
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000779

Length: 1,701

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinTINAGL1tubulointerstitial nephritis antigen-like isoform 3 [Homo sapiens]. 1412e-33O
Contig/Assembly ProteinTINAGL1tubulointerstitial nephritis antigen-like isoform 1 precursor [Homo sapiens]. 1412e-33
Contig/Assembly ProteinTINAGL1tubulointerstitial nephritis antigen-like isoform 2 precursor [Homo sapiens]. 1391e-32
Contig/Assembly ProteinTINAGtubulointerstitial nephritis antigen [Homo sapiens]. 1374e-32
Contig/Assembly ProteinCTSCdipeptidyl peptidase 1 isoform a preproprotein [Homo sapiens]. 1097e-24

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCtsbcathepsin B preproprotein [Mus musculus]. 541e-154O
Contig/Assembly ProteinTinagtubulointerstitial nephritis antigen [Mus musculus]. 1399e-33
Contig/Assembly ProteinTinagl1tubulointerstitial nephritis antigen-like precursor [Mus musculus]. 1342e-31
Contig/Assembly ProteinTinagl1tubulointerstitial nephritis antigen-like precursor [Mus musculus]. 1342e-31
Contig/Assembly ProteinCtscdipeptidyl peptidase 1 preproprotein [Mus musculus]. 1029e-22
Contig/Assembly ProteinCtshpro-cathepsin H preproprotein [Mus musculus]. 94.42e-19O
Contig/Assembly ProteinCtsscathepsin S preproprotein [Mus musculus]. 85.99e-17O
Contig/Assembly ProteinCtsll3cathepsin L-like 3 [Mus musculus]. 85.12e-16O
Contig/Assembly ProteinBC051665hypothetical protein LOC218275 [Mus musculus]. 791e-14O
Contig/Assembly ProteinCtszcathepsin Z preproprotein [Mus musculus]. 78.22e-14O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC486077PREDICTED: similar to cathepsin B preproprotein [Canis familiaris]. 590e-168
Contig/Assembly ProteinLOC478155PREDICTED: similar to P3ECSL [Canis familiaris]. 1436e-34
Contig/Assembly ProteinLOC481848PREDICTED: similar to tubulointerstitial nephritis antigen [Canis familiaris]. 1412e-33
Contig/Assembly ProteinCTSCdipeptidyl peptidase 1 [Canis lupus familiaris]. 1082e-23
Contig/Assembly ProteinLOC478608PREDICTED: similar to Dipeptidyl-peptidase I precursor (DPP-I) (DPPI) (Cathepsin C) (Cathepsin J) (Dipeptidyl transferase), partial [Canis familiaris]. 1043e-22
Contig/Assembly ProteinLOC479065PREDICTED: similar to Cathepsin H precursor [Canis familiaris]. 1004e-21O
Contig/Assembly ProteinLOC611983PREDICTED: similar to Cathepsin Z precursor (Cathepsin X) (Cathepsin P) [Canis familiaris]. 84.33e-16
Contig/Assembly ProteinCTSScathepsin S precursor [Canis lupus familiaris]. 844e-16O
Contig/Assembly ProteinLOC476010PREDICTED: similar to Cathepsin F precursor (CATSF) [Canis familiaris]. 78.62e-14
Contig/Assembly ProteinCTSL2cathepsin L1 precursor [Canis lupus familiaris]. 77.44e-14O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCTSBcathepsin B precursor [Bos taurus]. 614e-176O
Contig/Assembly ProteinTINAGL1PREDICTED: tubulointerstitial nephritis antigen-like 1-like [Bos taurus]. 1465e-35
Contig/Assembly ProteinTINAGL1PREDICTED: tubulointerstitial nephritis antigen-like 1 isoform 2 [Bos taurus]. 1465e-35
Contig/Assembly ProteinTINAGtubulointerstitial nephritis antigen [Bos taurus]. 1334e-31
Contig/Assembly ProteinCTSCdipeptidyl peptidase 1 [Bos taurus]. 1081e-23
Contig/Assembly ProteinCTSHpro-cathepsin H precursor [Bos taurus]. 92.88e-19O
Contig/Assembly ProteinCTSZcathepsin Z precursor [Bos taurus]. 85.51e-16O
Contig/Assembly ProteinCTSScathepsin S precursor [Bos taurus]. 821e-15O
Contig/Assembly ProteinCTSL1cathepsin L1 [Bos taurus]. 80.16e-15O
Contig/Assembly ProteinCTSL2cathepsin L2 precursor [Bos taurus]. 79.39e-15O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCTSBcathepsin B precursor [Sus scrofa]. 6610.0O
Contig/Assembly ProteinTINAGL1PREDICTED: tubulointerstitial nephritis antigen [Sus scrofa]. 1402e-33O
Contig/Assembly ProteinLOC100153159PREDICTED: tubulointerstitial nephritis antigen [Sus scrofa]. 1333e-31
Contig/Assembly ProteinLOC100522387PREDICTED: dipeptidyl peptidase 1-like [Sus scrofa]. 1081e-23
Contig/Assembly ProteinCTSHpro-cathepsin H precursor [Sus scrofa]. 997e-21O
Contig/Assembly ProteinLOC100153090PREDICTED: cathepsin S [Sus scrofa]. 842e-16O
Contig/Assembly ProteinLOC100627406PREDICTED: cathepsin S-like [Sus scrofa]. 842e-16O
Contig/Assembly ProteinCTSL1cathepsin L1 precursor [Sus scrofa]. 83.63e-16O
Contig/Assembly ProteinCTSZcathepsin Z [Sus scrofa]. 82.47e-16O
Contig/Assembly ProteinCTSFPREDICTED: cathepsin F [Sus scrofa]. 78.21e-14

Assembly Members: 189      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
KDN010096H10KDN01_0096_H10.bFS678118 AK393731
LVR010036C01LVR01_0036_C01.bBP442809 AK232389
OVRM10003E12OVRM1_0003_E12.bBP151038 AK234658


SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVR01_0036_C01.b : ttttggggacctattaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0047_H06.b : nttaagaggaacacgccgtaxxxxxxx
HTMT1_0033_E10.b : caggtaacgacgccgtxxxxxxxxxxxxxxxxxxxx
ADR01_0019_B07.b : aacaxxxxxxxxxx
LVRM1_0058_B04.b : aagttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_F05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_C04.b : ttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_D03.b : xxxxxxxxxxxxxxx
SMG01_0006_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0199_B02.b : cgttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_H12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_G08.b : ttgacxxxxxxxxxxxxxxxxxx
LVRM1_0019_H03.b : cgttgacxxxxxxxxxxxxxxxxxxxx
OVR01_0059_B10.b : ttgcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0109_G09.b : cggttgannnnnttggctaagcagcxxxxxxxxx
SPL01_0018_E05.b : caatctaggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_H04.b : nnnggcttggactatgacagtttgtacxxxxxxxxxxxxxxxxxxx
OVR01_0096_A06.b : gcttgtgacttgacagtttgtacxxxxxxxxxxxxxxxxxxx
SPL01_0084_C10.b : nnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_H07.b : tggggtggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0015_F10.b : nnnnccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_E06.b : ggggcctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_F10.b : cgctttttggtgactanntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_B05.b : cggcccaccaagcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0033_C02.b : gggggcttttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0062_H02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_C10.b : nccgctttnnnnnnnnccgttagcgttcgxxxxxxxxxxxxxxxxxxxxxx
SMG01_0060_C01.b : nngggttatnnnnnggatxxxxxxxxxxxxxxx
TCH01_0063_A12.b : nnnggcttgtgacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0098_A08.b : nnnn
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b : ttttggacggtacg
ADR01_0031_B12.b : nncctttnan
OVRT1_0073_D02.b : nggcgtttnnnnnnnccgttagcgnac
LVRM1_0122_E10.b : nagt
SKNB1_0008_A06.b :
LVRM1_0042_H08.b : ag
PTG01_0033_E06.b : ncccctaa
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b : ggcaxxxxxxxxxxxxxxxxx
ADR01_0048_D01.b :
BFLT1_0035_F07.b : nggatacgtca
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b : nnnnggttggactatna
SPL01_0057_F08.b : nnnnggctaggactatna
KDN01_0006_A03.b :
CLNT1_0092_D01.b : nntttccgtca
BFLT1_0030_G03.b : ggattcc
LVR01_0067_C09.b : gtgttaagaataaaacgcttagtgxxxxxxxxxx
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b : nnnnnnn
LVRM1_0174_C11.b : n
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b : nttttgctaggacttga
SPL01_0092_H12.b : ngggtgctaggactatnac
SPL01_0026_D06.b : ctttatggtgxxxxxxxxxxxxxx
PTG01_0031_G03.b :
UTR01_0015_G03.b : gggggccxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0062_G07.b : nnggc
UTR01_0088_F03.b : nnnnggctagtgacttnac
SPL01_0052_G07.b : nnnnggctaggactatnacx
LVR01_0050_C03.b : ggggtatttnntagctttgtgactxxxxxxx
MLN01_0054_H07.b : nnnttgctaggacttaaa
UTR01_0047_D02.b : ctxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_F02.b : nnnggctaggactatnac
CLNT1_0063_C01.b : nnnaacttc
LVR01_0098_F04.b : gcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_F03.b : nnnnccgtca
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b : nggactcgtta
BFLT1_0036_G01.b : gggatccgtca
LNG01_0007_A07.b : ggtttttttggcttagtgxxxxxxxxxxx
OVRT1_0068_C01.b : nggggttnnnnnnnnccgttc
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b : nnnggc
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : agg
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b : gggggta
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : ...........................ACTGGACTTAGCGCGGGGGCGGCTCTGGGAAGC
---------+---------+---------+---------+---------+---------+ 33
LVR01_0036_C01.b : xxxxxxxxxxxxxxxxxxxccttttctACTGGACTTAGCGCGGGGGCGGCTCTGGGAAGC
CBLT1_0047_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTTAGCGCGGGCCCGTATCTGGGAAGC
HTMT1_0033_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtACTTAGCGCGGGGGCGGCTCTGGGAAGC
ADR01_0019_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0058_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0064_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0047_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0189_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
SMG01_0006_H10.b : nnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVRM1_0199_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0072_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVRM1_0057_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0019_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0059_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
PTG01_0109_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
SPL01_0018_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0060_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0096_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
SPL01_0084_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
THY01_0066_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVRT1_0015_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0032_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
THY01_0205_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVR01_0063_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0033_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
THY01_0062_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVRT1_0095_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
SMG01_0060_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
TCH01_0063_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
KDN01_0098_A08.b : ggctgcgttggctctggaaaaaaaaaaaaaaaacTTAGCGCGGGGGCGGCTCTGGGAAGC
SKNB1_0070_D05.b : nnnnggggatnnnnnnnnccaacgcgtccacggnaTAGCGCGGGGGCGGCTCTGGGAAGC
OVRM1_0039_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGGGGGCGGCTCTGGGAAGC
KDN01_0021_F12.b : ttttttgctgcggtggctctggacttGCGCGGGGGCGGCTCTGGGAAGC
PST01_0081_A12.b : nnnactgcgttggctctggacttGCGCGGGGGCGGCTCTGGGAAGC
PST01_0098_C02.b : nnnnncctgcgttggctctggacttGCGCGGGGGCGGCTCTGGGAA*C
KDN01_0067_G01.b : nnnnggctacgtttgctatggaCGCGGGGGCGGCTCTGGGAAGC
SKNB1_0089_G01.b : nnnacttgctgcttgctctcgtctaggcgcGGGCGCCTCTGGGAAN*
BMWN1_0073_G08.b : aggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCGGCTCTGGGAAGC
ADR01_0031_B12.b : aaaactaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGAAGC
OVRT1_0073_D02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGC
LVRM1_0122_E10.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGC
SKNB1_0008_A06.b : nnnncctcacggttgctacggctgggAGC
LVRM1_0042_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
PTG01_0033_E06.b : annnnggataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
ADR01_0020_F05.b : caacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
SPLT1_0014_H11.b : nnnngggcaagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctg
ADR01_0048_D01.b : ttttaatatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
BFLT1_0035_F07.b : gcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_A10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0008_F05.b : nnnnccgagatnnnnnnnccagcgttgtgcacgg
TCH01_0040_E08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0057_F08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0006_A03.b : nttttgcttacggttgctatg
CLNT1_0092_D01.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0030_G03.b : gttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0002_H12.b : tctcacgttggcact
KDN01_0026_D08.b : nncctcgctgtggctct
KDN01_0049_H11.b : gcgttggctct
KDN01_0007_G05.b : nnccctttnnnnnnncctgcgtttgctat
KDN01_0071_E04.b : tttcctgcggttgctat
KDN01_0099_D03.b : nnnnggctactgttgctat
KDN01_0043_A07.b : nttttactgcggtggctat
KDN01_0043_B03.b : nnnnnggccgcgtttgctat
KDN01_0062_F04.b : nnnncctgctgttgctct
KDN01_0082_F01.b : nnntttgctgagttggctat
KDN01_0096_H10.b : nntttcctgaggttggctct
KDN01_0040_E11.b : ttttcctgcggtggctat
KDN01_0008_B06.b : nncccgtttnnnnnnccctgcgttgtgctct
KDN01_0100_G05.b : nnnnngctgaggttgctat
SKNB1_0008_B08.b : nnnttcctcacgttggctct
KDN01_0015_E02.b : nncctttttnnnnnnncctgcggtggctct
KDN01_0094_D09.b : nnnnncctgctgttgctat
KDN01_0086_A12.b : nnnnnggctacggtggctat
