[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-006502

Length: 2,375

Sequence [FASTA format sequence]
TGAGCTCCCT CGAGGAGGTG GTGAGGCTGG TGAAGCCCAC AGCCATCATA GGTGTTGCCG
CCATCGCAGG AGCCTTCACG GAGCAGATTC TGAGGGACAT GGCCTCCTTC CACGAGCGCC
CTATCATCTT TGCCCTGAGC AACCCCACCA GCAAGGCCGA GTGCACGGCT GAGAAGTGCT
ACCGGGTCAC CGAGGGCCGA GGGATCTTTG CCAGTGGGAG TCCTTTTAAA AGCGTGACCC
TGGAAGATGG CAGGACCTTC ATTCCCGGGC AGGGAAACAA CGCCTACGTG TTCCCCGGAG
TGGCTCTGGG CGTCATCGCT GGCGGGATCC GGCACATCCC AGACGAGATC TTCCTCCTGA
CAGCAGAGCA AATTGCCCAA GAGGTCTCGG AGCAGCATCT GTCACAGGGG AGACTGTACC
CACCGCTCAG CACCATCCGA GACGTGTCTC TGAGAATCGC CATCAAAGTC CTCGACTACG
CGTACAAACA CAACCTGGCC TCCTACTACC CAGAGCCCAA GGACAAGGAG GCTTTTGTAA
GATCCCTGGT CTATACTCCA GACTATGACT CCTTTACGCT GGACAGCTAC ACTTGGCCCA
AGGAAGCCAT GAATGTTCAG AATGTCTGAT GCAATTGCAG AGGTTCATGG GGGGCTGGAT
GAAGCCCAAA GTAACACTGG AACTATAAAT GGGATCCAAA CTGGCCATCC TTGTCATTGT
GTTTTTCCTT TGAACTTTCT GGTATGAAGG GAGATGCCTA GGCATACAGT GGATGACGGC
CTGTCCCTGA AGGCCTTGAA TTCCTTCCCA GGGATTTCTT CATCTGTTTA TTACCAACTA
GACCTGTGGG ACATCTAGAA TCCTGCCTAG AGCTCTGCCT TCACAGAGTC CAGGGTCTAG
AAGAGGAGAT GAGATATGGA CACAGTTCAC TTTGCCACAG GGCAGAAAGT GGTAAGTCTG
TGAAAGAACC GCAGATAAAG GTCACGAGTG CTCAGAGAAG GGAGAGGATA CTTCCTATGA
AGTATATCAT ATGACATAAG AGAGGGCTCC GGGGTGGCGG GGCAGGGCAG TGTTTGTACT
GAGTCCCAAG AGTGAAGGAT GGGTAGGGTT AATGGTAAAA TGAGGAATGT AAGGGCAGCC
ACTGGCCAGA AAGCTTGGCC CACCCATCAG GGAGCTCAGT CCCTGTTAGA GGAAGACAGT
TCCTGCAAGA CCAGACGGGT GTGAGGGCTG AGTGGCTGGA GGCGGCTCAC TAGTCAAAAA
TGGTCACCGT CCTGTGGGTT AAGTACTAGG CATTCCTTTT TGGTTATTAT GAAAAGGAAA
ACTAGGACTT TCCACTGTGG CTCAGTGGTC TACAAATCCA ACTAGCTTTC GTGAGGAGGA
GATTTCAATC CCTGGCTCCA CTTGGGGGGT TAAGGATCCT GCGTTGCTGT GGCTGTGGCA
TAGGGGGGCA TCTATAGCTC TAATTCCATC CCTAGCCTGG GATACTTCCA CATGCCATAG
GTGCGGCCCT AAAAAGAAAA AAAGAAAAAA GGAAAACCAG AGAAATGTTG GTGGGGAGGC
TCAGCAAACC AAGGAGTAGG AAGGAAGAGA GGCCTTGAAG GGAAGAGCAC CCTGGAGAAT
TCTAGGAAAG ACGTGATTTC ATTTCCTGGC TTCGGAACAC TCTCTTCCAC GCTTCACTCT
CTGAACTAAT TCAGCAAACT GGAGCAGTCT TCTTACAGAA TGGCATCAGT CTGTCCTGAG
TGATTCTTAG GCCAAGTTCA GTCATAGCTT CACCTCTCTC ATGTCCGGCA GAGCCCCCAC
ACCATGGGGT GGGGTGGGGG AGACGAGCCT GCGACTCCCA CGATCAAGAT CGCTAAATCG
CTCACATCTA TCAGGATGGC AGCAGCCGAC CTCTCCTCTC ACCCTGTAAC ACAGCAAACA
ATGGTCCATG GTGGACCACT GCCCACCCCT GCTACTCCTC AGCCTCCGGA TCCCACCGCC
CACAATAAAT GGGTCCTCTA TGGCCACCTC TCAGTGACAG GCCGGGTGGA CTGCTGGGCT
CCTAGAAGAG AGTTAGCAGA GACATCAGTC AGCTCTCACC CGGGTCTTGT TCTTCCAACA
TCTGCTTCCT TAGTGCTGGT GCTCAGCCAA GAAAGAACAT CCTGAGAAAA CATCCCTCTT
CTATAATCTG TGGACTCATA GCTAATGAGA ACATCTTCAG AAGAAGGTTT GATGAGTGAA
GCAGGAATCT GAGCACCAGG GAGCCGTTTC CATTACCTTT TCTACATTTT GTCCCACAAC
TTCCTCGGCC CCCCAACTCT GTTATAGGAA AAAAAAAAAA AAAAAAAAAA AAAGGGGGGA
AAAAATCCAT GGAAAATCAA ACCAAGGGGT TTTTT


SNP mapping information
SNP IDRel.Chr.Location (cM)
SNP0010490.91b935.8
SNP0010490.9b935.9


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly Proteinmalic enzyme 3, NADP(+)-dependent, mitochondrial389e-108
Contig/Assembly Proteinmalic enzyme 3, NADP(+)-dependent, mitochondrial389e-108
Contig/Assembly Proteinmalic enzyme 1, NADP(+)-dependent, cytosolic2682e-71
Contig/Assembly Proteinmalic enzyme 2, NAD(+)-dependent, mitochondrial2198e-57


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 13      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ITT010080H04ITT01_0080_H04.bBW983147 
MLN010054A04MLN01_0054_A04.bCJ011844 
MLN010097D03MLN01_0097_D03.bBW963894 
OVRM10052D12OVRM1_0052_D12.bBP149845 
OVRM10106E04OVRM1_0106_E04.bBP150284 
OVRM10129E07OVRM1_0129_E07.bBP150601 AK235962
PBL010010E10PBL01_0010_E10.bBW969125 
PBL010020F04PBL01_0020_F04.bBW969742 AK348765
TCH010027A08TCH01_0027_A08.bCJ024411 
TCH010055F04TCH01_0055_F04.bBW975998 
TCH010075F01TCH01_0075_F01.bCJ027851 AK238286
TCH010096H11TCH01_0096_H11.bCJ029497 
UTR010058B01UTR01_0058_B01.bBP462965 

  

Alignment:      TOP

20060611C-006502 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0096_H11.b : gggttttgcttggcctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0075_F01.b : ntttagcatgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : ......................TGAGCTCCCTCGAGGAGGTGGTGAGGCTGGTGAAGCCC
---------+---------+---------+---------+---------+---------+ 38
