATATGGAAT
UTR01_0072_E10.b : xxxxxxxxxxxxxxxGTTGGAGGCTGAAGCTGTTCCTGAAGTGTCTGAAAAATACGGAAT
20060611C-005957 : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
---------+---------+---------+---------+---------+---------+ 335
ADR01_0052_A06.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
ADR01_0070_A06.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
THY01_0022_H06.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
MLN01_0091_F11.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TCH01_0068_E11.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TES01_0035_D02.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TES01_0042_H04.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TES01_0025_H03.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
OVR01_0057_E01.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
PBL01_0036_C05.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
LVR01_0097_A08.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TES01_0011_A05.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
ITT01_0040_B07.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
ADR01_0029_E05.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TCH01_0034_A04.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
LNG01_0022_B04.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
OVR01_0040_E01.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
ADR01_0055_A01.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
THY01_0097_A01.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TCH01_0097_H09.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
SKNB1_0003_C01.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TCH01_0039_E07.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGGCCGGTTAGAT
ADR01_0022_C02.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
MLN01_0065_D02.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TES01_0017_H09.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
OVRM1_0161_E07.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
SPL01_0050_C04.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
UTR01_0023_G11.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
PBL01_0082_F06.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
TES01_0037_A11.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
UTR01_0071_E10.b : TAGTTCTGTACCCCCCCTTTCTGTTTTTCCAGAATTCCCCGAAGCATTGACCG*TTAGAT
UTR01_0072_E10.b : TAGTTCTGTACCCA*CCTTTCTGTTTTTCAAGAATTCTCAG*AGCATTGACCGGTTAGAT
20060611C-005957 : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
---------+---------+---------+---------+---------+---------+ 394
ADR01_0052_A06.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
ADR01_0070_A06.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
THY01_0022_H06.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
MLN01_0091_F11.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TCH01_0068_E11.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TES01_0035_D02.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TES01_0042_H04.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TES01_0025_H03.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
OVR01_0057_E01.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
PBL01_0036_C05.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
LVR01_0097_A08.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TES01_0011_A05.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
ITT01_0040_B07.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
ADR01_0029_E05.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TCH01_0034_A04.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
LNG01_0022_B04.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
OVR01_0040_E01.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
ADR01_0055_A01.b : GGTGCACATGCCCCAGA*GTTGACCGAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
THY01_0097_A01.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TCH01_0097_H09.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
SKNB1_0003_C01.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TCH01_0039_E07.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
ADR01_0022_C02.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
MLN01_0065_D02.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TES01_0017_H09.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
OVRM1_0161_E07.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
SPL01_0050_C04.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
UTR01_0023_G11.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
PBL01_0082_F06.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
TES01_0037_A11.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
UTR01_0071_E10.b : GGTGTCACTGCCCCCGAAGTTGACCAAAAGGTNTCGGCGACTGGCGTCCGCAGNCTCTTT
UTR01_0072_E10.b : GGTGCACATGCCCCAGA*GTTGACCAAAAAGGTTCAGCGACATGCGTCCAGCAGCTCTTT
20060611C-005957 : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
---------+---------+---------+---------+---------+---------+ 454
ADR01_0052_A06.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
ADR01_0070_A06.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
THY01_0022_H06.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
MLN01_0091_F11.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TCH01_0068_E11.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TES01_0035_D02.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TES01_0042_H04.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TES01_0025_H03.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
OVR01_0057_E01.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
PBL01_0036_C05.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
LVR01_0097_A08.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TES01_0011_A05.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
ITT01_0040_B07.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
ADR01_0029_E05.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TCH01_0034_A04.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
LNG01_0022_B04.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
OVR01_0040_E01.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
ADR01_0055_A01.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
THY01_0097_A01.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TCH01_0097_H09.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
SKNB1_0003_C01.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TCH01_0039_E07.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
ADR01_0022_C02.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
MLN01_0065_D02.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TES01_0017_H09.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
OVRM1_0161_E07.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
SPL01_0050_C04.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
UTR01_0023_G11.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
PBL01_0082_F06.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
TES01_0037_A11.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
UTR01_0071_E10.b : CCC*TCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCANCCTTCGTCTGAAGAAGCTGAC
UTR01_0072_E10.b : CCCATCTGGCGGTAGCGAGCACCTGAAAGAAGACCTCAGCCTTCGCCTGAAGAAGCTGAC
20060611C-005957 : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
---------+---------+---------+---------+---------+---------+ 514
ADR01_0052_A06.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
ADR01_0070_A06.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
THY01_0022_H06.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
MLN01_0091_F11.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TCH01_0068_E11.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TES01_0035_D02.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TES01_0042_H04.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TES01_0025_H03.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
OVR01_0057_E01.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
PBL01_0036_C05.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
LVR01_0097_A08.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TES01_0011_A05.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
ITT01_0040_B07.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
ADR01_0029_E05.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TCH01_0034_A04.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
LNG01_0022_B04.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
OVR01_0040_E01.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
ADR01_0055_A01.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
THY01_0097_A01.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TCH01_0097_H09.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
SKNB1_0003_C01.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TCH01_0039_E07.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
ADR01_0022_C02.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
MLN01_0065_D02.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TES01_0017_H09.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
OVRM1_0161_E07.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
SPL01_0050_C04.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
UTR01_0023_G11.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
PBL01_0082_F06.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
TES01_0037_A11.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
UTR01_0071_E10.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
UTR01_0072_E10.b : CCACGCTGCCCCCTGCATGCTGTTCATGAAGGGAACACCCCAGGAGCCGCGCTGCGGTTT
20060611C-005957 : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
---------+---------+---------+---------+---------+---------+ 573
ADR01_0052_A06.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
ADR01_0070_A06.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
THY01_0022_H06.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
MLN01_0091_F11.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TCH01_0068_E11.b : CAGCAAGCAAATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TES01_0035_D02.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAACAGTTTTGATA
TES01_0042_H04.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TES01_0025_H03.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAATTATCCAGTTTAGCAGTTTTGATA
OVR01_0057_E01.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
PBL01_0036_C05.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
LVR01_0097_A08.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TES01_0011_A05.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
ITT01_0040_B07.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ACCCAGTTTAGCAGTTTTGATA
ADR01_0029_E05.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TCH01_0034_A04.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
LNG01_0022_B04.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
OVR01_0040_E01.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
ADR01_0055_A01.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
THY01_0097_A01.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TCH01_0097_H09.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
SKNB1_0003_C01.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TCH01_0039_E07.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
ADR01_0022_C02.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
MLN01_0065_D02.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TES01_0017_H09.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
OVRM1_0161_E07.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
SPL01_0050_C04.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
UTR01_0023_G11.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
PBL01_0082_F06.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
TES01_0037_A11.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
UTR01_0071_E10.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
UTR01_0072_E10.b : CAGCAAGCAGATGGTGGAAATTCTTAACAAACATAAT*ATCCAGTTTAGCAGTTTTGATA
20060611C-005957 : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
---------+---------+---------+---------+---------+---------+ 633
ADR01_0052_A06.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
ADR01_0070_A06.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
THY01_0022_H06.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
MLN01_0091_F11.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TCH01_0068_E11.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TES01_0035_D02.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TES01_0042_H04.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TES01_0025_H03.b : TCTTCTCAGATGAAAAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
OVR01_0057_E01.b : TCTTCTCAGATGAAGAAGTTCGCCNAGGCCTNCAAACCTATTCCAATTGGCCCACCTACC
PBL01_0036_C05.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTTCAATTTGGCCACCTACC
LVR01_0097_A08.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TES01_0011_A05.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
ITT01_0040_B07.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
ADR01_0029_E05.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TCH01_0034_A04.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
LNG01_0022_B04.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
OVR01_0040_E01.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCANAACCTATTCCAATTGGCCCACCTACC
ADR01_0055_A01.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
THY01_0097_A01.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TCH01_0097_H09.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
SKNB1_0003_C01.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TCH01_0039_E07.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
ADR01_0022_C02.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCNAAACCTATTCCAATTGGCCCACCTACC
MLN01_0065_D02.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATCCCAATTGGCCCACCTACC
TES01_0017_H09.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
OVRM1_0161_E07.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
SPL01_0050_C04.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
UTR01_0023_G11.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
PBL01_0082_F06.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
TES01_0037_A11.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
UTR01_0071_E10.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
UTR01_0072_E10.b : TCTTCTCAGATGAAGAAGTTCGCCAAGGCCTCAAAACCTATTCCAATTGGCCCACCTACC
20060611C-005957 : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
---------+---------+---------+---------+---------+---------+ 690
ADR01_0052_A06.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
ADR01_0070_A06.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
THY01_0022_H06.b : CCCAGCCCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
MLN01_0091_F11.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
TCH01_0068_E11.b : CCCAGCTCTTTGTT*TCTGGAGAGCTCATAGGAGGGACTTGATATA*ATCAAGGACCTAA
TES01_0035_D02.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AAGACTTGATATT*ATCAAGGAGCTAG
TES01_0042_H04.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
TES01_0025_H03.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATATG*AGGACTTGATATT*ATCAAGGATCTAG
OVR01_0057_E01.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGGGAGGACTTGATATA*ATCCAGGAGCTAG
PBL01_0036_C05.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATANG*AAGACTTGATANNTATCANG*AGCTNA
LVR01_0097_A08.b : CTCAGCTCTATGTTTTCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
TES01_0011_A05.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
ITT01_0040_B07.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
ADR01_0029_E05.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
TCH01_0034_A04.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
LNG01_0022_B04.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
OVR01_0040_E01.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
ADR01_0055_A01.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
THY01_0097_A01.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
TCH01_0097_H09.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
SKNB1_0003_C01.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
TCH01_0039_E07.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
ADR01_0022_C02.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATANG*AAGACTTGATATA*ATCAAGGAGCTAG
MLN01_0065_D02.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
TES01_0017_H09.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
OVRM1_0161_E07.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
SPL01_0050_C04.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTTG
UTR01_0023_G11.b : CCCAGCTCTATGCT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
PBL01_0082_F06.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
TES01_0037_A11.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
UTR01_0071_E10.b : CCCAGCTCTATGTT*TCTGGAGAGCTTCTAGG*AGGACTTGATATA*ATCAAGGAGCTAG
UTR01_0072_E10.b : CCCAGCTCTATGTT*TCTGGAGAGCTCATAGG*AGGACTTGATATA*ATCAAGGAGCTAG
20060611C-005957 : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
---------+---------+---------+---------+---------+---------+ 744
ADR01_0052_A06.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
ADR01_0070_A06.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
THY01_0022_H06.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
MLN01_0091_F11.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAATTT*AGAGGAAA*
TCH01_0068_E11.b : AAGCTT*CT*AAAGAACTAAATACCATTTTCC*CCCGAAGCTCCCAAATTAAAAGAAAA*
TES01_0035_D02.b : AAGCCT*CT*AAAGAACTAAATAC*AATTTTG*CCCAAAGCTCCCAAATT*AAAGGAAA*
TES01_0042_H04.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
TES01_0025_H03.b : AAGCAT*CTTAAAGAACTAGATTA*CATTTGC*CCCCAATCTCCCAAATT*ATAGGAAA*
OVR01_0057_E01.b : AAGCCT*CT*AAGGAACTTGATACCATTTGGC*CCCAAAGCTCCCCAATTTAAAGGAAA*
PBL01_0036_C05.b : GAGCAT*CN*TAAGAACTAGATAC*ATTTTGC**CCAAAGCTCCCAAATTANA**GAAA*
LVR01_0097_A08.b : AAGCATTCT*AAAGAACTAGATAC*AATTTGCCCCCAAAGCTCCCAAATTTAGAGGAAA*
TES01_0011_A05.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
ITT01_0040_B07.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
ADR01_0029_E05.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
TCH01_0034_A04.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
LNG01_0022_B04.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
OVR01_0040_E01.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCANAGCTCCCAAATT*AGAGGAAA*
ADR01_0055_A01.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
THY01_0097_A01.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
TCH01_0097_H09.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
SKNB1_0003_C01.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
TCH01_0039_E07.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
ADR01_0022_C02.b : AAGCAT*CT*AAAGAACTAGATAN*CATTTGC*CC*AAAGCTCCCAAATT*ANANGAAA*
MLN01_0065_D02.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
TES01_0017_H09.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
OVRM1_0161_E07.b : AAGCAT*CT*AAAGAACTAGATAC*NATTTGC*CCCAAAGCTCCCAAATTTAGAG*AAA*
SPL01_0050_C04.b : AAGCAT*CT*AAAGAACTAGATACTATTTTGC*CCAAAGGCTCCCAATTT*AGAGGAAAA
UTR01_0023_G11.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
PBL01_0082_F06.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
TES01_0037_A11.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
UTR01_0071_E10.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGT*CCCCAAGCTCCCCAATT*AGAGGAAA*
UTR01_0072_E10.b : AAGCAT*CT*AAAGAACTAGATAC*AATTTGC*CCCAAAGCTCCCAAATT*AGAGGAAA*
20060611C-005957 : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
---------+---------+---------+---------+---------+---------+ 796
ADR01_0052_A06.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
ADR01_0070_A06.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
THY01_0022_H06.b : GGCTCCAAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
MLN01_0091_F11.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
TCH01_0068_E11.b : GGCTC*AAATTACTTGACAAATAAAGCCTTCC*GTGAAGCTCT*TTAATAAGG*GAAAAA
TES01_0035_D02.b : GGCTC*CAAGTTCTGA*CAAATAAACC*TTCT*GTGATGCTCT*TTTTAAAGG*G**AAA
TES01_0042_H04.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
TES01_0025_H03.b : GGCTC*ATAGTATTTG*ACAATAAAGC*TTCT*GTGATGCTCC*TTTATAAAG*G**AAA
OVR01_0057_E01.b : GGgctcaaagttcttgaccaaaaaaagctttccgtggaggctcctttttgaaagggaaaa
PBL01_0036_C05.b : GGCTC*A*AGTACTGA*CAA*TAAAGC*TTCT*GTGATGCTCT*Tatgaaggnaancaac
LVR01_0097_A08.b : GGCTC*AAAGTACTGAACAAATAAAGCCTTCTGGTGATGCTCTTTTATGAAGGGG**AAA
TES01_0011_A05.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
ITT01_0040_B07.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
ADR01_0029_E05.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
TCH01_0034_A04.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**GAA
LNG01_0022_B04.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
OVR01_0040_E01.b : GGCTC*AAAGTACTGA*CAAATAANGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
ADR01_0055_A01.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
THY01_0097_A01.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
TCH01_0097_H09.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
SKNB1_0003_C01.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
TCH01_0039_E07.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
ADR01_0022_C02.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
MLN01_0065_D02.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGGTGCTCT*TTATGAAGG*G**AAA
TES01_0017_H09.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
OVRM1_0161_E07.b : GGCTN*CAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCTn
SPL01_0050_C04.b : GGCTC*AAAGTACTGA*CAAATTAAGC*TTCTGGTGATGCCCT*TTATGAAGG*G**AAA
UTR01_0023_G11.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
PBL01_0082_F06.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
TES01_0037_A11.b : GGCTC*ATAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
UTR01_0071_E10.b : GGCTC*AAAGTACTGA*CAAATAAAGC*CTCT*GTGATGCTCT*TTATGAAGG*G**AAA
UTR01_0072_E10.b : GGCTC*AAAGTACTGA*CAAATAAAGC*TTCT*GTGATGCTCT*TTATGAAGG*G**AAA
20060611C-005957 : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
---------+---------+---------+---------+---------+---------+ 853
ADR01_0052_A06.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAA*TCTAAATAGTAC
ADR01_0070_A06.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCCCTGG*AATTCTAAATAGTAC
THY01_0022_H06.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGAAAAATCCCTGAAAATTCTAAATAGAAC
MLN01_0091_F11.b : C*CAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTTCTAATAGTAC
TCH01_0068_E11.b : C*AAACAGGAAGCCcaaatgttggtttcaccaaaacaattcccggaaaattctaaaaaat
TES01_0035_D02.b : C*AAACAGGAAGCCA*GTGGGG*TTTCCGCAAA*AAATCC*TGGAAATTTCAAATAGAAC
TES01_0042_H04.b : C*AAACAGGAAGCCCAATGTGG*TTTCCACAAACAAATCC*TGGAAATTCTAAATATTAC
TES01_0025_H03.b : C*AAACTTGAATCCCAATGTGGTTTTCATCAAAAAATTCC*TGGAAATTCTAAATAGTAC
OVR01_0057_E01.b : caaacgggaaaccccaagtgggggttttcccccaaaaaaatcccgtgaaaattttaaaaa
PBL01_0036_C05.b : anngagccagtgtggttcagcagacaatctggaaattctaatatactgttgtcacacnaa
LVR01_0097_A08.b : C*AAACAGGA*GCCCAGTGTGG*TTTCAGCAaaacaattccgggaatttcctaaataata
TES01_0011_A05.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
ITT01_0040_B07.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTTCTAATAGTAC
ADR01_0029_E05.b : C*AA*CAGGAAGCCTAGTGTGG*TTTCAGCAGACAAATCC*TGGAATTTCTAA*TAGTAC
TCH01_0034_A04.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
LNG01_0022_B04.b : C*GAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAAATCCTAATAGTAC
OVR01_0040_E01.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGNAAATTCTAAATAGTAC
ADR01_0055_A01.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
THY01_0097_A01.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
TCH01_0097_H09.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGGAATTCTAAATAGTAC
SKNB1_0003_C01.b : C*AAACAGGAAGCCAAGTGTGG*TTTCACCAGAACAATCCCTGGAAATTCTAAATAATAC
TCH01_0039_E07.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGNAAATTCT*AATAGTAC
ADR01_0022_C02.b : C*AAACAGGAAGCCA*GTGTGG*GTTCAGCAAACAAATCT*TGAAAATCCTAA*TAATAC
MLN01_0065_D02.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
TES01_0017_H09.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
OVRM1_0161_E07.b :
SPL01_0050_C04.b : CCAAATGGGAAGCCAAGTGTGGGTTTCACCAAACAAATCCCGGGAAatttctaaaatagt
UTR01_0023_G11.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
PBL01_0082_F06.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTTCTAATAGTAC
TES01_0037_A11.b : C*AAACATGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
UTR01_0071_E10.b : C*AAACCGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
UTR01_0072_E10.b : C*AAACAGGAAGCCAAGTGTGG*TTTCAGCAGACAAATCC*TGGAAATTCTAAATAGTAC
20060611C-005957 : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAGGGGT
---------+---------+---------+---------+---------+---------+ 909
ADR01_0052_A06.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAAGAATGAGAAAG*TCCGCAGGGGT
ADR01_0070_A06.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAGGGGT
THY01_0022_H06.b : TGGGTGTCGACTACGAAAACGTTTCGACATACTGGAAGATGAGGAAGT*CCGGCAGGGGT
MLN01_0091_F11.b : TGG*TGTCGACTACAAGAC**GTTCGACCTTCTGGAGGATGAAGAAGT*CCCGCGGGGGT
TCH01_0068_E11.b : tactgggtgttcaactacaaaaactttcgaaatatcttgaaagaataaaaaaatcccggc
TES01_0035_D02.b : CGT*TGTCGACTACAAAAC**TTTCAACATTATTGAGGATGAAGAAAT*CCCGCGGGGGT
TES01_0042_H04.b : TGG*TGTCCACTACAAGAA**GTTCGACATACTGGAGGATGAAGAAAT*CCCGGCAGGGT
TES01_0025_H03.b : TGG*TGCCAACTACTAGAC**TTTCttaatattgaaagatgtagaatttctgccagggtt
OVR01_0057_E01.b : aaaaacttgggggtcaaatatcaaaaaagttttgaaatttcttggaggaaataaagaaat
PBL01_0036_C05.b : agttcgactactggagaataggaatccgcaggggtgaaaactattccaatgccgactacc
LVR01_0097_A08.b : ctggggtccgacttacaaacgtttgaaattcttgaagggatgaagaagtcccggcagggg
TES01_0011_A05.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAGGGGT
ITT01_0040_B07.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGNNAGATGAGGAAGT*CCGGCAGGGGT
ADR01_0029_E05.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGAATGAGAAGT*CCGGCAGGGGT
TCH01_0034_A04.b : TGG*TGTCGACTACGCGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAAGGGT
LNG01_0022_B04.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAGGGGT
OVR01_0040_E01.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAAGATGAAGAAATCCCGGCGGGGGT
ADR01_0055_A01.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAAGATGAGGAAGT*CCGGCAGGGGT
THY01_0097_A01.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAGGGGT
TCH01_0097_H09.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAAGATGAGGAAGT*CCGGCAGGGGT
SKNB1_0003_C01.b : TGG*TGTCAACTACGAAAC**GTTCCACATACTGGAGGATTAAGAAATTCCCGCAGGGGT
TCH01_0039_E07.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGAATGAGAAGT*CCGGCAGGGGT
ADR01_0022_C02.b : TGT*TGTCGACTACCAAAC***TTCGACATACTGNAAGATGAGGAATT*CC*GCAGGGTT
MLN01_0065_D02.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAAGAAGT*CCGGCA*GGGT
TES01_0017_H09.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAGGGGT
OVRM1_0161_E07.b :
SPL01_0050_C04.b : accgggggtctaactaccaaaaccgtttcgactttctgggaggaattaaggaaattccgg
UTR01_0023_G11.b : T
PBL01_0082_F06.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAGGGGT
TES01_0037_A11.b : TGG*TGTCGACTACCAAAC**GTTCAACATACTGGAGGATGAGGAAGT*CCGGCAAGGGT
UTR01_0071_E10.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGCGCGGGGT
UTR01_0072_E10.b : TGG*TGTCGACTACGAGAC**GTTCGACATACTGGAGGATGAGGAAGT*CCGGCAGGGGT
20060611C-005957 : T*GAAAAC*CTACTCCAACT*GGCCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
---------+---------+---------+---------+---------+---------+ 965
ADR01_0052_A06.b : T*GAANNA*CTACTCCNACT*GGCCGACGTACCCTCANCTGTATGTGAAAGGGGGACT*G
ADR01_0070_A06.b : T*GAAAAC**TACTCNA*CT*GGNCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
THY01_0022_H06.b : T*GAAAAC*CTACTCCAACT*GGCCGACGTACCCTCCGCTTTATGTGAAAGGGGgacttg
MLN01_0091_F11.b : T*GAAAAC*TTACTCCA*CT*GGCCGAACTTCCCTCCGCTGTTTTTTAAAGGGGAACT*G
TCH01_0068_E11.b : agggttttaaaaaccttattccaattgggccaaatttacccccanntttttattaaaaag
TES01_0035_D02.b : T*GAAAAC*CTTCTCCAACT*GGGCGAATTACCCccccctgtttttaaaaagggaactgg
TES01_0042_H04.b : T*GAAAAC*CTACTCaacttggccaagttacctccgctttttgtgaagaggagtttggtc
TES01_0025_H03.b : tgaaaacctactccaactgggccaacttaccctcaccttttttttgaaaggcgacttggt
OVR01_0057_E01.b : ttcgggcggggggtttaaaaaacctttcttccaattggggccaaaaaaacccctctcctt
PBL01_0036_C05.b : tcactttattaaagggaactgtcgagccctgaatgttaggactaaaaaaaagggactctt
LVR01_0097_A08.b : gtaaaaacctcttcccactggccaaattccctccggctgtttgtgaaaaggggaacctgg
TES01_0011_A05.b : T*GAAAAC*TTA*TCAAATT*GGCCGACCTTCCCTCActttatgttaaaagggagctggt
ITT01_0040_B07.b : TTGAAACC*CTACTCCA*CT*GGNCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
ADR01_0029_E05.b : T*GAAA*C*CTACTCCA*CT*GGNCGACGTACCCTCN*CTGTATGTGA*AGGGGAGCT*G
TCH01_0034_A04.b : T*GAAAAC*CTACTCCACCT*GGCCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
LNG01_0022_B04.b : T*GAAAACCCTACTCAAACTGGCCCAACTTAACCTCACCTGTATGTGAAAGGGGAGCTGG
OVR01_0040_E01.b : T*GAAAAC*CTACTCCCACCTGGCCGACTTACCCCCCACTGTTTGTGAAAGGGGAACT*G
ADR01_0055_A01.b : T*GAAA*C*CTACTCCNACT*GGNCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
THY01_0097_A01.b : T*GAAAAC*CTACTCCAACT*GGCCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
TCH01_0097_H09.b : T*GAAAAA*CTACTCCA*CT*GGCCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
SKNB1_0003_C01.b : T*TAAAAacctaatcccaactgggccgaaattacccctcacctgttttttgaaaagggga
TCH01_0039_E07.b : T*GAAAAC*CTACTCCNACT*GGGCGACGTACCCTCAGCTGTATGTGAAAAGGGAGCT*G
ADR01_0022_C02.b : T*GAAAcctattccactggccgactaccttcnctttttttaaagggaacctgtcgaaagc
MLN01_0065_D02.b : T*GAAAAC*CCTATCCAACT*GGCCGACGTACCCTCACCTGTATGTGAAAGGGAACTT*G
TES01_0017_H09.b : T*GGAAAC*CTACTCCAACT*GGCCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
OVRM1_0161_E07.b :
SPL01_0050_C04.b : gcaggggttttgaaataccctacttccaactggggccgaacgttccccttcactcttttt
UTR01_0023_G11.b :
PBL01_0082_F06.b : T*GAAAAC*CTACTCCNACT*GGCCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
TES01_0037_A11.b : T*GAAAAC*CTACTCCAACTGGGCCGACGTACCCTCAACTGTATGTGAAAGGGGAaccgg
UTR01_0071_E10.b : T*GAAAAC*CTACTCCAACTGGCCCGAC*TACCCCTCGCTGTATGTGAAAGGGGAGCT*G
UTR01_0072_E10.b : T*GAAAAC*CTACTCCAACT*GGCCGACGTACCCTCAGCTGTATGTGAAAGGGGAGCT*G
20060611C-005957 : GTCGGAA*GCCTGGATATTGTT*AAGGAACTAAAA*AAAAACGGTGAGCTGCTGCCTATC
---------+---------+---------+---------+---------+---------+ 1022
ADR01_0052_A06.b : GTCNNGA*GCCTGNATAT*GTTN*ANGAACTAAAA*GAAAAcgtgagctgctgcctatct
ADR01_0070_A06.b : GNNTCGA*GCctgnnatatgtnaagaaactaaagaaacggtgagctgctgcctatcctga
THY01_0022_H06.b : gtcggaaggcctggaatatttgttaagggaactaaaaaaaaaaagggggagcttgcttgc
MLN01_0091_F11.b : GTCcgaagccctgattttttttagggacctaaaagaaaacggggggctgctgcctttcct
TCH01_0068_E11.b : ggagaactgngtnaaagacctctcaaatatttttagagaaaacataaaaaaaaaatgtgg
TES01_0035_D02.b : gtcgcaagccccgattttttttaggaactaataaaaaaagggggcctgcgccccttctga
TES01_0042_H04.b : gcagccctgtattttgttagggaactaaaaaaaacggtgagctgcttccctatcttgaaa
TES01_0025_H03.b : cgaatgccttaaaattttttaggaactaaaaaaaaaacgtgggaactgtgtcctttcctt
OVR01_0057_E01.b : tttttttttaaaagggggaacttgttgtccaaagagcttctaatttttttttttggggca
PBL01_0036_C05.b : gcatcggaaggaaactaaccgggggactgtgccactacgcggaagcctcttcctaatgca
LVR01_0097_A08.b : tcggaacccctgaaatttggttaaggaacaaaaaaaaaaaaacggttaagcctttttgcc
TES01_0011_A05.b : cggagcctggatatttgttagggacctaaagaaaacgtgagctgctgcctatcccgaaag
ITT01_0040_B07.b : GTCnngagcctggatatgntnangaaactaaagaaaacgtgagctgctgcctatcctgna
ADR01_0029_E05.b : Ggtcgagcctgnatattgtangaaactaaaaaaacgggagctgctgcctatcctgaagga
TCH01_0034_A04.b : GNTTGGA*GCCTGGATATTGTT**AGGAACTAAAA*GAAAcggtgagctgctgcctttct
LNG01_0022_B04.b : GTCGGAA*GCCTGGATATTGTTTAAGGAACTAAAA*AAAAAaacggtgagcctgctgccc
OVR01_0040_E01.b : GTCGGAAGGCCTGGATTTTTGTTAAGGAACTAAAA*GAAAAacgggggaacttctttggc
ADR01_0055_A01.b : GGgtcgagcctgnnatatgtnangaaactaaagaaaacgtgagctgctgcctatcctgaa
THY01_0097_A01.b : Ggtcgaaggcctgggtatttgtaaggaactaaaaaaaaacgggggagctgccggcctatc
TCH01_0097_H09.b : GTCgaagcctggatatgtttaggactaaaagaaacggtgactgctgcttatctgaaagga
SKNB1_0003_C01.b : acctgggtccggaagttctggaaattttttttagggaacttaaaaaaaaaacggggggag
TCH01_0039_E07.b : GTtggnagcctgnatatgntaaagaactaaagaaaacgtgagctgctgcctatctgaaag
ADR01_0022_C02.b : cggaattttttaagaactaaaaaaaagggaactgctcctatctgaaagaaaaactaatcc
MLN01_0065_D02.b : GTCGgaggcccggatattgtttagggactaaaagaaaacgggggaactgctgcccatcct
TES01_0017_H09.b : GTCGGAG*GCCTGAATATTGTTT*AGGAACTAAAAgttaaccgtgagctgctgcctatcc
OVRM1_0161_E07.b :
SPL01_0050_C04.b : tttgtaaaaagggtaaacttggttctgaaaagccccgcgaattattgtttttatgtgatc
UTR01_0023_G11.b :
PBL01_0082_F06.b : GTCNNGA*GCCTGNNATATGTN**ANGAACTANNA*AGAAACGGTGAGCTGCTGCCTATC
TES01_0037_A11.b : tcggaagcccggatattgtttaaggactaaaaaaaaacggggaagctgctgcctatcctg
UTR01_0071_E10.b : GTCcgaggcctgaatattgttaaggaactaaaagaaaaccgtgagcctgcgcctatcctg
UTR01_0072_E10.b : GTCGGAG*GCCTGGATATTGTT*AAGGAACTAAAAGAAAAACGGTGAGCTGCTGCCTATC
20060611C-005957 : CTGAAAGGAGAAAACTAAATCAGTGGGGG...............................
---------+---------+---------+---------+---------+---------+ 1051
ADR01_0052_A06.b : tgaaggagaaactaatcattgggggaactggtggccccctctgcaggaaggcgtcacttc
ADR01_0070_A06.b : anggagaaactatcagtgggggacttggtgccagctctgcaggagggcgtcactcgctga
THY01_0022_H06.b : cctattcctgaaagggaaaaaaaactaattccggggggggggaactttgggggccccccc
MLN01_0091_F11.b : tgaaggaaaaaattatctcctgggggaacttggttgccccccttcggtaggaagccgctc
TCH01_0068_E11.b : gaactcgttctatatcactgaaaaaaaaaaaaaatattacatagttgt
TES01_0035_D02.b : aaagaaaaaattaatcgtgggggaatttgggccccctcacttcaggaagccctccctccc
TES01_0042_H04.b : ggaaaaaactattcagtgggggaatggggtcccctcttctgcgggaagcctgccccccct
TES01_0025_H03.b : ataaggagtaaaacttatccttgggggaatttggtgtccaacctttgcaggtagccctcc
OVR01_0057_E01.b : cttttaaaaaaaaacgcggggagggcgccctcctctctctctccggaaggaagggaaaaa
PBL01_0036_C05.b : tcccaagggcaagaaagaaagctacccgtactgggtattccagcgctatgacggaggcgg
LVR01_0097_A08.b : tttcccttgaaagggataaaaaatttaaatccggggggggggaattttgttggtcccccc
TES01_0011_A05.b : gaaaaataatcattgggggacttggtgcccacctactgtaggaagccgtcacccccctta
ITT01_0040_B07.b : aagagaaaactatcagtgggggactggttgccgctactgacagaggccgtcactccgcga
ADR01_0029_E05.b : aaactatcatgggggcattggggccagctactgaggaagcgtcctccctgatgacaatcc
TCH01_0034_A04.b : gaaagaaaaaactatccgggggggactggtggccagctactgcagaggcgtcactcgctg
LNG01_0022_B04.b : tatccttgaaaagggaaaaaacttaattccgtggggggaacttgggtgcccccccttact
OVR01_0040_E01.b : ctattcctggaaaggaaaaaactaaaatccctgggggggaccttgggggcccccaccttc
ADR01_0055_A01.b : aagagaaaactatcatggggggacttgttgcccactactgcaggagccgttcactcgcct
THY01_0097_A01.b : ctgaaagggaaaaaaataattcattgggggggacttgggtggccccccttactggcggga
TCH01_0097_H09.b : gaaactatcatgggggactggtgccaactacgcagaggcgtcctcgcttatgacaatcct
SKNB1_0003_C01.b : cttggtgcccatatcccgggaaagggaaaaaaactaatcactggggggggaaatttggtg
TCH01_0039_E07.b : gagaaactatcantgggggacttggtgccagctctgcaagaggcgtcactccgcgagtga
ADR01_0022_C02.b : tggggacttggcccactatcgcaaagccttcctccctaaagacctccctgagtggcaaaa
MLN01_0065_D02.b : ggaaggaagaaaacttatccgtgtggggactgtgtgccccacctactgcaggaggccttc
TES01_0017_H09.b : ggaaggagaaaactaatccgttgggggacttggtgcccagctactgcaggaagccctccc
OVRM1_0161_E07.b :
SPL01_0050_C04.b : ttaaataaaataaacggtttaagtctttctggccccattcctctgttaatagggggaaaa
UTR01_0023_G11.b :
PBL01_0082_F06.b : CTGAAAGGAGAAAACTA**TCAGTGGGGGacttgggcccagctactgcaggaggccgtca
TES01_0037_A11.b : aaagggaaaaacttatccgtggggggaatgggtgcccaccttcggcagaaggcgtccacc
UTR01_0071_E10.b : aaagagaaaactaatccgtgggggaacgggtacccccccaccgccagaggccctcccctc
UTR01_0072_E10.b : CTGAAAGGAGAAAACTAAATCAGTGGGGGgacttggtacccagctactgcaggaaggccg
20060611C-005957 : ............................................................
---------+---------+---------+---------+---------+---------+ 1051
ADR01_0052_A06.b : gctgaatgaccattcctgaaggggccaagaataggaaaacctttccccggtacccgggga
ADR01_0070_A06.b : tgaccatccctgagtggccaggaatagaaatgctatcccgtttacccggggattctcaag
THY01_0022_H06.b : cttttttggcgggggggggcccgctccctcttcccccttaaaagggaacccccattcccc
MLN01_0091_F11.b : cctccctcctaatggacccactcctcaaggtgtgccaagaatatagaaaaatcctttctc
TCH01_0068_E11.b :
TES01_0035_D02.b : cctaatgaaaaacccctatgtgtgccaaaaaataaaaaaaatttacccccgtttccctgg
TES01_0042_H04.b : ttaaggacattccctgaggtggccaagaattagataatttttttcccggtttctctgggt
TES01_0025_H03.b : ttccccttaatgaactctccctaataggtccataaaaataataatatcttttccccgtat
OVR01_0057_E01.b : taattcttttg
PBL01_0036_C05.b : ttccccatgaaacataactcattcataaaaaaaaaaaggcctgtcaccggcgccccaaat
LVR01_0097_A08.b : cctatcttgccaggaaaggccccccaccccttcccccctttaaagaggaacaccccaccc
TES01_0011_A05.b : atgacactccccgaaggggcccaagaataggaaaacttttccccggttaacccggggttt
ITT01_0040_B07.b : atgacaatcctgagntggccaaggatagaaatgctatccccggtaccggggtattctcga
ADR01_0029_E05.b : taaggggccagaaaaggaagcttatcccggttcccgggtattccaggctcccagggaagg
TCH01_0034_A04.b : atgaccgtccctgagggcccaagaataggaaagcttatcccggttacctggggtattccc
LNG01_0022_B04.b : gcacggaaaggcccctcccccccccccttaaattgacccaattccccctctaaagggtgg
OVR01_0040_E01.b : ctggccggggaggggccgtcccccccccccctttaaggtggcccccatcccccccttgga
ADR01_0055_A01.b : gaggaaccattcccgagttgcccaaaaaatagaaaagcttaccccggttaaccgggggat
THY01_0097_A01.b : gggccctccccctcccccctgaagtggcc
TCH01_0097_H09.b : gagtgccaaggatagaaagcttacccggtacccgggtattccagctggcccaggaggatg
SKNB1_0003_C01.b : gtccccccctcccggggagggaggggcccgcccccccccccccgaaaggagaccaactcc
TCH01_0039_E07.b : ccaatcctgaggggccgaaggattagaaatgctatccccgttacccggggaattctccaa
ADR01_0022_C02.b : aaaaaaaacttccccgttacccgggtatttcccagcgcccaagggagaagcaatgtttcc
MLN01_0065_D02.b : ccccccctaaaggacccatcccctgaggtggccaagaaataagaaaatccttttcccccg
TES01_0017_H09.b : tcccctgaatgaccattccccgaaggggcccaagaataggaaaagcctatccccgggtta
OVRM1_0161_E07.b :
SPL01_0050_C04.b : aaatataactcctgtgtggggggacatcttggtgttgccccctaac
UTR01_0023_G11.b :
PBL01_0082_F06.b : ctcgctgagtgacagtcccctgagtgccgaagagtagnaatgcttatccccgntaccctg
TES01_0037_A11.b : tccctgaatgaacaatcccttaggtggccaagaatatggaaataccttatcccggttacc
UTR01_0071_E10.b : ccctaatgaaccgtcccccgagggggcccaggaataagaagatgcctacccccggttaac
UTR01_0072_E10.b : tccctccgctgaatgaccatcccctgaggtggcccaagataaggaaatgcctatccccgg
20060611C-005957 : ............................................................
---------+---------+---------+---------+---------+---------+ 1051
ADR01_0052_A06.b : attttccgggcggccccaatgacggaaacaacgtgttttcccccaaggaaacccataaaa
ADR01_0070_A06.b : gtgccctaggagcggagcaactgttttccccaaggaaccataaaatttcagtcatgaaaa
THY01_0022_H06.b : cctttggaggggggggggcccccaagaggggagagttaaaggggaaaaataatctccttt
MLN01_0091_F11.b : ccggttaccccgggtgttattctcccaggctctg
TCH01_0068_E11.b :
TES01_0035_D02.b : gtgttttccagagggcccataagtgaggaagacaaagtgttttctcccaatggaaaacaa
TES01_0042_H04.b : gttttcccgagctttccctattgagcggagacaactgtttttcctccaaatgtaaataca
TES01_0025_H03.b : accttggtttttttcccgtggctcccctaaattattcatattcccctgtttctcccccat
OVR01_0057_E01.b :
PBL01_0036_C05.b : ccgggcaatacacccttttaaggccaaggaaaaacccgccctttacggggaaactgtttt
LVR01_0097_A08.b : cccccgcggggggggtgggcccctaaaaaagaagaaatatgagaagaaaaataatttttc
TES01_0011_A05.b : ttcccaggcggccctaatggacggaagcgcactgttttccacccaaggaaaacccaaaac
ITT01_0040_B07.b : gctgcctaatgacggatccaggttttcaccnaatgaaaccaaaacttctccgtcattgaa
ADR01_0029_E05.b : agcacggtttccccatgaaaccaaaatcttcgttcttgaaaaaaaaaaaaaaagccttgt
TCH01_0034_A04.b : aggctgccctaatgaccggagcacaggtttcccccattgaaaacctataactcttaagtt
LNG01_0022_B04.b : ggccccaaaagaaaaatataaggaaaaaatatccctttttttcccccccccccgggtttt
OVR01_0040_E01.b : gggggggggccccaaggggaaaataaaggggaaaaaatttgtcctttttttttccccccc
ADR01_0055_A01.b : ttctccgggcgcccccaatgaacgaagccactgttttccccccaaaggaaaccaaaaaaa
THY01_0097_A01.b :
TCH01_0097_H09.b : cacggtttccccaataaaccaaaaatctcagtcatgaaaaaaaaaaaaaagccttggcca
SKNB1_0003_C01.b : ccctgaggggtggccccaagagaaatataaaaaaattcctttattccccggggtgtt
TCH01_0039_E07.b : gctgcccaggtgaacgaatccacgggttcccccaattgaaaccaataactccttcagtct
ADR01_0022_C02.b : cccatgaaaaataaattttcatcttttgnaaaaaaaaaaaaaatacnanntaattaccaa
MLN01_0065_D02.b : gttccctcggtgtttttttcgagggctgcctcaaatggaccggatatcaaggtgtttctc
TES01_0017_H09.b : ccctggggtaatttcccaggccgccctaaatgaacggaaggccacgttgttttctcccca
OVRM1_0161_E07.b :
SPL01_0050_C04.b :
UTR01_0023_G11.b :
PBL01_0082_F06.b : tgtattctccaggctgcctantgaacggagcgactggtttcacccaagagaaccataaac
TES01_0037_A11.b : ctggggatttttctcgaggctgcccttatgtaacggaaaccaacttgctttcccccccaa
UTR01_0071_E10.b : cgggggtatttctcccagccgccccaaatgaaacgaatgccacccgtttttccccccccc
UTR01_0072_E10.b : gttaccctggtgttatttcctcaaggctgccccaaatgaagcggaatcccaactggtttt
20060611C-005957 : ............................................................
---------+---------+---------+---------+---------+---------+ 1051
ADR01_0052_A06.b : tttcccgtttttgtaaaaaaaaaaaaagggccttgtcccacgcggggcggccctttaata
ADR01_0070_A06.b : aaaaaaaaaagccttggtctatgtaggccggcccctaaatccttggggccagtaccaccc
THY01_0022_H06.b : ttttttttttcccct
MLN01_0091_F11.b :
TCH01_0068_E11.b :
TES01_0035_D02.b : ataaactctttcgttctctgtaaaaaaaaaaaaaaaggccctttttttcatatggtgtcg
TES01_0042_H04.b : tatacatccttcatttcaaaaataaataatataataggcccatgttttcctactttttgt
TES01_0025_H03.b : atgtaatacaattcatactttctcctttcttataaaaaataataacaaaagaccactttt
OVR01_0057_E01.b :
PBL01_0036_C05.b : gacctggggtgaccccaaccgaaaattggggcccccggtttttaaaaacatttttaagcc
LVR01_0097_A08.b : ttttttattttcccc
TES01_0011_A05.b : ctttccagtttcttgataaaaaaaaaaaagggcccgttgtctcaactggggtccgggccc
ITT01_0040_B07.b : aaaaaaaaaaaaaaaaaaaaggccatggtctaattgggtccggcctcaaaatccctgggg
ADR01_0029_E05.b : tcactcgtgggccctaaaacccgggcccaacaacccttttaagggccaagagaaaaaaag
TCH01_0034_A04.b : cattaaaaaaaaa
LNG01_0022_B04.b : tttcccccccctttggggggttttttattttat
OVR01_0040_E01.b : cccgcggggttttt
ADR01_0055_A01.b : tcttcgttcattgtaaaaaaaaaaaaaaaaggccctgttcccaactcgggtcggccctta
THY01_0097_A01.b :
TCH01_0097_H09.b : ctgaggcgccccttaaatcctggggcct
SKNB1_0003_C01.b :
TCH01_0039_E07.b : t
ADR01_0022_C02.b : attanaaaaggccttgtctttgggcgccctaatcccggccaataaaactttttaagtcca
MLN01_0065_D02.b : cccaaagaaaaa
TES01_0017_H09.b : atgaaaacccaataaaaactcttcagtttcatttgaaaaaaaaaaaaaaaaaaaaaggcc
OVRM1_0161_E07.b :
SPL01_0050_C04.b :
UTR01_0023_G11.b :
PBL01_0082_F06.b : tcttcagtctttgnnnaaaaaanannnnnnnnnaaaaaaannnnnnnnnnggccatggtc
TES01_0037_A11.b : tgaaaaccatataaactccttcaggttccattgaaaacaataaaaaaggcctttgttctc
UTR01_0071_E10.b : gtgaaaacccccttaaacctctttccagcaattgaaaaaaaaaaaaaaaaaggcccccat
UTR01_0072_E10.b : tcccccccaaatgagaaacccaaaaaaaccttctttcaaaccaatttgaaaaaaaaaaaa
20060611C-005957 : ............................................................
---------+---------+---------+---------+---------+---------+ 1051
ADR01_0052_A06.b : tcctcgggggcc
ADR01_0070_A06.b : cttttaaaggggctat
THY01_0022_H06.b :
MLN01_0091_F11.b :
TCH01_0068_E11.b :
TES01_0035_D02.b : gcccgctaatatttctataaaaacaccccccccccccccgagaaaaaaaaaaaaaatatt
TES01_0042_H04.b : cctgcctcactaattatcttaaataatattctccactactcctcgacgataagaaaataa
TES01_0025_H03.b : ttattattgtcttcagttgtctcttatattattctaataaacacctcctccctctcttta
OVR01_0057_E01.b :
PBL01_0036_C05.b : cccaaaaattatcccagttaaattggcgnnnnnnnnnnnnnnnnnnnnnnnnnatta
LVR01_0097_A08.b :
TES01_0011_A05.b : taattatcttaaaaaaaccccaccccccccgacctaacaaaaaaagaaattgtgtttact
ITT01_0040_B07.b : cacctacccccccttttgtaagagcccaaagggtataaaagagcgcccttttccccggga
ADR01_0029_E05.b : gccctacccgggaaggcggttggaatcttggttgaaaaaaacaaaatagaaaacacccgg
TCH01_0034_A04.b :
LNG01_0022_B04.b :
OVR01_0040_E01.b :
ADR01_0055_A01.b : aaatccccagggggcaacgttcccaccccattttgtaaaaggcccctaaggt
THY01_0097_A01.b :
TCH01_0097_H09.b :
SKNB1_0003_C01.b :
TCH01_0039_E07.b :
ADR01_0022_C02.b : agaaaaaaaacggcctttatcgaggaaacttatttaaacttgggntatcaccataccgaa
MLN01_0065_D02.b :
TES01_0017_H09.b : catttgttctaaacttcgggtccgcgcctcttaacaatcttagaaaaaaac
OVRM1_0161_E07.b :
SPL01_0050_C04.b :
UTR01_0023_G11.b :
PBL01_0082_F06.b : aactgcggccgccctcaaattctggggccacattaccaacctttggtaagggccaaagag
TES01_0037_A11.b : tcatttttagtgtctgcgctttaaatattttcataataaaatctcccacccctctccgtg
UTR01_0071_E10.b : gggccccaagctcnaggttccccgccctccccaaaatactccccccaggggcccccaatc
UTR01_0072_E10.b : aaaaaaaaaaggcccccattggggcccccgaaccttgcaggggccgccgggccccccctt
20060611C-005957 : ............................................................
---------+---------+---------+---------+---------+---------+ 1051
ADR01_0052_A06.b :
ADR01_0070_A06.b :
THY01_0022_H06.b :
MLN01_0091_F11.b :
TCH01_0068_E11.b :
TES01_0035_D02.b : ttggttatttttttta
TES01_0042_H04.b : taggttgt
TES01_0025_H03.b : taggaactaataaa
OVR01_0057_E01.b :
PBL01_0036_C05.b :
LVR01_0097_A08.b :
TES01_0011_A05.b : gtttttccctttagggacacaan
ITT01_0040_B07.b : aaacactgtgttttagaaactttgtgggttttcaacccacattcggaagaatattaaagg
ADR01_0029_E05.b : gggaaaaaaannnnnnnnnnccccaacnttacgattaacctgcgtcc
TCH01_0034_A04.b :
LNG01_0022_B04.b :
OVR01_0040_E01.b :
ADR01_0055_A01.b :
THY01_0097_A01.b :
TCH01_0097_H09.b :
SKNB1_0003_C01.b :
TCH01_0039_E07.b :
ADR01_0022_C02.b : tattggtttcccccgtttttaaaaaa
MLN01_0065_D02.b :
TES01_0017_H09.b :
OVRM1_0161_E07.b :
SPL01_0050_C04.b :
UTR01_0023_G11.b :
PBL01_0082_F06.b : cataaacgacgggcctttaacccgggaaaacctggattttaaacttcttggacgtggacc
TES01_0037_A11.b : aacagaatataaaa
UTR01_0071_E10.b : ttccccgaccccgcctttttttgtgaaaaagggggccccccataggaggcccctatatat
UTR01_0072_E10.b : ccttaaaatatttcccctctcaggggggggccccacaacccttttaacccgccgttaccc
20060611C-005957 : ............................................................
---------+---------+---------+---------+---------+---------+ 1051
ADR01_0052_A06.b :
ADR01_0070_A06.b :
THY01_0022_H06.b :
MLN01_0091_F11.b :
TCH01_0068_E11.b :
TES01_0035_D02.b :
TES01_0042_H04.b :
TES01_0025_H03.b :
OVR01_0057_E01.b :
PBL01_0036_C05.b :
LVR01_0097_A08.b :
TES01_0011_A05.b :
ITT01_0040_B07.b : cctctccggt
ADR01_0029_E05.b :
TCH01_0034_A04.b :
LNG01_0022_B04.b :
OVR01_0040_E01.b :
ADR01_0055_A01.b :
THY01_0097_A01.b :
TCH01_0097_H09.b :
SKNB1_0003_C01.b :
TCH01_0039_E07.b :
ADR01_0022_C02.b :
MLN01_0065_D02.b :
TES01_0017_H09.b :
OVRM1_0161_E07.b :
SPL01_0050_C04.b :
UTR01_0023_G11.b :
PBL01_0082_F06.b : ccaatacccggaatattgtggtgcccccgcgccgttcttataaaaaaccactttgttacc
TES01_0037_A11.b :
UTR01_0071_E10.b : aagcacggg
UTR01_0072_E10.b : ccccccccttttttttttttttgaaaacaaaaaaagggggggctttcccccccttttaat
20060611C-005957 : ............................................................
---------+---------+---------+---------+---------+---------+ 1051
ADR01_0052_A06.b :
ADR01_0070_A06.b :
THY01_0022_H06.b :
MLN01_0091_F11.b :
TCH01_0068_E11.b :
TES01_0035_D02.b :
TES01_0042_H04.b :
TES01_0025_H03.b :
OVR01_0057_E01.b :
PBL01_0036_C05.b :
LVR01_0097_A08.b :
TES01_0011_A05.b :
ITT01_0040_B07.b :
ADR01_0029_E05.b :
TCH01_0034_A04.b :
LNG01_0022_B04.b :
OVR01_0040_E01.b :
ADR01_0055_A01.b :
THY01_0097_A01.b :
TCH01_0097_H09.b :
SKNB1_0003_C01.b :
TCH01_0039_E07.b :
ADR01_0022_C02.b :
MLN01_0065_D02.b :
TES01_0017_H09.b :
OVRM1_0161_E07.b :
SPL01_0050_C04.b :
UTR01_0023_G11.b :
PBL01_0082_F06.b : cctcccccctct
TES01_0037_A11.b :
UTR01_0071_E10.b :
UTR01_0072_E10.b : aagtatgggtggtgg