PTG01_0074_F05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_G10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_F08.b : gttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_E02.b : caatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0008_H03.b : nnttgtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0051_E12.b : cagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0031_G03.b : tttttttgctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0062_G07.b : gtattnnnnggctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0054_H07.b : cagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0047_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0063_C01.b : tgcggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_F03.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0079_C03.b : aaaaanggataaacagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_A09.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_F03.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0072_F01.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0019_G09.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0036_G01.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0007_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0068_C01.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0051_G04.b : cgctattaccagtacgttgtctac
KDN01_0004_B01.b : nccgattttnnnnntncctaaagtgtgcacg
KDN01_0004_E01.b : ncccgtccttnnnntntncctacgtngtgcacg
KDN01_0088_A09.b : ttttttgctgaggtggct
KDN01_0009_G09.b : nccgttnnnnnnncctacgtttgctct
KDN01_0025_E11.b : ttttgtggctgttgctat
KDN01_0039_G05.b : ttttcctacgtggct
KDN01_0025_D08.b : tttttcctgctgtggcta
SPL01_0081_F04.b : ttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0074_G11.b : nnnccgcggtagaggccgtagtattaaxxxxxxxxxxxxxxxxx
OVR01_0096_F07.b : xxxxxxxxxxxxxxxxxxxxx
SPLT1_0011_A04.b : nnnnggcgagtacacgccgtaxxxxxxxxxxxxxx
OVRT1_0005_A04.b : nccgtttnnnnnnnnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0092_C01.b : nnnggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0027_C11.b : tttttccaggtacacgxxxxxxxxxxxxxxxxx
OVRM1_0003_E12.b : agcttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_D10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0080_B06.b : nngggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0148_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0194_H08.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_E05.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_C01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_C06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0084_B06.b : gctttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_G12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_A11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0046_C09.b : catttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0091_H12.b : nttgtgctaggactatgacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_C09.b : nccgataannnnggactaagcagcggtaxxxxxxxxxx
UTR01_0022_E08.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0001_G11.b : nnncccttaannnnatgaactacaxxxxxxxxxxxxxxxxx
ITT01_0063_B06.b : nnnggtgaaacxxxxxxxxxxxxxxxxxxx
THY01_0097_B07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_C03.b : tcagggcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_B07.b : nnnggcttttnngggnnccctcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0059_D09.b : nnnncccatgaacaxxxxxxxxxxxxxxxxxx
OVRT1_0070_B08.b : ncccttttnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0022_H11.b : gaactccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0048_B12.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
KDN01_0031_H05.b :
KDN01_0017_D01.b : nccg
LVRM1_0125_B07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0013_C07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_F06.b : xxxxxxxxxxxxxxxx
LVR01_0083_E08.b : attttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_H12.b : tgggcattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0034_D12.b : nttctttnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0062_C01.b : nnnngc
KDN01_0094_G04.b :
PCT01_0015_E10.b : nnnnggc
KDN01_0021_F06.b :
PCT01_0014_C05.b : nnncccg
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxx
BFLT1_0099_C05.b : gattcgtttgcgnacgxxxxxxxxxxxxxxxxx
KDN01_0046_B05.b :
LVR01_0091_D10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0011_B05.b : cgcatgn
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 91
OVR01_0096_F07.b : xxxxxxxxxxxccttaaactactgGAGAACC*TGCCCGAGCGCTCG*GAGGCTGCCTACC
SPLT1_0011_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0005_A04.b : xxxxxxxxxxxxxxxxxxxxxxtgGAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPLT1_0092_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
CBLT1_0027_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxAGAACC*TGCCCGACCGTTCG*GAGGCTGCAGACC
OVRM1_0003_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0127_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0113_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0080_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0148_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0194_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0058_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0056_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0118_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0084_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0084_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0115_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0107_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0046_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0091_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SMG01_0023_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
UTR01_0022_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxgGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SMG01_0001_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ITT01_0063_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
THY01_0097_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0048_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0036_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ADR01_0059_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0070_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0022_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ITT01_0048_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0031_H05.b : nctcgcgttggctatgggtcgACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0017_D01.b : ttttnnnnnnccatgcttgtgctcggagACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0125_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0013_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0057_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0083_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0050_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0034_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SKNB1_0062_C01.b : ggggnnnnncctcacgtttgctactggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0094_G04.b : nncctgcgttggctatggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PCT01_0015_E10.b : gtgtangnnnncctgcgtttgctctggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0021_F06.b : nnnnnnncctgcgttggctactggaaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PCT01_0014_C05.b : tagannnnnncctgcgttgtgctctggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0099_B12.b : nnnnggctgcggtggctatggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0040_F03.b : nnnncctgctgtggctctggactgCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0079_B12.b : nnnggccgctgtggctctggagacctgCCGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0103_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0099_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCGCTCG*GAGGCTGCAGACC
KDN01_0046_B05.b : acctttAGACC
LVR01_0091_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACC
KDN01_0011_B05.b : nnnnncctgcgttggctctggattatgaccctggaacctgggagaaggagcgtcttaggg
ADR01_0012_C07.b : nnnnggtgaacaxx
PCT01_0007_H05.b : nnnccggactnnnnn
THY01_0064_D07.b : cttttgagtggcxx
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 147
KDN01_0011_B05.b : tggctgagtttggggagtcagcgggctgtcCAGGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0012_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGGATCCACCTGCCAAAAA
PCT01_0007_H05.b : nactgcgttggcacggggcggcggcgcggacgcggtgaatctGGATCCACCTGCC*AAAA
THY01_0064_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0083_B04.b : nnccgcggtagaggccgtagtatt
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b : nnnaaactacctaaxxxxxxxxxxxxxxx
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 206
SPLT1_0083_B04.b : tnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTGCTGCTGACCAGTGCCCGGGAGAGT
ILNT1_0064_G06.b : nccgacggtacgaggccgtaxxxxxxxxxxxxxxx
KDN01_0067_B05.b :
OVR01_0100_C06.b : ngttagtgacttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F12.b : tgggcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0032_B07.b : nnncccctcgggngggctggacttgacxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : aaaaanaccgat
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 265
KDN01_0067_B05.b : nnnnncctgcgttggcctggatgactggtcATTTTATTAC**AGCAAAACACTAC
OVR01_0100_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTATTAACAAGCAAAACACTAC
LVR01_0099_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTATTAACAAGCAAAACACTAC
MLN01_0032_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATTAACAAGCAAAACACTAC
KDN01_0028_F10.b : tttttggctgcgttggctacggcaaaACTAC
KDN01_0054_B01.b : cgttggctatggcaacCTAC
KDN01_0012_H06.b : nccgtttannnnncctgcgttggcacggact
DCI01_0021_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b : gag
OVRM1_0179_C01.b :
DCI01_0118_A02.b : acaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 324
KDN01_0015_E11.b : ncccttttnnnnnccctgcgttggctctggagtgagAGCTC*TGTG
LVRM1_0037_A08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTG
OVRM1_0179_C01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0086_F02.b :
DCI01_0028_F01.b : nnnaaacatactaaxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 384
DCI01_0118_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0086_F02.b :
DCI01_0028_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 443
KDN01_0086_F02.b : nttttttnnnnnnncctgcgggtgctcggcataagagat
DCI01_0028_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 502
DCI01_0045_D03.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 562
OVRM1_0003_E12.b : CCGGctcggcatacgtagcctccctccgtgtcgcgcggaggtcgcccgctcggacgtgca
DCI01_0045_D03.b : nnttttcatatctaaxxx
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 621
ADR01_0019_B07.b : CACCTGTTGTGGCcaactagtggtggggatggctgtaaccggtggctttccctccgggaa
LVRM1_0058_B04.b : CACCTGTTGTGGCTACGAGTGTGGcggatggccgttacgtgggtctctcccctggatcct
OVRM1_0039_F04.b : tcacctggtccggcgaccactgtcggcacggccgtcacggtggctctccctttggcagcc
LVRM1_0042_H08.b : CAacatgtgtggcgacaaaagtgatggatggcagcacgcggcgagatgccacatgaatga
PTG01_0074_F05.b : ccctgtttgtgcacaaagtgggggatggctttaacgggggctttccctctggaactggaa
LVRM1_0174_C11.b : CACCctggtggcaaagagggaggggaaattcgggaaagttagacttccttcccggaacct
OVRM1_0003_E12.b : tacccgctgcggcgactagtgtggcgatggccgcatcgacggttgaatctccggagcctg
DCI01_0045_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 678
ADR01_0019_B07.b : cctggaacttctggaaaaaaaagggcctgggtgtccggggggccttttataatcccctgg
LVRM1_0058_B04.b : gcaacttccggtacaaaaaaggtccggggttcggtgtgccctatagctttccgttgtggt
LVRM1_0064_F05.b : caaactttggactatgaaggcttcggggctctcgtcgtcgtatctttacgatgttcctag
OVRM1_0039_F04.b : ggaacttctgccatatgtacggcctggcggtcgggggcccccagcgattcttcctcgagt
SKNB1_0089_G01.b : GGAAC*TTCTGtacccaccttggctcgctgtctccgatcctccaccactcgtcctcactt
LVRM1_0042_H08.b : tgaaacctgcttaacccataaacgaaatgaattgccagcgcccaccctgagatttagcgc
PTG01_0074_F05.b : cttctgaaaaaaaagggccggggtccggggggcccttaaaccccaaggggttgtggggcc
LVRM1_0174_C11.b : ggaacttcctgactaaaaagggcctggttgtacgggggcctccaagtatacccagggggg
OVRM1_0003_E12.b : tatctctcgtacttcgacggcccctgctttcgtttgctcnccatattctctcccgggatg
DCI01_0045_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_D02.b : gggtgcacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
---------+---------+---------+---------+---------+---------+ 735
LVR01_0036_C01.b : gtttgcgggccctactccatcccaccttgtgaacacccgtgaaatcgctcccggcccccc
ADR01_0019_B07.b : gggtttgcaggccctattccctcccacctggcaaaaacctgtgaaacggttcccggcccc
LVRM1_0058_B04.b : gtcgggctattccattaca
LVRM1_0064_F05.b : tgactcgagtgtgtatccgttgtgctccactcggtttctggtgtccgtccccgcgtcttc
LVRM1_0047_C04.b : GTTGCggggccaacacgaaccaccttgtgaacacaacccgaaagcttcccgcacccc
LVRM1_0189_D03.b : GTTGCAGGCCCTACT*CCATCCCACttgggaagacacgtgaacggtcccggccccgt
SMG01_0006_H10.b : TTTGCAGGCCtactccctccaacctgggaaacccacttgaacgggtcccggccccgtgga
OVRM1_0039_F04.b : cgtttgttctattcctatccaccattcgatcacctactgaaatatgtacctgtgacaccc
SKNB1_0089_G01.b : tgcccgccccacttcccccccccttcgatcagcccttaaaccagtccccaccccccgctc
LVRM1_0042_H08.b : aaagtaagcgaccgcgcacaaaccacatagtaagtatattataataccgaatcaaacaca
PTG01_0074_F05.b : caatccctcccccccttggaaacccccgtgaaggggccccggcccccgtgcgcggggggg
LVRM1_0174_C11.b : gttgaggccccgactcgccgaatgttgccaacacgatgtcccccctccccagcattacgg
LVRM1_0043_G10.b : gtcgcatgcactagccgatgcacctttaagaaagccagcgacggaagacgagccagngga
OVRM1_0003_E12.b : acggccccccttccgcccctcatgtgttcgcctcgtctacgtactccgacccactcgcac
UTR01_0014_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggGTGAA*CGGCTCCCGG*CCCC
---------+---------+---------+---------+---------+---------+ 789
LVR01_0036_C01.b : gtgcactgggggaggggaactccccccacttgcaccacgatttgcgagcctggcttacac
CBLT1_0047_H06.b : *GTGCTCTGGGG**AGGGGGA*CACCCCCATGTGC*Actaggtttgcccaccctggctgc
ADR01_0019_B07.b : cttgtcaggtggaggggggaacccccctatttactagaatttttgaaacctgtttacccc
LVRM1_0058_B04.b :
LVRM1_0064_F05.b : gtaacgtgccgatacacgtctcgcaccgctatccagtagatcgcgttt
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ctggggaggggaaccccccaagggacaaaatttgggaacctggttaacccccgcctaaaa
OVRM1_0199_B02.b :
LVRM1_0072_H12.b : CGTG
OVRM1_0039_F04.b : gtccgagggtttgcgaacctctccctttctctaccaa
SKNB1_0089_G01.b : cctgtgcccgttatccgcccccgacccctccccattctcccacccccctctccctcacga
LVRM1_0042_H08.b : tagactggaaaacgacaataccgcgttggctataaatagaccgcaccacttg
PTG01_0074_F05.b : ggggacccccccatgtggaaaaaattttggaagcggggtaccccccccctaaaaaaaaaa
LVRM1_0174_C11.b : ttgtgtggaaacgtggactttgaccccgcgtcgtgcccgaatcgc
LVRM1_0043_G10.b : agggggaagggcgaaatatagcttacacctacgcgcttgtataag
LVRM1_0077_F08.b : CGTGCACTGCGG**AAGGCGA*CACCTCCCACTGC*Aattacatctgccagcctcgctac
KDN01_0051_G04.b : CGTGCACTGGGG**AGGGGGACACCCCCAGTGCAtttagatctgcagcctggccacaccc
OVRM1_0003_E12.b : cggcccgccccttgttctcaatttttagcccaaacatcccgccgctctttctctttctta
LVRM1_0127_D10.b : CGTGCAACTGGGGAAGGGGGaacacccccagtgtatcaaaatctgctagccgggcttaca
OVR01_0080_B06.b : CGTGCACTGGGG**AGGGGGACCCCCCCAAGTGgcacaaaatttgggagccttggttacc
LVRM1_0125_B07.b : CGTGCACTGGGGT*AGGGGGAAACCCCCCAagcgcagcaagaatttgcggaacctgtgtt
---------+---------+---------+---------+---------+---------+ 844
LVR01_0036_C01.b : cccttccctacaaaaaagaaaaccccattttccgctgcactctcttcagccttcctctag
CBLT1_0047_H06.b : ctcccttttttcaaataaaaaaagcaagtccgaaggagcttccaacaccttcttttgtaa
ADR01_0019_B07.b : cgttcttaaataaaaaaaagtctttgtaatgcgcttcataatattctcttgaaaaaaaag
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : aaaaaaaaaccatttgaagggattccccaaaatttctaggaacaaaaggaaatttggggg
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : taccccccgtccctactaagaaaaacaaaccctttcggaatgtcggctccttctgccttt
OVRM1_0039_F04.b :
SKNB1_0089_G01.b : cctaaccacaccccgtcgttttgtctctacatccctcttcttcccccccccccttctcct
LVRM1_0122_E10.b : ACACCCC*G
LVRM1_0042_H08.b :
ADR01_0020_F05.b : caccccgttctaacaaaaaaaaaaacactttcggaagcaccttctaaagcattctttgga
SKNB1_0002_H12.b : ACACCCCGTCCCTACAAagaagaacaagcccctttcggaatggcagctcctaaagcattc
PTG01_0074_F05.b : aaaaactcttggaaggggcccctccaccattctctctaaaaaaaaagaaagatttgtggg
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b : cc
LVRM1_0056_E02.b :
ADR01_0008_H03.b : ACACCCC*GTCtacaaagagaacaacacttcgaatggcacttctacgcttctctaggaac
SPL01_0051_E12.b : ACACCCC*GTCCTACAAAagaagaaaaaccccttcgggatgcagcttccttcagcatctt
SPL01_0092_H12.b : ACACCCC*GTCCTAACAAGAA*Agacaagcactttcggatgcagcctcctacagcatctc
KDN01_0051_G04.b : cgtcctacaagagagaaaagtactttggattgcagctcctttagcatttcttggaacgga
SPL01_0081_F04.b : AAACACC*GTCCTAATAAGAA*GACCAGCgccttggattgcgatcctccggcttctctag
OVR01_0096_F07.b : atccccccttcctaacaaaaaataaaaacccttctggatgcaatcttcctactgctttct
OVRM1_0003_E12.b : cacacatcctttattccatcacttcatccccattcctcc
LVRM1_0127_D10.b : ccccgcttacataggagaaaagctctttcggatgcacttcctcn
OVRM1_0113_H12.b : ctctccctcctattaacacgacatgcactccttatgca
OVR01_0080_B06.b : ccccgtccttacaaaaaaaaaaaccaccttggaatggagctcctacgccatcttcttggg
OVRM1_0148_A01.b :
OVRM1_0194_H08.b : ACA
LVRM1_0058_C10.b : ACACtcgtcctacaaaa
LVRM1_0056_E05.b : ACACCC
OVRM1_0084_C06.b : ACAC*CC*GTCCTACAAAGAA*GAtagcacttcggatgcn
OVR01_0084_B06.b : ACACCCC*GTCCTACAAAaaaaaaaaacattttggatggagcttcctctgcctcctcttg
LVRM1_0125_B07.b : accccccgctcccactaaaaaaaccagncctttccgtatgtatn
LVRM1_0013_C07.b : ACACgcgtgcctagagagagacatgcacttcggatgc
---------+---------+---------+---------+---------+---------+ 897
LVR01_0036_C01.b : gaaacgaaaagggaaaaatcatggtcggaaaatctacaaaaacgggccccggtcacaagg
CBLT1_0047_H06.b : cgagaaggagattctggcccgaattctacaaaactggtcccggtttggggtggcctctcc
ADR01_0019_B07.b : aatttctgggaaaatttataaaattccccggccagggggcctctccttgtatcccgattc
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : aaatttacaaaaggcccgggcaaggggctttccggggatccccactcccgcgaaaaatcg
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : tttttggaaccagataggggaatttgtgtcggaaaattttctataaccggccccggtcct
PTG01_0109_G09.b : gggacgaaaaagaaatcttggcggaaatttccaaaaacggccggtcaggggggccttcct
OVRM1_0039_F04.b :
SKNB1_0089_G01.b : ggctccccctcggtatccctccccccatagcccccctcccctcccaccctcacttccccc
BMWN1_0073_G08.b : TAGGAACGAG*GAGGAaaatctggccggaaatcttaaaaaacggcccggtcggagggggc
LVRM1_0122_E10.b :
LVRM1_0042_H08.b :
ADR01_0020_F05.b : accaaaaaggaaatcttggcggaaatttacaaaaactgcccggtcgaagggggctttcct
LVRM1_0150_A10.b :
SKNB1_0002_H12.b : tttttgggaaccgaaaaaggagaatcttgggcggaaaaattttaccaaaaaacgggcccc
PTG01_0074_F05.b : gaaaaaatccaaaagggccccgcggggagggggccctccgggtgtcacccatctcccccg
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : aaaaggaaattctggcggaaatcaccaaaacggcccgtcaaggggcctttccgggacacc
SPL01_0051_E12.b : ctagggaacgagaaaggagaatcttgggccggaagatctacaataaacgggccccgggtc
SPL01_0092_H12.b : ttgggaaccaggaaggaaatcctgggcgggaaattctacaaaaaaccggcccgggtccaa
SPL01_0026_D06.b :
KDN01_0051_G04.b : aaaggagatcttggccggaaatctacaaaaacggaaccgttcaagggggctttcatgtgg
SPL01_0081_F04.b : gaagagtagggaatcattgcggaaatctatcaaaaaccgggcggccgaggggggccttcc
OVR01_0096_F07.b : ttaggaaacaaaaagggaaatcttgggcggaaaatctaacaaaaactgtctcggatcaag
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : accaaaaaggagaattctggggcggaaattttcaaaaaacgggtcccgtcgaggggggcc
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : gaaataaaaagaaaatatgggcgtaaatcttcaaaaaacggccccggttaaagggggcct
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
---------+---------+---------+---------+---------+---------+ 954
LVR01_0036_C01.b : gggccctatctggtgttactcagaatttcccggcaaatataacctcggggggtcgacccc
CBLT1_0047_H06.b : gtggtacctcggaatccctgtattaaaagccgggaagtgtcccgcctctccgccaggaaa
ADR01_0019_B07.b : tgttaaaaattttcggagtggtcccacccctcataaaaattttggggaggcttttctctt
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ggggggcccccccccccccggaaattttggggagccccccccccccccccgggggggggg
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : aaggggggcccctcctacggggttaccccggaactttccttgctatatataaatttggtg
PTG01_0109_G09.b : gggtctccgaactcccggagtataaatctggatggcccacccctcccagagaacttgttg
SPL01_0018_E05.b :
OVR01_0060_H04.b : ctttcactggggacctcggaacttccggcagtataagcctgggagggtacccgccccgtc
OVR01_0096_A06.b : GGCCTTtcacggggtactccggaatttccggcagtataagttctgggggggacccacccc
SPL01_0084_C10.b : GGGCCTTCcctggggtctccggacttcccggcaatatagattgggatggtacctccccgg
THY01_0066_H07.b : GGGGCTTCACTG*TGTACTCcggacttcctgcagtataaagtctggagttgtaccaacca
OVRM1_0039_F04.b :
SKNB1_0089_G01.b : cccacctcccccttcccccttaaacaatcccccccaccccccccctctcaccagaacttt
BMWN1_0073_G08.b : ctccctggggtatccgacttcctgcattaaagttcgggagggacccccccttcacaggaa
LVRM1_0122_E10.b :
LVRM1_0042_H08.b :
ADR01_0020_F05.b : gggttatcggactttccggctataaagtttggaatgtgaccacccctcccaggaaacttg
SPLT1_0014_H11.b : GGGCCTTCccggggtacccggatttctggcataaaaatctggggtggaacccccccctcc
LVRM1_0150_A10.b :
PCT01_0008_F05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCtgcagtatagtctggatgtacagcacgtcaca
TCH01_0040_E08.b : GGGCCTTCACTG*TGgtacctcgacttcccgcaaataaaagtctggaatgtacccacccg
SPL01_0057_F08.b : GGGCCTTCCCTG*TGTACTCCGA*CTTCCTGCAtattaagccgggaatggacccgccccg
SKNB1_0002_H12.b : cggtccgagggggggcctttcacctgggggtaactccggaaactttcctgggaagttata
PTG01_0074_F05.b : aaaaaaaaggggggggggccccccccccccacaaaaaatttgggggggggcccccccccc
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : gaactccggcattaaaattctggatgtaccacccgttcaaggaaattgatgggaggcctg
SPL01_0051_E12.b : gaaaggggggccctttccctggtggtactcgggaatttcctgccagtataaaaaattcgg
SPL01_0092_H12.b : ggggggccttcccctggtggtactccggactttcctggcaagaataaagttttgggaatg
SPL01_0026_D06.b :
PTG01_0031_G03.b : GGGCCTCCA*TG*TGTACTCGAA*CTTCtgcagtaaaatctggatggaccacacgtcaca
UTR01_0015_G03.b :
UTR01_0088_F03.b : GGGCCTTCCCTG*TGTACTCGGG*CTTCCTGCcagtataagtctggaatgtaccgccccc
SPL01_0052_G07.b : GGGCCTTCACTG*TGTACTCGGA*ATTCCTGCcgaataagcctgggagggtaccgccccg
KDN01_0051_G04.b : tactccggacttcctggcgatttagtcttggagggtatccccacgtctacatgaaaactt
SPL01_0081_F04.b : tgtggcctggcctgttccgctcaattttgacaggaaacattgcaaaattcccaaccgaat
OVR01_0096_F07.b : aggggcctttccttggggaccccggaacttcctggccgtttaaattcttggaaggtgacc
CBLT1_0027_C11.b : GGGCCTTCAtggggtcccggatttcctgcaatataattcggagtgtacccacccgtccca
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : tcttcttgtgtaactccgacccttcctcccgcgataaactttggggggggttcaaccccc
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : cctttgggtacctcggactttcctgcaaatataaatcttgggaggtttccttcccacgtc
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : GGGCCTTtccctggggtacttcggaaccttcctggcagaataagtctggaagtggaccag
OVR01_0091_H12.b : GGGCCTTCACTG*TGTACctcggacttcttgcaatataaatctggaagtgtaccagcccg
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
BFLT1_0103_F05.b : GGGCCTTCACTG*TGTACTCGAA*CTcccgcgttataattcggaatggacaacacgtcaa
KDN01_0046_B05.b : GGGGCTTCccttgtgttctcggactccctgcataatattctggagtgtacccacacgttc
---------+---------+---------+---------+---------+---------+ 1010
LVR01_0036_C01.b : cacccccctcccctggcaaaccttcactgtgcaaggcccccttccctctcttcctatctc
CBLT1_0047_H06.b : cttgtgtggaggccctttctacttccctcttgtgtcggaggaattaagatgtaccctcct
HTMT1_0033_E10.b : tccccgggaaattggtggggggccatgcctcccgcttctggggtggggagtggaaaatgg
ADR01_0019_B07.b : cctcctcgggttgggaagaggaaaagaccccccttgtgtgggttctaattctcaaaacac
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ggaaaaaggcccccctcgggggggggggatttttggaaaaaaaaggggggaaaggggttt
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : aggttttctcccccacctctctttgggggaaatcttactggggggaagtctagtgctctt
PTG01_0109_G09.b : gggggcctggcatccccatcttgggctgggaaaggaaaaaggcccccctagggttgggcg
SPL01_0018_E05.b :
OVR01_0060_H04.b : ccaggggaactttttggggaggccctggcccttctcccattctgtggggtgggggaaggg
OVR01_0096_A06.b : cttcccagggaaaacttgaaggggagggccatggccctccccccttcctgggcgctggga
SPL01_0084_C10.b : tcccaggaaaacttgttggggagggcctggcctatcgccatccctgggcttgggggaggg
THY01_0066_H07.b : cgtcccaggaaaacttgatggggaggcccttgcccttccccattccggggcttgggggag
OVRT1_0015_F10.b : cccagagactttgtggggaggcctgccatccccttctggggctgggaagtgaaaatggcc
OVR01_0032_E06.b : tcacaggagaatttgatggggagggcctgcccttcccccttcctggggctgggggagggg
THY01_0205_F10.b : TCCCAGGgagactggatgggaagccctgccatccgccatcctgggctgggggaatgggaa
LVR01_0063_B05.b : TCCCAGGAaaacttgatgggaaggccatgccctccgcatccttgggctggggaatgggaa
OVR01_0033_C02.b : TCACAGGAGA*CTTtgatgggaggccctgccctcccccttcctggggtggggaagggaaa
THY01_0062_H02.b : TCACAGGAGA*CCTGATGGGAGGCCctggcattccgcctcctggggctggggaatgga
SKNB1_0070_D05.b : TCACAGGAAA*CTTGATGGGAAGGC*CTGCCATCCcatcctgggctgggaaaatggaaaa
OVRM1_0039_F04.b :
SKNB1_0089_G01.b : gaccgcctgccttctcccctccttcctccttcctactccccctccacacccacttcccct
BMWN1_0073_G08.b : acttgatgggagggcctggcctccccatccgtggctggggagggaaaaggcccccccttt
LVRM1_0122_E10.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : cagaagacttgatgggagccatgccatcgcatctgggctggggaatgaaaatggcccccc
ADR01_0020_F05.b : agggggggccagccctctccctcctgggcggggaatggaaaaaggacccccctaagggtg
SPLT1_0014_H11.b : cagaaaatttagggggaggcctgcccttccccatccgggggtgggggaatgaaaaagggg
LVRM1_0150_A10.b :
PCT01_0008_F05.b : gagactgatgggagccatgccatcgcatcctggctgggaatgaagatggcacccctactg
TCH01_0040_E08.b : ttcccaggagaactttgaggggaaggcctgcccatccgcatccctgggctgggggaaggg
SPL01_0057_F08.b : tcccagaagaattgatggggagggcttggccatcccgctccctgggctggggaaagtgga
SKNB1_0002_H12.b : aaaatctcggggaggggggacccccccccccgttccccagaggaaaaaccttttaagggg
PTG01_0074_F05.b : ccccccccctgggggggggagaaaaaaaaacccccccccggggggggggggccccccccc
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : ccctcccatccgggctggggaaggaaaaaggacccccaacgggtggggcgaatccgggaa
SPL01_0051_E12.b : ggaatgggtacccatccacggttcactagggaaaaattttggttgggggaggggcctatt
SPL01_0092_H12.b : ggaaccacgcaccgctcccccgggaaaaacttttgatgggggagggccctgtgcccaatc
SPL01_0026_D06.b :
PTG01_0031_G03.b : gaaaattgatgggaggccatgcttccccttctgggttgggaatgaaaatgccacccctta
UTR01_0015_G03.b :
SMG01_0062_G07.b : caggaaactgatgggaggcatgccatcccatcctgggctgggaatggaaaatggcacccc
UTR01_0088_F03.b : ttccaggaaactttgatgggagggcatggccatcccgcaccctggggctggggaatggaa
SPL01_0052_G07.b : tcccaggaaaattgaatgggaaggccatgcccttccccattcctggggcggggggaaggg
LVR01_0050_C03.b : tcccaggaaaacttgatgggagggcctggccaccccattcctgggctgggggagtgggaa
MLN01_0054_H07.b : cacagaagacttgatggaggcatgccatcgcatcctgggctgggaagggaaaatggcccc
UTR01_0047_D02.b : gtcacaggaaactttgatgggaaggcctggccctccgcatcctgggctgggggagatgga
SPL01_0068_F02.b : TCACcagaaaactgatggggagccctggcctcccgcatcctgggctggggaagtgaaaaa
CLNT1_0063_C01.b : TCACAGGAGA*CTTtgatggaggccattgcatcgcatcctgggctggggaagtgagaatg
LVR01_0098_F04.b : gtcacaggaaaacttgatgggagggcatggccctccccatccctgggctgggggaggtgg
KDN01_0051_G04.b : gatgtgtagcccttgcattccgcattcggagctggggaatgggataaggtccccccctta
SPL01_0081_F04.b : ctgttaggaatggaaaataatccccccggattcattaggttccccggaaattgaaggccc
OVR01_0096_F07.b : caaccaccttcacatgaaaaacttgttgtgggagggcccttgtcctatcccctcaacttt
CBLT1_0027_C11.b : gggaacttttatgggaagccatgccatccccatcctggggtgggaattgaaaaaggcacc
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : gtcaccgggaaacttttgtggggggggcatgcccccctcccattcttgggtcgggggggg
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : cccgggagaatttgatggtgagggcctggtcattctcttttcttgttgttttggaatgga
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : cacgtccccaggaaaacttgatgggaagccatgccctcccgcatcctgggcttggggaag
OVR01_0091_H12.b : tcccaaggagacttgtatgggaggccatgccctccgcattcctgggcctggggaaatgga
SMG01_0023_C09.b : cagaaacttgatgggagccatgccatccgcatcctgggctgggaagtggaaaaggcaccc
UTR01_0022_E08.b :
SMG01_0001_G11.b : cacggaaactttgaaggaagccatgccatccccttccggggttgggaaatgaaaatggga
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : TCACAagaaaacttgatggggaggccttgcccttccccatccctgggctggggaagtgga
SKNB1_0062_C01.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCgcatctggggctgggnaaatggaaga
BFLT1_0103_F05.b : ggaaacttgatgggaggcctgccatcccatcctgggtggggaatgaaaagggaccccctt
KDN01_0046_B05.b : caagaaattgatgggaggctagcctaccctacctgagttgggaagggaaaatggcacccc
---------+---------+---------+---------+---------+---------+ 1068
LVR01_0036_C01.b : cctcggccggccgataattgggaaaaaaaagcgtttacccctcccttatatatgtttttt
CBLT1_0047_H06.b : tcccggccgggctggaatctccgttaataaaaacggcggtcgcaaatggctttgtttcaa
HTMT1_0033_E10.b : ccccccttctgggttggtcggcacctctggaaacaaaaatgggggggaaaggcttttttt
ADR01_0019_B07.b : attgggggaaatagtttttttaaaatcctaagaaagatactcggtacttcagcaaaataa
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : tttaaacccccaaaaagaaaaatcgggggccaacaaaaaaaggggggggccccaccctcc
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : tcctacaatcctgtggggccttggtggaattttgtataaattagtccctcctccctacct
PTG01_0109_G09.b : gaaactctggaaacaaacggggggaaaagggttcttaaaatccccaaagacaggttcccg
SPL01_0018_E05.b :
OVR01_0060_H04.b : aaaaaatggccacccccctattgggctggggtgggcaaccttcctggaaaacacaaaact
OVR01_0096_A06.b : aatggaaaaaatggcaccccccttcctgggcggggtcgggcaacctcctgggaa
SPL01_0084_C10.b : ggataatgggccacccccctaatgggttggtctgggcatctcctggaaaaaagaagtggg
THY01_0066_H07.b : tggaaaa
OVRT1_0015_F10.b : cccctacgggctggcggcgactccggaaaacagacgggggtgaaaaggccttcttaaaat
OVR01_0032_E06.b : ggagaagggacccccccttactggtctgggccgggaaactccccggaaaccccaaaacgg
THY01_0205_F10.b : aatggcccccccctactggcctgggtcggccacttccgggaacccaaaccgggggtgaac
LVR01_0063_B05.b : aatggcacccccctactggcttgggtccggcaactccctgggaaccccaaactggggggt
OVR01_0033_C02.b : aatgggccccccccttcgggtttgggccggaaattcccggaaacaccaaatggggggtgg
THY01_0062_H02.b :
OVRT1_0095_C10.b : gccccccctactggctggtcggcactcctggacaccgactggggggaaatggcttcttaa
SMG01_0060_C01.b : AATGGGAC*CCCCTAtgggtgggccggaactcctggaaccagaacggggtgaacatggct
TCH01_0063_A12.b : AATGGCAC*CCCCTACTGCCTGGTCGGgcaactcctgggaccccgaactggggggacatg
KDN01_0098_A08.b : GATGGCAC*CCCCTACTGGCTGGTCGGCActctgaaacacagatggggtgacatggcttc
SKNB1_0070_D05.b : tgccacccccactggctggccgcaactccggaaaccaaaccggggtgacaatgccttctt
OVRM1_0039_F04.b :
KDN01_0021_F12.b : AATGCACC*CCtactgcctggtcggcactcctgaaacacgactggggtgacaatggcttc
KDN01_0067_G01.b : ATGG**CA*CCCCTACTGGCTGGTCGGCAACTCCTGaacacagactggggtgacatggct
SKNB1_0089_G01.b : ccccccctcgcccgcccctcaattcccccctcagaaggccttcttcccccccctttcctg
BMWN1_0073_G08.b : gggtgggtcgcaacccgggaaacaagcggggggaaaatgctttttaaattccaaaggaag
ADR01_0031_B12.b : AATGGCCC*CCCCatggctgggccggcaatcccggaaaccaaactggggggaaaaggggt
OVRT1_0073_D02.b : AAT*GCCC*CCCCTACTGGCtggcggcaactcctggaacaaaactgggtgaacagggctc
LVRM1_0122_E10.b :
SKNB1_0008_A06.b : AATGGCAC*CCCCTACTtggctggtcggcaaactcctggaacacagaaccggggggaaca
LVRM1_0042_H08.b :
PTG01_0033_E06.b : taatggtgggcggaactcctgaaacaaactgggggaaatggttctttaaatcctcaaaga
ADR01_0020_F05.b : gttggcaatccttgaaaaccaaacggggtgaaaagtgcttctttaaaatcccaaagaaag
SPLT1_0014_H11.b : cccccctttgggggggtggggaaaccccggaaaaaaaaacggggggaaaaagggctcttt
LVR01_0086_H02.b : aaatggcacccccctctgggctgggtcgcaaactcccgggaaaaccaaacggggggggga
ADR01_0048_D01.b : ATGGCACC*CCtactggctggccgcaatccgggaacaagactggggggaaatggctcttt
LVRM1_0150_A10.b :
PCT01_0008_F05.b : ctggtcgcactctgaaaacgactgggtgacatggctctttagatctcaaagcagatcctg
TCH01_0040_E08.b : agaaatggccccccctacttggctggtgcgggaactctccggaaaacacagactgggggg
SPL01_0057_F08.b : aaatggccccccccctatggggtggggtggggaactccctgggaacaccaaacgtggggg
CLNT1_0092_D01.b : ATGGCCCC*CCtactggcgggcggcaattcctgaacacgactgggggacaatggctccta
BFLT1_0030_G03.b : AA*GGCAC*CCCCTACTGGGTGTTCGGAAACTCCggaaaacagacggggggacaagggtt
SKNB1_0002_H12.b : ggggaggggccatgggcctattcccccaaattccctgggggccttggggggaaagatggg
KDN01_0026_D08.b : tgccaccccctactggatggtcgaaagtcctggaacacccactgtggtgaaatgccctct
KDN01_0049_H11.b : AATTGCCC*CCCCTACTGGCTGGgccggaacttcctggaaaacaaacgggggtgaaaagg
KDN01_0007_G05.b : ATGGCACC*CCtactggctgggtcgcactcctgaacacagactgggtgacatggctcntt
KDN01_0071_E04.b : AAT*GCAA*CCCCTACTGGCTGGTCGGCActcctggaacacgactgggtgacaatgcttc
PTG01_0074_F05.b : gaaaaaaaaggggggggggggatgtgttttttaataacaaaaaaaaaaagagggtgtggg
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : caaaaagggggaacaaaggctttttaaaatccaaaaaagggtcatggggctcaaattaaa
SPL01_0051_E12.b : ggcccatccccgcaatttccttggggacctggggggaaaattgggataaata
SPL01_0092_H12.b : ccgccattt
SPL01_0026_D06.b :
PTG01_0031_G03.b : tggctgtcggaaatcctgaaaacaaaaggggggaaaagggctccttaaaaccccaaagaa
UTR01_0015_G03.b :
SMG01_0062_G07.b : taagggtggtcggaaactctggaacaaaacggggtggacatgcttctttaaatacccaaa
UTR01_0088_F03.b : aatggcaccccctactggctggggtcggaactccgggaaaccaaaagggggggaaaatgg
SPL01_0052_G07.b : aaaaagggacccccccctaatgtgcgggtccgggaaattccctggaaaaacaaaacgggg
LVR01_0050_C03.b : aagggccccccccactggccggggccggcaacctcctggaaaaacaaaacggggggtgaa
MLN01_0054_H07.b : cccactggctgggcgcaattcctggacaagacggggtggaaatgggttctttaaatcctc
UTR01_0047_D02.b : gaaatggcacccccctactggctgggtcgggaacttcctgggaaacccaaactgggggtt
SPL01_0068_F02.b : tggcacccctactggctgg
CLNT1_0063_C01.b : ccacccctactggctggtcgcacctctggaacccagactgggntgacaaggcttccttag
LVR01_0098_F04.b : aaaaagggccccccccttctgggcttggtcgggcaactccctggaacccccaaaactggg
OVRT1_0038_F03.b : AATGGCAC*CCCttaatggcgggtccggcaactccggaaaccaaactgggggtgaaatgg
ADR01_0079_C03.b : AATGGCA**CCCCTACTGGCTGGTCGcaacttctggaaccagactggggtgacatggctt
ITT01_0076_A09.b : AAT*GCAC*CCCCTACTGGCTGGTCGccactcctggacacagactggggtgacatggctt
ITT01_0008_F03.b : AATGGCAC*CCC*TACTGGCTGGTCNGCAAttctggaaccagactggggtgacatggctt
ITT01_0072_F01.b : AA*GGCCA*CCCCTACTGGCTGGTCCGCAATTCCTGaacacaaactggggtgacattggc
BFLT1_0019_G09.b : AAATGCAC*CCCCTACTGGCtgttcggcaattccctggaaccaaaaggggggaacaaggc
BFLT1_0036_G01.b : AAGGCAAC*CCCCTACTGGCGGGTCGcaactcctggaaacaaaactggggggacatggct
LNG01_0007_A07.b : AATGGCAC*CCCCTACTGGCTGGgtcgggcactccctggaacaccgactgggggtggaca
KDN01_0051_G04.b : tgaaatgggcggccatatctcggaaacacaagacggggggaacatgggttttatttaaaa
KDN01_0004_B01.b : aatggcaccccctaatggtgggccggaacatcctgaaaaaaaacgggggtgaaatggctt
KDN01_0004_E01.b : aaggcccccctaatggttggccggaaatcctgaaaaaaaaactgggtgaaaaaggcttct
KDN01_0088_A09.b : AAT*GCAC*CCCCTACTGGCTGGTCGGCActcctggaacaagactggggtgacatggctt
KDN01_0039_G05.b : ATGGCACC*CCtactggctggtcggaaatcctgaaaacagactgggtgacaatggcttct
KDN01_0025_D08.b : AATGGCAC*CCCCTACTGGCTGGTtcgcactcctggacacagactggggtgacatggctt
SPL01_0081_F04.b : aaactccccccctggcagaaagcccttttaaccaaggagcctgctaaacttggaggaaag
SPLT1_0074_G11.b : AAT*GCAC*CCCCTAATGGCTGTTCGGgcactcctggaaaacaaacggggggaacatggc
OVR01_0096_F07.b : tttgtctttggggaagtggaacaaagggcccccccccacattggcccgggtgttgtacac
SPLT1_0011_A04.b : AATGGCCA*CCCCTAATGGCcgggtcggcaactctgggaaaaaaaagggggtggacaagg
OVRT1_0005_A04.b : ATGGCACC*CCtactggctggntcgcactcctggacccngactggggtgacaatgcttct
SPLT1_0092_C01.b : AAATGGAC*CCCCTACTGGCTGGTCGGCAactcctgaacaaaaagggggtgaaatggctc
CBLT1_0027_C11.b : cccttactggctggttggaacacccgggaaacaaaacggggggaacaaggcctctttaaa
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : gggagaaatggcccccccccactcggggggggggggaaaatcttcggggaaaacaaagag
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : aaaaataccttcccccttcttggcggtggtggggactactctgtgaaaaataaaatggag
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : ggaaaatgggccccccccaactgggtgggccgggaaattcccggaaaacccgaacggggg
OVR01_0091_H12.b : aaaatggccaccccccctcgtggctgggtccggcaactccttggaaaaaaagaaagtggg
SMG01_0023_C09.b : cctactggctggccggaaattctgaaaacaaaatggggggaaaatggtttcttaaatcct
UTR01_0022_E08.b :
SMG01_0001_G11.b : ccccccacggctggtccgcaatcctggaacaaaagggggggaaaagggctttttaaatcc
ITT01_0063_B06.b : A*TGGCAC*CCCCTACTGGCTGGTCGGCActcctgaacacagactggggtgacatggctt
THY01_0097_B07.b : AAatggcaccccctaactggttggtctggcactcctggaaaaaaaaactggggtgaaaaa
LVR01_0048_C03.b : gaatggcacccccctatggctgggccgcaattcctggaaacccaaaacgggggtgacaat
OVRT1_0036_B07.b : AATGGCAC*CCCTACTGGCtgttccggcactcctggaccacgaactggggtgacatggct
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : gaatgggcaccccccttactggcctgggtcgggcaactccctggaaaaaacaaactgggg
LVR01_0050_H12.b : gaatgggacct
OVRT1_0034_D12.b : AATGGCAC*CCCtaatggctggttcgcactcctggaaaacgaatggggggaacatgcctt
SKNB1_0062_C01.b : tggcancccctactggctggtncgcactcctgnaacacnactggggtgacatggcttctt
KDN01_0094_G04.b : AATG*CAC*CCCCTACTGGCTGGTCGGCActtctggaaccagactggggtgacaatgctt
PCT01_0015_E10.b : AAATGGCA*CCCCTACTGGCTGGTCGGCActcctgaacacagactggggtgacatggctt
BFLT1_0103_F05.b : atggcggtcggaaatccctgaaaaaaacaggggggaaatggttccttaaatccccaagga
BFLT1_0099_C05.b : AAATGCAC*CCCCTACTGGCTGGGCGGCActcctgaacaacgaatggggtgacatggctt
KDN01_0046_B05.b : ctatggttgggtcgaaactcctggaacagaaaggggtgacaagggcttctttagatcttc
LVR01_0091_D10.b : AATGGCCC*CCCCTtactggctgggtcgggaacctcccggaaaccaaaactgggggggga
ADR01_0012_C07.b : ATGGCACC*CCctattgcctggtcgcaactcctggaaccgactggggtgacatggcttct
KDN01_0047_E11.b : AATGGCAC*CCCCTtattggtttgtcggcaactccctgtaacacagactggggttgaaca
OVRM1_0179_C01.b : GATGGCCC*CCACCACAGGCTGGTCGGCaatccttgtactcaaaaaggggtgacaacggc
---------+---------+---------+---------+---------+---------+ 1126
LVR01_0036_C01.b : gggtctcctcgtttactactcctcccctcgacaaacacccacaaataaaccaggtgggcc
CBLT1_0047_H06.b : ccaccccgacgcagagtttatggtggatcctattcggattctccgcggcgcgcccacttt
HTMT1_0033_E10.b : aaaacccaaaaggacggaaccctggggctccagtcaaaaattggggggtgaacccggggc
ADR01_0019_B07.b : tggggggaatactcattcccccatataatagattttatttgcccccctgggtttttttct
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ccccctttaaaagaaatttttttgcccccccgggtattttttcccaaaaccccggggggg
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : gtggtggtgggcttgggtatatatctcttgtgttgatactattaacgttgtgctgtggat
PTG01_0109_G09.b : ggggcccacaccaaaatcgggcgggaacccgggtcccccctttcaaaggtttattttttg
SPL01_0018_E05.b :
OVR01_0060_H04.b : gtggggtgaacaagtggcttctn
OVR01_0096_A06.b :
SPL01_0084_C10.b : tgtggacaaggggcttctttttagaccctcctaagaaatg
THY01_0066_H07.b :
OVRT1_0015_F10.b : ctccaaagaaaggaatcctggggactcgatcaaaatcggggttgaaacccgtggcccccc
OVR01_0032_E06.b : gggggggaaaaaattgggcttttcttttaaaaatccctccaaaaaggaaaaagggaatcc
THY01_0205_F10.b : aaggggcttcttttaaaattcccccaaaaggaaagggttttcctggggggcctttcgaat
LVR01_0063_B05.b : ggacaatgggttttct
OVR01_0033_C02.b : aaaatgggcttttttttaaaaatcccctaaaaggaaaagggaatccctttggggggcttc
THY01_0062_H02.b :
OVRT1_0095_C10.b : gatcttcaagggacgggacccggggctccaatccaaaatggggctggatccctgtccccc
SMG01_0060_C01.b : tcttaaatccttaaagaaaggatcctgtggggcccagctcaaatcggggctggaacccag
TCH01_0063_A12.b : ggctcccttaagatccccagaggaaa
KDN01_0098_A08.b : tttaaatctacaaagaaggatcctgggcatcaatcagaaatctgctggaaccaggactcc
SKNB1_0070_D05.b : taaaatctccaaggacagatcctgtgcctccaatccaaaatctggctggaaccccattac
OVRM1_0039_F04.b :
KDN01_0021_F12.b : tttagatcttcaaagaacagatcactgtgcatcaagtcaaaatcgtgcctgaatccatgt
PST01_0081_A12.b : ccttctttaaaatcctccaaaagaagggtcacgggggccatcaaaccaaaaatctggcct
PST01_0098_C02.b : GCTTtctttagatccctcgaagaaaaggatcctgggggcatcaattccaaatccttggct
KDN01_0067_G01.b : tcttttagatctcaaagnaangatcactggtgcatcaagtcgaantcgtggctgaaatcc
SKNB1_0089_G01.b : tctctgcctcaccctctcccccccgctcctactctctctccccatccccccgctcccccg
BMWN1_0073_G08.b : gatccggggcctcatcaaaattggggggaaacaggtcccccctttaaaagtgttttgttg
ADR01_0031_B12.b : tcctttagatcctccaaggaaaggatcccgtgggctccaaacaaaaaatgggggggggaa
OVRT1_0073_D02.b : cttaaatcctcaagggacggaccctgtggcacaattcaaaacctggtggaatccagtctc
LVRM1_0122_E10.b :
SKNB1_0008_A06.b : agggctttctttaagatccttcgaaaggcaggatcccc
LVRM1_0042_H08.b :
PTG01_0033_E06.b : aagaacctgtggctcaatcaaaatggggcggaacccaggacccccttttcaaaaagggaa
ADR01_0020_F05.b : gtctncttgtggttccagtcaaaattgggctggaatccctggtacccccatttcaaaaag
SPLT1_0014_H11.b : ttaaaattccaaaaagaaggaatccggggggccccaataaaaaataggggggggaaaccc
LVR01_0086_H02.b : catggggctttttttaaaaatccccccaaaggaacagggattcctgggggggaattccaa
ADR01_0048_D01.b : aaatctcaaagacggatctcgtggcatcattcaaattgtggcggaacccagtaccccctt
BFLT1_0035_F07.b : GCTTCTTTAAaaccctcaaaggaggaatcctggtggctctcactcaaaatggggctggaa
LVRM1_0150_A10.b :
PCT01_0008_F05.b : tgctcagtcgaaacgggctggatcatgactccaattcaaatgctattgttgcgccctggc
TCH01_0040_E08.b : gaaaaatggctttcctttaaaatcccccaaaggaaaggaattcccgggtggctctccaaa
SPL01_0057_F08.b : ggaacaagggcct
KDN01_0006_A03.b : tccttaagattctcgaagaaaggatcctggtgcatcattcaaaatcgggctggaatccat
CLNT1_0092_D01.b : aaatcctcaaggacaggtcccggggctcgagtccaaaactggctggaaccctggactccc
BFLT1_0030_G03.b : tcttaaaacccccaaagaaagaatccggggccttcgagtaaaaatcgggggggaacccag
LVR01_0067_C09.b :
SKNB1_0002_H12.b : agaaaaaaatgggggcccccccccccccatcatgggcgcctgtggggtcgggggcaaaac
KDN01_0026_D08.b : taaaatcctcagaaacaagatccctgggcatcgatcagaatcgtggctggatccctgact
KDN01_0049_H11.b : gctttctttaaaatccccnaaggacaggatcacgtgggcactgaattcaaaaattggggc
KDN01_0007_G05.b : nagatctcannagacagatcctgggcatcnagtaaaatcgggctggatccatggctccaa
KDN01_0071_E04.b : tttagatcctcaaggacagatcctnggcatcgagtcaaaaacgtggtggaatccagtact
KDN01_0099_D03.b : tcttaagatcctcaaagacaggatcatgtggcatccagtcaagatcgtggctggatccat
KDN01_0043_A07.b : cttctttagaatctcaaaagacggatcactgtgcatcaagtcgaaatcgtggctgaaatc
KDN01_0043_B03.b : cttctttagaatctcagaggacagaatcactgtgcatcgagtcaaagacgtgcctggaat
KDN01_0062_F04.b : GCTTCTTaagaatctcaaangacagatcctgtggcatnagtcgaaaacgtggctggaatc
KDN01_0082_F01.b : CCTTCTTTAnaatctcaaaggaaggatcactgggcctcaaatcaaaatcctggctgaaat
KDN01_0096_H10.b : GCTTCTTTAgaatctcaaagaaaggatcactgtggcatccagtcgaaatccgggctgaaa
KDN01_0040_E11.b : GCTTCCTTAAGATCCTC*AGAagaacgggatcctggtggcatcgaatcaaaaaatcggct
KDN01_0008_B06.b : GCTTCTTTAgatcctcagaggacagatcctgtgncatcnagtcaaaatcgtggctgggat
PTG01_0074_F05.b : gcacaaaaaaaaaaaagggggggggaccccccccccccccccctctaaaaaaaaaatttt
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : taggggggggaccccgttcccccttttcaaaaggtaatttttgccccccggggattttcc
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : ggatcctggggactcagcaaaaactgggctgaaaccagtgccccatttcaaaaggttaat
UTR01_0015_G03.b :
SMG01_0062_G07.b : gaaggatcctggggcaccatcaaaatcggggcgggacccaggatccccattttaaaaggc
UTR01_0088_F03.b : ctttctttaaaaaccccaaagaaggaattcctggggcatctcattaaaaatcgggggctg
SPL01_0052_G07.b : ggggaacattgggcc
LVR01_0050_C03.b : a
MLN01_0054_H07.b : aaggaaggatccctggtgcttcaatccaaaatcggggggggaaaccctgttctcccattt
UTR01_0047_D02.b : gaaaaatggggcttcttttaaaaatccttcaaaa
SPL01_0068_F02.b :
CLNT1_0063_C01.b : atcccccaaggaaggatcccggggcaccaagccaaatcgggccgggaacccagtaccccc
LVR01_0098_F04.b : ggggaacaatggggctttcttttaaaaattccctcccaaaggaaacaggatttcccttgg
OVRT1_0038_F03.b : cttccttaaaatccctaaaggacaagaacctgtgggcatccattccaaaatctgggttgg
ADR01_0079_C03.b : ctttaaatctcaaaagacagatcctgtgcatcnatcaaaaatctgctgggatccatgact
ITT01_0076_A09.b : ctttagatcctcaaagacggatcctgtggcatcagtcaaaatcctgctggaatcctgtac
ITT01_0008_F03.b : ctttagatcctcgaggacaggatcctgttgcatcnagtcnaaatcggggctgaattccat
ITT01_0072_F01.b : ttctttaaatcctcaaaggacaggatcacgtggcatcaagccgaaattctggctggaatc
BFLT1_0019_G09.b : tttttttaaatccccaaagaaaaggatcccgtggcctccaatccaaaatcgggccgggaa
BFLT1_0036_G01.b : tctttaaaaccccaaagaaaggatcatggtggcatcagtcaaaaatctgcgtggaaaccc
LNG01_0007_A07.b : ttggccttcctttaaaatccctccaaaaggacagggattacttggtgggcatccaagatt
OVRT1_0068_C01.b : ctctttaggatctccaaaggaaggatccttgtgcatcgagtcaaaatgtgggcgggaacc
KDN01_0051_G04.b : tcctctaagcacaggatgcagggggttatgagatcaaaaaatcgggggggaaaaccccgt
KDN01_0004_B01.b : ctttaggatcccaaaaaaaggatacctggggatcaaatccaaaatccgggcgggaaccca
KDN01_0004_E01.b : ttaaaatccccaaagaaaggatccctgtggatccaaccaaaaataggggcggaacccctt
KDN01_0088_A09.b : ctttagatctcagaggacagatcactgtgcatcaatcaaagtcgtggctgaatccatgtc
KDN01_0009_G09.b : cttctttagaatctcnaagacaggatcctgtggctcgagtccaaaatctggctggatccc
KDN01_0025_E11.b : GCTTNCTTAAGATCCTC*AGAagacggatcactgtggctccaatcagaaatcgtggctga
KDN01_0039_G05.b : ttaaatcctcaaagacaggatcctgtggcacgattcgaaaacgtgcctgaaaccctgtac
KDN01_0025_D08.b : cttnagatctcaaagacagatactgtgcatcgatcagagtctggctggatccatgtatcc
SPL01_0081_F04.b : ttaaagaggttcgggggtgggccctgggggaaaaaaccttaaaactgggctggaccccca
SPLT1_0074_G11.b : ttccttaaaatactaaaagaacggaatcctggggcatcagttcaaaattggggcgggatc
OVR01_0096_F07.b : attcctttgaaaatacaaatactgggggtggtaccactgtgtctttccctttaacaaaac
SPLT1_0011_A04.b : cttctttaaaatctcaaagaaaaggatactggggcatccaatcaaaaatctgggcgggat
OVRT1_0005_A04.b : taaaatcctcaaaggacggatcacgttggcatcaatcaaaataggggcgggaacccagga
SPLT1_0092_C01.b : tttaaattctcaaaaaaagaatcctgtggcctcaatcaaattggggcggaaacccatgta
CBLT1_0027_C11.b : ttcccaaaaaaagggatccctgggcccaaagccaaaaatctgggtggaaacccattaact
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : ggggggggacaaagggcttctttttataacccccctagagaaaaggagcattcgtggtgc
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : ggtcaaataatgcttttttttattataccctccctaagagattggttatcttgtttgcac
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : gggaaaattggctttctttaaaaaacccccaaaaggaaggggaatcctctgtggggcttc
OVR01_0091_H12.b : ggtgaaaaatggctttcttttaaaatatcctccaa
SMG01_0023_C09.b : tcaaagaaaggatcctgggcctctcaaccaaaatcgggcggaaacccggtatcccctttt
UTR01_0022_E08.b :
SMG01_0001_G11.b : ccaagaaaggaatctctgggccccagtcaaaaatgtggctggaaccccgtaatccccttt
ITT01_0063_B06.b : cttnagatctcagnagacagatcactgtgctcnagtcaagatcgtgctggatccctgtac
THY01_0097_B07.b : gggctttttttaaaacccccaaaggaaaggaatccctgtgggcatcgaatcccaaaaaat
LVR01_0048_C03.b : gggttttctttaaaaatccccaaaagaaaaggaa
OVRT1_0036_B07.b : tctttaaatcctcaaaggaaggatcctggggcatcaatcaaatatctggctgggaaccct
ADR01_0059_D09.b : GCTTCTTTAgatcctcagaaggaaggatcactgtggcatcaagatcaaaatcgtggccgg
OVRT1_0070_B08.b : cttctttaaaatctccgaggaaggatcctgtggcatcnagtcaaaatcgggctgaatcca
BFLT1_0022_H11.b : GCTTCTTTAAatccttcaaggaaaggatcctgggccatcatccaaaaatgtggctggaac
KDN01_0031_H05.b : tctttaaatctccaagaaaggatccctggggctcaattaaaaatcgtgcctgaatccctg
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : ggggaaaaaatggcttttttttaaaaatacccccaaaaagaaacaagaatccccttgggg
LVR01_0050_H12.b :
OVRT1_0034_D12.b : ctttaaatcctcaaagaaaggatcctggggcatcaagtcaaaaacgtggtggaaacccag
SKNB1_0062_C01.b : tanatctccnnnagaaggatcatgtggctccantccaaaatcgtggctggaatccagtac
KDN01_0094_G04.b : tcttaaagatctcagaggacagatcctgtggcatcgagtcgaaatcgtgctggaatccag
PCT01_0015_E10.b : ctttagatctcnaaagacagatcctgtggctccaatcaaatcgggctggaatccggactc
KDN01_0021_F06.b : tacttaatatctgcaaagacagatcactgtggcatctgatcgatatcggggctggaatcc
PCT01_0014_C05.b : GTTTCTTTAgaatctcaaaggaaggatcctggggcatcgagtcaaaatcgggctggatcc
BFLT1_0103_F05.b : aggatccctgggctcaaataaaattggggcggaaccatgtcccccattttaaaagcgtat
BFLT1_0099_C05.b : ccttaaaatcctcaaggacggatcacgtggcatcaatcaaaaacgggctggaatccagga
KDN01_0046_B05.b : aaagacggaatcttgggtcttagtctaaaaccgggatggaacccatatccccatctcaaa
LVR01_0091_D10.b : aaatgaactttttttaaaattcctcaaaagaacaggaattccctgggggcaatccaaggt
KDN01_0011_B05.b : GCTcttttagatccccaaagaaaggatcactgtggntcgagtcaaagacgtggctgaatc
ADR01_0012_C07.b : ttaaatctccaaggaaggtcccggggcatcagtccaaatcgggctggaaccctgtctccc
PCT01_0007_H05.b : GCTTCTTTAgatcctcaaagacaggatcactgtgcatccagtcaaaatctggctggatcc
ILNT1_0064_G06.b : GCTTCTTTAgatcctcaaggacagaatcactgtgcatcgattcaaaatcttggcgggaat
OVR01_0100_C06.b : GCTTCTTTAAGATCCTC*Acaaggaaaggatcactgtgggcatccagatcaaaaaatctg
DCI01_0021_C12.b : GCTTCTTTtaaatccccaaaagaacagatccctggggcatccagtcaaaaatctgggctg
KDN01_0047_E11.b : tggcttcttttaagatcttcataggacaggatcacttgtgcctcaaatctaaagattgtt
LVRM1_0037_A08.b :
OVRM1_0179_C01.b : ttcgatag
DCI01_0028_F01.b : tccttaaaatcctcaaagaaaggtatcctgggcctcaatctcaaaattcgggctggaacc
---------+---------+---------+---------+---------+---------+ 1184
LVR01_0036_C01.b : acctgtgaactaactcccacggtggggcccccctctcctcttccctctcttc
CBLT1_0047_H06.b : tattaccgctttcagaagaaatatatttatgtcgcgccaccggggtgatttactctacat
HTMT1_0033_E10.b : cccccttttctaaaagcttaactgtttggccgccccggggaattttccccccaatcaccc
ADR01_0019_B07.b : cctaaatctctttattgtggtgggtgggacatatatattcttttttttttataaacaaga
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ggggggggggggaaaaaaaatattttttttttttttaaaaaaaaagtgttttttttccgc
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : cact
PTG01_0109_G09.b : gcccccggggggttttctcccaaaaaccctgaattgggggggagggggaaaaaaaaattc
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b : tttcaaaaggtttatttttgtggcccccggggcatttttccccaaaataccttgaattgg
OVR01_0032_E06.b : cctttgggggggacttcctaaaacctccaaaaaaaatatctggggggggggtggggaaaa
THY01_0205_F10.b : ttcaaaaaaattttggggcggggggaaacccccctt
LVR01_0063_B05.b :
OVR01_0033_C02.b : tcagagttcaaaaaaaatcttggggggctcttgggaaataccccccgggtatttttctcc
THY01_0062_H02.b :
OVRT1_0095_C10.b : attttaaaagggtgatcggttgcccccccgggcattttccccaataaccctggaatgggg
SMG01_0060_C01.b : gactccccttttaaaaagggttttgtttggccccccgggggattttttccgcataaccct
TCH01_0063_A12.b :
KDN01_0098_A08.b : catttctaagggtgattgttgccgcccggggcattttccgaaaaaaccctggaatggggg
SKNB1_0070_D05.b : cccctttcaaaatcctaatcgttttgcccccctgggcatttttcccaaaacctggattgn
OVRM1_0039_F04.b :
KDN01_0021_F12.b : actccccattctaaaatgctgattgtttgccgcccgtgggcattttttcccaataaaccc
PST01_0081_A12.b : gggaaccccgggaactccccttttctaggaatggcttatctgtttggccgcccctgtggg
PST01_0098_C02.b : ggatcccatggacccccattttctaaaaagcttgatcggttggcccccctggggcatttt
KDN01_0067_G01.b : atgtactcccaattctaaaatgctgatcgttggccgcccctggggcagttttccgncaaa
SKNB1_0089_G01.b : ttctatattactctccccgccccttcacgtccacttacaccccccccctcctccttcgca
BMWN1_0073_G08.b : gcccccggggaattccccaaaacccttggatggggtgggggggaaaaatttttttttttt
ADR01_0031_B12.b : ccccggaacccccctttttgggaaggggttatttttttgccccccccgggggaatttttc
OVRT1_0073_D02.b : cccttcttaaaggttaatggttggcccccctgggcatttttccccataaccctggaattg
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : tgtttgccccctggggctttttcccaaaaccctgaatgggggggggggagaaaaaaattt
ADR01_0020_F05.b : gtttatcgtttggcgcccctggggcattttccccaataaaccttggaatgtggggtttat
SPLT1_0014_H11.b : cggtgcccccctttttaaaaaatcaatttttttttgccccccccggggaattttttccca
LVR01_0086_H02.b : gtcccaaaaaaattgggggggcgtggggaatccccccctgggttaccctccccccccttt
ADR01_0048_D01.b : tctaaatgcgatttgttggccgccctggggcattttccccattaacccttgaatgggggg
BFLT1_0035_F07.b : ttccatgtactcccatttcaaaaatgctgattggtttggccccccctggggaatttttcc
LVRM1_0150_A10.b :
PCT01_0008_F05.b : attttcccaaaacctggatggggtgaggggaaaaaaattttttttttattaaaaaaagct
TCH01_0040_E08.b : tccaagaaactgggggctggagaacccccgtgttcttccccctttcttaaa
SPL01_0057_F08.b :
KDN01_0006_A03.b : gtactcccatttctaaaatgctgattttttgcccccctggggcattttcccgcaataacc
CLNT1_0092_D01.b : tttctaaagggaatcgttggcccccgggggaatttccccaaaacccttgaatgggtggaa
BFLT1_0030_G03.b : gtctcccacttttaaaaggctaattgttgtggcccccgggggcatttttccccattaacc
LVR01_0067_C09.b :
SKNB1_0002_H12.b : tttccttggtggagaaacacacaaaaaacccggggggggggtgtgaaacaaattggtgcg
KDN01_0026_D08.b : cacattccaaaaggctgactgtaggcccccgggccatttttcgaaaaaaccctgtgatgg
KDN01_0049_H11.b : tgggaaacccctgtactcccccattttccaaaattgctgaatttgtttggcccccccctg
KDN01_0007_G05.b : ttctaaangctgattgtttggcgccctgggcattttcgcaataacctggatggggggagg
KDN01_0071_E04.b : cccattctaaantgctaatcgttggcccccctggggaattttccccaataaccttgggat
KDN01_0099_D03.b : gtatccccattctaaagtgctgatcgttggcggccctgggcattttccccatataacctt
KDN01_0043_A07.b : catgtactcccatttcagaatgctgatctgttgccgcccctgggcagttttcccccataa
KDN01_0043_B03.b : ccatgtactcccctttctagaagtgctgatctgtttggcgccccgtgggcagtttttccg
KDN01_0062_F04.b : catgtactccaatttctagagtgctgatctgttgggcggccctgggcagttttcggcana
KDN01_0082_F01.b : ccatgtatcccccattctaaaatgcttaacttgttggcccccctggggaatttttcccga
KDN01_0096_H10.b : tccatgtactccccattctaaagtgctgatcggttgccgccccggggcatttttccgcat
KDN01_0040_E11.b : ggaaatccatggacccccaatcctaaaaatgctgatttgtttggcccccctgggcacatt
KDN01_0008_B06.b : ccagtactccccattctaaantgctgatcgttgggcgcccctggggcgttttcggcaata
KDN01_0100_G05.b : aaatccatggactccccattctaaaatgctgattgtttggcgcccctgggcagttttccg
SKNB1_0008_B08.b : TG
KDN01_0015_E02.b : TGGAATCCatgtactcccatttctaaagtgctgatctgtttgccgcccctggggagtttt
KDN01_0094_D09.b : TGGAATCC*ATGTACTCCCCATTTCAAGAAtgctgatctggtggcccgcccctggggcaa
PTG01_0074_F05.b : tttttcccccccccccgtttttttctctctacaaaaaccccggggggggggggggggggg
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : caaaaaccctggattggggtgaagggggaaaaaaattttttttttgatcaaaaaagggga
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : ttttggcccccggggcatttccccaaaaaacctgtgatggggggaaggggaaaaaaattc
UTR01_0015_G03.b :
SMG01_0062_G07.b : gtatgtttggccccccggggattttccccataaccttggaatgggggggagggggaaaaa
UTR01_0088_F03.b : gaatcccgtggcccccccatttctaaaaaggcgaatatgtttggccccccccg
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b : tcaaagtgcttatctttttgcccccccggggcatttttcccgacataacccttggaatgg
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b : ctttcaaaagggttaatgtttggcgccctggggaattttcccaaataactggatgtgggn
LVR01_0098_F04.b : ggggcccttctaaagttccaaaaaaattttggtggggccgggggaaaatccccccttggt
OVRT1_0038_F03.b : aacccaagtacctcccatttcaaaaggtgtttcgtttggccgcccctggggaattttccc
ADR01_0079_C03.b : cccattcagaatgctgactgtttgccgccctgggcattttccccaaataccttgggatgg
ITT01_0076_A09.b : tcccatttcagagtgctgattgtttgccggccctgggcaatttttcccataaaacctgga
ITT01_0008_F03.b : gtatccccattctagaatgctgatctgttggccccccttgggcaattttccgcaaaaaac
ITT01_0072_F01.b : catgcactccccatttcaaaagggctgattggttggcccccctgggccattttttcccca
BFLT1_0019_G09.b : tccctggactccccatttccaaaagtcttactgtttggccccccccgggcaatttttccc
BFLT1_0036_G01.b : tgtatccccctttcaaaaatgctaatgtgtttgcccccctggggcatttttcccaattaa
LNG01_0007_A07.b : caaaaaattcggtgggcctgggaattcccccatttttatc
OVRT1_0068_C01.b : caatgtacccccttttaaaatgctgatttgttggccccccggggcatttttcccaataac
KDN01_0051_G04.b : gtatccccccattttaaaaaggtgaacattactgggcccgccccgggttatattcttccc
KDN01_0004_B01.b : tgacccccctttctaaaaggctatctttttggccccccgggggaattttccccaaatacc
KDN01_0004_E01.b : gtacccccctttcaaaaaggttaatttgtttgccccccctgggaaaattttccccaatta
KDN01_0088_A09.b : tccccctttcaaaatgctatcggttggcccccctgggcagttttccgcataaacccttga
KDN01_0009_G09.b : agtaccccaattctaaaaggcggattgtttgcccccttgggcatttttcgcatataactt
KDN01_0025_E11.b : atcccatgtactcccaattctaaagtgctgaactgtttggcgccccggggcagtttttcc
KDN01_0039_G05.b : ccccatttcaaaaggcgatctgttgggcgccctgggcaattttcccgaaaaacccttgga
KDN01_0025_D08.b : ccattcagaatgtgatcgttggcgccctgggcattttccccntaaaccttggatgggttg
SPL01_0081_F04.b : aa
SPLT1_0074_G11.b : cccagaccccccttttcaaaaggtgtaattgtttgcgccccctggggaattttcccccaa
OVR01_0096_F07.b : tcccccagagagcaagacgagttacccctgtgctgtttcc
SPLT1_0011_A04.b : cccagtatccccattttcaaaaagggtaatcttttgcccccctggggcattttttcccaa
OVRT1_0005_A04.b : ctccccttccaaagtgcgaatcgtttggcgccccggggagatttcccgccaaaaccttgg
SPLT1_0092_C01.b : tcccctttcaaaatgtaattttttggccccccgggaatttttccccataaaccctgaatt
CBLT1_0027_C11.b : cccctttcaaaaaagtttattttgttgccacccccgggaaatttttcccacaataaaccc
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : gttccagtaccaaacaattagagtgtgggaagtccctcagatacctcct
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : tctctacataataaagctagttgggtgggagacctcacggtgattccctacctttatctt
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : aaactccaaaaaatccgggggttgggaaatccccatggtatcccccccccctttttttca
OVR01_0091_H12.b :
SMG01_0023_C09.b : taaaaggcgattgtttgcccccctggggaattttccccaaaaacccctggaatggggtaa
UTR01_0022_E08.b :
SMG01_0001_G11.b : ctaaaaattctattttttgccccccctggggaattttccccaatataccttgtaatttgg
ITT01_0063_B06.b : tcccattcaaagtgctgatctgttgccgccccggggcgttttccgcattaaccctggatg
THY01_0097_B07.b : cggggctggggaaatcccaatgttcctctcccatttttctaaaaaagtgggttaaatttt
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ggtatccccattcaaaaatgctaatcgttgggccccccggggcatttttcccaataaccc
ADR01_0059_D09.b : aaacccaggtactccccattctgaaaggctgatctgtttgccgccccggggggaattttc
OVRT1_0070_B08.b : tgtatccccattcaaaatgctaattgtttgcccccccggggcaattttccccaaaaccct
BFLT1_0022_H11.b : cccggactccccctttcaaaaaggtaattttttggccccccccgggggatttttccccca
KDN01_0031_H05.b : tacccccatttctagaatgctgatcgtttggccccctggggagttttccccagaaaaccc
KDN01_0017_D01.b : TGGAATCCatgtactccccattctaaagtgctgatctgtttgccgcccctggggcagttt
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : ggcattctcaagttccaaaaaaaatttggggggcttgggaaaatccccccgtgttaatcc
LVR01_0050_H12.b :
OVRT1_0034_D12.b : gtacccccatttctaaagtgcttattgttgggccccccctggggaatttttccccaaaaa
SKNB1_0062_C01.b : tcccccttcaaaatgctaatcgtttgcccccccgggcattttccgcgtacctggaggggg
KDN01_0094_G04.b : tactcccattctaaaagctgatttgttgccgccctgtggcatttttccgcatataccctt
PCT01_0015_E10.b : catttcaaaagctaatcgtttgccccctgggacttttccccaaaaccctggatgggtgta
KDN01_0021_F06.b : atgtactcccattcaaaantctgatctgttggcgcccatgagcattttcccgcatatgcc
PCT01_0014_C05.b : atgactcccattccaaaatgctgatctgttgccgcccttggcaatttttcccaattaacc
KDN01_0099_B12.b : TGGAATCCatgtactcccaatttcaaaagtgctgatctgtttgccgcccctggggcattt
KDN01_0040_F03.b : TGGAACCC*AGGTACTCCCCATTTCTAaaaggctgatttgtttggcggcccctgggcatt
BFLT1_0103_F05.b : tttttgccccccgggcaattttcccaataacccgtgattgggggttagggggaaaaaaat
BFLT1_0099_C05.b : actcccctttcaaaaagctgaatcgtttgccccccctgggaaatttcccccaaaaaccct
KDN01_0046_B05.b : agggtattgcttggccctcccgggaattattcccgacaaacccttgcatgggggttaggg
LVR01_0091_D10.b : caaaaaaatcctggggctgggaaatccccaagggtacccccccccttttttcttaaaaaa
KDN01_0011_B05.b : ccatgtactcccatttctaaagtgctgatcgtttggccgccctgggcatttttccccaat
ADR01_0012_C07.b : attctaaaatgcgatcggttggcgccctgggcagttttccccataaacttgggattgggg
PCT01_0007_H05.b : atgtctccccatctaaagtgctgattcgtggcgccctggggcatttccccaattaaccct
ILNT1_0064_G06.b : ccatggtatccccttttcaaaattgctaatcgttttgcccccccctgggcattttttccc
OVR01_0100_C06.b : ggctggaaacccctggtactcccccattttctagaatgtgctgaatttgtttgggccccc
DCI01_0021_C12.b : gaaacccaaggactcccccctttttaaaaaggctgatttgtttgggccccccccggggca
KDN01_0047_E11.b : ggtggaaaccccatgtctccccttttctaaaaaagctgatctgttttgccgccccccgtg
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0028_F01.b : caggtcctccccatttaaaaaggtcttatgtttggcccccccgggggcatttttccccca
---------+---------+---------+---------+---------+---------+ 1242
LVR01_0036_C01.b :
CBLT1_0047_H06.b : cctaagcctccgagaatgcggaggtgagtgggagatatgacngctcctcatcacttgtct
HTMT1_0033_E10.b : ctgtgaatgtggggtggaaggggggaataaaacttttttttttgtagttatataaaaggg
ADR01_0019_B07.b : tattaattactcgacgatatgggacacttctttccaatttttctcagataatatctattg
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : gggggggggggggccccctcttcttttcttttttttaaaaaaaaatctgtttgaggggcc
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b : ttttttttttttaaaaaaaggggttttttaagggccagagggggggggaaccctggtgtc
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b : ggggttagggggagaaaaaattttttttttttagatcaaaagagaggtttttnaggcgcc
OVR01_0032_E06.b : atctcccccccttgttggttccccctccccccccccctttttttttttcttt
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b : ccccccccttttttt
THY01_0062_H02.b :
OVRT1_0095_C10.b : gtgaaggggaaaaaaaatcttttttttgattaaaaaacgggtttttaaaagcctggaggg
SMG01_0060_C01.b : tggatgggggggggagggggaaaaaaatcttttctttttgttcaaaaaggggattttaag
TCH01_0063_A12.b :
KDN01_0098_A08.b : ttatggggaaaaaaatcttttttcttgattaaaaaggcggattttaaggccccggagggg
SKNB1_0070_D05.b : nnggggggggnngngaaaaaaatttcttttcttttttcaaaaaaanngtttttaagcccn
OVRM1_0039_F04.b :
KDN01_0021_F12.b : tggaatgggggggagggggggaaaaaaaatctttattccttagtcaaaaaaaacggagtt
PST01_0081_A12.b : acattttctcccccaaaaaaaccctttggaaatgggggttgggataggggggaatagaaa
PST01_0098_C02.b : ttccccaaatacccttgggaatggggtttaagggggaaagaaagtcttttttcttgtatt
KDN01_0067_G01.b : aaaccttgggatggggggtagnagggggaaataaaaaatttttttttctttgattcaaaa
SKNB1_0089_G01.b : cccatacaacgatgtccccctccctccactcttctacacgctcccccccctccctcccat
BMWN1_0073_G08.b : tataaaaagcgttttaaccgcgagaggggggccctttttctccatttttaaaaaaaggtg
ADR01_0031_B12.b : ccccaaaaccccttggagggg
OVRT1_0073_D02.b : ggggtgaaggggaaaaaaaagctttatctttagataaaagggggggttttaaagcccaga
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : tttttttttacaaaaaagagcgtttaaaagccccaggagggggcactctgtcctcacatt
ADR01_0020_F05.b : ggggaaagaaaattctttatttttagttcaaaaaagccgattttaaaggcctcaggaggg
SPLT1_0014_H11.b : caaaataacccctgaaaaggggggtgtaaagggcgaaaaaaaaattttttttttttttat
LVR01_0086_H02.b : tttcttcataaaaaaaaagggggcgtcttttatat
ADR01_0048_D01.b : tatgggggaaaaaaattctttttctttgnttaaaaaagagagattttaaagccctcagag
BFLT1_0035_F07.b : caaaaatcccccttgaattgggggtgaaaggggatataaaaattctttttttttaattca
LVRM1_0150_A10.b :
PCT01_0008_F05.b : tttaaagctaaaggtgggaaccgtttcatatttttagaaacatagttggaagggttttaa
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : ctggaatggggtttaagggggaaaaaaaaagctttttccttgattcaaaaaagcgagaat
CLNT1_0092_D01.b : gagggaaaaaaattttttatctggttaaaaaaagggggttttaaaggctagaatgggggg
BFLT1_0030_G03.b : cctggaaattggggttgaggggggaaaaaaattccttttttttgatccaaaaaacggggg
LVR01_0067_C09.b :
SKNB1_0002_H12.b : ccttc
KDN01_0026_D08.b : gcgggatggggatagaatccttttatcttattcaaaatcagatttttgagacctgggggg
KDN01_0049_H11.b : tgggcaattttttcccccataataacccttgtgaattgggggggtgatagggggaaatga
KDN01_0007_G05.b : gggggaaaaaaaagttttttcttgatttaaaaagggggttttaaggcttgaatggtgggg
KDN01_0071_E04.b : ggggtggatggggaaaagaaatgtttttatcttgattcaaaaaagcggattttaaaggcc
KDN01_0099_D03.b : gggatggggggtgatgggggaaaggaaatccttattcttaattcaaaaaatgggggattt
KDN01_0043_A07.b : accttgggatggggtggatgggggaataaaatgtctttttcttgagttcaaaaaagccga
KDN01_0043_B03.b : caaaaaacccttgggatgggggtggatgggggggataagaagtgcctttatctttgattc
KDN01_0062_F04.b : taccntgggatgggatggaaggggggggaaaaaaatttctttattttttagtgaaaagaa
KDN01_0082_F01.b : attaaccctgtgaattgggggtggaaggggggaaaaaaatgtccttattccttgaattca
KDN01_0096_H10.b : ataacccttggaatggggtgggatgggggaaagaaatgcttttaatcttgattcaaaaaa
KDN01_0040_E11.b : ttttccgccatataacccttggaaatgggggtggatggggggaaaaaaatagtcttttat
KDN01_0008_B06.b : acccttggatggtggtggggggggaaaaaaaagttttttttttttgtttaaaaaaaagga
KDN01_0100_G05.b : cataaacccttggaatgggggttgatgggggaaagaaagcctttatctttaattcaaaaa
SKNB1_0008_B08.b :
KDN01_0015_E02.b : ttcccagataaccctggaatgggtggaanggggaaaaaaaaaaaaatttttttctttggt
KDN01_0094_D09.b : tttttccgcataatacccttgggatggggggggtgatggggaaagaaaagtctttattct
PTG01_0074_F05.b : agagagaagaataatatttttttttttctttataaaaaaaaaaaaatttgttttttngnc
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : tttaaaggcccagaggggggcaccctgtgttcctaatttttttgaaaacatagggttgga
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : tttttctttattcaaagaagagattttatacgcccaggaggggggcaaaactgttcccca
UTR01_0015_G03.b :
SMG01_0062_G07.b : aattttttttttgtttcaaaaaagaggtttttaaaccccagaggggggcaatcccgtcca
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b : gggggaatgggggaaaaaaaatcttttttccttgattccaaaaaagcgagatttttcagg
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b : nnnnnnnnaggaggagaaaaa
LVR01_0098_F04.b : tttccctccccccccctttttttcttttaaaaaaaaagggtgggccttgtgaaatatttc
OVRT1_0038_F03.b : ccaaaaacccttgggatagggggttagagaggggaaaaaaaattttttttctttgattaa
ADR01_0079_C03.b : ggggaagggggaagaaatctttttctttaatcaaaaaaaaggctttttaagcccaggatg
ITT01_0076_A09.b : atggggggtgatgggggaaagaaatgcttttttcttggttcaaaaaaacaggatttttaa
ITT01_0008_F03.b : cttgggattggggtggaaggggggaaagaattgtctttatccttagatcaaaaaagccgg
ITT01_0072_F01.b : aaaaaccctgggtatggggggtatagggggaaaaaaatgtctttattctttgttcaaaaa
BFLT1_0019_G09.b : caatataacctgggaattgggggggtaaggggggaataaaaatctttttttttgagtcca
BFLT1_0036_G01.b : cccttggaattggggttaagggggaaaaaaaatcccttttctttgattaaaaaaaaaggg
LNG01_0007_A07.b :
OVRT1_0068_C01.b : ccttggaatggggggggatagggggaaaaaaaattcttttttttaatccaaaaaaggcgg
KDN01_0051_G04.b : gcgactaaccctcttaaacagagggtgttgagaggcgaaataaaaactccttatattttt
KDN01_0004_B01.b : cttggaattggggtaaagggggaaaaaaaaaatcttttttctttggttcaaaaaaaccgg
KDN01_0004_E01.b : aacccttggaatggggtgttaaggggggaaaaaaaaattttttttttcttgtattcaaaa
KDN01_0088_A09.b : atgggggggatggggaaaaaaagtttttatctgattcaaaaaaaccggattttaacggcc
KDN01_0009_G09.b : ggatggggtggaggggggaaaaaaaaatctttttctttgttttaaaaaaacgaggtttta
KDN01_0025_E11.b : caatataccttggaatgtggggtgaaggggggaatagaaatgcttttttcttggatttaa
KDN01_0039_G05.b : tggggtggaagggggatagaaatgttttttctttaattaaaaaagccgaatttaaacggc
KDN01_0025_D08.b : aaggggggaagaattgctttatcttagtcaaaaaagccgagtttaaagcctcagaagggt
SPL01_0081_F04.b :
SPLT1_0074_G11.b : aaaccctggaatgggggttaaggggggaaaaaaatttctttttcttttattcaaaaaagg
OVR01_0096_F07.b :
SPLT1_0011_A04.b : taaccccttgaatgggggtttaaaggggaaaaaaaattctttttcttttatttaaaaaaa
OVRT1_0005_A04.b : gatggggggggggggggaaggaaaaattttttttttgtttcaaaaaaaaggcgtttttaa
SPLT1_0092_C01.b : gggggtagagggggaaaaaaattttttttctaaattaaaaaaaacgcttgtttaagcccc
CBLT1_0027_C11.b : cttaaattgggtgttaagggggaaaaaaaactcttttcttctgtaattcaaagaagacga
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : aacataacctttaattctgacttactccccg
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : aaaaaagtggcttttgaattttgtgttttgtgggccccgccccccctcggggggggagga
OVR01_0091_H12.b :
SMG01_0023_C09.b : gggggaaaaaaaaatttttttttttatttcaaaaaaaccgattttaaagcgctaaagtgg
UTR01_0022_E08.b :
SMG01_0001_G11.b : gttttaaggggaaaaaaaattttttttcttttgtttaaaaaaagggagattttaaagccc
ITT01_0063_B06.b : gggnttaaaggggggaaggaatttctttttctttgattcaaaaaggcggatttaaaagcc
THY01_0097_B07.b : gtttttggccccccccccccgggggggcc
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ctggaattggggtggaagggggaaaaaaaattttttttcttaactaaaaaagagagggtt
ADR01_0059_D09.b : ccgcatataaccctgggaattggggggttaatgggggaataaaaattcttttattcttga
OVRT1_0070_B08.b : tgaattggggttaagggggaaaaaaagcttttttcttaattaaaaaaaacggcttttaaa
BFLT1_0022_H11.b : aaaacccttttgaatgggggggaaagggggataaaaaaattctttttttttgtattcaaa
ITT01_0048_B12.b : ATTTTTcccgccaaaaaacccctgggaattgggggttgatagggggaaaaaaaaagcttt
KDN01_0031_H05.b : ttggattgggtggaggggggaataaaaagtctttttctttattccaaaaaaggagaattt
KDN01_0017_D01.b : tcccgacatataccctttggattgggggtggatgggggaaaggaatgtcttttatctttg
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : cccccccccttttttttctaaaaaaaaagggggcttgaaaaattttgtgtttttttttgg
LVR01_0050_H12.b :
OVRT1_0034_D12.b : accccttgatatggggggtgaaggggggaaaaaaaaaatcttttttcttttgattccaaa
SKNB1_0062_C01.b : ggggnnnnnnnnaaaaaaaaaaaaatttttttttttttttaaaaaaaaagggttttttta
KDN01_0094_G04.b : ggaatgggggttgaggggggaggaatgtctttattttgagttcaaaaaagcaggatttta
PCT01_0015_E10.b : ggggggaaaaaaatctttttctttattaaaaaaagcggttttaaagcctaagaatggtgg
KDN01_0021_F06.b : ctagaatggagcgtaggggggaattgaatgtctttctccttagtcttaagaatcagaatt
PCT01_0014_C05.b : ttggatggggggatgnnggggaaaaaaaatttttttttctttatttcaaaaaacggggtt
KDN01_0099_B12.b : ttcccgcatttaacccttgggaattggggtgggaatgggggaaaagaaaagtcttttatt
KDN01_0040_F03.b : tttcccccatataacccttggaattggggtgaagggggggatggaaatttcttttttctt
KDN01_0079_B12.b : atttttccgcatataacccttgggatgggggtgttaagggggaaaaggaaatgcttttaa
BFLT1_0103_F05.b : ttttttttatttaaaaaaagggtttttaaagcaaaggaggggggcacctttttgccctct
BFLT1_0099_C05.b : tggattggggtggaagggggaaaaaaatgcttttttcttaaatcaaaaaaaaagggtttt
KDN01_0046_B05.b : gataagaaagatcttttttgtagtctaaaaatacgaatttgtacgcctatggaggtgtgt
LVR01_0091_D10.b : aggggttgaattctctgttttttggggccccccccccccggggggggggggaaaattttt
KDN01_0011_B05.b : taaccttggaatggggtggagggggggaataaaaattttttttttttgattcaaaaaagc
ADR01_0012_C07.b : ttgatggggaaagaaatgctttattcttattcaaaaaagcagcgttttaaaagcccagaa
PCT01_0007_H05.b : ggattggggttgatgggggaaagaaatggctttatctttattcaaaaaagcagggtttaa
THY01_0064_D07.b : CAGTTTTTCCCc
SPLT1_0083_B04.b : ttttttccccaatataaccttgggattggggtgtgatggggggaaaagaaattcttttat
ILNT1_0064_G06.b : caaaaaaccccttgaattgggggtgtaggggggaaagaaaattctttatccttaattaaa
KDN01_0067_B05.b : GCAGTTTTCCCGCAGTATAGCCCTTGGGATGGGGtgtgatggggggataagaatgtcttt
OVR01_0100_C06.b : ccctgggggcagttttttccccgccacatataacccctttggaatttgggggttctgaat
DCI01_0021_C12.b : aattttccccccataaaaccctttggattgggggggtgatgggggggaaaaaaaaatttt
KDN01_0047_E11.b : cattattttccctcatataacccttggtatttggggctttatggggggaaaggaaattgt
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0028_F01.b : ataaacccttggatttgggtttgaaagggggaaaaaaatcctttttttcttagtttaaaa
---------+---------+---------+---------+---------+---------+ 1302
LVR01_0036_C01.b :
CBLT1_0047_H06.b : gtcagctgatgtactgacatttatcctatctcgtgttcgcggagtcttatcatgttccca
HTMT1_0033_E10.b : gggttttaaacgcgcccggg
ADR01_0019_B07.b : ggtgctctttatcacaaaaattctttctactaaatcctcttatttttcattctcttttc
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : cc
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b : tcaaaggtttctcggaaaacatagcgtctgggggggggttttactaaacacgaaaacctt
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b : agagtggggggaccccttgtgtctacctgtttttaagaaacaaaggggttggggagggtt
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b : gggggcacttcgttgtctcctttttttgggaaacaaggggttgggggggggttaaaaacc
SMG01_0060_C01.b : gggccagggggtgggcacccttggtgctctatttttctaagacacttgggttgaggaagg
TCH01_0063_A12.b :
KDN01_0098_A08.b : ggcaacccggtccctacatgttctagaaactaaggcgagggaggaggttaaaaaaccaaa
SKNB1_0070_D05.b : naanngnncnccccccctctcc
OVRM1_0039_F04.b :
KDN01_0021_F12.b : ttaaaggccccagaatggggggcaaacctgtttgcaacaaatcttcaaaaaa
PST01_0081_A12.b : aagtctctttttttcttttgagttccaaaaaaaggcggggaatttt
PST01_0098_C02.b : caaaaaaagcgagatttataaaggctcaggagggttgggccaaccctgttgcctatacat
KDN01_0067_G01.b : aaagcaagatttttaagggctttagaaggggggggacaaccccgtgttgccataattgtt
SKNB1_0089_G01.b : ccca
BMWN1_0073_G08.b : tgtggaaggtgttataaaaacccttcccaaaaacctctatttgggcccttcccccccccc
ADR01_0031_B12.b :
OVRT1_0073_D02.b : aggggtgggaaccttgttccataattgttttagaaaaaaaggcttggggaggaggttttc
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : ttctaaaaacaggggtgaagggaggcgttataaaaaaaaaccctcccccccgaaaccccc
ADR01_0020_F05.b : gtggccacccttgttgttcatacgtttttctggaaaattatgctgttttgaagtgtcttt
SPLT1_0014_H11.b : gtcgagaaaagggcggttatttataggcggccgagagagggg
LVR01_0086_H02.b :
ADR01_0048_D01.b : ggggggaaccccggtgtcctccctttttttggaaaaaatagggtttggaggggctt
BFLT1_0035_F07.b : aaaaaaacaggggtttaaaaagccccagagaggggtgggcaaccttgttttccacacatg
LVRM1_0150_A10.b :
PCT01_0008_F05.b : aaaaaaaccttcccgaaaacctcaaagtggcgccttccccccccccccaaaaaaacttct
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : ttaaaaggcctagagagggtgggcaaccttgttgtgcttacctttttcgggaaaacttag
CLNT1_0092_D01.b : aaccctgtgccatacgtttctcggaacttgagggtagg
BFLT1_0030_G03.b : tttttaaggcccagagaggggggggaaaccctgttctctcaaattttcttagagaaacct
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b : ccgtttcccgggtgcctgccctttaatgaaacctcccataaggagactctcctaacagaa
KDN01_0049_H11.b : aaaagtttctttattctttaggtctcaaataaaagcgggagttttttagaaagccctaag
KDN01_0007_G05.b : aaccctttgccacccggtccagaaaatagggttggaagaagttattaaacaaaaccttcc
KDN01_0071_E04.b : tagaaggtgcgccaacctgtttcctaaatgttttaggaacacttaggcgaaggaggaccg
KDN01_0099_D03.b : taaaggcccagaatgggggggcaaccctggttgcttacactgtttcagagacactaagct
KDN01_0043_A07.b : gtttcgaaggcctaaggacgggtgggcaacccttgtttgcaataaatgtttccaagaaca
KDN01_0043_B03.b : caaaaaaggcgggaatttaaaanggctcagaatgggtggggcacccctgggtcactaaca
KDN01_0062_F04.b : gnggaatttatagggcctaagatggttgaggaaatctgtgtgtttaaaatgttttgtgga
KDN01_0082_F01.b : aaaaaatcagaattttttaacaggcctcaggatggtttggggcaacccctgggttgcact
KDN01_0096_H10.b : agcggaattttaaaagcctcaggaagggtcgggcaaacctggttgcctaaactttttcca
KDN01_0040_E11.b : tcttggattccaaaagatgccggattttttaaagagccctcagagtgtggggggccaaac
KDN01_0008_B06.b : gtttaaaggcctgggatggggggggaaccttgttgcccaattggtttcggagaaatagcg
KDN01_0100_G05.b : agcagaattttaaaaggctcaagaatggtgggccacctgggttgcccaacttgtttccag
SKNB1_0008_B08.b :
KDN01_0015_E02.b : tcaaaaaaaagaggagttttaaaaagcctcgggatgggtggggaaacccttgttggccta
KDN01_0094_D09.b : ttgagtcaaaaaaagccggaatttaaacaggcctaagatgggttgggcaaacccggtttg
KDN01_0086_A12.b : TCTTTTATTCTTTTGGTTCAaaaaaaagccggagtttttaa
PTG01_0074_F05.b : gggacgggggggggggggcggcgnnncccctccctcactcaactaaaaat
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : gagagggattaaaacaaaaacctctcccccaaacacctaaattttggtcc
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : acattttcgagaaaaaaaagctaaggaggggaggtttaaaaaaaaacccttctgccccga
UTR01_0015_G03.b :
SMG01_0062_G07.b : taagtgtttaagaaacagggtttagggagtggtgtttaaaaaaaacccttcccccgaaaa
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b : c
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b : ttgtgggg
OVRT1_0038_F03.b : aaaaaggcgggtttttacaggcccacggaggggtggggcaactcgttgtccactacgttt
ADR01_0079_C03.b : gtgggccacccgtttccctaatgtttcggaaaaaaagggataggaagccgtaaccaaaca
ITT01_0076_A09.b : ggcctagatggttggggcaaccttgtgtctctacatttttaggaaacacaagggcgtttg
ITT01_0008_F03.b : aattttaaagggcccagagagggtgggccaaaccctgttgccccacattttttcgggaac
ITT01_0072_F01.b : aagcagatttttaaaggccccagggatgggttgggcagaccctgttggccctaaaattct
BFLT1_0019_G09.b : aaaaaagcggcggtttttaaagccctcaggatgggtggggcaacctctgttgcttaaact
BFLT1_0036_G01.b : gctttttaaaggccaaggatggtggggaaacctttgttccataaca
LNG01_0007_A07.b :
OVRT1_0068_C01.b : tttttaaaggcccagagggtggggcaaccttgtgtcctaaattgtttcaggaaccaaaag
KDN01_0051_G04.b : attagtatgaacacattatagcagtctttngaaatagacctagtacgagtatgggtcact
KDN01_0004_B01.b : ggttttttaaagggccaggagggggggggccaacctggggttcacaaacgtttttccaga
KDN01_0004_E01.b : aaaggccagttttttaagggccccaagaatgggggggggaaacctctggttgcccaaaaa
KDN01_0088_A09.b : taagatgggtgggcaaccctgtccccataatttttttagaaacacatagggtaaggaaga
KDN01_0009_G09.b : aagctcaggagggtggggagacctttggctaccttttttgggaaacaaaggggttggaga
KDN01_0025_E11.b : aaaagcccggaattttaaaggcctcaggaagggtcgggccaaccgtggttgcttaaactg
KDN01_0039_G05.b : ccaggaagggtggccaccccgtttgcttacttttctcggaaaactaaggcgtagggaagg
KDN01_0025_D08.b : cgcaacccggttgccacaatgctcaaggaacctaagcgatagaagggctttcataaacac
SPL01_0081_F04.b :
SPLT1_0074_G11.b : gcgttttataaggcccagaaggggggggaactctgtttctctccatttttccgagaacaa
OVR01_0096_F07.b :
SPLT1_0011_A04.b : ggcgcgttttttaacaccctaaaaatgtggtgcaaacccttttgtccaaccagttttctg
OVRT1_0005_A04.b : gcccaggagggtggggaacccggttgcttcaaatttttaagaaaaaaaagcgttggggag
SPLT1_0092_C01.b : gagaaggggtggcacctctgtgacacagcgcttctagaaaacgnnngcgggngaaggcgc
CBLT1_0027_C11.b : gcgtttttttagtcactatgtaatgttgtaggagcactatttatgacactgaataagctt
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : aaattattttttttcttccccccccgccacaataaataaaaataaac
OVR01_0091_H12.b :
SMG01_0023_C09.b : tggggacaccctgttccctaaaatttcttggaaaaccttgggttgtgggaaggcgttcct
UTR01_0022_E08.b :
SMG01_0001_G11.b : ctaaggattgtggggcaaactttttgtgcccacaatatttggagaaaacccttagggtgt
ITT01_0063_B06.b : aaggagggtgggcaacctgtgtgctaaacgttttcggaacacaaagcggttggaagacgt
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ttaaagcccaaggagggggggcaccttttgtccttacagtttcggaaaaacaagcggagg
ADR01_0059_D09.b : ttcaaaaaaagcggcttttttaaggcctcaagaaggggggggcaacctttgtgtctttac
OVRT1_0070_B08.b : gcccaggaaggttgggaaccctggttctaaatttttagggaaacaaaggggtaggaaggg
BFLT1_0022_H11.b : aaaagaggggtttttcaacgcctcaagacg
ITT01_0048_B12.b : tattctttggttcaaaaaaaggcggagttttataaaggcctaaagaggtggtgggcaaac
KDN01_0031_H05.b : ttaagggccaagaagggtggggcaacccgggtctcactaatgtttccagaaacactaagg
KDN01_0017_D01.b : agtcaaaaagagcnggattttaaacggcctcggaatggtcggcccaactctgttgcctta
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : gggccccccccccccccccccccggcggggggg
LVR01_0050_H12.b :
OVRT1_0034_D12.b : aaaagacgggttttttttaaagccccaagagggggtgggcccaacctggggttgcctaca
SKNB1_0062_C01.b : aaanacaaaagagtggggggcc
KDN01_0094_G04.b : aaggctctagactggtcgggcaaccctgtttgcataacttttttcaggaaaaactaggct
PCT01_0015_E10.b : caacctgtttcccaacttttttggaaaaataggggtggggaggggtttttcaaaaaaaaa
KDN01_0021_F06.b : ttaacagcccaggatggatgggcaagaccggttcctaaaatgtttatttgcaacctaggc
PCT01_0014_C05.b : ttaaaagctctaggaggggtgggaaccttggttcctaactttttttggaaaaaaaaaggg
KDN01_0099_B12.b : ctttgagttcaaaaaaaggcgggaatttttaaaaggccctaggaatggggtgggccaacc
KDN01_0040_F03.b : tggattccaaaagagcggaatttttaaaaggctctaagaggggtcggccaacctcggttg
KDN01_0079_B12.b : tccttgattccaaaaaaagtgcgaatttttaaacggccctcagaatggtgtggggcaaac
BFLT1_0103_F05.b : ttttgagaaaactggcttagaggattttttaaaaaaaaaaccctcctcccagaaccctca
BFLT1_0099_C05.b : taaagcctcaggagggttgggcaaaccggttgtcatacaggttttctagaaaacataagc
KDN01_0046_B05.b : cagaactgtcctgatacattgatacaagaagaatattgccgattggagtagctttaacaa
LVR01_0091_D10.b : ttttttttctccccgccccccaaattatattaaaaaac
KDN01_0011_B05.b : agaattttaaaaccttagagatgggtggccaaccctgtctccccaacttgtctcgggaaa
ADR01_0012_C07.b : tggtcgggcaactctgttgcatacctgttttcagaaaaataggcggtggaaggggcttta
PCT01_0007_H05.b : aagccctaagatggttgggcaaccctgtttcctaactttttcaggaaaactaggcgtagg
THY01_0064_D07.b :
SPLT1_0083_B04.b : cttttgatttaaaaaaatacgggtttttaaacggcctaaggaaggggtgggccaaccctt
ILNT1_0064_G06.b : aaaaatcaggttttgtaaagggccagggaaggttgggcgagcctcgttttgcaaagactt
KDN01_0067_B05.b : tatctttgagtcagataaaatgcagagtttttaacgggctcaggactgggtcggccaagc
OVR01_0100_C06.b : tgcgcgggaatagaaaacggtccctttattatcctctagattcccaaataaaatagccgg
LVR01_0099_F12.b : TCTTTTtattcttttgagttcagaaaaaaatgccaggccgttttttagacaggccctcaa
MLN01_0032_B07.b : tttatctttgattcaaaaagaggcagagttttaacggcctcaggacggggcgggccagct
KDN01_0028_F10.b : TCTTTTATTCTTTGATTTCAAATAAAATGCAGagtttttagaccgcctcaagactgggtc
KDN01_0012_H06.b : TCCTTTATctttgatttcgaaaagagcaggatttttagaggcctcaggactggtcgggca
DCI01_0021_C12.b : ttttttcttttaatttcaaaaaaaaagccggcggttttttataaggcccccaagaacgag
KDN01_0047_E11.b : ttttctccttgtagttctaattattcatgaatttttacactttcccttttgctggtcttg
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : tattccttgagttcgaaaaaaagcagccaacctcctgtctgcatcgcattgcttcaagga
DCI01_0028_F01.b : aaaagcaggttttttaaaaggccccaaggagggggggggcaacccttgtttccccaacaa
OVRM1_0110_B01.b :
UTR01_0014_D02.b : ccctttcatcttcaagaccctactacgtggtcaggttggaggacttgccttgaacactgg
---------+---------+---------+---------+---------+---------+ 1362
LVR01_0036_C01.b :
CBLT1_0047_H06.b : tggcatctcacgcatataatttactgaattgcctcacctgatgggtccca
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b : ctccccccgagaaccccccacaatagtgtgccgccccctcccccc
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b : tctataaaccaaagacctcttgccccgaggatccttcatagtgttcgcgcctctt
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b : aaaacccttcgccccaaaacccttcat
SMG01_0060_C01.b : gtttcataaaaaanaaaactctcccccagagaccccacaattgttgggccctctgtcccc
TCH01_0063_A12.b :
KDN01_0098_A08.b : accttccccccgaaacccccaaaagttccggccctttggcccctccgcggga
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b : tttccagggaaacccaagcccgtaggaaggaacggttactaaaacacaaaaccgcctttc
KDN01_0067_G01.b : tctaggaacccttaggcggtatggaaggccgtttcccca
SKNB1_0089_G01.b :
BMWN1_0073_G08.b : ttaaaaacnntttggacaccccccccccgaggggggccgccccttgtctttaaagaaata
ADR01_0031_B12.b :
OVRT1_0073_D02.b : aaaacagaagcccttcccccagaaaaccctcaaaatgtggcgcgccttcccccccccccc
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : aaatgtggggccttttgcccccccccccggaaaaaaaaatttttggggagctcgagtagt
ADR01_0020_F05.b : tattaatacaagaaaccctctccctcgcgaaacccctcaaatatggtggtggcctntttg
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b : tttcttggaagaacaaagagcgttaggaggagagcggtatatcaaacaaagagccgctct
LVRM1_0150_A10.b :
PCT01_0008_F05.b : ggcccccccccccaagggnnncccttaaannnnttttaagaaaaaaccttaaataaaata
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : ggctttaggaggacctgtaattaaaaccaaaacccctctcccccggaaaaacctctcaaa
CLNT1_0092_D01.b :
BFLT1_0030_G03.b : aggggcttaggagagaccgcctc
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b : gcccttctcccgaaacccttaaatgtgggcccctggccccctcccctcgaaaaacctttt
KDN01_0049_H11.b : gagtggtggtggcacaacacctggttcgccaacaccggttcttctcggaaaa
KDN01_0007_G05.b : ccgaaaccccaaaggtgggcccctttcccccccccccccaaacaaattcaaaaaccaccc
KDN01_0071_E04.b : gtataaaaccaaaaaccgttccgccccgaaaccctcaaaagatgtgcgggcccttttggc
KDN01_0099_D03.b : gaagggaaggagttgcataaaaacaaaaaccctctccgcccggaaaccctccaaaatgtt
KDN01_0043_A07.b : actaagcctatgggatggaccgtccctcaaaaaccaaaaccccctttccccccggaaacc
KDN01_0043_B03.b : ggttttcaggaacaattaggctattaggaggaaccgttcttcaaaacaaaaacgcccttt
KDN01_0062_F04.b : acaattaggggttggaaggaaggtttttaaaacaaaagggcgtccccaaccaaacccccc
KDN01_0082_F01.b : acactgttttccaggaaaccccttaggctttatggaaagaacactttcaataaaaac
KDN01_0096_H10.b : ggaaaaacatagctctatggaagggacggttcattaaacacaaaaaaccacttctcgccc
KDN01_0040_E11.b : ctcttttctccaccagaatgttcttcaaggaaccacnttaggtcttattgggaagggccc
KDN01_0008_B06.b : gtagggaggggtgtctttaaacaaaaacctttcccccgaaaacacccaaaagttggggct
KDN01_0100_G05.b : gaacactaggccttaagggaagacctttataaaaaacaaaaccccttcgccccgaaaacc
SKNB1_0008_B08.b :
KDN01_0015_E02.b : aaggtttctaaagaaaaaaaggcgggagggaaaggagtgtttattaaaacaaaaaacccc
KDN01_0094_D09.b : cattacacttcttcaggaaaacattaagctgttagggaaggacgtgtcataaaaccaaaa
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : aagcccctaaatagtgtgggtatttgtgcccccccacctcaaaaaat
UTR01_0015_G03.b :
SMG01_0062_G07.b : cccccaaaaggtgcggctctttccccccccccctcaaaaaacctttttcggacctcccac
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b : ttcaggaaacaatgagggtgggggagaggggttttaaaaacacaaagagcttttcccccc
ADR01_0079_C03.b : aaaccccctctcccggaaccctctaaatgttggcccccttt
ITT01_0076_A09.b : gaggaaggtttcttaaacacaaaaaacctttc
ITT01_0008_F03.b : actaggcctataggaagggggttttatataaaacaaaaccactttcccccgggaaacccc
ITT01_0072_F01.b : ccaggaaacacctaggctgttagaaagaacggttatataaaaccaaaaacacccttcgcc
BFLT1_0019_G09.b : tgttcttgggaacacacatgggctttaaggagaggggtgttatataaaacaaagaacgct
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b : gggatggagaggcggttataaaacagaagccttctccccacaaaaccctcaaaatggtgc
KDN01_0051_G04.b : ttgtgcgtggttctattaagctttatcagagcgtatatgttccagtaatgatcatggttt
KDN01_0004_B01.b : aaaaccttaaggcctattagaggaagcttttttaaaaaaacaaaaaaaccttttcccccc
KDN01_0004_E01.b : ttttttcagaaaaaaacaaaaggggtgattggaagaacccgtgtatataaaaccaaaaaa
KDN01_0088_A09.b : ctttcaaaaaacaaaaacccctttcccccggaaacccccaaaaatgtgtccggccctttg
KDN01_0009_G09.b : acgtttataaaacaaaagccttccccccaaagaccccaaaagttcggggctctgtccccc
KDN01_0025_E11.b : tttttagaaacacctaagctgtataggaaggacctttaatcaacaacaaaaacccctttc
KDN01_0039_G05.b : cggtttctaaaaccaaaacgcttttccaccggaaaaccctccaaaaggttgggggccctt
KDN01_0025_D08.b : aaacccctccccccgaaaaccctaaaatgtgtgggccctttccccccccccgctaaaaaa
SPL01_0081_F04.b :
SPLT1_0074_G11.b : aagggcgtaaggagaggctttttaaaaaaaaaaaactcttttccccccaaacacccccaa
OVR01_0096_F07.b :
SPLT1_0011_A04.b : gaaaaacaagagcgttgtggaaaggctgttataaaaaaacaaaacccgctcccccccagg
OVRT1_0005_A04.b : gaagggtttaataaaaaagggctgtcccccgaaaaccccaaaaggtggggcccctctccc
SPLT1_0092_C01.b : gaatagaaacaaagcgccgccccccccgaaaccccgcaaattggtggcattctntgtgcg
CBLT1_0027_C11.b : t
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b : caaaacaaaacaccctctcccccaagaaacccccaaaagtgtggcgggcttttttggccc
UTR01_0022_E08.b :
SMG01_0001_G11.b : ttgagatagcccttattcaaaacacaagaaaccttttttcccccccaaaaaaacct
ITT01_0063_B06.b : taactaaccaaaaacctttcccccgaaacccccaaaagtggcgggctttcgccccccccc
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ggaggcgtgttataaaacaaaaaccccttgcccagaaaccctcaaaaggtggggggcctt
ADR01_0059_D09.b : atttttta
OVRT1_0070_B08.b : cgtctaaaaaaaaaaacccttccccccgaaacaccccaaagggggcggcctcttcgcccc
BFLT1_0022_H11.b :
ITT01_0048_B12.b : ctttgttgccataaacttgttcccagagaaaattaag
KDN01_0031_H05.b : tttaggagggactgttattataaccaaaaacctttttccccccgaaaaaccccccaaaat
KDN01_0017_D01.b : cattctttcagagaacactaagcgttaggaaggacctgtcttcaaaacaaaacgcccttc
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b : caagtttctccgaaagaat
SKNB1_0062_C01.b :
KDN01_0094_G04.b : ataggaaggacttgtattaaaaccaaaaccccttccgccccgaaaacctcccaaagggtg
PCT01_0015_E10.b : cctctccccccgaaacccccaaaaggtgggggccttttggccccccccccccgaagaaaa
KDN01_0021_F06.b : catgggggttacattgcaaaaaatccggaccgtttctccccactaaaccctcaaaaggtg
PCT01_0014_C05.b : tttggagggggctttcttaaaacaaaaaaccctctcccccccaaaaaccccaaaaagtgt
KDN01_0099_B12.b : cctggtttccattaat
KDN01_0040_F03.b : ccaaactgtttcttcagaacaccctaggcttgttggaaggccgttttcttctaaccagga
KDN01_0079_B12.b : ctcggttggccataaacggtttttcaagaaa
BFLT1_0103_F05.b : aatgttttcgcttttcccccccccctctaagaaacatttctctgagcccccccccccccc
BFLT1_0099_C05.b : gcttaggagagagcgttttaaaaacaaaaaacccccttccccccaaaaaaccctcaa
KDN01_0046_B05.b : atcaaattacctctccacgagtaagcctctatatggtggggggctctttgaacactcctc
LVR01_0091_D10.b :
KDN01_0011_B05.b : acctagcgttttagggagaacctttcttaaaacaaaaaaccctctcccccgaaaaacctc
ADR01_0012_C07.b : ttacaaccaaaacccccttccccccgaaaacccctcaaaatgttgtcgggccctttgccc
PCT01_0007_H05.b : gaagacctttctaaaaaaccaaacccctttccccccgaaaaccctccaaaaaggtgtggg
THY01_0064_D07.b :
SPLT1_0083_B04.b : ggtctgcctcaacatgtcttcaaggaaacactaaaggcttataggggaggaccccttcca
ILNT1_0064_G06.b : ttggcaagaaagcacgtggtgttggggatggcaggttgctgttaaccaaaagcccccttc
KDN01_0067_B05.b : tcgtgtcgcatcagactgtctccaggaaaccactaagcctgatcaggatggacgtttcca
OVR01_0100_C06.b : ggcgttcttttaaaccagggcccttaagggtat
LVR01_0099_F12.b : gggactgggggtccgggcccaagccctccgggttcctgcccaatccagcccccttttcct
MLN01_0032_B07.b : cttgctgccattacatggcttcagggaaaaactaagcctgatagggaagaaccctttcat
KDN01_0028_F10.b : gggcaagcctcgtgtctgcatcagcatgtcttcaagaaaaacactaagcctgatcaggaa
KDN01_0054_B01.b : tcgggccaagctcgtgtctgcatcacaatgtcttccaagagaccaactaggcctgatcag
KDN01_0012_H06.b : acctcgtgttgccatcacatggcttccaggaaaccactaaggctgataaggaaggaccct
DCI01_0021_C12.b : ggttgggccaaaccctctgttttgccctacacacacttcttttcaaga
KDN01_0047_E11.b : tgaaacttcagtctggttctttcgtttttcttttagacttattaaatggcttacgtatga
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : acacnctaagcctattcggaatgaacgctttccatccaaccccacaaaacgccctttccc
DCI01_0028_F01.b : tttttttaaaggaaaaaattcaagcctttttggaaaagcccttttctcttaaaacaccaa
OVRM1_0110_B01.b :
UTR01_0014_D02.b : tgtcctgcgagaatcaagacacacctacccttagagaaaaactccccgccccgtcaggag
---------+---------+---------+---------+---------+---------+ 1422
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b : ccccccccccagaaaaacactttttctggagactctcctcttcgtga
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b : gccccggaaagacccctcaaaaagtggtgccgc
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b : tacnnnnncgnnnngt
ADR01_0031_B12.b :
OVRT1_0073_D02.b : gcggaggaaaaacactttt
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b : gtctcctatctgctctaagaagaacccctctttcttagagactcccactcca
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b : cc
LVRM1_0150_A10.b :
PCT01_0008_F05.b : aannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : atgtgtggcggcccattcgcccccccccctcccgtcttaaaaaaaaccacttttctccga
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b : tcaagagaccaaccttgnaaaaaannnnnnnaaaanncctttccaaaaataaagatttaa
KDN01_0049_H11.b :
KDN01_0007_G05.b : ncccaaaaaagggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
KDN01_0071_E04.b : ccctccccccctccggaaaaaccctttttcccgggaaacctctgacctttgacccacaaa
KDN01_0099_D03.b : gggggcccttttgcccccccctccgcctgaaaaaaacccttttttccgggggactcccga
KDN01_0043_A07.b : cccccaaaatgggggccgcgcccctcttcc
KDN01_0043_B03.b : ccccccgaaacaccctcaaaaaggttccggcctcttttgtcgccccttctcccctccaga
KDN01_0062_F04.b : aaaatagtgtgggggcgccttggccccccaccgctccttaaaaaaaacaatttttatagg
KDN01_0082_F01.b :
KDN01_0096_H10.b : cggaaaaccctctccaatatttt
KDN01_0040_E11.b : ttctatcctaaacaacaaaaaacccgttctccccacccgaaaaacaccccct
KDN01_0008_B06.b : ctgcgcccccccccccccnaaaaaccaattctgagaaccacctaccccaaaaaaaanaaa
KDN01_0100_G05.b : ccccccaaaagtgcgggggcctttgggcgccccctccccctcgggaaaagacacttggtt
SKNB1_0008_B08.b :
KDN01_0015_E02.b : tttccgccccggaaa
KDN01_0094_D09.b : cccgtttccccccccgaaaacacctccaaaagtgttgtcggcgccttttccgaacccacc
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b : tccccaaaaggggggnnnncctccnnggccgtgtttatgtttttttatatttt
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b : cagaaacccctaaaatgtggggggctttttttgcccccccccccgcccaagaaaac
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b : tcaaaatggttccggcgccctttgccccccccacccgcctcaa
ITT01_0072_F01.b : cccgaaa
BFLT1_0019_G09.b : c
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b : ggccctcttgcccccccccccccagaaaaaaac
KDN01_0051_G04.b : gactttgttgatttacgtattgctacacatcatactctgcgcatactgattaagtactcg
KDN01_0004_B01.b : cagaaaaacctcccaaaaagtgggggccccc
KDN01_0004_E01.b : acccttttccccccccgaaaaaccccccccaaaaagttttgccggccccccctct
KDN01_0088_A09.b : gcccccccccccctcaaaaaaaacccttgtttttgggt
KDN01_0009_G09.b : cccctcttaaaaaacattttagggccctactccccctaaaagagggggaaacccnggaac
KDN01_0025_E11.b : tccccaccaaaaca
KDN01_0039_G05.b : ttggcgccccctccccttttagaaaaaacccttgttctcgggggacccgaagatcttggt
KDN01_0025_D08.b : caccttttccagggctcccaacttaaccacaaagaggggggaaatcccgggtgctttgtt
SPL01_0081_F04.b :
SPLT1_0074_G11.b : aaagtggttggggccttttttgcccccccctccccccccaaaaaaaccccccttttttct
OVR01_0096_F07.b :
SPLT1_0011_A04.b : agaaccctcctataaagttttgccg
OVRT1_0005_A04.b : cccccccccaaaaaatttttcgggctccgactcccccctggaggggggggaaccgact
SPLT1_0092_C01.b : ncgcttnatncgnagaaaaacnntatctnggnggaccgacgcccagnccaggaaagggga
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b : tcctccccgtccgaagaaaacacctttttctcggagaa
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b : gcccgaaaaacctctttcagagaccccaccccccccccaaatagtggggaaancgcccgg
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ttgcccccccccggctgagaaaacctctt
ADR01_0059_D09.b :
OVRT1_0070_B08.b : cccccccccgaaaaaaccttttttcggagacctaaccttcggccccagg
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b : ggtgggcgccctctttggcgccccacctcccgctcggagaaaa
KDN01_0017_D01.b : gcccccgaacaccccccaaatgtgttgggggctctttggccccctccccccgccaggaaa
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b : cgggccccctttccgcccccacccgctctagaaaaacaccctttttcagggaaactctga
PCT01_0015_E10.b : ccctttttcggaggcccccacccccccccaaaaaaggcgggaacccccctctcctttttc
KDN01_0021_F06.b : tgaggccacttttctccctattctcggaggaaaacctctttgtttagggatctctaatct
PCT01_0014_C05.b : gggggccttttttcccccccccccccccccggaaaaaaccctttttttcggggcacctcc
KDN01_0099_B12.b :
KDN01_0040_F03.b : aacccgttcccccccgaaaaaccctctcaaaagtgttgcgggcccttttgccccccctca
KDN01_0079_B12.b :
BFLT1_0103_F05.b : caaaggcgcccccccngnactcggaacgaggcgggngnnntngagccaggnggctagagt
BFLT1_0099_C05.b :
KDN01_0046_B05.b : gtaccagataaaaaacattgttaagagaatcaccgaactatactataatagggctgctaa
LVR01_0091_D10.b :
KDN01_0011_B05.b : taaatgtttccggccctcttttcccctcctcccccgcaaaaaaaaacccttttctcggag
ADR01_0012_C07.b : ccccctccgcctccgaaaaaacacccttgtttctggggactctctaagctcttaacttct
PCT01_0007_H05.b : gccctttggccccccactcccccttaaaaaaaaaccttttttccaggggccctccacccc
THY01_0064_D07.b :
SPLT1_0083_B04.b : ataaaaaccaaaaaaccccctttcccccccgcggaaaccccctctcaaaaaaatgttcgc
ILNT1_0064_G06.b : ccgcccaggaaagagccctccaaaagtttttgggggggcgcgtttggacggacctcagct
KDN01_0067_B05.b : tcaaaacacaagagccgccctccgcgccaccgaaaccaccctccgaatattgggtgggcc
OVR01_0100_C06.b :
LVR01_0099_F12.b : tcccaaagggaaaaaaacccaaaaccttaaaggggcccctgggaattttcagggggaaaa
MLN01_0032_B07.b : tcaaaattcaaaaaccacgtttccccccccgggaaagaccccttccaaaaattgtgtgcc
KDN01_0028_F10.b : tggaacctgtcattccaaacccaaaaaccgccgtttcgcccaccggaaaagaaccctcta
KDN01_0054_B01.b : ggatggacgctgtcaatcccaacccccggaaacgccgtttcgcgccacggaagacgcccc
KDN01_0012_H06.b : ttcaatcaaaacccaaaaaccgcccttccccgcacggaaaaccacccctctaaataagtg
DCI01_0021_C12.b :
KDN01_0047_E11.b : atcctttcttttgtattcttgattacccctttgttgcttatcttgaaagggcctcttctt
KDN01_0015_E11.b : TGATCAAGGAATGGACgctgtcacatcccaacaccacggagccgccgctttcgcgccacc
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : gccacggaaaaccaccttctcaaatattggtccgccggtccataattttggaaaacctcc
DCI01_0028_F01.b : aaaacccccttccccccccccaaaaaacccccccccaaaaaaatttgtttgcgggccccc
OVRM1_0110_B01.b :
UTR01_0014_D02.b : ccttcactgacagatgcgcctcgtcagccggcctcctacataacagagatcccatcatct
---------+---------+---------+---------+---------+---------+ 1482
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : gaaacctccgagccttacccccccaagaaaaggggggaaaactgccccttgtgacctgtg
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b : gnnnntngggcggaannnnn
KDN01_0049_H11.b :
KDN01_0007_G05.b : nnnnnnnnnnn
KDN01_0071_E04.b : gg
KDN01_0099_D03.b : gct
KDN01_0043_A07.b :
KDN01_0043_B03.b : aaaaaccccttgttctcggggatcctccacc
KDN01_0062_F04.b : aaacacaagctttnccccccaaaaaangggaaaaaatctcacttctcttttta
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b : annnnnaagtganntnnngagaggagactattataataataataannnnnnnnnnnnnng
KDN01_0100_G05.b : tcgggga
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b : cc
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b : tagatacacctccgaatatt
KDN01_0025_E11.b :
KDN01_0039_G05.b : tataggg
KDN01_0025_D08.b : ttacnggaatattaattatatttcacctaacttnnnnnnnnnnnnnnngaaatat
SPL01_0081_F04.b :
SPLT1_0074_G11.b : gaggaaactccagaacttttagggt
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b : agaacccgcctgagttagtttgatctat
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b : ggccnntgttctccgggggtttatattgcgatgtacaannnnnnnnnnnnnnnnnnnnnn
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b : aaacctttgtttcagagggactctaaaccttaaggtgtgggg
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b : acctttagtttcaggaagaggggcgaaacctcccttttttct
PCT01_0015_E10.b : tt
KDN01_0021_F06.b : cttcaccaacaagagttgcnnnnnnggtttgtgnggagctcttctttaaanggcccaaaa
PCT01_0014_C05.b : acctcccccccccaaagagggggggaaaccccccngagaannngnttatcatagaaagca
KDN01_0099_B12.b :
KDN01_0040_F03.b : ctcaggtccctagaagacacccttgtttcctaggaagactctatagctctcaagcctaca
KDN01_0079_B12.b :
BFLT1_0103_F05.b : aaaataatcttatnnt
BFLT1_0099_C05.b :
KDN01_0046_B05.b : agctctctctctcatc
LVR01_0091_D10.b :
KDN01_0011_B05.b : accccacctcaccnccaaaagaaggccgaaannnnnnnnnnntttttttannnngggtgc
ADR01_0012_C07.b : aaaaagggggggggaaaaccggccccttggtacatcgggtgttatt
PCT01_0007_H05.b : caccccaagagaaggggggggaaaaccccccggggcggggggnnnnnnggttangnnnng
THY01_0064_D07.b :
SPLT1_0083_B04.b : cgggccccattttggcgccccctcacatccgcgctttctgaaaaaaaaaaaccccctttt
ILNT1_0064_G06.b : ggtgggctcgagaaaaaagccacggttgtttttggataaggcggtccggggaaaactttg
KDN01_0067_B05.b : ggccattattgccagacttcaattccacgattttaaaaaaaaaaaccccttttagttccg
OVR01_0100_C06.b :
LVR01_0099_F12.b : aaggggggaaaaccccccc
MLN01_0032_B07.b : gggccttttttgtcgccccccaaaccaacggtgccaagaaaaaaaaacccctttggtcct
KDN01_0028_F10.b : aaataatggtcggccggccactttttgtgccgaccccaaatccggcgattctaaaaaaaa
KDN01_0054_B01.b : tcctcaatagttggtcttgccggtcccttattttgcggaacttccaaatccgccaatgca
KDN01_0012_H06.b : gtctgccggcccataatttgtcaggcctcccaattcgccnattggaaaaaaaaaaaaccc
DCI01_0021_C12.b :
KDN01_0047_E11.b : atatagttttatacgattataccttatgtaacttatcctgctgcgtgactacttataaac
KDN01_0015_E11.b : ggagaagcacccttcttaaataagttggtctggcgggcccattcatttgggcaggacctt
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : caatccagcgtttgctaagaaaaaaaaccaccttcttggttcccgaggaggcgaccctct
KDN01_0086_F02.b : CACCCGGAGAACcacccctcctcaactaactgtgttctgcccggtcccactcatttttgc
DCI01_0028_F01.b : tttttgtgaaaacccctcaattttgggattcccgaaaaaaaaaaaaaccccttttggttt
OVRM1_0110_B01.b :
UTR01_0014_D02.b : tcgcggcgtagaacctctccgctgaaagtatccgtccgcatctctttgtgtccacggtcc
---------+---------+---------+---------+---------+---------+ 1542
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : ttctaacatcaa
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b : ggnnnnnnnnnt
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b : aattattattatatattaannnnnnnnnnnnnnnnnncccacagagtatgaaaant
PCT01_0014_C05.b : tgatct
KDN01_0099_B12.b :
KDN01_0040_F03.b : aggaagtgcgcgcg
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b : tacatcaaactctttt
ADR01_0012_C07.b :
PCT01_0007_H05.b : ttttcgtctctcaaaacaaatgcttttggggnnnnnnt
THY01_0064_D07.b :
SPLT1_0083_B04.b : gtttcggaggaggcacctccttaaaagtccttgagggcgttcacgagagagtggatgggt
ILNT1_0064_G06.b : agacggtatgnaaggtgaaagaggtgtcccagaaacaccgggccgcggagggaggtgtng
KDN01_0067_B05.b : agtggagcaacccccggaaacctttaagggttaaatgaaataaagatggggcgggaaaac
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b : gaggggggagctctggagggccttttt
KDN01_0028_F10.b : aaacccccttttaggttccgaaggaggcaacccccctgaaagcccttaaaggccgttacg
KDN01_0054_B01.b : aaggaaaaaaaacccaacttctgtttccggaaggaggcaaccttctgaaaaagctttgaa
KDN01_0012_H06.b : cattttagttccgaaggaaggcgatctcttggaaagccttaagacttttaaatggaatta
DCI01_0021_C12.b :
KDN01_0047_E11.b : tattaagctcatcttaatttacgaatgacaaatccatcctttagatcgtattctcacgtt
KDN01_0015_E11.b : cccaatcaagcggattgctagaaaaaaaaaaacccccctttttagtttcccgaaaggaag
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : tgaaagcctttaaagccttctaaagagggatagaatggggccctggaaaacccccggccc
KDN01_0086_F02.b : aaggaccctccaaaatccagncgaattgcttagaaaaaacaaaaaccccaccttctagtt
DCI01_0028_F01.b : tcccgggaagggaccccccctcgaagaactcttttaaggacttttcaccaaaggaagaag
OVRM1_0110_B01.b :
UTR01_0014_D02.b : cgccgtcgccctcaacttgcgcccgctg
---------+---------+---------+---------+---------+---------+ 1602
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b : gccgggaaaa
ILNT1_0064_G06.b : gcgtcagtagatggatacgtatggaggg
KDN01_0067_B05.b : ccccggcccccgcctggggtcccgggtttgtggttaaaaatttaaccggggg
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b : gaaattagaatggggccctggaaaacacatctcccccattt
KDN01_0054_B01.b : ggggtaaactgaaaattaaatttggggtccggaaaaccactcggggcccctggaatggag
KDN01_0012_H06.b : gatcggtgtccggaaaaccacccgccccccaaaagaagaatccccgtttgggtttcttat
DCI01_0021_C12.b :
KDN01_0047_E11.b : gtttaattcgtagactgtacgtgcggttactg
KDN01_0015_E11.b : gggactcccccgggaaagggcttctgaaaggggtgtaaactgggaaatttaaaaactggg
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : cccggattagagataccccgtgttgggttctcaatattataaccccgggggaggctcttc
KDN01_0086_F02.b : ttccagaatggagggaaactctactggaagaggccttctacagggctgcaaacctgagag
DCI01_0028_F01.b : aggggggccggcaaaaaaccccccgccccccccccccctcgagaggcacccccgggcggt
OVRM1_0110_B01.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 1662
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b : gtcccaggggggtgggatctccaaaattataaacgcgggaaggggtccg
KDN01_0012_H06.b : ttaaacgggggggggggcgcccaataaaattatatcntagagaannnnnnnttccatatc
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b : gggcccgggaaaacc
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b : gtaaggattcgggtggcctggaaaaaacacaatttccggcccccatttcagatttggggg
DCI01_0028_F01.b : gggggtctaaaaaaacaaaccagggggggaggggg
OVRM1_0110_B01.b :
UTR01_0014_D02.b :
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b : cacgatgctct
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b : gtttcccaccggccggcctggggagtcttccattaaactttacaggacccccggggggaa
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
UTR01_0014_D02.b :
20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b : ggttgtggttaagttcctctaaaaaaattttgaaaactttttttaaccgcttccgtgat
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b : tccttggtgtggatcctctccaattcaaatcttgatccatgaaccctccgggtgtgggaa
UTR01_0014_D02.b :
20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b : ggcctggctggttcacggtcttcccttaagcatgaaatatttgcaaaaaccgtttttcgt
UTR01_0014_D02.b :
20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b : tataactcgttcccctgcaggaacaggaaagccaaaacgcctccccatgaacacggttgg
UTR01_0014_D02.b :
20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :