[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-006582

Length: 1,015

Sequence [FASTA format sequence]
TGGCTATGGG CGGGCGCGTT TCCGCCGTCC GGCCGGGCGA GCGCCGAGTC CCGCGGGCGG
CGCGGAAGCG GCGGCCGGGC AGCCATGTCG CCTTTGTCTG CGGCGCGGGC GGCCCTGCGG
GTCTACGCGG CGGGCGCGGC GGTGATCCTG GCGCAGCTGC TGCGCCGCTG CCGCGGGGGC
TTCGCGGAGC CAGTTTTCCC GCCACAACCC GGGCGCGTTG CCATAGTGAC CGGAGGGACG
GAGGGCATCG GCTTTGCCAC CGCGAAGCAT CTGGCGAGAC TGGGCATGCA CGTGATCATA
GCTGGAAACA ATGACAGCAA AGCCCGGGAA GCGGTGAGGA AGATCCGAGA GGAGACCCTG
AATGACAAAG TGGAGTTTTT ATATTGCGAC CTGGCGTCCA TGAAGTCTAT CCGGCAGTTT
GTCCAGAAGT TCAAGATGAA GAAAATCCCT CTCCACGTCC TGGTCAATAA CGCCGGCGTG
ATGATGGTGC CGCAGAGGGA GACGGAGGAC GGCTTCGAGG AGCACTTTGG AGTGAACTAC
CTGGGCCACT TCCTGCTGAC CCACCTCCTC CTGGACGACC TGCAGGCGTC GGGCTCCCCC
GGCCGCAGCG CCAGGGTGGT GACCGTGTCC TCGGCCACAC ACTACGTTGG GGAGCTGGAC
TTGGACGACC TCCAGAGCAG TGGCGGCTAC TCCCCGCACG GCGCCTACGC CCGCAGCAAG
CTGGCCCTGG TCCTCTTCTC CCACCGGCTG CAGGTGCTGC TGGAGGCCAA GGGCAGCCCA
GTGACCGCCA ACGTGGCCGA CCCCGGCGTG GTCAACACCG ACCTGTACAG ACACGTCTTC
TGGGGCACGC GGCTCCTCAA GAAGCTCTTC GGCTGGTGGT TTTTCCAGAC CCCGGATGAA
GGAGCCTGGA CGTCCGTCTA TGCTGCCGTC TCCCCGGCGC TGGAAGGCGT GGGCGGCCGC
TATCTTTACA CGAGAAGGAG ACCAAGTCAT TGGCGATCAC GTACGACCCG AAGCT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRSXdehydrogenase/reductase (SDR family) X-linked443e-125O
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 (all-trans/9-cis/11-cis)1671e-41O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 (all-trans/9-cis/11-cis)1632e-40O
Contig/Assembly ProteinRDH11retinol dehydrogenase 11 (all-trans/9-cis/11-cis)1511e-36O
Contig/Assembly ProteinWWOXWW domain containing oxidoreductase1441e-34
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 (all-trans/9-cis)1324e-31O
Contig/Assembly ProteinMGC23280hypothetical protein MGC232801071e-23O
Contig/Assembly ProteinLOC388963similar to short-chain dehydrogenase/reductase 171.61e-12
Contig/Assembly ProteinLOC388963similar to short-chain dehydrogenase/reductase 171.61e-12
Contig/Assembly ProteinDHRS2dehydrogenase/reductase (SDR family) member 261.61e-09O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 13      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVRM10074F03LVRM1_0074_F03.bBP139918 
LVRM10187E10LVRM1_0187_E10.bBW963231 AK233613
MLN010008H11MLN01_0008_H11.bCJ008355 
OVRM10170G05OVRM1_0170_G05.bBP460761 AK236270
SPL010070E06SPL01_0070_E06.bCJ019325 
TCH010051E11TCH01_0051_E11.bCJ026263 
TES010005F06TES01_0005_F06.bCJ030340 
TES010016A09TES01_0016_A09.bCJ031054 
TES010016D12TES01_0016_D12.bCJ031078 
TES010081G06TES01_0081_G06.bCJ035244 
TES010082D05TES01_0082_D05.b  AK401008
TES010098E04TES01_0098_E04.bCJ036413 
TES010103C10TES01_0103_C10.bCJ036768 

  

Alignment:      TOP

20060611C-006582 : ..................................TGGCTATGGGCGGGCGCGTTTCCGCC
---------+---------+---------+---------+---------+---------+ 26
TES01_0082_D05.b : TGGCTATGGGCGGGCGCGTTTCCGCC
TES01_0081_G06.b :
LVRM1_0187_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0170_G05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0051_E11.b : tcgggcctaggactatnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0070_E06.b : nnnggctaggactatcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_F03.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0098_E04.b :
TES01_0103_C10.b :
MLN01_0008_H11.b : nnttttgctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0005_F06.b :
TES01_0016_A09.b :
TES01_0016_D12.b :
20060611C-006582 : GTCCGGCCGGGCGAGCGCCGAGTCCCGCGGGCG*GCGCGGAAGCGGCGGCCGGGCAGCCA
---------+---------+---------+---------+---------+---------+ 85
TES01_0082_D05.b : GTCCGGCCGGGCGAGCGCCGAGTCCCGCGGGCGCGCTCGAAAGCGGCGGCCGGGCAGCCA
TES01_0081_G06.b : tgtggctcTGGGT*ccgcgggcg*gcgcgga*gcggcggccgggcAGCCA
LVRM1_0187_E10.b : xxxxxxxxxxxxgagcgccGAGTCCCGCGGGCG*GCGCGGAAGCGGCGGCCGGGCAGCCA
OVRM1_0170_G05.b : xxxxxxxxxxxxxxxxxxxGAGTCCCGCGGGCG*GCGCGGAAGCGGCGGCCGGGCAGCCA
TCH01_0051_E11.b : xxxxxxxxxxxxxxxxxxxGAGTCCCGCGGGCG*GCGCGGAAGCGGCGGCCGGGCAGCCA
SPL01_0070_E06.b : xxxxxxxxxxxxxxxxxxxGAGTCCCGCGGGCG*GCGCGGAAGCGGCGGCCGGGCAGCCA
LVRM1_0074_F03.b : xxxxxxxxxxxxxxxxxxxxxGTCCCGCGGGCG*GCGCGGAAGCGGCGGCCGGGCAGCCA
TES01_0098_E04.b : ntttttcgcgtggctctggGT*CCGCGGGCG*GCGCGGAAGCGGCGGCCGGGCAGCCA
TES01_0103_C10.b : nntttcctgcggtggctatggGTcc*gcgggcg*gcgcgga*gcggcggccgggcAGCCA
MLN01_0008_H11.b : xxxxxxxxxxxxxxxxxxxxxtaCCCGCGGGCG*GCGCGGAAGCGGCGGCCGGGCAGCCA
TES01_0005_F06.b : gcgttggctatgggtCCGCGGAC**GCGCGGAAGCGGCGGCCGGGCAGCCA
TES01_0016_A09.b : nnnnncctgctgtggctatgggAGCGGCGGCCGGGCAGCCA
TES01_0016_D12.b : naattgcggtggctctgggtagctGCGGCCGGGCT*CCA
20060611C-006582 : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
---------+---------+---------+---------+---------+---------+ 144
TES01_0082_D05.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
TES01_0081_G06.b : TGTCGCCCTTGTCTGTGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGCCGGTG
LVRM1_0187_E10.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
OVRM1_0170_G05.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
TCH01_0051_E11.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
SPL01_0070_E06.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
LVRM1_0074_F03.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
TES01_0098_E04.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
TES01_0103_C10.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
MLN01_0008_H11.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
TES01_0005_F06.b : TGTCGCCTTTGTCTGCGGCGCAGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
TES01_0016_A09.b : TGTCGCCTTTGTCTGCGGCGCGGGCGGCCCTG*CGGGTCTACGCGGCGGGCGCGGCGGTG
TES01_0016_D12.b : TGTCGCCTTTGTCTGCGGAGCGGGCGGCCCTGTCGGGTCTACGCGGCGGGCGCGGCGGTG
20060611C-006582 : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
---------+---------+---------+---------+---------+---------+ 204
TES01_0082_D05.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
TES01_0081_G06.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
LVRM1_0187_E10.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
OVRM1_0170_G05.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
TCH01_0051_E11.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
SPL01_0070_E06.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
LVRM1_0074_F03.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
TES01_0098_E04.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
TES01_0103_C10.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
MLN01_0008_H11.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
TES01_0005_F06.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
TES01_0016_A09.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
TES01_0016_D12.b : ATCCTGGCGCAGCTGCTGCGCCGCTGCCGCGGGGGCTTCGCGGAGCCAGTTTTCCCGCCA
20060611C-006582 : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
---------+---------+---------+---------+---------+---------+ 263
TES01_0082_D05.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
TES01_0081_G06.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
LVRM1_0187_E10.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
OVRM1_0170_G05.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
TCH01_0051_E11.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
SPL01_0070_E06.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
LVRM1_0074_F03.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
TES01_0098_E04.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
TES01_0103_C10.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
MLN01_0008_H11.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
TES01_0005_F06.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
TES01_0016_A09.b : CAACCCGGGCGCGTTGCCATA*GTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
TES01_0016_D12.b : CAACCCGGGCGCGTTGCCATATGTGACCGGAGGGACGGAGGGCATCGGCTTTGCCACCGC
20060611C-006582 : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
---------+---------+---------+---------+---------+---------+ 323
TES01_0082_D05.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
TES01_0081_G06.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
LVRM1_0187_E10.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
OVRM1_0170_G05.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
TCH01_0051_E11.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
SPL01_0070_E06.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
LVRM1_0074_F03.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
TES01_0098_E04.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
TES01_0103_C10.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
MLN01_0008_H11.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
TES01_0005_F06.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
TES01_0016_A09.b : GAAGCATCTGGCGAGACTGGGCATGCACGTGATCATAGCTGGAAACAATGACAGCAAAGC
TES01_0016_D12.b : GAATCATCTGGCGAGACTGGGCATGCACGTGGTCATAGCTGGAAACCATGACAGCAAAGC
20060611C-006582 : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
---------+---------+---------+---------+---------+---------+ 383
TES01_0082_D05.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
TES01_0081_G06.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
LVRM1_0187_E10.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
OVRM1_0170_G05.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
TCH01_0051_E11.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
SPL01_0070_E06.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
LVRM1_0074_F03.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
TES01_0098_E04.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
TES01_0103_C10.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
MLN01_0008_H11.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
TES01_0005_F06.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
TES01_0016_A09.b : CCGGGAAGCGGTGAGGAAGATCCGAGAGGAGACCCTGAATGACAAAGTGGAGTTTTTATA
TES01_0016_D12.b : CCGGGAAGCGGTGAGGAAGATCCTAGAGGAGACCCTGAATGACCAAGTGGAGTTTTTATA
20060611C-006582 : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
---------+---------+---------+---------+---------+---------+ 443
TES01_0082_D05.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
TES01_0081_G06.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
LVRM1_0187_E10.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
OVRM1_0170_G05.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
TCH01_0051_E11.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
SPL01_0070_E06.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
LVRM1_0074_F03.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
TES01_0098_E04.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
TES01_0103_C10.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
MLN01_0008_H11.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
TES01_0005_F06.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
TES01_0016_A09.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
TES01_0016_D12.b : TTGCGACCTGGCGTCCATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAA
20060611C-006582 : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
---------+---------+---------+---------+---------+---------+ 503
TES01_0082_D05.b : AATCCCTCTCCACGTCCTGATCAATAACGCCGGCGTGATGATGGTGCCGCATAGGGAGAC
TES01_0081_G06.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTACCGCAGAGGGAGAC
LVRM1_0187_E10.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
OVRM1_0170_G05.b : AATCCCTCTCCACGTCCTGGTCAATAACGCTGGCGTGATGATGGTGCCGCAGAGGGAGAC
TCH01_0051_E11.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
SPL01_0070_E06.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
LVRM1_0074_F03.b : AATCCCTCTCCACGTCCTGGTCAATAACGCTGGCGTGATGATGGTGCCGCAGAGGGAGAC
TES01_0098_E04.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
TES01_0103_C10.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
MLN01_0008_H11.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
TES01_0005_F06.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
TES01_0016_A09.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
TES01_0016_D12.b : AATCCCTCTCCACGTCCTGGTCAATAACGCCGGCGTGATGATGGTGCCGCAGAGGGAGAC
20060611C-006582 : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
---------+---------+---------+---------+---------+---------+ 561
TES01_0082_D05.b : GGATGACGGCTTCTAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
TES01_0081_G06.b : GGAGGACGGCTTCTAGGAGCACTTTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
LVRM1_0187_E10.b : GGACGACGGCTTCTATGAACAC*TTTGGAATGAAATTCCTGGGGCCCTTCCTGGCTGACC
OVRM1_0170_G05.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
TCH01_0051_E11.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
SPL01_0070_E06.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
LVRM1_0074_F03.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
TES01_0098_E04.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
TES01_0103_C10.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
MLN01_0008_H11.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
TES01_0005_F06.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACCACCTGGGCCACTTCCT*GCTGACC
TES01_0016_A09.b : GGAGGACGGCTTCGAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
TES01_0016_D12.b : GGATGACGGCTTCAAGGAGCAC*TTTGGAGTGAACTACCTGGGCCACTTCCT*GCTGACC
20060611C-006582 : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
---------+---------+---------+---------+---------+---------+ 621
TES01_0082_D05.b : CACCTCCTCCTGGACGACCTGCAAGCGTCGGGCTCCCCCGGCCGCAGCGCCATGGTGGTG
TES01_0081_G06.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
LVRM1_0187_E10.b : acctcccccttggaagacccgcaggtatcgggtttccccggcccagcgcctcggtgggcg
OVRM1_0170_G05.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCTCCAGGGTGGTG
TCH01_0051_E11.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
SPL01_0070_E06.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
LVRM1_0074_F03.b : CACCTCCTCCTGGACGACCTGCANGCGTCGGGCTCCCCCGGCCGCAGCTCCAGGGTGGTG
TES01_0098_E04.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
TES01_0103_C10.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
MLN01_0008_H11.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
TES01_0005_F06.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
TES01_0016_A09.b : CACCTCCTCCTGGACGACCTGCAGGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
TES01_0016_D12.b : CACCTCCTCCTGGACGACCTGCAAGCGTCGGGCTCCCCCGGCCGCAGCGCCAGGGTGGTG
20060611C-006582 : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
---------+---------+---------+---------+---------+---------+ 681
TES01_0082_D05.b : ACCGTGTCCTCGG*CACACACTACTTTGGGGAACTGGACTTGGACGATCTCCAAAGCTAT
TES01_0081_G06.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTTGGACAACTCCATAACAGT
LVRM1_0187_E10.b : acgacgtccttggcacgctagaacgttcccccagttgattgcgccatcccgcccacatag
OVRM1_0170_G05.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGC
TCH01_0051_E11.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
SPL01_0070_E06.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
LVRM1_0074_F03.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGC
TES01_0098_E04.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
TES01_0103_C10.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
MLN01_0008_H11.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
TES01_0005_F06.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
TES01_0016_A09.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
TES01_0016_D12.b : ACCGTGTCCTCGGCCACACACTACGTTGGGGAGCTGGACTTGGACGACCTCCAGAGCAGT
20060611C-006582 : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTG*GCCCT*GGTCCTCTTC
---------+---------+---------+---------+---------+---------+ 738
TES01_0082_D05.b : GGCGGCTTACTCCCCGCACGGTGTCTTCCCCCGCATCAAGCTG*GCCCT*GGTCCCCTTC
TES01_0081_G06.b : GGCGGCT*ACTCCCCGCACGGCGCCTACTCCCTGAGTAAGGTGGGCCCT*GGCCCTCTTC
LVRM1_0187_E10.b : tgccgcatcctttattgtctgatcctcccccccgattccgttcgccaagcgactatatac
OVRM1_0170_G05.b : GGCGGCT*ACTCCCCGCACGGCGCCTACACCCGCAGCAAGCTG*GGCCT*GGTCCTCTTC
TCH01_0051_E11.b : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTG*GCCCT*GGTCCTCTTC
SPL01_0070_E06.b : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTG*GCCCT*GGTCCTCTTC
LVRM1_0074_F03.b : GGCGGCT*ACTCCCCGCAGGGGGC*TACACCCGCAGCAAGCTT*GGCCT*GGTCCTCTTC
TES01_0098_E04.b : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTGGGCCCT*GGTCCTCTTC
TES01_0103_C10.b : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTG*GCCCT*GGTCCTCTTC
MLN01_0008_H11.b : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTG*GCCCT*GGTCCTCTTC
TES01_0005_F06.b : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTG*GCCCT*GGTCCTCTTC
TES01_0016_A09.b : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTG*GCCCT*GGTCCTCTTC
TES01_0016_D12.b : GGCGGCT*ACTCCCCGCACGGCGCCTACGCCCGCAGCAAGCTG*GCCCTTGGTCCTCTTC
20060611C-006582 : TCCC*ACCGGCTGCAGGTGC*TGCTGG*AGGCCAAGGGCAGCCC*AGTGACCGCCAACGT
---------+---------+---------+---------+---------+---------+ 794
TES01_0082_D05.b : TCCC*ACCGTCTGCAtggtgctcttggatgcccaagggcactccattgtacgcccaacgt
TES01_0081_G06.b : TCCCCACCGGCTTGCAGTGCTTGCTGGGAGGCCAGGGGCAGCCCcatggaccgcctaacg
LVRM1_0187_E10.b : caccacagtgctcattttttgtggcggacgagggtgtcccctga
OVRM1_0170_G05.b : TCCC*ACCGGCTGCAGGCGC*TGCTGG*AGGCCTAGGGCAGCCCG*GTGACCGCCAACGT
TCH01_0051_E11.b : TCCC*ACCGGCTGCAGGTGC*TGCTGG*ANGCCAAGGGCAGCCC*AGTGACCGCCAACGT
SPL01_0070_E06.b : TCCC*ACCGGCTGCAGGTGC*TGCTGG*AGGCCAAGGGCAGCCCCAGTGACCGCCAACGT
LVRM1_0074_F03.b : TCCC*ACCGGCTGCAAGCGC*TGCTGG*AGGCCAgggccacccgt
TES01_0098_E04.b : TCCC*ACCCGCTGCAGGTGC*TGCTGGAGGCCCAAGGGCAGCCC*ATTGACCGCCAACGT
TES01_0103_C10.b : TCCC*ACCGGCTGCAGGTGC*TGCTGG*AGGCCAAGGGCAGCCC*AGTGACCGCCTACGT
MLN01_0008_H11.b : TCCC*ACCGGCTGCAGGTGC*TGCTGG*AGGCCAAGGGCAGCCC*AGTGACCGCCAACGT
TES01_0005_F06.b : TCCC*ACCGGCTGCAGGTGC*TGCTGG*AGGCCAAGGGCAGCCC*AGTGACCGCCAACGT
TES01_0016_A09.b : TCCC*ACCGGCTGCAGGTGC*TGCTGG*AGGCCAAGGGCAGCCC*AGTGACCGCCAACGT
TES01_0016_D12.b : TCCC*ACCGGCTGCAGGTGC*TGCTGG*AGGCCAAGGGCAGCCC*AGTGACCGCCAACGT
20060611C-006582 : GGCCGACCCCGGCGTGGTCAACACCGACCTGTACAGACACGTCTTCTGGGGCACGCGGCT
---------+---------+---------+---------+---------+---------+ 854
TES01_0082_D05.b : ggcccgaacccggcgtgggctataaccgacctggttcaaaacccgtctttctgggggaaa
TES01_0081_G06.b : tggccgaacccgggggtgggtaatcacgaacttgtaataaacccgttttctgggggaacc
LVRM1_0187_E10.b :
OVRM1_0170_G05.b : GGCCGAACCCGGC
TCH01_0051_E11.b : GGCCGACCCCGGCGTGGTCAACACCGACCTGTACAGACACGTCTTCTGGGGCACGCGGCT
SPL01_0070_E06.b : GGCCGACCCCGGCGTGGTCAACACCGACCTGTACAGACACGTCTTCTGGGGCACGCGGCT
LVRM1_0074_F03.b :
TES01_0098_E04.b : GGCCGAACCCGGCGTGGTCAACACCGACCTGTACAGACACGTCTTCTGGGGCACGCGGCT
TES01_0103_C10.b : GGCCGACCCCGGCGTGGTCAACACCGACCTGTACAGACACGTCTTCTGGGGCACGCGGCT
MLN01_0008_H11.b : GGTCGACCCCGGCGTGGTCAACACCGACCTGTACAGACACGTCTTCTGGGGCACGCGGCT
TES01_0005_F06.b : GGCCGACCCCGGCGTGGTCAACACCGACCTGTACAGACACGTCTTCTGGGGCACGCGGCT
TES01_0016_A09.b : GGCCGACCCCGGCGTGGTCAACACCGACCTGTACAGACACGTCTTCTGGGGCACGCGGCT
TES01_0016_D12.b : GGCCGACCCCGGCGTGGTCAACACCGACCTGTACAGACACCTCTTCTGGGGCACGCGGCT
20060611C-006582 : CCTCAAGAAGCTCTT*CGGC*TGGT**GGTTTTTCCAGACCCCGG*ATGAAGGAGCCTG*
---------+---------+---------+---------+---------+---------+ 908
TES01_0082_D05.b : ccggcttcctctagaaacttcttccggcggggggttttttcaaaaaccccggatgaaggg
TES01_0081_G06.b : cgggctcccaaaaagcctttcgggcggggggtttttccaaacccccgaataatggagcct
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b : CCTCAAGAAGCTCTT*CGGC*TGGT**GGTTTTTCAAGACCCCGG*ATGAAAGAGCCTG*
SPL01_0070_E06.b : CCTCAAGAAGCTCTT*CGGC*TGGT**GGTTTTTCA*GACCCCCG*ATGAAAGAGCCCG*
LVRM1_0074_F03.b :
TES01_0098_E04.b : CCTCAAGAAGCTCTT*CGGC*TGGGTGGGTTTTTCA*GAACCCCG*Aatgaaggaaccgg
TES01_0103_C10.b : CCTCAAGAAGCTCTT*CGGCCTGGT**GGTTTTTCAAGACCCCCGGATGAAGGAACCCGG
MLN01_0008_H11.b : CCCTCAGAAGCTCTT*CGGC*TGGT**GGTTTTTTCAGACCCCGG*ATGAAGGAGCCTG*
TES01_0005_F06.b : CCTCCAGAAACTCTTTCGGC*TGGT**GGTTTTTCAAGACCCCGG*ATGAAGGAGCCTGG
TES01_0016_A09.b : CCTCAAGAAGCTCTT*CGGC*TGGT**GGTTTTTTCAGACCCTGG*ATGAAGGAGCCTG*
TES01_0016_D12.b : CCTCCAGAAGCTCTT*CCGC*TGGT**GGTTTTTCCAGACCCCGG*ATGAAGGAGCCTG*
20060611C-006582 : GACGTCCGTCTATGCTGCCGTCTCCCCGGCGCTGGAAGGCGTGGGCGGCCGCTATCTTTA
---------+---------+---------+---------+---------+---------+ 968
TES01_0082_D05.b : aacctggtaatatccgtttatttctgctcttcccccccggccttggtaagggtggggcag
TES01_0081_G06.b : gggaaaccccgtctatggtggccctatccccggatctttgaaagggcgggggtggcccct
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b : GACGTCCGTCTATGCTGccgtctccccggcgctggaaggcgtgggcggccgcatctttta
SPL01_0070_E06.b : GACGTCCGTCTATGCTGcccgtctccccggcgctggaaaggcttgggccggcccctatct
LVRM1_0074_F03.b :
TES01_0098_E04.b : gaacgcccgtctaagctgccgtctcccgggccctggaaaggctggggcggccccctttct
TES01_0103_C10.b : GACTTCCGTCTATGCTGccgtctccccaggcgctggaaggggtgggcggcccccatcttt
MLN01_0008_H11.b : GACGTCTGTCTATGCTGCCGTCTCCCCGGCGCTGGAAGGCGTGGGCGGCCGCTATCTTTA
TES01_0005_F06.b : AACGTCCGTCTATGCTGccgtctccctcgtcctgtgaaagcgtggggcggccgctttctt
TES01_0016_A09.b : GACGTCCGTCTATGCTGCCGTCTCCCCGGCGCTGGAAGGCGTGGGCGGCCGCTATCTTTA
TES01_0016_D12.b : GACGTCCGTCTATGCTGGCCTCCCCCCGGCGCctgaaagcctgggcgggccctttccttt
20060611C-006582 : CACGAGAAGGAGACCAAGTCATTGGCGATCACGTACGACCCGAAGCT.............
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b : gtcctcaatctttaaaatagtaaagggaaacaaatccttttggtgaatccctatccaacc
TES01_0081_G06.b : ttttttttataaagataagggaatcctatttctttggggaaatttcgtaaaaacccataa
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b : aacgagaaggaaaccaagtcatttggcgatacgtacgaaccgaaactttaccgacggctg
SPL01_0070_E06.b : ttacaccgagaagggagacccattcctttggcgatcccgtacgaccccaaaactttcacc
LVRM1_0074_F03.b :
TES01_0098_E04.b : tttccacgaaaagggaaaccaattcattggcaattccgtaccaacccaaaactttcccaa
TES01_0103_C10.b : tccaccagaaagaaaaccagtcattgggggatcacgtacaacccgaaactttcaccaaag
MLN01_0008_H11.b : CAacgaggaggaaggccagtccctgccgatcacgtacgacccgagcttcagcgacagctg
TES01_0005_F06.b : ttcaatctagaaggaagactagtccattggcgattacgttactaccccaaactttcaccg
TES01_0016_A09.b : CACGAGAAGGAGACCAAGTCATTGGCGATCACGTACGACCCGAAGCTtcagcgacagctg
TES01_0016_D12.b : tccaccagaacgagacccaatcattggcgaatcccttacaaccgaaacttctccgacagt
20060611C-006582 : ............................................................
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b : ctattttttctctaatatcttggggctcgtaaatttcactaaaaacctgtccatcacaaa
TES01_0081_G06.b : tctttccctaaattttgggggcccccgaatttccccaaaataatctatattccccaaaat
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b : tgggccggaattgcccaatgaccggcatccccaaattgaccagaacacctttggggatag
SPL01_0070_E06.b : gaccggctgttgggcccggaagtttcccagatgaaccggccatcccccaacattaacc
LVRM1_0074_F03.b :
TES01_0098_E04.b : aagcttggggccccgaatttccaaaagacccggattcccacaatgaacccaaaaaccttt
TES01_0103_C10.b : ctgtggggcccggaattgccaaaatgaccggcattccccaaatggacccaggaacacctt
MLN01_0008_H11.b : ttggcccggatttgccaatgaccgcatccctgactgacccggaaacttgtgggggatagc
TES01_0005_F06.b : aaagctgtggggccccggattttcccaaatgaacgggcatcccccaactgtacccatgaa
TES01_0016_A09.b : tgggcccggagttgccagatgaccggcatcgcccacatgacccggaaaccttgtggggat
TES01_0016_D12.b : tgtgggcccggagttgcccaatacccggatcgtcaactgaacccagaaaccttgtgggga
20060611C-006582 : ............................................................
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b : atatactccctaaaacctttggctggtgttaacgcctagactcgggaagaaattttactg
TES01_0081_G06.b : ttacccctaaaaaccctttggggggagaatggcctccagcctgggagggaaaatcatttg
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b : cggccagcccggaggaacccgttggccaaccctcccaggtcgttttgtctggaaagccct
SPL01_0070_E06.b :
LVRM1_0074_F03.b :
TES01_0098_E04.b : gggggaaaaccggccaacccggggaaaaccttttggcccaacctttccaggggcgttctt
TES01_0103_C10.b : ggggggaaagcggccacagccgggaaggaacgcttcggccaaacacctcaaaggggcgtt
MLN01_0008_H11.b : gccacccgggaggacccgtcggccacccctgcaggtgctttggcctgacgcccccttgtt
TES01_0005_F06.b : cctccttttggggaataatagcgcctggtccggggatggacaccctttcgggcccatcct
TES01_0016_A09.b : agcggccaggccgggaggaccgcgtcgcccaacgctcgcaggggcgtctgctctggaaag
TES01_0016_D12.b : aagggtccagtccggaagaccccgtccgcccaacctctccaggtcgttcgcctggaaacg
20060611C-006582 : ............................................................
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b : atccgtccttattattgtgtacatttcttggtactggctctttgtttttattcgcgctgt
TES01_0081_G06.b : gccactaattctctaaggggtggtctttctatttggataaagtccccttggaactttttc
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b : tttgttctttcccccgcgccttgaattggtcgggcccattcccccccccttcggtggctt
SPL01_0070_E06.b :
LVRM1_0074_F03.b :
TES01_0098_E04.b : ttttagaaaggccctttgggtttttcccgcccggcccccaaaaaggggggggccaatttc
TES01_0103_C10.b : tggctctggaagggcctttgtgttctttccgccgggcctcctgaaaagggttgggtccaa
MLN01_0008_H11.b : cttccgcggggctcaaaagtgtgggcccatttccccggtgttcctggcttttaagaataa
TES01_0005_F06.b : ttttcaagggtgctttttggcttttggaaacgcggccctttgggtttcttttccggcacg
TES01_0016_A09.b : cgcctctgggtccttccgccgggcctcaaaaagtggtgggtcgcatttcccccccctgcc
TES01_0016_D12.b : cgcccttggttccttccccccccccctcaaaatgagtctgttccaaatcccccaccccct
20060611C-006582 : ............................................................
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b : gcccccttaatagttatacatatattcatcacacccctattctttgagtcttttcttgat
TES01_0081_G06.b : tccctgccgctacataataattttggtaggcacatttctccaccacacacagggtggctt
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b : ttgtggaaataaaaacaaaacggcctttaattggt
SPL01_0070_E06.b :
LVRM1_0074_F03.b :
TES01_0098_E04.b : ccccccccggggggggctttttagaaaagaaaaaaaaaaaggcggggtgaaggggcccta
TES01_0103_C10.b : attccccgccccggcccgggtcttttggggaatgtaaaaaaccaaaggggctgttagtgt
MLN01_0008_H11.b : aaacaaggcgggttattgccctaacctggtcccccccaattgcgatccaagataagggcg
TES01_0005_F06.b : gctcctttcataaaagggtgatggtgacccatatttatctccaccactcttggtgagtgg
TES01_0016_A09.b : ggggctttttgggaattaaaaaaaaagcggcggaatggggccctgaccctggcctccccc
TES01_0016_D12.b : tcccgggcctttttcggaaagtgaaaaacctagcgcgtgtgtgaagtgtgtccctaaccc
20060611C-006582 : ............................................................
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b : aattaaaaacatattagtcccgataagatttcctatatnaacctgtacctactcctctat
TES01_0081_G06.b : ttttgttgtgtgtataaaacatcttgagcgtctgttgtatggggactctgaatatattgt
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b :
SPL01_0070_E06.b :
LVRM1_0074_F03.b :
TES01_0098_E04.b : acctctggcctcccccccaatttgttgtttccacaagataacagggcggggggcccccta
TES01_0103_C10.b : gggccctaaacttcgggccctctcccccaattgtcggattctaaaagaaattaggggccg
MLN01_0008_H11.b : ggtctgtttttatctcccccaaaaaaaaagcaaattccctgggggcccctatatccgggg
TES01_0005_F06.b : ctccttttctaaaaaaatatgaata
TES01_0016_A09.b : ccaattctgtttccaaagaaaaagggccgggcgctcgctttaactcctccccccgaaaaa
TES01_0016_D12.b : ttgggcctctcgcccccaatttcttaattccccagagatctacggggccgggggccctgg
20060611C-006582 : ............................................................
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b : ttgtgtcctctctcatgtaaaaaatggtcagtgtaggctactcataataatcac
TES01_0081_G06.b : tactctccacctctatgttgtgtatcttacctagatatgacttgtgcgtgtgtgccg
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b :
SPL01_0070_E06.b :
LVRM1_0074_F03.b :
TES01_0098_E04.b : tttataatccggcccgcgcataaaaaaaaaaaaggccagttcgc
TES01_0103_C10.b : cgtgcccccgtatta
MLN01_0008_H11.b : cacccacccctttttatgtcttatttttaacgccccttcagcgaaacaggtttgaacttg
TES01_0005_F06.b :
TES01_0016_A09.b : aaaaaaaaaaaagtgtctgtggagcggccgccacatttataaaaacacaccccccccaca
TES01_0016_D12.b : ctattttaacccgcgncgccccg
20060611C-006582 : ............................................................
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b :
TES01_0081_G06.b :
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b :
SPL01_0070_E06.b :
LVRM1_0074_F03.b :
TES01_0098_E04.b :
TES01_0103_C10.b :
MLN01_0008_H11.b : gtgaaaaccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0005_F06.b :
TES01_0016_A09.b : aaaaaaaaatgtgtgtattttgctt
TES01_0016_D12.b :
20060611C-006582 : ............................................................
---------+---------+---------+---------+---------+---------+ 1015
TES01_0082_D05.b :
TES01_0081_G06.b :
LVRM1_0187_E10.b :
OVRM1_0170_G05.b :
TCH01_0051_E11.b :
SPL01_0070_E06.b :
LVRM1_0074_F03.b :
TES01_0098_E04.b :
TES01_0103_C10.b :
MLN01_0008_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0005_F06.b :
TES01_0016_A09.b :
TES01_0016_D12.b :