TCH01_0096_H11.b : xxxxxxxxxxxxxxxxxxxxxxTGAGCTCCCTCGAGGAGGTGGTGAGGCTGGTGAAGCCC
TCH01_0075_F01.b : xxxxxxxxxxxxxxxxxxxxxxTGAGCTCCCTCGAGGAGGTGGTGAGGCTGGTGAAGCCC
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : ACAGCCATCATAGGTGTTGCCGCCATCGCAGGAGCCTTCACGGAGCAGATTCTGAGGGAC
---------+---------+---------+---------+---------+---------+ 98
TCH01_0096_H11.b : ACAGCCATCATAGGTGTTGCCGCCATCGCAGGAGCCTTCACGGAGCAGATTCTGAGGGAC
TCH01_0075_F01.b : ACAGCCATCATAGGTGTTGCCGCCATCGCAGGAGCCTTCACGGAGCAGATTCTGAGGGAC
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : ATGGCCTCCTTCCACGAGCGCCCTATCATCTTTGCCCTGAGCAACCCCACCAGCAAGGCC
---------+---------+---------+---------+---------+---------+ 158
TCH01_0096_H11.b : ATGGCCTCCTTCCACGAGCGCCCTATCATCTTTGCCCTGAGCAACCCCACCAGCAAGGCC
TCH01_0075_F01.b : ATGGCCTCCTTCCACGAGCGCCCTATCATCTTTGCCCTGAGCAACCCCACCAGCAAGGCC
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : GAGTGCACGGCTGAGAAGTGCTACCGGGTCACCGAGGGCCGAGGGATCTTTGCCAGTGGG
---------+---------+---------+---------+---------+---------+ 218
TCH01_0096_H11.b : GAGTGCACGGCTGAGAAGTGCTACCGGGTCACCGAGGGCCGAGGGATCTTTGCCAGTGGG
TCH01_0075_F01.b : GAGTGCACGGCTGAGAAGTGCTACCGGGTCACCGAGGGCCGAGGGATCTTTGCCAGTGGG
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : AGTCCTTTTAAAAGCGTGACCCTGGAAGATGGCAGGACCTTCATTCCCGGGCAGGGAAAC
---------+---------+---------+---------+---------+---------+ 278
TCH01_0096_H11.b : AGTCCTTTTAAAAGCGTGACCCTGGAAGATGGCAGGACCTTCATTCCCGGGCAGGGAAAC
TCH01_0075_F01.b : AGTCCTTTTAAAAGCGTGACCCTGGAAGATGGCAGGACCTTCATTCCCGGGCAGGGAAAC
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : AACGCCTACGTGTTCCCCGGAGTGGCTCTGGGCGTCATCGCTGGCGGGATCCGGCACATC
---------+---------+---------+---------+---------+---------+ 338
TCH01_0096_H11.b : AACGCCTACGTGTTCCCCGGAGTGGCTCTGGGCGTCATCGCTGGCGGGATCCGGCACATC
TCH01_0075_F01.b : AACGCCTACGTGTTCCCCGGAGTGGCTCTGGGCGTCATCGCTGGCGGGATCCGGCACATC
PBL01_0020_F04.b : gaaagaxxxxxxxxxxxxxx
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : CCAGACGAGATCTTCCTCCTGACAGCAGAGCAAATTGCCCAAGAGGTCTCGGAGCAGCAT
---------+---------+---------+---------+---------+---------+ 398
TCH01_0096_H11.b : CCAGACGAGATCTTCCTCCTGACAGCAGAGCAAATTGCCCAAGAGGTCTCGGAGCAGCAT
TCH01_0075_F01.b : CCAGACGAGATCTTCCTCCTGACAGCAGAGCAAATTGCCCAAGAGGTCTCGGAGCAGCAT
PBL01_0020_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxggtgcttcaggcaatattctccttccagggcc
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : CTGTCACAGGGGAGACTGTACCCACCGCTCAGCACCATCCGAGACGTGTCTCTGAGAATC
---------+---------+---------+---------+---------+---------+ 458
TCH01_0096_H11.b : CTGTCACAGGGGAGACTGTACCCACCGCTCAGCACCATCCGAGACGTGTCTCTGAGAATC
TCH01_0075_F01.b : CTGTCACAGGGGAGACTGTACCCACCGCTCAGCACCATTCGAGACGTGTCTCTGAGAATC
PBL01_0020_F04.b : cccaagcaggggccttgaggcatgttcctccttgggtccaattcctcagtgaaacgtgtt
OVRM1_0129_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxx
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : GCCATCAAAGTCCTCGACTACGCGTACAAACACAACCTGGCCTCCTACTACCCAGAGCCC
---------+---------+---------+---------+---------+---------+ 518
TCH01_0096_H11.b : GCCATCAAAGTCCTCGACTACGCGTACAAACACAACCTGGCCTCCTACTACCCAGAGCCC
TCH01_0075_F01.b : GCCATCAAAGTCCTCGACTACGCGTACAAACACAACCTGGCCTCCTACTACCCAGAGCCC
PBL01_0020_F04.b : tttccctagGTCCTCGACTACGCGTACAAACACATCCTGGCCTCCTACTACCCAGAGCCC
OVRM1_0129_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTGGCCTCCTACTACCCAGAGCCC
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : AAGGACAAGGAGGCTTTTGTAAGATCCCTGGTCTATACTCCAGACTATGACTCCTTTACG
---------+---------+---------+---------+---------+---------+ 578
TCH01_0096_H11.b : AAGGACAAGGAGGCTTTTGTAAGATCCCTGGTCTATACTCCAGACTATGACTCCTTTACG
TCH01_0075_F01.b : AAGGACAAGGAGGCTTTTGTAAGATCCCTGGTCTATACTCCAGACTATGACTCCTTTACG
PBL01_0020_F04.b : AAGGACAAGGACGCTTTTGTAAGATCCCTGGTCTATACTCTAGACTATGACTCCTTTACG
OVRM1_0129_E07.b : AAGGACAAGGAGGCTTTTGTAAGATCCCTGGTCTATACTCCAGACTATGACTCCTTTACG
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : CTGGACAGCTACACTTGGCCCAAGGAAGCCATGAATGTTCAGAATGTCTGATGCAATTGC
---------+---------+---------+---------+---------+---------+ 638
TCH01_0096_H11.b : CTGGACAGCTACACTTGGCCCAAGGAAGCCATGAATGTTCAGAATGTCTGATGCAATTGC
TCH01_0075_F01.b : CTGGACAGCTACACTTGGCCCAAGGAAGCCATGAATGTTCAGAATGTCTGATGCAATTGC
PBL01_0020_F04.b : CTGGACAGCTACACTTGGCCCAAGGAAGCCATGAATGTTCACAATGTCTGATGCACTTGC
OVRM1_0129_E07.b : CTGGACAGCTACACTTGGCCCAAGGAAGCCATGAATGTTCAGAATGTCTGATGCAATTGC
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : AGAGGTTCATGGGGGGCTGGATGAAGCCCAAAGTAACACTGGAACTATAAATGGGATCCA
---------+---------+---------+---------+---------+---------+ 698
TCH01_0096_H11.b : AGAGGTTCATGGGGGGCTGGATGAAGCCCAAAGTAACACTGGAACTATAAATGGGATCCA
TCH01_0075_F01.b : AGAGGTTCATGGGGGGCTGGATGAAGCCCAAAGTAACACTGGAACTATAAATGGGATCCA
PBL01_0020_F04.b : CGAGGTTCATGGGGGGCTGGATGAAGCCCAAAGTAAGACTGGAACTATAAATGGGATCCA
OVRM1_0129_E07.b : AGAGGTTCATGGGGGGCTGGATGAAGCCCAAAGTAACACTGGAACTATAAATGGGATCCA
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : AACTGGCCATCCTTGTCATTGTGTTTTTCCTTTGAACTTTCTGGTATGAAGGGAGATGCC
---------+---------+---------+---------+---------+---------+ 758
TCH01_0096_H11.b : AACTGGCCATCCTTGTCATTGTGTTTTTCCTTTGAACTTTCTGGTATGAAGGGAGATGCC
TCH01_0075_F01.b : AACTGGCCATCCTTGTCATTGTGTTTTTCCTTTGAACTTTCTGGTATGAAGGGAGATGCC
PBL01_0020_F04.b : AACTGGCCATCCTTGTCCTTGTGTTTTTCCTTTGAACTTTCTGGTATGAAGGGAGATGCC
OVRM1_0129_E07.b : AACTGGCCATCCTTGTCATTGTGTTTTTCCTTTGAACTTTCTGGTATGAAGGGAGATGCC
OVRM1_0106_E04.b :
TCH01_0055_F04.b : nnnnggcta
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : TAGGCATACAGTGGATGACGGCCTGTCCCTGAAGGCCTTGAATTCCTTCCCAGGGATTTC
---------+---------+---------+---------+---------+---------+ 818
TCH01_0096_H11.b : TAGGCATACAGTGGATGACGGCCTGTCCCTGAAAGCCTTGAATTCCTTCCCAGGGGATTC
TCH01_0075_F01.b : TAGGCATACAGTGGATGACGGCCTGTCCCTGAAGGCCTTGAATTCCTTCCCAG*GATTTC
PBL01_0020_F04.b : TAGGCATACAGTGGATGACGGCCTGTCCCTGAAGGCCTTGAATTCCTTCCCAGGGATTTC
OVRM1_0129_E07.b : TAGGCATACAGTGGATGACGGCCTGTCCCTGAAGGCCTTGAATTCCTTCCCAGGGATTTC
OVRM1_0106_E04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0055_F04.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0010_E10.b : ngggggtttaanggatacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : TTCATCTGTTTATTACCAACTAGACCTGTGGGACATCTAGAATCCTGCCTAGAGCTCTGC
---------+---------+---------+---------+---------+---------+ 878
TCH01_0096_H11.b : TTCATCTGTTTATTACCAACTAGACCTGTGGGACATCTAGAATCCTGCCTAGAGCTCTGC
TCH01_0075_F01.b : TTCATCTGTTTATTACCAACTANACCTGTGGGACATCTAGAATCCTGCCTAGAGCTCTGC
PBL01_0020_F04.b : TTCAACTGTTTATTACCAACTAGACCTGTGGGACCTCAAGAATCCTGCCTAGAGCTCTGC
OVRM1_0129_E07.b : TTCATCTGTTTATTACCAACTAGACCTGTGGGACATCTAGAATCCTGCCTAGAGCTCTGC
OVRM1_0106_E04.b : xxxxxxxxxxxxTTACCAACTAGACCTGTGGGACATCTAGAATCCTGCCTAGAGCTCTGC
TCH01_0055_F04.b : xxxxxxxxxxxxTTACCAACTAGACCTGTGGGACATCTAGAATCCTGCCTAGAGTTCTGC
PBL01_0010_E10.b : xxxxxxxxxxxxTTACC*ACTAGACCTGTGGGACATCTAGAATCCTGCCTAGAGCTCTGC
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : CTTCACAGAGTCCAGGGTCTAGAAGAGGAGATGAGATATGGACAC*AGTTCACTTTGCCA
---------+---------+---------+---------+---------+---------+ 937
TCH01_0096_H11.b : CTTCCCAGAGTCCAGGGTCTANAAGAGGAGATGAGATTTGGACAC*AGTTCACTTTTGCA
TCH01_0075_F01.b : CTTCACAGAATCCAGGGTCTAGAAGAGGAGATGAGATATGGAC*CCAGTTCACTTTGGCA
PBL01_0020_F04.b : CTTCACAGAGTCTAGGGTCTAGAACAGGAGATGAGATATGGACACCCTTTCACTTTGCCA
OVRM1_0129_E07.b : CTTCACAGAGTCCAGGGTCTAGAAGAGGAGATGAGATATGGACAC*AGTTCACTTTGCCA
OVRM1_0106_E04.b : CTTCACAGAGTCCAGGGTCTAGAAGAGGAGATGAGATATGGACAC*AGTTCACTTTGCCA
TCH01_0055_F04.b : CTTCACAGAGTCCAGGGTCTAGAAGAGGAGATGAGATATGGACAC*AGTTCACTTTGCCA
PBL01_0010_E10.b : CTTCACAGAGTCCAGGGTCTAGAAGAGGAGATGAGATATGGACAC*AGTTCACTTTGCCA
TCH01_0027_A08.b : nnnngggtagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : CA*GGGCAGAAAGTGGTAA*GTCTGTGAAAGAACCGCAGATAAAGGTCACGAGTGCTCAG
---------+---------+---------+---------+---------+---------+ 995
TCH01_0096_H11.b : CAGGGGCAAAAAGGGGTAATC*CTGTGAAAGAAACGCAAATAAAGGTCcgaagtgcccaa
TCH01_0075_F01.b : CA*GGGCAGAAAGTGGTAA*GTCTGTGAAAG*AACCCAAATAA*GGTCACGAGTGCTCca
PBL01_0020_F04.b : CC*GGGCACAAAGTGGTAAAGTCTGTGCAAG*AACCcccataaagggtcacagtgccctc
OVRM1_0129_E07.b : CA*GGGCAGAAAGTGGTAA*GTCTGTGAAAGAACCGCAGATAAAGGTCACGAGTGCTCAG
OVRM1_0106_E04.b : CA*GGGCAGAAAGTGGTAA*GTCTGTGAAAGAACCGCAGATAAAGGTCACGAGTGCTCAG
TCH01_0055_F04.b : CA*GGGCAGAAAGTGGTAA*GTCTGTGAAAGAACCGCAGATAAAGGTCACGAGTGCTCAG
PBL01_0010_E10.b : CA*GGGCAGAAAGTGGTAA*GTCTGTGAAAGAACCGCAGATAAAGGTCACGAGTGCTCAG
TCH01_0027_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACCGCAGATAAAGGTCACGAGTGCTCAG
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : AGAAGGGAGAGGATACTTCCTATGAAGTATATCATATGACATAAGAGAGGGCTCCGGGGT
---------+---------+---------+---------+---------+---------+ 1055
TCH01_0096_H11.b : gaaaggaaaggttttcatatgacttaaaagagggctccggggtggcggggcagccattgg
TCH01_0075_F01.b : aaaaggagaggtatttctatgacataaaaaagggctccggggtgccgggcagggcatgtt
PBL01_0020_F04.b : agaagggacaggatacttcctatgactatatcctctgcacctccatagggctcccgggtg
OVRM1_0129_E07.b : AGAANGGAGAGGATACTTCCTATGAAGTATATCATATGACATAAGAGAGGGCTCCGGGGT
OVRM1_0106_E04.b : AGAAGGGAGAGGATACTTCCTATGAAGTATATCATATGACATAAGAGAGGGCTCCGGGGT
TCH01_0055_F04.b : AGAAGG**************GA*GAGGTATATCATATGACATAAGAGAGGGCTCCGGGGT
PBL01_0010_E10.b : AGAAGGGAGAGGATACTTCCTATGAAGTATATCATATGACATAAGAGAGGGCACCGGGGT
TCH01_0027_A08.b : AGAAGGGAGAGGATACTTCCTATGAAGTATATCATATGACATAAGAGAGGGCTCCGGGGT
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : GGCGGGGCAGGGCAGTGTTTGTACTGAGTCCCAAGAGTGAAGGATGGGTAGGGTTAATGG
---------+---------+---------+---------+---------+---------+ 1115
TCH01_0096_H11.b : ttgtactgattccaaaaattaagaatggtaagggtaagggtaaatggagaaggtaaggcc
TCH01_0075_F01.b : tgtactgatcccaaaatgaaggagggtagggttatggtaaatgaagaattaggggccccc
PBL01_0020_F04.b : gcaaggcaggccaccgtccgaactgaatccccaaaaaggaaggactggtacggtctatgg
OVRM1_0129_E07.b : GGCGGGGCAGGGCAGTGTTTGTACTGAGTCCCCAGAGTGAAGGATGGGTAGGGTTAATGG
OVRM1_0106_E04.b : GGCGGGGCAGGGCAGTGTTTGTACTGAGTCCCAAGAGTGAAGGATGGGTAGGGTTAATGG
TCH01_0055_F04.b : GGCGGGGCAGGGCAGTGTTTGTACTGAGTCCCAAGAGTGAAGGATGGGTAGGGTTAATGG
PBL01_0010_E10.b : GGCGGGGCAGGGCAGTGTTTGTACTGAGTCCCAAGAGTGAAGGATGGGTAGGGTTAATGG
TCH01_0027_A08.b : GGCAGGGCAGGGCAGTGTTTGTACTGAGTCCCAAGAGTGAAGGATGGGTAGGGTTAATGG
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : TAAAATGAGGAATGTAAGGGCAGCCACTGGCCAGAAAGCTTGGCCCACCCATCAGGGAGC
---------+---------+---------+---------+---------+---------+ 1175
TCH01_0096_H11.b : ccccttggccaaaaacctgggcccacccttcaggaacccattccggtttagagaaaaaat
TCH01_0075_F01.b : cgggccaaaagcttgccccccatct
PBL01_0020_F04.b : ccaaacggcggaaggtctgggcaccccctggccagaaaacttggccccccccatccggga
OVRM1_0129_E07.b : TAAAATGANGGATGTAAGGGCAGCCACTGGCCAGA*AGCCTGGCCCCACCATCAAGGAGC
OVRM1_0106_E04.b : TAAAATGAGGAATGTAAGGGCAGCCACTGGCCAGAAAGCTTGGCCCACCCATCAGGGAGC
TCH01_0055_F04.b : TAAAATGAGGAATGTAAGGGCAGCCACTGGCCAGAAAGCTTGGCCCACCCATCAGGGAGC
PBL01_0010_E10.b : TAAAATGAGGAATGTAAGGGCAGCCACTGGCCAGAAAGCTTGGCCCACCCATCAGGGAGC
TCH01_0027_A08.b : TAAAATGAGGAATGTAAGGGCAGCCACTGGCCAGAAAGCTTGGCCCACCCATCAGGGAGC
OVRM1_0052_D12.b : gttgxxxxxxx
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b :
20060611C-006502 : TCAGTCCCTG*TTAGAGGAAGACAGTTCCTGCAAGACCAGACGGGTGTGAGGGCTGAGTG
---------+---------+---------+---------+---------+---------+ 1234
TCH01_0096_H11.b : tcctcgaaaacaaaagggg
TCH01_0075_F01.b :
PBL01_0020_F04.b : gctccctctcctgttataagaagaaccgcttccggcacaccctaacggtctgaaagctta
OVRM1_0129_E07.b : TCA*TCCCTGGTTAGA*GAAGACAGTTCCTGCAAGACCANNACGGTGTGAGGCCTGAATG
OVRM1_0106_E04.b : TCAGTCCCTG*TTAGAGGAAGACAGTTCCTGCAAGACCAGACGGGTGTGAGGGCTGAGTG
TCH01_0055_F04.b : TCAGTCCCTG*TTAGAAGAAGACAGTTCCTGCCAGACCAGACCGGCGTGAGGGCTGAATG
PBL01_0010_E10.b : TCAGTCCCTG*TTAGAGGAAGACAGTTCCTGCAAGACCAGACGGGCGTGAGGGCTGAGTG
TCH01_0027_A08.b : TCAGTCCCTG*TTAGAGGAAGACAGTTCCTGCAAGACCAGACGGGTGTGAGGGCTGAGTG
OVRM1_0052_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGAGGGCTGAGTG
UTR01_0058_B01.b : ttttttttttaggtagcttcgtgxxxxxx
ITT01_0080_H04.b :
MLN01_0054_A04.b : nnnnggct
MLN01_0097_D03.b :
20060611C-006502 : GCTGGAGGCGGCTCACTAGTCAAAAATGGTCACCGTCCTGTGGGTTAAGTACTAGGCATT
---------+---------+---------+---------+---------+---------+ 1294
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b : aaggctccgaacccctcttccttggccaaaaaggccccccgcccccgggggttaatcccc
OVRM1_0129_E07.b : GCTGGAGGCCGCTCACTANTCAAAAATGGTC*CCGTCCTGgtggt
OVRM1_0106_E04.b : GCTGGAGGCGGCTCACTAGTCAAAAATGGTCACCGTCCTGTGGGTTAAGTACTAGGCATT
TCH01_0055_F04.b : GCTGGAGGCGGCTCACTAGTCAAAAATGGTCACCGTCCTGTGGGTTAAGTACTAAGCATT
PBL01_0010_E10.b : GCTGGAGGCGGCTCACTAGTCAAAAATGGTCACCGTCCTGTGGGTTAAGTACTAGGCATT
TCH01_0027_A08.b : GCTGGAGGCGGCTCACTAGTCAAAAATGGTCACCGTCCTGTGGGTTAAGTACTAGGCATT
OVRM1_0052_D12.b : GCTGGAGGCGGCTCACTAGTCAAAAATGGTCACCGTCCTGTGGGTTAAGTACTAGGCATT
UTR01_0058_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0080_H04.b : nnnnggatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0054_A04.b : aggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_D03.b :
20060611C-006502 : CCTTTTTGGTTATTATGAAAAGGAAAACTAGGACTTTCCACTGTGGCTCAGTGGTCTACA
---------+---------+---------+---------+---------+---------+ 1354
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b : caggactctccttttgggtcattacccaacacggaaacttcgggccttcccccggggctc
OVRM1_0129_E07.b :
OVRM1_0106_E04.b : CCTTTTTGGTTATTATGAAAAGGAAAACTAggactttccactgtggctcagtggtctaca
TCH01_0055_F04.b : CCTTTTTGGTTATTATGAAAAGGAAAACTAggactttccactgtggctcagtggtctaca
PBL01_0010_E10.b : CCTTTTTGGTTATTATGAAAAGGAAAACTAggactttccactgtggctcagtggtctaca
TCH01_0027_A08.b : CCTTTTTGGTTATTATGAAAAGGAAAACTAggactttccactgtggctcagtggtctaca
OVRM1_0052_D12.b : CCTTTTTGGTTATTATGAAAAGGAAAACTAggactttccactgtggctcagtggtctaca
UTR01_0058_B01.b : xxxxxxxGGTTATTATGAAAAGGAAAACTAggactttccactgtggctcagtggtctaca
ITT01_0080_H04.b : xxxxxxxxxxTATTATGAAAAGGAAAACTAggactttccactgtggctcagtggtctaca
MLN01_0054_A04.b : xxxxxxxxxxgctgATGAAAAGGAAAACTAggactttccactgtggctcagtggtctaca
MLN01_0097_D03.b :
20060611C-006502 : AATCCAACTAGCTTTCGTGAGGAGGAGATTTCAATCCCTGGCTCCACTTGGGGGGTTAAG
---------+---------+---------+---------+---------+---------+ 1414
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b : cccgggccccccgaaaccacccaagtcttccccgggggggagaactcccctccccgccct
OVRM1_0129_E07.b :
OVRM1_0106_E04.b : aatccaactagctttcgtgaggaggagatttcaatccctggctccacttggggggttaag
TCH01_0055_F04.b : aatccaactagctttcgtgaggaggagatttcaatccctggctccacttggggggttaag
PBL01_0010_E10.b : aatccaactagctttcgtgaggaggagatttcaatccctggctccacttggggggttaag
TCH01_0027_A08.b : aatccaactagctttcgtgaggaggagatttcaatccctggctccacttggggggttaag
OVRM1_0052_D12.b : aatccaactagctttcatgaggaggagatttcaatccctggctccacttggggggttaag
UTR01_0058_B01.b : aatccaactagctttcgtgaggaggagatttcaatccctggctccacttggggggttaag
ITT01_0080_H04.b : aatccaactagctttcgtgaggaggagatttcaatccctggctccacttggggggttaag
MLN01_0054_A04.b : aatccaactagctttcgtgaggaggagatttcaatccctggctccacttggggggttaag
MLN01_0097_D03.b : nnnnggctaggactatnacxxxxxxxxxxxxxx
20060611C-006502 : GATCCTGCGTTGCTGTGGCTGTGGCATAGGGGGGCATCTATAGCTCTAATTCCATCCCTA
---------+---------+---------+---------+---------+---------+ 1474
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b : ccacatgggggggctcacaccactcccccctccaccggctggcccacttgcggggctcct
OVRM1_0129_E07.b :
OVRM1_0106_E04.b : gatcctgcgttgctgtggctgtggcataggggggcatctatagctctaattccatcccta
TCH01_0055_F04.b : gatcctgcgttgctgtggctgtggcataagggggcatctatagctctaattccatcccta
PBL01_0010_E10.b : gatcctgcgttgctgtggctgtggcatacgggggcatctatagctctaattccatcccta
TCH01_0027_A08.b : gatcctgcgttgctgtggctgtggcataggggggcatctatagctctaattccatcccta
OVRM1_0052_D12.b : gatcctgcgttgctgtggctgtggcataggggggcatctatagctctaattccatcccta
UTR01_0058_B01.b : gaccctgcgttgctgtggctgtggcataggggggcatctatagctctaattccatcccta
ITT01_0080_H04.b : gatcctgcgttgctgtggctgtggcataggggggcatctatagctctaattccatcccta
MLN01_0054_A04.b : gatcctgcgttgctgtggctgtggcataggggggcatctatagctctaattccatcccta
MLN01_0097_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttccatcccta
20060611C-006502 : GCCTGGGATACTTCCACATGCCATAGGTGCGGCCCTAAAAAGA*AAAAAAGAAAAAAGGA
---------+---------+---------+---------+---------+---------+ 1533
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b : aaacgctctaatctcccgcaccccccggggcaacttaccctcttcctctgcgtggcgcct
OVRM1_0129_E07.b :
OVRM1_0106_E04.b : gcctgggatacttccacatgccataggtgcgggccctaaaaga*aaaaaagaa*aaaGCG
TCH01_0055_F04.b : gcctgggatacttccacatgccataagtgcggcccttaaaaga*aaaaaagaaaaaagga
PBL01_0010_E10.b : gcctgagatacttccacatgccataggtgcggccctaaaaaga*caaaaagaaaaaagga
TCH01_0027_A08.b : gcctgggatacttccacatgccataggtgcggccctaaaaagaaaaaaaagaaaaaagga
OVRM1_0052_D12.b : gcctgggatacttccacatgccataggtgcggccctaaaaaga*aaaaaagaaaaaagga
UTR01_0058_B01.b : gcctgggatacttccacatgccataggtgcggccctaaaaaga*aaaaaagaaaaaagga
ITT01_0080_H04.b : gcctgggatacttccacatgccataggtgcggccctaaaaagaaaaaaaagaaaaaagga
MLN01_0054_A04.b : gcctgggatacttccacatgccataggtgcggccctaaaaaga*aaaaaagaaaaaagga
MLN01_0097_D03.b : gcctgggatacttccacatgccataggtgcggccctaaaaaga*aaaaaagaaaaaaGGA
20060611C-006502 : AAACCAGAGAAATGTTGGTGGGGAGGCTCAGCAAACCAAGGAGTAGGAAGGAAGAGAGGC
---------+---------+---------+---------+---------+---------+ 1593
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b : ccaaagagaacaaacaacctggcccacccctcttctttggcgtgggcggctccccacaca
OVRM1_0129_E07.b :
OVRM1_0106_E04.b : GAACCAGAGAAATGTTGGTGGGGAGGCTCA*CAAACCAAGGAGTAGGAAGGAAGAGAGGC
TCH01_0055_F04.b : gaaCCCCAGAAATGTTGGTGGGGAGGCTCTTCCAACCCCGGAGTAGGAAGGAAaaaaagg
PBL01_0010_E10.b : aCACCACAGAAATGTTGGTGGGGAGGCTCAGCAAACCAAGGAGTACGAAGGAAGAGAGGC
TCH01_0027_A08.b : aaaCCAGAGAAATGTTGGTGGGGAGGCTCAGCAAACCAAGGAGTAGGAAGGAAGAGAGGC
OVRM1_0052_D12.b : aaaCCAGAGAAATGTTGGTGGGGAGGCTCAGCAAACCAAGGAGTAGGAAGGAAGAGAGGC
UTR01_0058_B01.b : aaaCCAGAGAAATGTTGGTGGGGAGGCTCAGCAAACCAAGGAGTAGGAAGGAAGAGAGGC
ITT01_0080_H04.b : aaaCCAGAGAAATGTTGGTGGGGAGGCTCAGCAAACCAAGGAGTAGGAAGGAAGAGAGGC
MLN01_0054_A04.b : aaaCCAGAGAAATGTTGGTGGGGAGGCTCAGCAAACCAAGGAGTAGGAAGGAAGAGAGGC
MLN01_0097_D03.b : AAACCAGAGAAATGTTGGTGGGGAGGCTCAGCAAACCAAGGAGTAGGAAGGAAGAGAGGC
20060611C-006502 : CTTGAAGGGAAGAGCACCCTGGAGAATTCTAGGAAAGACGTGATTTCATTTCCTGGCTTC
---------+---------+---------+---------+---------+---------+ 1653
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b : accgccttacgctcacaactctctctgggccaacacctccccgcaacttacgcaacaatg
OVRM1_0129_E07.b :
OVRM1_0106_E04.b : C*TGAAGGGAAGAc
TCH01_0055_F04.b : ccttgtaagggaaaagcacccctggagaaatctagggaaagacgcggatttattttcctg
PBL01_0010_E10.b : CTTGTAGGGAAGAGCACCCTGGAGAATTCTAGGAAAGACGTGATTTCATTTCCTGGCTTC
TCH01_0027_A08.b : CTTGAAGGGAAGAGCACCCTGGAGAATTCTAGGAAAGACGTGATTTCATTTCCTGGCTTC
OVRM1_0052_D12.b : CTTGAAGGGAAGAGCACCCTGGAGAATTCTAGGAAAGACGTGATTTCATTTCCTGGCTTC
UTR01_0058_B01.b : CTTGAAGGGAAGAGCACCCTGGAGAATTCTAGGAAAGACGTGATTTCATTTCCTGGCTTC
ITT01_0080_H04.b : CTTGAAGGGAAGAGCACCCTGGAGAATTCTAGGAAAGACGTGATTTCATTTCCTGGCTTC
MLN01_0054_A04.b : CTTGAAGGGAAGAGCACCCTGGAGAATTCTAGGAAAGACGTGATTTCATTTCCTGGCTTC
MLN01_0097_D03.b : CTTGAAGGGAAGAGCACCCTGGAGAATTCTAGGAAAGACGTGATTTCATTTCCTGGCTTC
20060611C-006502 : GGAACACTCTCTTCCACGCTTCACTCTCTGAACTAATTCAGCAAACTGGAGCAGTCTTCT
---------+---------+---------+---------+---------+---------+ 1713
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b : atactctttctccgcgcgttcacccctctcccccccg
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b : ggtttcggaaaactctctttccccgcttttactttcttgaaataattccgcaaaaatggt
PBL01_0010_E10.b : GGAA*ACTCTCTTCCCCGCTTCACTCTCTGAACTAATTCAGCAAACTGGAGCAATCTTCT
TCH01_0027_A08.b : GGAACACTCTCTTCCACGCTTCACTCTCTGAACTAATTCAGCAAACTGGAGCAGTCTTCT
OVRM1_0052_D12.b : GGAACACTCTCTTCCACGCTTCACTCTCTGAACTAATTCAGCAAACCGAAGCAGTCTTCT
UTR01_0058_B01.b : GGAACACTCTCTTCCACGCTTCACTCTCTGAACTAATTCAGCAAACTGGAGCAGTCTTCT
ITT01_0080_H04.b : GGAACACTCTCTTCCACGCTTCACTCTCTGAACTAATTCAGCAAACTGGAGCAGTCTTCT
MLN01_0054_A04.b : GGAACACTCTCTTCCACGCTTCACTCTCTGAACTAATTCAGCAAACTGGAGCAGTCTTCT
MLN01_0097_D03.b : GGAACACTCTCTTCCACGCTTCACTCTCTGAACTAATTCAGCAAACTGGAGCAGTCTTCT
20060611C-006502 : TACAGAATGGCATCAGTCTGTCCTGAGTGATTCTTAGGCCAAGTTCAGTCATAGCTTCAC
---------+---------+---------+---------+---------+---------+ 1773
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b : agcggccttctttttcaaaaaggggaatcccttctgttcccgggtgggattttttagggc
PBL01_0010_E10.b : TACAAAATGGCATCGTTCTGTCCTGAGTGATTCCTAGGCCAGTTTCAGTCATAACTTCCC
TCH01_0027_A08.b : TACAGAATGGCATCAGTCTGTCCTGAGTGATTCTTAAGCCAAGTTCAGTCATAGCTTCAC
OVRM1_0052_D12.b : TACAGAATGGTATCAGTCTGTCCTGAGTGATTCTTAGGCCAAGTTCAGTCATAGCTTCAC
UTR01_0058_B01.b : TACAGAATGGCATCAGTCTGTCCTGAGTGATTCTTAGGCCAAGTTCAGTCATAGCTTCAC
ITT01_0080_H04.b : TACAGAATGGCATCAGTCTGTCCTGAGTGATTCTTAGGCCAAGTTCAGTCATAGCTTCAC
MLN01_0054_A04.b : TACAGAATGGCATCAGTCTGTCCTGAGTGATTCTTAGGCCAAGTTCAGTCATAGCTTCAC
MLN01_0097_D03.b : TACAGAATGGCATCAGTCTGTCCTGAGTGATTCTTAGGCCAAGTTCAGTCATAGCTTCAC
20060611C-006502 : CTCTCTCATGTCCGGCAGAGCCCCCACACCATGGG*GTGGGGTGGGGGAGACGAGCCTGC
---------+---------+---------+---------+---------+---------+ 1832
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b : caaagttcaagcccatagacttcccccccctccccatggtcccgggagaagaccccccca
PBL01_0010_E10.b : TTCTCTCAGGTCCGGCAaaaccccaccccctgggggtggggggggggaaacaaccctcca
TCH01_0027_A08.b : CTCTCTCATGTCCGGCAGAGCCCCCACACCATGGGGGTGGGGTGGGGGgaaacnanncnn
OVRM1_0052_D12.b : CTCTCTCATGTCCGGCAGAGCCCCCACACCATGGG*GTGGGGTGGGGGAGACGAGCCTGC
UTR01_0058_B01.b : CTCTCTCATGTCCGGCAGAGCCCCCACACCATGGG*GTGGGGTGGGGGAGACGAGCCTGC
ITT01_0080_H04.b : CTCTCTCATGTCCGGCAGAGCCCCCACACCATGGG*GTGGGGTGGGGGAGACGAGCCTGC
MLN01_0054_A04.b : CTCTCTCATGTCCGGCAGAGCCCCCACACCATGGG*GTGGGGTGGGGGAGACGAGCCTGC
MLN01_0097_D03.b : CTCTCTCATGTCCGGCAGAGCCCCCACACCATGGG*GTGGGGTGGGGGAGACGAGCCTGC
20060611C-006502 : GACTCCCACGATCAAGATCGCTAAATCGCTCACATCTATCAGGATGGCAGCAGCCGACCT
---------+---------+---------+---------+---------+---------+ 1892
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b : acccacgtggggtggggggggggggggagaaaaaaaaccttttgaaatttccccggaata
PBL01_0010_E10.b : ccccccccatcagatcgctaaatcgctccctctttcgggagggagtggccgacccttctt
TCH01_0027_A08.b : nnancccnanggnnnnaatgngctaaaacgnngganacaaaggggagggcaacaccnaac
OVRM1_0052_D12.b : GACTCCCACGATCAAGATCGCTAAATCGCTCACATCTATCACGATGGCAGCAGCCGACCT
UTR01_0058_B01.b : GACCCCCATGGTCAAGATCGCTAAATCGCTCACATCTATCAGGATGGCAGCAGCCGACCT
ITT01_0080_H04.b : GACTCCCACGATCAAGATCGCTAAATCGCTCACATCTATCAGGATGGCAGCAGCCGACCT
MLN01_0054_A04.b : GACTCCCACGATCAAGATCGCTAAATCGCTCACATCTATCAGGATGGCAGCAGCCGACCT
MLN01_0097_D03.b : GACTCCCACGATCAAGATCGCTAAATCGCTCACATCTATCAGGATGGCAGCAGCCGACCT
20060611C-006502 : CTCCTCTCACC*CTGTAACACAGCAAACAATGGTCCATGGTGGACCACTGCCCACCCCTG
---------+---------+---------+---------+---------+---------+ 1951
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b : aaaaaatagtcctaaaaacccccccccctctttattcagggagtgggggggagagccgaa
PBL01_0010_E10.b : cccccccgaaacacccaaaaaaggggcctggtggaaccagtgccaccccggtaatcccta
TCH01_0027_A08.b : cgtccctttccacacctggaacgaaccaaagatggccctatgtggaagaatggttaagcc
OVRM1_0052_D12.b : CTCCTCTCACCCCTGT*ACACAGCANACAATGGTCCATGGTGGACCACTGCCCACCCCTG
UTR01_0058_B01.b : CTCCTCTCACC*CTGTAACACAGCAAACAATGGTCCATGGTGGACCACTGCCCACCCCTG
ITT01_0080_H04.b : CTCCTCTCACC*CTGTAACACAGCAAACAATGGTCCATGGTGGACCACTGCCCACCCCTG
MLN01_0054_A04.b : CTCCTCTCACC*CTGTAACACAGCAAACAATGGTCCATGGTGGACCACTGCCCACCCCTG
MLN01_0097_D03.b : CTCCTCTCACC*CTGTAACACAGCAAACAATGGTCCATGGTGGACCACTGCCCACCCCTG
20060611C-006502 : CTACTCCTCAGCCTCCGGATCCCACCGCCCACAATAAATGGGTCCTCTATGGCCACCTCT
---------+---------+---------+---------+---------+---------+ 2011
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b : aaatctttccctttttacccctggga
PBL01_0010_E10.b : acctcgggatccagggcccaaataaggggtccctcagggccccccccagggagggccggg
TCH01_0027_A08.b : ctgatagtattaagaaatnagaattacccccnnccaaaaaaaatgggttccccatagggc
OVRM1_0052_D12.b : CTACTCCTCAGCCCTCGGATCCCACCGCCCACAATAAATGGGTCCTCTATGGCCACCTCT
UTR01_0058_B01.b : CTACTCCTCAGCCTCCGGATCCCACCGCCCACAATAAATGGGTCCTCTATGGCCACCTCT
ITT01_0080_H04.b : CTACTCCTCAGCCTCCGGATCCCACCGCCCACAATAAATGGGTCCTCTATGGCCACCTCT
MLN01_0054_A04.b : CTACTCCTCAGCCTCCGGATCCCACCGCCCACAATAAATGGGTCCTCTATGACCACCTCT
MLN01_0097_D03.b : CTACTCCTCAGCCTCCGGATCCCACCGCCCACAATAAATGGGTCCTCTATGGCCACCTCT
20060611C-006502 : CAGTGACAGGCCGGGTGGACTGCTGGGCTCCTAGAAGAGAGTTAGCAGAGACATCAGTCA
---------+---------+---------+---------+---------+---------+ 2071
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b : ggactcgggctccccaaaaaagttgngaaaaaccttcccctcccccggttgggtttccac
TCH01_0027_A08.b : cactttcatagaaaagaccggggggaatgggtggaatccccaaataaagattgtagacaa
OVRM1_0052_D12.b : CAGg
UTR01_0058_B01.b : CAGTGACAGGCCGGGTGGACTGCTGGGCTCCTAGAAGAGAGTTAGCAGAGACATCAGTCA
ITT01_0080_H04.b : CAGTGACAGGCCGGGTGGACTGCTGGGCTCCTAGAAGAGAGTTAGCAGAGACATCAGTCA
MLN01_0054_A04.b : CAGTGACAGGCCGGGTGGACTGCTGGGCTCCTAGAAGAGAGTTAGCAGAGACATCAGTCA
MLN01_0097_D03.b : CAGTGACAGGCCGGGTGGACTGCTGGGCTCCTAGAAGAGAGTTAGCAGAGACATCAGTCA
20060611C-006502 : GCTCTCACCCGGGTCTTGTTCTTCCAACATCTGCTTCCTTAGTGCTGGTGCTCAGCCAAG
---------+---------+---------+---------+---------+---------+ 2131
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b : accgcccccctgaggggggggcgcccaaagaacact
TCH01_0027_A08.b : aacacaggcccct
OVRM1_0052_D12.b :
UTR01_0058_B01.b : CCTCTCACCCGGGTCTTGTTCTTCCAACATCTGCTTCCTTAGTGCTGGTGCTCAGCCAAG
ITT01_0080_H04.b : GCTCTCACCCGGGTCTTGTTCTTCCAACATCTGCTTCCTTAGTGCTGGTGCTCAGCCAAG
MLN01_0054_A04.b : GCTCTCACCCGGGTCTTGTTCTTCCNACATCTGCTTCCTTAGTGCTGGTGCTCAGCCNAG
MLN01_0097_D03.b : GCTCTCACCCGGGTCTTGTTCTTCCAACATCTGCTTCCTTAGTGCTGGTGCTCAGCCAAG
20060611C-006502 : AAAGAACATCC*TGAGAAAACATCCCTCTTCTATAATCTGTGGACTCATAGCTAATGAGA
---------+---------+---------+---------+---------+---------+ 2190
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b : AAAGAACATCC*TGAGAAAACATCCCTCTTCTATAATCTGTGGACTCATAGCTAATGAGA
ITT01_0080_H04.b : AAAGAACATCCCTGAGA*AACATCCCTCTTCTATAATCTGTGGACTCATAGCTAATGAGA
MLN01_0054_A04.b : AAAGAACATCC*TGAGAAAACATCCCTCTTCTATAATCTGTGGACTCATAGCTAATGAGA
MLN01_0097_D03.b : AAAGAACATCC*TGAGAAAACATCCCTCTTCTATAATCTGTGGACTCATAGCTAATGAGA
20060611C-006502 : ACATCTTCAGAAGAAGGTTTGATGAGTGAAGCAGGAATCTGAGCACC*AGGGAGCCGTTT
---------+---------+---------+---------+---------+---------+ 2249
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b : ACATCTTCCAAAGAAAGTTGGATGAATGAAATTGGAATCTGAACCCCAAGGGAGCCGTTT
ITT01_0080_H04.b : ACATCTTCAGAAGAGGTTTTGATGAGTGAAGCAGGAATCTGAGCACC*AGGGAGCCGTTT
MLN01_0054_A04.b : ACATCTTCAGAAGAAGGTTTGATGAGTGAAgcaggaatctgaccaccanggaagcgtttt
MLN01_0097_D03.b : ACATCTTCAGAAGAGGGTTTGATGAGTGAAGCAGGAATCTGAGCACC*AGGGAGCCGTTT
20060611C-006502 : CCATTACCTTTTCTACATTTT*GTCCCACAACTT*CCTCGGCCCCCCAACTC*TGTTATA
---------+---------+---------+---------+---------+---------+ 2306
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b : CCATTACCTTTTTTACCTTTTTGTCCCACAAATTTCCCCGGCCCCCCCACTCCTGTTTTA
ITT01_0080_H04.b : CCATTACCTTTctacattttgtcccacacttcctcggcaccccactctgttataggaaaa
MLN01_0054_A04.b : catttacttttctacattttgtcccaaaacttctcggcacccaaactctgttataggnnn
MLN01_0097_D03.b : CCATTACCTTTTCTACATTTT*GTCCCACAACTT*CCTCGGCAACCCAACTC*TGTTATA
20060611C-006502 : GGAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGAAAAAATCCATGGAAAATCAAACCAAG
---------+---------+---------+---------+---------+---------+ 2366
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b : GGaaaaaaaaaaaaaaaaaaaaaaaaaGGGGGGAAAAAATCCATGGAAAATCAAACCAAG
ITT01_0080_H04.b : aaaaaaaaaaaaaaggcggagaaatccctgaatccaaccagggatttgacagatcattta
MLN01_0054_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0097_D03.b : GGGAAAAAAAAAAAAAAAAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20060611C-006502 : GGGTTTTTT...................................................
---------+---------+---------+---------+---------+---------+ 2375
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b : GGGttttttaaaaaaattcattttaattttaaaaaaacttttgaaccttagttcttaatt
ITT01_0080_H04.b : gttaccaacttgaccttgcaattaggcagaccaaagaaggggaaacaatttcattttctt
MLN01_0054_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0097_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20060611C-006502 : ............................................................
---------+---------+---------+---------+---------+---------+ 2375
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b : taacccaaa
ITT01_0080_H04.b : tgttaaaaaaatgaaaatttgctgggcctaaacatgtattttagggtggggccctaccgg
MLN01_0054_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0097_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20060611C-006502 : ............................................................
---------+---------+---------+---------+---------+---------+ 2375
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b : gttggtccctccggaaatttttcccggccccgcccttaatttaattccccaccttttttg
MLN01_0054_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0097_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20060611C-006502 : ............................................................
---------+---------+---------+---------+---------+---------+ 2375
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b : gagaaaccccccttaattaaagagtggcccaaaaaccccgcagaaaatttttttgttccc
MLN01_0054_A04.b : nnnnnnnnnnnnnnnnnn
MLN01_0097_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20060611C-006502 : ............................................................
---------+---------+---------+---------+---------+---------+ 2375
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b : cggttaa
MLN01_0054_A04.b :
MLN01_0097_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20060611C-006502 : ............................................................
---------+---------+---------+---------+---------+---------+ 2375
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20060611C-006502 : ............................................................
---------+---------+---------+---------+---------+---------+ 2375
TCH01_0096_H11.b :
TCH01_0075_F01.b :
PBL01_0020_F04.b :
OVRM1_0129_E07.b :
OVRM1_0106_E04.b :
TCH01_0055_F04.b :
PBL01_0010_E10.b :
TCH01_0027_A08.b :
OVRM1_0052_D12.b :
UTR01_0058_B01.b :
ITT01_0080_H04.b :
MLN01_0054_A04.b :
MLN01_0097_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn