[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001127

Length: 1,674

Sequence [FASTA format sequence]
CAGGGATAAC TGGCTTGTGG CGGCCAAGCG TTCATAGCGA CGTCGCTTTT TGATCCTTCG
ATGTCGGCTC TTCCTATCAT TGTGAAGCAG AATTCACCAA GCGTTGGATT GTTCACCCAC
TAATAGGGAA CGTGAGCTGG GTTTAGACCG TCGTGAGACA GGTTAGTTTT ACCCTACTGA
TGATGTGTTG TTGCCATGGT AATCCTGCTC AGTACGAGAG GAACCGCAGG TTCAGACATT
TGGTGTATGT GCTTGGCTGA GGAGCCAATG GGGCGAAGCT ACCATCTGTG GGATTATGAC
TGAACGCCTC TAAGTCAGAA TCCCGCCCAG GCGGAACGAT ACGGCAGCGC CGCGGGAGCC
TCGGTTGGCC TCGGATAGCC GGTCCCCCGC CGTCCCCGCC GGCGGGCCGC CGCGCGCGCC
CGCGTGCGGC GTGTCCCGTC GCGCGTCGGG ACCGGGGTCC GGTGCGGAGA GCCCTTCGTC
CTGGGAAACG GGGCGCGGCC GGAAAGCGCG GCCGCCCCCT CGCCCGTCAC GCACCGCACG
TTCGTGGGGA ACCTGGTGCT AAACCATTCG TAGACGACCT GCTTCTGGGT CGGGGTTTCG
TACGTAGCAG AGCAGCTCCC TCGCTGCGAT CTATTGAAAG TCAGCCCTCG ACACAAGGCC
TCCGCGACAT TTGCTTCTGA CACAACCGTG TTCACTAGCA ACTGCACAAA CAGACAACAT
GGTGCATCTG TCTGCTGAAG AGAAGGAGGC CGTCCTCGGC CTGTGGGGCA AAGTGAATGT
GGACGAAGTT GGTGGTGAGG CCCTGGGCAG GCTGCTGGTT GTCTACCCCT GGACTCAGAG
GTTCTTCGAG TCCTTTGGGG ACCTGTCCAA TGCCGATGCC GTCATGGGCA ATCCCAAGGT
GAAGGCCCAC GGCAAGAAGG TGCTCCAGTC CTTCAGTGAC GGCCTGAAAC ATCTCGACAA
CCTCAAGGGC ACCTTTGCTA AGCTGAGTGA GCTGCACTGT GACCAGCTGC ACGTGGATCC
TGAGAACTTC AGGCTCCTGG GCAACGTGAT AGTGGTTGTT CTGGCTCGCC GCCTTGGCCA
TGACTTCAAC CCGGATGTGC AGGCTGCTTT TCAGAAGGTG GTGGCTGGTG TGGCCAATGC
CCTGGCCCAC AAGTACCACT AAGTTCCCCT TCCTGATTTC CAGGAGGAGC CCTTTTTCCT
CTGAACCCAA AAACTGGATA TGGAAATATT ATGAAGAGTT TTGAGCATCT GGCCTCTGCG
TAATAAAAAC ATTTATTTTC ATTGCAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAANNAAAAA AAAAAAAAAA ANNANNNNNN
NNCCCCCCCG GGCCCCCCTT CCCCTTGGGG GGGGGGGGAC CCCGCCACCC AAAAAAGAAA
ATTTTGTTGG GGGTGGGCCC CCCCCCCATG CGGGGGGGGG AGAAACATTT TTTTTTAGGG
GAAAAGGGGG GGCGCTTTTT TTATTTAACC CATCCGGCCG CCAGAAAAAC AGTCACCACG
TTTTTTTTTT TTTTTTTTTT TTTGGGGGGG GGGGGGGGTG TTTTTTTTTT TTTCATGAGA
ACACCCCCCC CCCCGGGAGG GAGGTTTTTG GTCTTGATCC TGCCCCCCCC CCCC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHBBhemoglobin subunit beta [Homo sapiens]. 2563e-68O
Contig/Assembly ProteinHBDhemoglobin subunit delta [Homo sapiens]. 2542e-67O
Contig/Assembly ProteinHBE1hemoglobin subunit epsilon [Homo sapiens]. 2281e-59O
Contig/Assembly ProteinHBG2hemoglobin subunit gamma-2 [Homo sapiens]. 2227e-58O
Contig/Assembly ProteinHBG1hemoglobin subunit gamma-1 [Homo sapiens]. 2198e-57O
Contig/Assembly ProteinHBA2hemoglobin subunit alpha [Homo sapiens]. 1028e-22O
Contig/Assembly ProteinHBA1hemoglobin subunit alpha [Homo sapiens]. 1028e-22O
Contig/Assembly ProteinHBZhemoglobin subunit zeta [Homo sapiens]. 99.87e-21O
Contig/Assembly ProteinHBQ1hemoglobin subunit theta-1 [Homo sapiens]. 97.14e-20O
Contig/Assembly ProteinHBMhemoglobin subunit mu [Homo sapiens]. 84.72e-16O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100503605PREDICTED: hemoglobin subunit beta-1-like isoform 4 [Mus musculus]. 2441e-64O
Contig/Assembly ProteinHbb-b1hemoglobin subunit beta-1 [Mus musculus]. 2441e-64O
Contig/Assembly ProteinLOC100503605PREDICTED: hemoglobin subunit beta-1-like isoform 2 [Mus musculus]. 2441e-64O
Contig/Assembly ProteinBeta-shemoglobin subunit beta-1-like [Mus musculus]. 2441e-64O
Contig/Assembly ProteinLOC100503164PREDICTED: hemoglobin subunit beta-1-like isoform 2 [Mus musculus]. 2412e-63O
Contig/Assembly ProteinLOC100503164PREDICTED: hemoglobin subunit beta-1-like isoform 4 [Mus musculus]. 2412e-63O
Contig/Assembly ProteinLOC100503164PREDICTED: hemoglobin subunit beta-1-like isoform 1 [Mus musculus]. 2412e-63O
Contig/Assembly ProteinLOC100503164PREDICTED: hemoglobin subunit beta-1-like isoform 3 [Mus musculus]. 2412e-63O
Contig/Assembly ProteinHbb-b2hemoglobin subunit beta-2 [Mus musculus]. 2411e-63O
Contig/Assembly ProteinLOC100503164PREDICTED: hemoglobin subunit beta-1-like isoform 3 [Mus musculus]. 2412e-63O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC609402PREDICTED: similar to beta globin isoform 2 [Canis familiaris]. 2612e-69O
Contig/Assembly ProteinLOC480784PREDICTED: similar to beta globin [Canis familiaris]. 2541e-67O
Contig/Assembly ProteinLOC609402PREDICTED: similar to beta globin isoform 1 [Canis familiaris]. 2541e-67O
Contig/Assembly ProteinLOC485256PREDICTED: similar to Hemoglobin epsilon chain [Canis familiaris]. 2529e-67O
Contig/Assembly ProteinLOC476825PREDICTED: similar to beta globin [Canis familiaris]. 2503e-66O
Contig/Assembly ProteinLOC485255PREDICTED: similar to Hemoglobin epsilon chain [Canis familiaris]. 2242e-58O
Contig/Assembly ProteinLOC608715PREDICTED: similar to Myoglobin isoform 4 [Canis familiaris]. 67.44e-11O
Contig/Assembly ProteinLOC608715PREDICTED: similar to Myoglobin isoform 2 [Canis familiaris]. 67.44e-11O
Contig/Assembly ProteinLOC608715PREDICTED: similar to Myoglobin isoform 1 [Canis familiaris]. 67.44e-11O
Contig/Assembly ProteinCYGBcytoglobin [Canis lupus familiaris]. 62.41e-09O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHBE1hemoglobin, epsilon 1 [Bos taurus]. 2463e-65O
Contig/Assembly ProteinHBBhemoglobin subunit beta [Bos taurus]. 2457e-65O
Contig/Assembly ProteinLOC788610hemoglobin, gamma 2 [Bos taurus]. 2435e-64O
Contig/Assembly ProteinHBGhemoglobin fetal subunit beta [Bos taurus]. 2435e-64O
Contig/Assembly ProteinLOC100337028PREDICTED: hemoglobin fetal subunit beta-like [Bos taurus]. 2394e-63O
Contig/Assembly ProteinLOC781674PREDICTED: hemoglobin fetal subunit beta-like [Bos taurus]. 2394e-63O
Contig/Assembly ProteinLOC781088PREDICTED: hemoglobin fetal subunit beta-like [Bos taurus]. 2394e-63O
Contig/Assembly ProteinLOC783672PREDICTED: hemoglobin fetal subunit beta-like [Bos taurus]. 2394e-63O
Contig/Assembly ProteinHBE4hemoglobin subunit epsilon-4 [Bos taurus]. 2164e-56O
Contig/Assembly ProteinHBE2hemoglobin subunit epsilon-2 [Bos taurus]. 2081e-53O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHBBhemoglobin subunit beta [Sus scrofa]. 2971e-80O
Contig/Assembly ProteinLOC100515788PREDICTED: hemoglobin subunit beta-like [Sus scrofa]. 2663e-71O
Contig/Assembly ProteinHBE1hemoglobin subunit epsilon [Sus scrofa]. 2393e-63O
Contig/Assembly ProteinLOC100621288PREDICTED: LOW QUALITY PROTEIN: hemoglobin subunit epsilon-4-like [Sus scrofa]. 1396e-33O
Contig/Assembly ProteinMBmyoglobin [Sus scrofa]. 64.32e-10O
Contig/Assembly ProteinLOC100518861PREDICTED: cytoglobin-like [Sus scrofa]. 63.24e-10O


Assembly Members: 1907      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010013C06ADR01_0013_C06.bDB782667 
ADR010017C07ADR01_0017_C07.bDB783005 
BFLT10002G09BFLT1_0002_G09.bFS640153 
BFLT10003A12BFLT1_0003_A12.bFS640174 
BFLT10003E05BFLT1_0003_E05.bFS640207 
BFLT10028C05BFLT1_0028_C05.bFS642267 
BFLT10039E04BFLT1_0039_E04.bFS643187 
BFLT10115C10BFLT1_0115_C10.bHX202973 
BFLT10116G01BFLT1_0116_G01.bHX203086 
BFLT10124D05BFLT1_0124_D05.bHX203710 
BKFL10086F04BKFL1_0086_F04.bFS654040 
BKFL10116D11BKFL1_0116_D11.bFS656678 
BMWN10001A06BMWN1_0001_A06.bHX205655 
BMWN10001C08BMWN1_0001_C08.bHX205671 
BMWN10001C09BMWN1_0001_C09.bHX205672 
BMWN10001D05BMWN1_0001_D05.bHX205678 
BMWN10001E02BMWN1_0001_E02.bHX205686 
BMWN10001E11BMWN1_0001_E11.bHX205694 
BMWN10001G09BMWN1_0001_G09.bHX205710 
BMWN10001H10BMWN1_0001_H10.bHX205719 
BMWN10002B07BMWN1_0002_B07.bHX205733 
BMWN10002F07BMWN1_0002_F07.bHX205767 
BMWN10002F12BMWN1_0002_F12.bHX205770 
BMWN10002G01BMWN1_0002_G01.bHX205771 
BMWN10002H02BMWN1_0002_H02.bHX205780 
BMWN10002H09BMWN1_0002_H09.bHX205783 
BMWN10003D02BMWN1_0003_D02.bHX205803 
BMWN10003D05BMWN1_0003_D05.bHX205805 
BMWN10003E10BMWN1_0003_E10.bHX205814 
BMWN10003E11BMWN1_0003_E11.bHX205815 
BMWN10003G12BMWN1_0003_G12.bHX205828 
BMWN10003H05BMWN1_0003_H05.bHX205831 
BMWN10003H06BMWN1_0003_H06.b  
BMWN10003H10BMWN1_0003_H10.bHX205833 
BMWN10004A09BMWN1_0004_A09.bHX205836 
BMWN10004C02BMWN1_0004_C02.bHX205845 
BMWN10004C05BMWN1_0004_C05.bHX205846 
BMWN10004C12BMWN1_0004_C12.bHX205848 
BMWN10004G01BMWN1_0004_G01.bHX205859 
BMWN10004H09BMWN1_0004_H09.bHX205872 
BMWN10005A04BMWN1_0005_A04.bHX205875 
BMWN10005B06BMWN1_0005_B06.bHX205886 
BMWN10005C09BMWN1_0005_C09.bHX205892 
BMWN10005D10BMWN1_0005_D10.bHX205898 
BMWN10005F03BMWN1_0005_F03.bHX205908 
BMWN10005F06BMWN1_0005_F06.bHX205909 
BMWN10005F10BMWN1_0005_F10.bHX205912 
BMWN10005G02BMWN1_0005_G02.bHX205915 
BMWN10006A02BMWN1_0006_A02.bHX205927 
BMWN10006B07BMWN1_0006_B07.bHX205936 
BMWN10006D05BMWN1_0006_D05.bHX205952 
BMWN10006D10BMWN1_0006_D10.bHX205954 
BMWN10006F10BMWN1_0006_F10.bHX205964 
BMWN10006G01BMWN1_0006_G01.bHX205965 
BMWN10006G02BMWN1_0006_G02.bHX205966 
BMWN10006H08BMWN1_0006_H08.bHX205978 
BMWN10007A07BMWN1_0007_A07.bHX205985 
BMWN10007A09BMWN1_0007_A09.bHX205987 
BMWN10007B07BMWN1_0007_B07.bHX205994 
BMWN10007C03BMWN1_0007_C03.bHX205999 
BMWN10007C08BMWN1_0007_C08.bHX206003 
BMWN10007D07BMWN1_0007_D07.bHX206011 
BMWN10007D11BMWN1_0007_D11.bHX206014 
BMWN10007F09BMWN1_0007_F09.bHX206031 
BMWN10007G06BMWN1_0007_G06.bHX206040 
BMWN10007H11BMWN1_0007_H11.bHX206053 
BMWN10008A04BMWN1_0008_A04.bHX206057 
BMWN10008B07BMWN1_0008_B07.bHX206065 
BMWN10008B09BMWN1_0008_B09.bHX206067 
BMWN10008D02BMWN1_0008_D02.bHX206079 
BMWN10008D08BMWN1_0008_D08.bHX206082 
BMWN10008F06BMWN1_0008_F06.bHX206100 
BMWN10008F10BMWN1_0008_F10.bHX206103 
BMWN10008H07BMWN1_0008_H07.bHX206121 
BMWN10008H10BMWN1_0008_H10.bHX206122 
BMWN10009A01BMWN1_0009_A01.bHX206124 
BMWN10009C02BMWN1_0009_C02.bHX206138 
BMWN10009C07BMWN1_0009_C07.bHX206142 
BMWN10009C11BMWN1_0009_C11.bHX206145 
BMWN10009E10BMWN1_0009_E10.bHX206161 
BMWN10009G07BMWN1_0009_G07.bHX206175 
BMWN10010A06BMWN1_0010_A06.bHX206193 
BMWN10010A10BMWN1_0010_A10.bHX206196 
BMWN10010C12BMWN1_0010_C12.bHX206210 AK399682
BMWN10010D01BMWN1_0010_D01.bHX206211 
BMWN10010F07BMWN1_0010_F07.bHX206239 
BMWN10010F12BMWN1_0010_F12.bHX206243 
BMWN10010G07BMWN1_0010_G07.bHX206247 
BMWN10011A01BMWN1_0011_A01.bHX206261 
BMWN10011B04BMWN1_0011_B04.bHX206266 
BMWN10011D08BMWN1_0011_D08.bHX206284 
BMWN10011F05BMWN1_0011_F05.bHX206299 
BMWN10011F10BMWN1_0011_F10.bHX206304 
BMWN10011G06BMWN1_0011_G06.bHX206312 
BMWN10011H09BMWN1_0011_H09.b  
BMWN10012B07BMWN1_0012_B07.bHX206331 
BMWN10012B10BMWN1_0012_B10.b  
BMWN10012B11BMWN1_0012_B11.bHX206334 
BMWN10012C01BMWN1_0012_C01.bHX206335 
BMWN10012C12BMWN1_0012_C12.bHX206342 
BMWN10012E03BMWN1_0012_E03.bHX206348 
BMWN10012G03BMWN1_0012_G03.bHX206362 
BMWN10012H01BMWN1_0012_H01.bHX206368 
BMWN10012H02BMWN1_0012_H02.bHX206369 
BMWN10013A11BMWN1_0013_A11.bHX206382 
BMWN10013B01BMWN1_0013_B01.bHX206383 
BMWN10013B03BMWN1_0013_B03.bHX206385 
BMWN10013C01BMWN1_0013_C01.bHX206391 
BMWN10013C12BMWN1_0013_C12.bHX206398 
BMWN10013D01BMWN1_0013_D01.bHX206399 
BMWN10013D05BMWN1_0013_D05.bHX206402 
BMWN10013D11BMWN1_0013_D11.bHX206406 
BMWN10013E08BMWN1_0013_E08.bHX206413 
BMWN10013F03BMWN1_0013_F03.bHX206416 
BMWN10013G02BMWN1_0013_G02.bHX206424 
BMWN10013H09BMWN1_0013_H09.bHX206442 
BMWN10013H10BMWN1_0013_H10.bHX206443 
BMWN10014A01BMWN1_0014_A01.bHX206445 
BMWN10014B06BMWN1_0014_B06.bHX206451 
BMWN10014C02BMWN1_0014_C02.bHX206453 
BMWN10014D03BMWN1_0014_D03.bHX206459 
BMWN10014E09BMWN1_0014_E09.bHX206471 
BMWN10014F01BMWN1_0014_F01.bHX206472 
BMWN10014F02BMWN1_0014_F02.bHX206473 
BMWN10014H06BMWN1_0014_H06.bHX206480 
BMWN10015B06BMWN1_0015_B06.bHX206489 
BMWN10015B11BMWN1_0015_B11.bHX206491 
BMWN10015H01BMWN1_0015_H01.bHX206505 
BMWN10016D01BMWN1_0016_D01.bHX206525 
BMWN10016F07BMWN1_0016_F07.bHX206548 
BMWN10016H06BMWN1_0016_H06.bHX206558 
BMWN10017A04BMWN1_0017_A04.bHX206565 
BMWN10017B04BMWN1_0017_B04.bHX206574 
BMWN10017C02BMWN1_0017_C02.bHX206578 
BMWN10017D10BMWN1_0017_D10.bHX206592 
BMWN10017F03BMWN1_0017_F03.bHX206602 
BMWN10017H10BMWN1_0017_H10.bHX206611 
BMWN10018A01BMWN1_0018_A01.bHX206613 
BMWN10018A05BMWN1_0018_A05.bHX206616 
BMWN10018D06BMWN1_0018_D06.bHX206646 
BMWN10018F04BMWN1_0018_F04.bHX206662 
BMWN10018F07BMWN1_0018_F07.bHX206664 
BMWN10018F09BMWN1_0018_F09.bHX206666 
BMWN10018G07BMWN1_0018_G07.bHX206673 
BMWN10019A03BMWN1_0019_A03.bHX206687 
BMWN10019C08BMWN1_0019_C08.bHX206705 
BMWN10019H05BMWN1_0019_H05.bHX206746 
BMWN10019H06BMWN1_0019_H06.bHX206747 
BMWN10020A04BMWN1_0020_A04.bHX206751 
BMWN10020A09BMWN1_0020_A09.bHX206753 
BMWN10020B05BMWN1_0020_B05.bHX206758 
BMWN10020C02BMWN1_0020_C02.bHX206764 
BMWN10020C05BMWN1_0020_C05.bHX206766 
BMWN10020C08BMWN1_0020_C08.bHX206768 
BMWN10020E08BMWN1_0020_E08.bHX206789 
BMWN10020F05BMWN1_0020_F05.bHX206795 
BMWN10021A05BMWN1_0021_A05.bHX206820 
BMWN10021A08BMWN1_0021_A08.bHX206823 
BMWN10021B10BMWN1_0021_B10.bHX206829 
BMWN10021B11BMWN1_0021_B11.bHX206830 
BMWN10021C05BMWN1_0021_C05.bHX206832 
BMWN10021D07BMWN1_0021_D07.bHX206843 
BMWN10021E03BMWN1_0021_E03.bHX206850 
BMWN10021E07BMWN1_0021_E07.bHX206854 
BMWN10021E11BMWN1_0021_E11.bHX206858 
BMWN10021G11BMWN1_0021_G11.bHX206874 
BMWN10021H07BMWN1_0021_H07.bHX206879 
BMWN10021H08BMWN1_0021_H08.bHX206880 
BMWN10021H09BMWN1_0021_H09.bHX206881 
BMWN10022A09BMWN1_0022_A09.b  
BMWN10022C11BMWN1_0022_C11.bHX206897 
BMWN10022E06BMWN1_0022_E06.bHX206909 
BMWN10022G12BMWN1_0022_G12.bHX206931 
BMWN10022H04BMWN1_0022_H04.bHX206933 
BMWN10022H09BMWN1_0022_H09.bHX206936 
BMWN10023A01BMWN1_0023_A01.b  
BMWN10023A05BMWN1_0023_A05.bHX206941 
BMWN10023B04BMWN1_0023_B04.bHX206948 
BMWN10023D06BMWN1_0023_D06.bHX206959 
BMWN10023E10BMWN1_0023_E10.bHX206973 
BMWN10023G10BMWN1_0023_G10.bHX206987 
BMWN10023H12BMWN1_0023_H12.bHX206998 
BMWN10024A11BMWN1_0024_A11.bHX207006 
BMWN10024C01BMWN1_0024_C01.bHX207012 
BMWN10024C09BMWN1_0024_C09.bHX207017 
BMWN10024D05BMWN1_0024_D05.b  
BMWN10024D12BMWN1_0024_D12.bHX207028 
BMWN10024E07BMWN1_0024_E07.bHX207031 
BMWN10024F02BMWN1_0024_F02.bHX207035 
BMWN10024H04BMWN1_0024_H04.bHX207052 
BMWN10024H05BMWN1_0024_H05.bHX207053 
BMWN10024H12BMWN1_0024_H12.bHX207057 
BMWN10025A11BMWN1_0025_A11.bHX207062 
BMWN10025B02BMWN1_0025_B02.bHX207064 
BMWN10025C08BMWN1_0025_C08.bHX207076 
BMWN10025D02BMWN1_0025_D02.bHX207080 
BMWN10025E02BMWN1_0025_E02.bHX207089 
BMWN10025E09BMWN1_0025_E09.bHX207093 
BMWN10025E11BMWN1_0025_E11.bHX207094 
BMWN10025F03BMWN1_0025_F03.bHX207098 
BMWN10025H02BMWN1_0025_H02.bHX207113 
BMWN10025H04BMWN1_0025_H04.bHX207115 
BMWN10026A04BMWN1_0026_A04.bHX207126 
BMWN10026B07BMWN1_0026_B07.bHX207135 
BMWN10026C03BMWN1_0026_C03.bHX207142 
BMWN10026C12BMWN1_0026_C12.bHX207147 
BMWN10026F06BMWN1_0026_F06.bHX207166 
BMWN10026G12BMWN1_0026_G12.bHX207178 
BMWN10026H07BMWN1_0026_H07.bHX207184 
BMWN10026H08BMWN1_0026_H08.bHX207185 
BMWN10027A01BMWN1_0027_A01.bHX207187 
BMWN10027A07BMWN1_0027_A07.bHX207192 
BMWN10027A10BMWN1_0027_A10.bHX207194 
BMWN10027B12BMWN1_0027_B12.bHX207203 
BMWN10027C03BMWN1_0027_C03.bHX207206 
BMWN10027E04BMWN1_0027_E04.bHX207220 
BMWN10027E12BMWN1_0027_E12.bHX207226 
BMWN10027G04BMWN1_0027_G04.bHX207238 
BMWN10027G08BMWN1_0027_G08.bHX207241 
BMWN10027G10BMWN1_0027_G10.bHX207242 
BMWN10027H01BMWN1_0027_H01.bHX207244 
BMWN10027H08BMWN1_0027_H08.bHX207250 
BMWN10027H11BMWN1_0027_H11.bHX207252 
BMWN10028A10BMWN1_0028_A10.bHX207261 
BMWN10028A11BMWN1_0028_A11.bHX207262 
BMWN10028A12BMWN1_0028_A12.bHX207263 
BMWN10028B05BMWN1_0028_B05.bHX207267 
BMWN10028B11BMWN1_0028_B11.bHX207272 
BMWN10028D09BMWN1_0028_D09.bHX207288 
BMWN10028D11BMWN1_0028_D11.bHX207289 
BMWN10028F08BMWN1_0028_F08.bHX207308 
BMWN10029F01BMWN1_0029_F01.bHX207368 
BMWN10029F08BMWN1_0029_F08.bHX207374 
BMWN10030A07BMWN1_0030_A07.bHX207392 
BMWN10030B07BMWN1_0030_B07.bHX207398 
BMWN10030B10BMWN1_0030_B10.bHX207400 
BMWN10030D01BMWN1_0030_D01.bHX207410 
BMWN10030E10BMWN1_0030_E10.bHX207424 
BMWN10030F04BMWN1_0030_F04.bHX207429 
BMWN10030G07BMWN1_0030_G07.bHX207440 
BMWN10030H09BMWN1_0030_H09.bHX207445 
BMWN10031A01BMWN1_0031_A01.bHX207448 
BMWN10031A02BMWN1_0031_A02.bHX207449 
BMWN10031A06BMWN1_0031_A06.bHX207452 
BMWN10031B11BMWN1_0031_B11.bHX207466 
BMWN10031C05BMWN1_0031_C05.bHX207472 
BMWN10031C06BMWN1_0031_C06.bHX207473 
BMWN10031D06BMWN1_0031_D06.bHX207481 
BMWN10031E04BMWN1_0031_E04.bHX207489 
BMWN10031E07BMWN1_0031_E07.bHX207491 
BMWN10031F05BMWN1_0031_F05.bHX207499 
BMWN10031G06BMWN1_0031_G06.bHX207511 
BMWN10031G08BMWN1_0031_G08.bHX207512 
BMWN10031H05BMWN1_0031_H05.bHX207518 
BMWN10032A10BMWN1_0032_A10.bHX207530 
BMWN10032B08BMWN1_0032_B08.bHX207538 
BMWN10032C01BMWN1_0032_C01.bHX207543 
BMWN10032E08BMWN1_0032_E08.bHX207566 
BMWN10032E11BMWN1_0032_E11.bHX207569 
BMWN10033B11BMWN1_0033_B11.bHX207598 
BMWN10033B12BMWN1_0033_B12.bHX207599 
BMWN10033D08BMWN1_0033_D08.bHX207615 
BMWN10033E07BMWN1_0033_E07.bHX207623 
BMWN10033H04BMWN1_0033_H04.bHX207647 
BMWN10034D10BMWN1_0034_D10.bHX207683 
BMWN10034F05BMWN1_0034_F05.bHX207698 
BMWN10034H08BMWN1_0034_H08.bHX207716 
BMWN10035B08BMWN1_0035_B08.b  
BMWN10035C08BMWN1_0035_C08.bHX207739 
BMWN10035C11BMWN1_0035_C11.bHX207742 
BMWN10035E08BMWN1_0035_E08.bHX207751 
BMWN10035F05BMWN1_0035_F05.bHX207757 
BMWN10035G04BMWN1_0035_G04.bHX207766 
BMWN10035H09BMWN1_0035_H09.bHX207775 
BMWN10036A02BMWN1_0036_A02.bHX207778 
BMWN10036A09BMWN1_0036_A09.bHX207781 
BMWN10036B02BMWN1_0036_B02.bHX207785 
BMWN10036B07BMWN1_0036_B07.bHX207790 
BMWN10036B11BMWN1_0036_B11.bHX207793 
BMWN10036C07BMWN1_0036_C07.bHX207798 
BMWN10036C10BMWN1_0036_C10.bHX207801 
BMWN10036F05BMWN1_0036_F05.bHX207822 
BMWN10036G11BMWN1_0036_G11.bHX207836 
BMWN10036H01BMWN1_0036_H01.b  
BMWN10037B06BMWN1_0037_B06.bHX207849 
BMWN10037B09BMWN1_0037_B09.bHX207851 
BMWN10037C07BMWN1_0037_C07.bHX207857 
BMWN10037D06BMWN1_0037_D06.bHX207864 
BMWN10037E09BMWN1_0037_E09.bHX207875 
BMWN10037F09BMWN1_0037_F09.bHX207884 
BMWN10037G03BMWN1_0037_G03.bHX207890 
BMWN10037H07BMWN1_0037_H07.bHX207904 
BMWN10037H11BMWN1_0037_H11.bHX207905 
BMWN10038A05BMWN1_0038_A05.bHX207907 
BMWN10038A11BMWN1_0038_A11.bHX207910 
BMWN10038A12BMWN1_0038_A12.bHX207911 
BMWN10038E10BMWN1_0038_E10.bHX207931 
BMWN10038F04BMWN1_0038_F04.bHX207934 
BMWN10038F11BMWN1_0038_F11.bHX207939 
BMWN10038H05BMWN1_0038_H05.bHX207950 
BMWN10038H08BMWN1_0038_H08.bHX207953 
BMWN10038H09BMWN1_0038_H09.bHX207954 
BMWN10039A04BMWN1_0039_A04.bHX207956 
BMWN10039D07BMWN1_0039_D07.bHX207972 
BMWN10039F03BMWN1_0039_F03.bHX207981 
BMWN10039F05BMWN1_0039_F05.bHX207982 
BMWN10039F06BMWN1_0039_F06.bHX207983 
BMWN10039F12BMWN1_0039_F12.bHX207985 
BMWN10039G03BMWN1_0039_G03.bHX207986 
BMWN10039G09BMWN1_0039_G09.b  
BMWN10040A03BMWN1_0040_A03.b  
BMWN10040A05BMWN1_0040_A05.bHX207993 
BMWN10040B03BMWN1_0040_B03.bHX207998 
BMWN10040B10BMWN1_0040_B10.b  
BMWN10040C03BMWN1_0040_C03.bHX208002 
BMWN10040D03BMWN1_0040_D03.bHX208008 
BMWN10040D06BMWN1_0040_D06.bHX208010 
BMWN10040E08BMWN1_0040_E08.b  
BMWN10040F08BMWN1_0040_F08.bHX208023 
BMWN10040G08BMWN1_0040_G08.bHX208028 
BMWN10041A02BMWN1_0041_A02.bHX208033 
BMWN10041A09BMWN1_0041_A09.bHX208037 
BMWN10041B04BMWN1_0041_B04.bHX208041 
BMWN10041C05BMWN1_0041_C05.bHX208046 
BMWN10041C06BMWN1_0041_C06.bHX208047 
BMWN10041C07BMWN1_0041_C07.bHX208048 
BMWN10041D02BMWN1_0041_D02.bHX208052 
BMWN10041D05BMWN1_0041_D05.bHX208054 
BMWN10041F05BMWN1_0041_F05.bHX208063 
BMWN10041H04BMWN1_0041_H04.bHX208077 
BMWN10041H06BMWN1_0041_H06.bHX208079 
BMWN10042A04BMWN1_0042_A04.bHX208081 
BMWN10042A05BMWN1_0042_A05.bHX208082 
BMWN10042A07BMWN1_0042_A07.bHX208084 
BMWN10042A08BMWN1_0042_A08.bHX208085 
BMWN10042B06BMWN1_0042_B06.bHX208091 
BMWN10042B07BMWN1_0042_B07.bHX208092 
BMWN10042B10BMWN1_0042_B10.bHX208093 
BMWN10042E01BMWN1_0042_E01.bHX208110 
BMWN10042G02BMWN1_0042_G02.bHX208119 
BMWN10042G06BMWN1_0042_G06.bHX208122 
BMWN10043C07BMWN1_0043_C07.b  
BMWN10043C09BMWN1_0043_C09.b  
BMWN10043C12BMWN1_0043_C12.b  
BMWN10043D01BMWN1_0043_D01.b  
BMWN10043D04BMWN1_0043_D04.b  
BMWN10043E04BMWN1_0043_E04.b  
BMWN10043E05BMWN1_0043_E05.b  
BMWN10043F10BMWN1_0043_F10.b  
BMWN10043G06BMWN1_0043_G06.b  
BMWN10043H06BMWN1_0043_H06.bHX208146 
BMWN10043H12BMWN1_0043_H12.b  
BMWN10044A10BMWN1_0044_A10.bHX208153 
BMWN10044B05BMWN1_0044_B05.bHX208157 
BMWN10044B09BMWN1_0044_B09.bHX208161 
BMWN10044C04BMWN1_0044_C04.bHX208167 
BMWN10044C05BMWN1_0044_C05.b  
BMWN10044E05BMWN1_0044_E05.bHX208181 
BMWN10044E12BMWN1_0044_E12.bHX208186 
BMWN10044F10BMWN1_0044_F10.bHX208193 
BMWN10044G07BMWN1_0044_G07.bHX208199 
BMWN10045B08BMWN1_0045_B08.bHX208218 
BMWN10045C12BMWN1_0045_C12.bHX208229 
BMWN10045D12BMWN1_0045_D12.bHX208236 
BMWN10045F03BMWN1_0045_F03.bHX208243 
BMWN10045H01BMWN1_0045_H01.bHX208254 
BMWN10045H02BMWN1_0045_H02.bHX208255 AK399727
BMWN10045H12BMWN1_0045_H12.bHX208260 
BMWN10046A03BMWN1_0046_A03.bHX208263 
BMWN10046A04BMWN1_0046_A04.b  
BMWN10046A09BMWN1_0046_A09.b  
BMWN10046B06BMWN1_0046_B06.bHX208273 
BMWN10046C07BMWN1_0046_C07.bHX208278 
BMWN10046D11BMWN1_0046_D11.bHX208289 
BMWN10046D12BMWN1_0046_D12.bHX208290 
BMWN10046E01BMWN1_0046_E01.bHX208291 
BMWN10046E02BMWN1_0046_E02.bHX208292 
BMWN10046E03BMWN1_0046_E03.bHX208293 
BMWN10046E08BMWN1_0046_E08.bHX208297 
BMWN10046G04BMWN1_0046_G04.bHX208314 
BMWN10046H09BMWN1_0046_H09.bHX208329 
BMWN10046H11BMWN1_0046_H11.bHX208330 
BMWN10047A07BMWN1_0047_A07.bHX208336 
BMWN10047A08BMWN1_0047_A08.bHX208337 
BMWN10047A10BMWN1_0047_A10.bHX208339 
BMWN10047C12BMWN1_0047_C12.bHX208361 
BMWN10047D05BMWN1_0047_D05.bHX208364 
BMWN10047E04BMWN1_0047_E04.bHX208373 
BMWN10047F07BMWN1_0047_F07.bHX208386 
BMWN10047H07BMWN1_0047_H07.bHX208401 
BMWN10048B12BMWN1_0048_B12.bHX208423 
BMWN10048D06BMWN1_0048_D06.bHX208439 
BMWN10048G03BMWN1_0048_G03.bHX208469 
BMWN10048G05BMWN1_0048_G05.bHX208471 
BMWN10048H06BMWN1_0048_H06.bHX208481 
BMWN10049C06BMWN1_0049_C06.bHX208510 
BMWN10049D08BMWN1_0049_D08.bHX208522 
BMWN10049F05BMWN1_0049_F05.bHX208540 
BMWN10049F12BMWN1_0049_F12.bHX208546 
BMWN10049G07BMWN1_0049_G07.bHX208552 
BMWN10050A06BMWN1_0050_A06.bHX208571 
BMWN10050A08BMWN1_0050_A08.bHX208572 
BMWN10050B07BMWN1_0050_B07.bHX208580 
BMWN10050D03BMWN1_0050_D03.bHX208597 
BMWN10050D07BMWN1_0050_D07.bHX208601 
BMWN10050E07BMWN1_0050_E07.bHX208613 
BMWN10050H08BMWN1_0050_H08.bHX208640 
BMWN10051C11BMWN1_0051_C11.bHX208672 
BMWN10051E01BMWN1_0051_E01.bHX208685 
BMWN10051F03BMWN1_0051_F03.bHX208694 
BMWN10051G06BMWN1_0051_G06.bHX208703 
BMWN10051G08BMWN1_0051_G08.bHX208704 
BMWN10051G10BMWN1_0051_G10.b  
BMWN10051H09BMWN1_0051_H09.bHX208708 
BMWN10052A01BMWN1_0052_A01.bHX208711 
BMWN10052A03BMWN1_0052_A03.bHX208713 
BMWN10052C08BMWN1_0052_C08.bHX208733 
BMWN10052C10BMWN1_0052_C10.bHX208735 
BMWN10052C11BMWN1_0052_C11.bHX208736 
BMWN10052D12BMWN1_0052_D12.bHX208742 
BMWN10052G05BMWN1_0052_G05.bHX208758 
BMWN10052G10BMWN1_0052_G10.bHX208761 
BMWN10052G11BMWN1_0052_G11.bHX208762 
BMWN10052H08BMWN1_0052_H08.bHX208765 
BMWN10052H11BMWN1_0052_H11.bHX208766 
BMWN10053A05BMWN1_0053_A05.bHX208771 
BMWN10053E04BMWN1_0053_E04.bHX208799 
BMWN10053F12BMWN1_0053_F12.bHX208813 
BMWN10053G07BMWN1_0053_G07.bHX208817 
BMWN10053H03BMWN1_0053_H03.bHX208821 
BMWN10053H08BMWN1_0053_H08.bHX208824 
BMWN10053H11BMWN1_0053_H11.bHX208825 
BMWN10054A07BMWN1_0054_A07.bHX208830 
BMWN10054C02BMWN1_0054_C02.bHX208840 
BMWN10054D11BMWN1_0054_D11.bHX208855 
BMWN10054E08BMWN1_0054_E08.bHX208862 
BMWN10054G05BMWN1_0054_G05.bHX208877 
BMWN10055A01BMWN1_0055_A01.bHX208889 
BMWN10055A02BMWN1_0055_A02.bHX208890 
BMWN10055A07BMWN1_0055_A07.bHX208894 
BMWN10055C01BMWN1_0055_C01.bHX208904 
BMWN10055D01BMWN1_0055_D01.bHX208909 
BMWN10055D10BMWN1_0055_D10.bHX208913 
BMWN10055D12BMWN1_0055_D12.bHX208915 
BMWN10055E03BMWN1_0055_E03.bHX208917 
BMWN10055E04BMWN1_0055_E04.bHX208918 
BMWN10055F02BMWN1_0055_F02.bHX208922 
BMWN10055F09BMWN1_0055_F09.bHX208924 
BMWN10055H01BMWN1_0055_H01.bHX208931 
BMWN10055H11BMWN1_0055_H11.b  
BMWN10055H12BMWN1_0055_H12.bHX208935 
BMWN10056B11BMWN1_0056_B11.bHX208941 
BMWN10056E04BMWN1_0056_E04.bHX208958 
BMWN10056F01BMWN1_0056_F01.bHX208963 
BMWN10056G04BMWN1_0056_G04.bHX208974 
BMWN10056G06BMWN1_0056_G06.b  
BMWN10056G08BMWN1_0056_G08.bHX208976 
BMWN10056H03BMWN1_0056_H03.bHX208979 
BMWN10056H06BMWN1_0056_H06.bHX208982 
BMWN10057A03BMWN1_0057_A03.bHX208988 
BMWN10057A04BMWN1_0057_A04.bHX208989 
BMWN10057B08BMWN1_0057_B08.bHX209003 
BMWN10057B12BMWN1_0057_B12.bHX209007 
BMWN10057C06BMWN1_0057_C06.bHX209012 
BMWN10057C07BMWN1_0057_C07.bHX209013 
BMWN10057E01BMWN1_0057_E01.bHX209026 
BMWN10057E03BMWN1_0057_E03.bHX209028 
BMWN10057F02BMWN1_0057_F02.bHX209038 
BMWN10057F08BMWN1_0057_F08.bHX209043 
BMWN10057F09BMWN1_0057_F09.bHX209044 
BMWN10057G03BMWN1_0057_G03.bHX209050 
BMWN10057H06BMWN1_0057_H06.bHX209060 
BMWN10057H07BMWN1_0057_H07.bHX209061 
BMWN10057H10BMWN1_0057_H10.bHX209062 
BMWN10058B09BMWN1_0058_B09.bHX209074 
BMWN10058F06BMWN1_0058_F06.bHX209100 
BMWN10058F07BMWN1_0058_F07.bHX209101 
BMWN10058F12BMWN1_0058_F12.bHX209103 
BMWN10058G09BMWN1_0058_G09.bHX209107 
BMWN10058G12BMWN1_0058_G12.bHX209109 
BMWN10058H01BMWN1_0058_H01.b  
BMWN10058H07BMWN1_0058_H07.bHX209110 
BMWN10058H10BMWN1_0058_H10.bHX209112 
BMWN10059B08BMWN1_0059_B08.bHX209130 
BMWN10059C01BMWN1_0059_C01.bHX209133 
BMWN10059C03BMWN1_0059_C03.bHX209135 
BMWN10059C09BMWN1_0059_C09.bHX209141 
BMWN10059D10BMWN1_0059_D10.bHX209152 
BMWN10059D11BMWN1_0059_D11.bHX209153 
BMWN10059E01BMWN1_0059_E01.bHX209155 
BMWN10059F10BMWN1_0059_F10.b  
BMWN10060A09BMWN1_0060_A09.bHX209191 
BMWN10060D10BMWN1_0060_D10.bHX209219 
BMWN10060E02BMWN1_0060_E02.bHX209223 
BMWN10060E12BMWN1_0060_E12.bHX209229 
BMWN10060F08BMWN1_0060_F08.bHX209234 
BMWN10060H01BMWN1_0060_H01.bHX209244 
BMWN10060H03BMWN1_0060_H03.b  
BMWN10060H08BMWN1_0060_H08.bHX209247 
BMWN10061A01BMWN1_0061_A01.bHX209250 
BMWN10061A02BMWN1_0061_A02.bHX209251 
BMWN10061B01BMWN1_0061_B01.bHX209256 
BMWN10061C08BMWN1_0061_C08.bHX209265 
BMWN10061D04BMWN1_0061_D04.bHX209270 
BMWN10061H10BMWN1_0061_H10.bHX209305 
BMWN10062A06BMWN1_0062_A06.bHX209311 
BMWN10062B03BMWN1_0062_B03.b  
BMWN10062B04BMWN1_0062_B04.bHX209315 
BMWN10062C03BMWN1_0062_C03.bHX209324 
BMWN10062C08BMWN1_0062_C08.bHX209328 
BMWN10062D08BMWN1_0062_D08.bHX209338 
BMWN10062E03BMWN1_0062_E03.bHX209344 
BMWN10062E07BMWN1_0062_E07.bHX209348 
BMWN10062F01BMWN1_0062_F01.bHX209350 
BMWN10062F05BMWN1_0062_F05.bHX209352 
BMWN10062H11BMWN1_0062_H11.bHX209371 
BMWN10063B06BMWN1_0063_B06.bHX209382 
BMWN10063C07BMWN1_0063_C07.bHX209392 
BMWN10063D11BMWN1_0063_D11.bHX209400 
BMWN10063F05BMWN1_0063_F05.bHX209411 
BMWN10063F06BMWN1_0063_F06.bHX209412 
BMWN10063H07BMWN1_0063_H07.bHX209429 
BMWN10063H08BMWN1_0063_H08.bHX209430 
BMWN10064B10BMWN1_0064_B10.bHX209449 
BMWN10064C02BMWN1_0064_C02.bHX209451 
BMWN10064D06BMWN1_0064_D06.bHX209456 
BMWN10064D07BMWN1_0064_D07.bHX209457 
BMWN10064D11BMWN1_0064_D11.bHX209460 
BMWN10064E05BMWN1_0064_E05.bHX209466 
BMWN10064E10BMWN1_0064_E10.bHX209469 
BMWN10064F07BMWN1_0064_F07.bHX209478 
BMWN10064G04BMWN1_0064_G04.bHX209485 
BMWN10064H02BMWN1_0064_H02.bHX209491 
BMWN10064H08BMWN1_0064_H08.bHX209496 
BMWN10065A06BMWN1_0065_A06.bHX209503 
BMWN10065B03BMWN1_0065_B03.bHX209509 
BMWN10065B10BMWN1_0065_B10.bHX209513 
BMWN10065D05BMWN1_0065_D05.bHX209520 
BMWN10065D11BMWN1_0065_D11.bHX209525 
BMWN10065E03BMWN1_0065_E03.bHX209528 
BMWN10065E05BMWN1_0065_E05.bHX209530 
BMWN10065E07BMWN1_0065_E07.bHX209532 
BMWN10065F06BMWN1_0065_F06.bHX209538 
BMWN10065H02BMWN1_0065_H02.bHX209550 
BMWN10065H03BMWN1_0065_H03.bHX209551 
BMWN10066A11BMWN1_0066_A11.b  
BMWN10066B03BMWN1_0066_B03.bHX209562 
BMWN10066B12BMWN1_0066_B12.bHX209570 
BMWN10066C12BMWN1_0066_C12.b  
BMWN10066D06BMWN1_0066_D06.bHX209581 
BMWN10066D08BMWN1_0066_D08.bHX209583 
BMWN10066E01BMWN1_0066_E01.bHX209587 
BMWN10066E02BMWN1_0066_E02.bHX209588 
BMWN10066E10BMWN1_0066_E10.bHX209594 
BMWN10066F07BMWN1_0066_F07.bHX209598 
BMWN10066H11BMWN1_0066_H11.bHX209616 
BMWN10067A01BMWN1_0067_A01.bHX209617 
BMWN10067B06BMWN1_0067_B06.bHX209630 
BMWN10067B08BMWN1_0067_B08.bHX209631 
BMWN10067B11BMWN1_0067_B11.bHX209632 
BMWN10067D09BMWN1_0067_D09.bHX209651 
BMWN10067E08BMWN1_0067_E08.bHX209659 
BMWN10067F03BMWN1_0067_F03.bHX209663 
BMWN10068A01BMWN1_0068_A01.bHX209682 
BMWN10068B05BMWN1_0068_B05.bHX209693 
BMWN10068C10BMWN1_0068_C10.bHX209704 
BMWN10068D01BMWN1_0068_D01.bHX209707 
BMWN10068E07BMWN1_0068_E07.bHX209721 
BMWN10068F03BMWN1_0068_F03.bHX209727 
BMWN10068H04BMWN1_0068_H04.bHX209750 
BMWN10068H10BMWN1_0068_H10.bHX209755 
BMWN10069A07BMWN1_0069_A07.bHX209763 
BMWN10069E08BMWN1_0069_E08.bHX209796 
BMWN10069F09BMWN1_0069_F09.bHX209808 
BMWN10069F10BMWN1_0069_F10.bHX209809 
BMWN10069G03BMWN1_0069_G03.bHX209814 
BMWN10069G05BMWN1_0069_G05.bHX209816 
BMWN10069H03BMWN1_0069_H03.bHX209825 
BMWN10070A10BMWN1_0070_A10.bHX209835 
BMWN10070A12BMWN1_0070_A12.bHX209837 
BMWN10070B07BMWN1_0070_B07.bHX209842 
BMWN10070E03BMWN1_0070_E03.bHX209863 
BMWN10070F12BMWN1_0070_F12.bHX209877 
BMWN10071C05BMWN1_0071_C05.bHX209903 
BMWN10072A08BMWN1_0072_A08.bHX209950 
BMWN10072B02BMWN1_0072_B02.bHX209954 
BMWN10072C05BMWN1_0072_C05.bHX209965 
BMWN10072E05BMWN1_0072_E05.bHX209983 
BMWN10072E11BMWN1_0072_E11.bHX209989 
BMWN10072E12BMWN1_0072_E12.bHX209990 
BMWN10072G02BMWN1_0072_G02.bHX210000 
BMWN10072G03BMWN1_0072_G03.bHX210001 
BMWN10072G06BMWN1_0072_G06.bHX210002 
BMWN10072G12BMWN1_0072_G12.bHX210006 
BMWN10072H06BMWN1_0072_H06.bHX210008 
BMWN10073A10BMWN1_0073_A10.bHX210021 
BMWN10073A11BMWN1_0073_A11.bHX210022 
BMWN10073B01BMWN1_0073_B01.bHX210023 
BMWN10073B06BMWN1_0073_B06.bHX210027 
BMWN10073B09BMWN1_0073_B09.bHX210030 
BMWN10073C04BMWN1_0073_C04.bHX210035 
BMWN10073D12BMWN1_0073_D12.bHX210046 
BMWN10073E02BMWN1_0073_E02.bHX210048 
BMWN10073G03BMWN1_0073_G03.bHX210062 
BMWN10073G06BMWN1_0073_G06.bHX210063 
BMWN10073H10BMWN1_0073_H10.b  
BMWN10074A01BMWN1_0074_A01.bHX210071 
BMWN10074A09BMWN1_0074_A09.bHX210076 
BMWN10074A12BMWN1_0074_A12.bHX210078 
BMWN10074B05BMWN1_0074_B05.bHX210082 
BMWN10074C06BMWN1_0074_C06.bHX210092 
BMWN10074C12BMWN1_0074_C12.bHX210096 
BMWN10074D06BMWN1_0074_D06.bHX210100 
BMWN10074G03BMWN1_0074_G03.bHX210121 
BMWN10074H01BMWN1_0074_H01.bHX210127 
BMWN10075A03BMWN1_0075_A03.bHX210136 
BMWN10075C03BMWN1_0075_C03.bHX210152 
BMWN10075E10BMWN1_0075_E10.bHX210173 
BMWN10075F09BMWN1_0075_F09.bHX210182 
BMWN10075F10BMWN1_0075_F10.bHX210183 
BMWN10075G03BMWN1_0075_G03.bHX210187 
BMWN10075H03BMWN1_0075_H03.bHX210196 
BMWN10076B10BMWN1_0076_B10.bHX210219 
BMWN10076D07BMWN1_0076_D07.bHX210233 
BMWN10076E07BMWN1_0076_E07.bHX210241 
BMWN10076F11BMWN1_0076_F11.bHX210254 
BMWN10076G07BMWN1_0076_G07.bHX210262 
BMWN10076H04BMWN1_0076_H04.bHX210266 
BMWN10076H05BMWN1_0076_H05.bHX210267 
BMWN10076H08BMWN1_0076_H08.bHX210269 
BMWN10076H11BMWN1_0076_H11.bHX210271 
BMWN10077A08BMWN1_0077_A08.bHX210275 
BMWN10077A12BMWN1_0077_A12.bHX210276 
BMWN10077B01BMWN1_0077_B01.bHX210277 
BMWN10077D04BMWN1_0077_D04.bHX210291 
BMWN10077D07BMWN1_0077_D07.bHX210293 
BMWN10077F07BMWN1_0077_F07.bHX210315 
BMWN10077G11BMWN1_0077_G11.bHX210325 
BMWN10077H04BMWN1_0077_H04.bHX210330 
BMWN10077H08BMWN1_0077_H08.bHX210333 
BMWN10078A04BMWN1_0078_A04.bHX210339 
BMWN10078A09BMWN1_0078_A09.bHX210342 
BMWN10078B08BMWN1_0078_B08.bHX210349 
BMWN10078B11BMWN1_0078_B11.bHX210352 
BMWN10078C02BMWN1_0078_C02.bHX210354 
BMWN10078C05BMWN1_0078_C05.bHX210357 
BMWN10078C07BMWN1_0078_C07.bHX210358 
BMWN10078C11BMWN1_0078_C11.bHX210361 
BMWN10078E12BMWN1_0078_E12.bHX210373 
BMWN10078G02BMWN1_0078_G02.bHX210380 
BMWN10078G06BMWN1_0078_G06.bHX210383 
BMWN10079B01BMWN1_0079_B01.bHX210404 
BMWN10079C10BMWN1_0079_C10.bHX210420 
BMWN10079D05BMWN1_0079_D05.bHX210426 
BMWN10079D07BMWN1_0079_D07.bHX210428 
BMWN10079E06BMWN1_0079_E06.bHX210437 
BMWN10079H10BMWN1_0079_H10.bHX210458 
BMWN10080B07BMWN1_0080_B07.bHX210473 
BMWN10080C03BMWN1_0080_C03.bHX210479 
BMWN10080D09BMWN1_0080_D09.bHX210490 
BMWN10080E10BMWN1_0080_E10.bHX210498 
BMWN10080F04BMWN1_0080_F04.bHX210503 
BMWN10080H02BMWN1_0080_H02.bHX210518 
BMWN10080H05BMWN1_0080_H05.bHX210519 
BMWN10081A08BMWN1_0081_A08.bHX210529 
BMWN10081C02BMWN1_0081_C02.b  
BMWN10081D01BMWN1_0081_D01.b  
BMWN10081E01BMWN1_0081_E01.bHX210556 
BMWN10081E09BMWN1_0081_E09.bHX210560 
BMWN10081E11BMWN1_0081_E11.bHX210562 
BMWN10081E12BMWN1_0081_E12.bHX210563 
BMWN10081G06BMWN1_0081_G06.bHX210574 
BMWN10081G09BMWN1_0081_G09.bHX210577 
BMWN10081H01BMWN1_0081_H01.bHX210580 
BMWN10081H05BMWN1_0081_H05.bHX210583 
BMWN10082A04BMWN1_0082_A04.bHX210593 
BMWN10082B03BMWN1_0082_B03.bHX210600 
BMWN10082B10BMWN1_0082_B10.bHX210606 
BMWN10082G03BMWN1_0082_G03.bHX210641 
BMWN10083A08BMWN1_0083_A08.bHX210658 
BMWN10083A09BMWN1_0083_A09.b  
BMWN10083A12BMWN1_0083_A12.bHX210661 
BMWN10083B12BMWN1_0083_B12.bHX210669 
BMWN10083C05BMWN1_0083_C05.bHX210674 
BMWN10083E01BMWN1_0083_E01.bHX210692 
BMWN10083G12BMWN1_0083_G12.bHX210710 
BMWN10083H04BMWN1_0083_H04.bHX210713 
BMWN10083H05BMWN1_0083_H05.bHX210714 
BMWN10084B03BMWN1_0084_B03.bHX210731 
BMWN10084B04BMWN1_0084_B04.bHX210732 
BMWN10084B05BMWN1_0084_B05.b  
BMWN10084B12BMWN1_0084_B12.bHX210736 
BMWN10084C01BMWN1_0084_C01.bHX210737 
BMWN10084C11BMWN1_0084_C11.bHX210743 
BMWN10084E07BMWN1_0084_E07.bHX210753 
BMWN10084F04BMWN1_0084_F04.bHX210759 
BMWN10084F07BMWN1_0084_F07.bHX210762 
BMWN10084F09BMWN1_0084_F09.b  
BMWN10084G04BMWN1_0084_G04.bHX210769 
BMWN10084H07BMWN1_0084_H07.bHX210779 
BMWN10085A10BMWN1_0085_A10.bHX210787 
BMWN10085C08BMWN1_0085_C08.bHX210798 
BMWN10085D01BMWN1_0085_D01.bHX210802 
BMWN10085D03BMWN1_0085_D03.bHX210804 
BMWN10085D04BMWN1_0085_D04.bHX210805 
BMWN10085D05BMWN1_0085_D05.bHX210806 
BMWN10085D07BMWN1_0085_D07.bHX210807 
BMWN10085E10BMWN1_0085_E10.bHX210816 
BMWN10085F05BMWN1_0085_F05.bHX210821 
BMWN10085G11BMWN1_0085_G11.bHX210828 
BMWN10085G12BMWN1_0085_G12.bHX210829 
BMWN10085H03BMWN1_0085_H03.bHX210830 
BMWN10086A03BMWN1_0086_A03.bHX210834 
BMWN10086A10BMWN1_0086_A10.bHX210836 
BMWN10086C05BMWN1_0086_C05.bHX210847 
BMWN10086C10BMWN1_0086_C10.bHX210849 
BMWN10086C12BMWN1_0086_C12.bHX210851 
BMWN10086E05BMWN1_0086_E05.bHX210863 
BMWN10086G04BMWN1_0086_G04.bHX210873 
BMWN10086G08BMWN1_0086_G08.bHX210877 
BMWN10086H06BMWN1_0086_H06.bHX210883 
BMWN10086H07BMWN1_0086_H07.bHX210884 
BMWN10087A04BMWN1_0087_A04.bHX210889 
BMWN10087A06BMWN1_0087_A06.bHX210891 
BMWN10087A09BMWN1_0087_A09.bHX210894 
BMWN10087B04BMWN1_0087_B04.bHX210899 
BMWN10087C02BMWN1_0087_C02.bHX210904 
BMWN10087C05BMWN1_0087_C05.bHX210907 
BMWN10087E04BMWN1_0087_E04.bHX210919 
BMWN10087E07BMWN1_0087_E07.bHX210922 
BMWN10087G10BMWN1_0087_G10.b  
BMWN10087H04BMWN1_0087_H04.bHX210946 
BMWN10088A04BMWN1_0088_A04.bHX210954 
BMWN10088A11BMWN1_0088_A11.bHX210958 
BMWN10088B07BMWN1_0088_B07.bHX210965 
BMWN10088D01BMWN1_0088_D01.bHX210978 
BMWN10088D10BMWN1_0088_D10.bHX210985 
BMWN10088E03BMWN1_0088_E03.bHX210990 
BMWN10088G01BMWN1_0088_G01.bHX211006 
BMWN10088G06BMWN1_0088_G06.bHX211011 
BMWN10088G10BMWN1_0088_G10.bHX211014 
BMWN10089A03BMWN1_0089_A03.bHX211025 
BMWN10089A10BMWN1_0089_A10.bHX211029 
BMWN10089A11BMWN1_0089_A11.bHX211030 
BMWN10089B11BMWN1_0089_B11.bHX211038 
BMWN10089E01BMWN1_0089_E01.bHX211057 
BMWN10089E04BMWN1_0089_E04.bHX211059 
BMWN10089E10BMWN1_0089_E10.bHX211062 
BMWN10090A08BMWN1_0090_A08.bHX211096 
BMWN10090B03BMWN1_0090_B03.bHX211101 
BMWN10090C01BMWN1_0090_C01.bHX211109 
BMWN10090D04BMWN1_0090_D04.bHX211120 
BMWN10090D08BMWN1_0090_D08.bHX211123 
BMWN10090D09BMWN1_0090_D09.bHX211124 
BMWN10090E07BMWN1_0090_E07.bHX211131 
BMWN10090G02BMWN1_0090_G02.bHX211142 
BMWN10090G08BMWN1_0090_G08.bHX211147 
BMWN10091A01BMWN1_0091_A01.bHX211159 
BMWN10091C02BMWN1_0091_C02.bHX211180 
BMWN10091C10BMWN1_0091_C10.bHX211185 
BMWN10091D04BMWN1_0091_D04.bHX211189 
BMWN10091E08BMWN1_0091_E08.bHX211198 
BMWN10091G01BMWN1_0091_G01.bHX211207 
BMWN10091G08BMWN1_0091_G08.bHX211212 
BMWN10091G11BMWN1_0091_G11.bHX211214 
BMWN10092B01BMWN1_0092_B01.b  
BMWN10092B02BMWN1_0092_B02.b  
BMWN10092B04BMWN1_0092_B04.bHX211231 
BMWN10092G08BMWN1_0092_G08.bHX211259 
BMWN10092G11BMWN1_0092_G11.bHX211260 
BMWN10092H09BMWN1_0092_H09.bHX211264 
BMWN10093A06BMWN1_0093_A06.bHX211268 
BMWN10093A08BMWN1_0093_A08.bHX211270 
BMWN10093A12BMWN1_0093_A12.bHX211273 
BMWN10093B06BMWN1_0093_B06.bHX211278 
BMWN10093B08BMWN1_0093_B08.bHX211280 
BMWN10093B10BMWN1_0093_B10.bHX211281 
BMWN10093D01BMWN1_0093_D01.bHX211294 
BMWN10093E03BMWN1_0093_E03.bHX211306 
BMWN10093E08BMWN1_0093_E08.b  
BMWN10093F02BMWN1_0093_F02.bHX211316 
BMWN10093G05BMWN1_0093_G05.bHX211326 
BMWN10093G09BMWN1_0093_G09.bHX211329 
BMWN10093G10BMWN1_0093_G10.b  
BMWN10093G11BMWN1_0093_G11.bHX211330 
BMWN10093H01BMWN1_0093_H01.bHX211332 
BMWN10093H05BMWN1_0093_H05.bHX211336 
BMWN10094B07BMWN1_0094_B07.bHX211356 
BMWN10094E02BMWN1_0094_E02.bHX211379 
BMWN10094G09BMWN1_0094_G09.bHX211403 
BMWN10095A06BMWN1_0095_A06.bHX211414 
BMWN10095A11BMWN1_0095_A11.bHX211417 
BMWN10095C12BMWN1_0095_C12.bHX211432 
BMWN10095D01BMWN1_0095_D01.bHX211433 
BMWN10095D07BMWN1_0095_D07.bHX211437 
BMWN10095G07BMWN1_0095_G07.bHX211465 
BMWN10095G10BMWN1_0095_G10.bHX211468 
BMWN10095G12BMWN1_0095_G12.bHX211470 
BMWN10095H06BMWN1_0095_H06.bHX211473 
BMWN10095H11BMWN1_0095_H11.bHX211475 
BMWN10096A01BMWN1_0096_A01.bHX211477 
BMWN10096B11BMWN1_0096_B11.bHX211494 
BMWN10096B12BMWN1_0096_B12.bHX211495 
BMWN10096C02BMWN1_0096_C02.bHX211497 
BMWN10096C12BMWN1_0096_C12.bHX211504 
BMWN10096F05BMWN1_0096_F05.bHX211518 
BMWN10096F10BMWN1_0096_F10.bHX211522 
BMWN10096G08BMWN1_0096_G08.bHX211531 
BMWN10096G11BMWN1_0096_G11.bHX211533 
BMWN10096H09BMWN1_0096_H09.bHX211538 
BMWN10097B11BMWN1_0097_B11.bHX211549 
BMWN10097C04BMWN1_0097_C04.bHX211551 
BMWN10097C05BMWN1_0097_C05.bHX211552 
BMWN10097D02BMWN1_0097_D02.bHX211556 
BMWN10097D12BMWN1_0097_D12.bHX211563 
BMWN10097F02BMWN1_0097_F02.bHX211571 
BMWN10097G02BMWN1_0097_G02.bHX211579 
BMWN10097G05BMWN1_0097_G05.bHX211581 
BMWN10097H07BMWN1_0097_H07.bHX211587 
BMWN10098B08BMWN1_0098_B08.bHX211596 
BMWN10098B12BMWN1_0098_B12.bHX211598 
BMWN10098C07BMWN1_0098_C07.bHX211604 
BMWN10098C11BMWN1_0098_C11.bHX211607 
BMWN10098E09BMWN1_0098_E09.bHX211623 
BMWN10098E12BMWN1_0098_E12.bHX211626 
BMWN10098G11BMWN1_0098_G11.bHX211637 
BMWN10098G12BMWN1_0098_G12.bHX211638 
BMWN10099A11BMWN1_0099_A11.bHX211649 
BMWN10099B04BMWN1_0099_B04.bHX211653 
BMWN10099C07BMWN1_0099_C07.bHX211660 
BMWN10099D08BMWN1_0099_D08.bHX211669 
BMWN10099E06BMWN1_0099_E06.bHX211676 
BMWN10099E09BMWN1_0099_E09.bHX211677 
BMWN10099E10BMWN1_0099_E10.bHX211678 
BMWN10099E11BMWN1_0099_E11.bHX211679 
BMWN10099F12BMWN1_0099_F12.b  
BMWN10099H05BMWN1_0099_H05.bHX211690 
BMWN10099H07BMWN1_0099_H07.bHX211692 
BMWN10100A10BMWN1_0100_A10.bHX211699 
BMWN10100B09BMWN1_0100_B09.bHX211705 
BMWN10100D03BMWN1_0100_D03.bHX211716 
BMWN10100E06BMWN1_0100_E06.bHX211727 
BMWN10100E11BMWN1_0100_E11.bHX211732 
BMWN10100H02BMWN1_0100_H02.b  
BMWN10100H08BMWN1_0100_H08.bHX211751 
CLNT10118H07CLNT1_0118_H07.bHX220577 
DCI010050H02DCI01_0050_H02.bDB794419 
HTMT10077E07HTMT1_0077_E07.bFS669692 
HTMT10093A06HTMT1_0093_A06.bFS670754 
ILNT10010F04ILNT1_0010_F04.bHX227507 
ILNT10016H04ILNT1_0016_H04.bHX227968 
ILNT10026E09ILNT1_0026_E09.bHX228732 
ILNT10035H04ILNT1_0035_H04.bHX229496 
ILNT10038F05ILNT1_0038_F05.bHX229724 
ILNT10061E04ILNT1_0061_E04.bHX231587 
ILNT10065H03ILNT1_0065_H03.bHX231951 
ILNT10068A03ILNT1_0068_A03.bHX232131 
ILNT10070F12ILNT1_0070_F12.bHX232355 
ILNT10075C04ILNT1_0075_C04.bHX232719 
ILNT10085G05ILNT1_0085_G05.bHX233568 
ITT010088B05ITT01_0088_B05.bBW983789 
LVRM10002G10LVRM1_0002_G10.bBP140620 
LVRM10005C10LVRM1_0005_C10.bBP138777 
LVRM10006F04LVRM1_0006_F04.bBP139930 
LVRM10008D08LVRM1_0008_D08.bBP139180 
LVRM10011G09LVRM1_0011_G09.bBP453528 
LVRM10024G06LVRM1_0024_G06.bBP140472 
LVRM10032E07LVRM1_0032_E07.bBP139603 
LVRM10043A05LVRM1_0043_A05.bCJ002047 
LVRM10065G12LVRM1_0065_G12.bBP140733 
LVRM10066H11LVRM1_0066_H11.bBP141185 
LVRM10086B05LVRM1_0086_B05.bCJ002857 
LVRM10086C08LVRM1_0086_C08.bBW962959 
LVRM10096C11LVRM1_0096_C11.bCJ003681 
LVRM10102D01LVRM1_0102_D01.bBP138936 
LVRM10107E09LVRM1_0107_E09.bBP451926 
LVRM10112E12LVRM1_0112_E12.bBP452138 
LVRM10113D06LVRM1_0113_D06.bBP450918 
LVRM10120A04LVRM1_0120_A04.bBP448350 
LVRM10122H01LVRM1_0122_H01.bBP453844 
LVRM10140A05LVRM1_0140_A05.bBP448436 
LVRM10140C10LVRM1_0140_C10.bBP450381 
LVRM10143H07LVRM1_0143_H07.bBP454274 
LVRM10145F05LVRM1_0145_F05.bBP452488 
LVRM10150G11LVRM1_0150_G11.bBP453734 
LVRM10151H02LVRM1_0151_H02.bBP453931 
LVRM10153B06LVRM1_0153_B06.bBP449315 
LVRM10164H11LVRM1_0164_H11.bCJ004222 
LVRM10171C01LVRM1_0171_C01.bCJ004719 
LVRM10179B02LVRM1_0179_B02.bCJ005331 
LVRM10205A08LVRM1_0205_A08.bCJ007396 
MLN010057H11MLN01_0057_H11.bCJ012173 
OVRM10037E02OVRM1_0037_E02.bBP458536 
OVRM10081F02OVRM1_0081_F02.bBP151291 
OVRT10007E03OVRT1_0007_E03.bFS686965 
OVRT10011B11OVRT1_0011_B11.bFS687268 
OVRT10017G01OVRT1_0017_G01.bFS687813 
OVRT10033D02OVRT1_0033_D02.bFS689071 
OVRT10041H10OVRT1_0041_H10.bFS689787 
OVRT10093G06OVRT1_0093_G06.bFS694014 
OVRT10127A02OVRT1_0127_A02.bHX236941 
OVRT10129C10OVRT1_0129_C10.bHX237131 
OVRT10141B11OVRT1_0141_B11.bHX238088 
OVRT10143D02OVRT1_0143_D02.bHX238268 
OVRT10148C11OVRT1_0148_C11.bHX238683 
PBL010001C03PBL01_0001_C03.bBW968560 
PBL010001C09PBL01_0001_C09.bBW968564 
PBL010001D04PBL01_0001_D04.bBP155710 
PBL010001E11PBL01_0001_E11.bBW968581 
PBL010002C03PBL01_0002_C03.bBW968603 
PBL010002D01PBL01_0002_D01.bBW968604 
PBL010002E09PBL01_0002_E09.bBP155928 
PBL010002F08PBL01_0002_F08.bBP156105 
PBL010002G10PBL01_0002_G10.bBP156347 
PBL010003C04PBL01_0003_C04.bBW968627 
PBL010003F12PBL01_0003_F12.bBP156168 
PBL010003H01PBL01_0003_H01.bBW968654 
PBL010003H03PBL01_0003_H03.bBP156461 
PBL010004D01PBL01_0004_D01.bBP155655 
PBL010004D10PBL01_0004_D10.bBW968684 
PBL010005B07PBL01_0005_B07.bBW968727 
PBL010005H07PBL01_0005_H07.bBW968790 
PBL010005H11PBL01_0005_H11.bBW968794 
PBL010006B12PBL01_0006_B12.bBW968808 
PBL010007A09PBL01_0007_A09.bBP155164 
PBL010007C09PBL01_0007_C09.bBW968870 
PBL010007H06PBL01_0007_H06.bBW968917 
PBL010008C09PBL01_0008_C09.bBW968950 
PBL010008E01PBL01_0008_E01.bBW968965 
PBL010008E10PBL01_0008_E10.bBW968973 
PBL010008G07PBL01_0008_G07.bBW968987 
PBL010008H09PBL01_0008_H09.bBP156589 
PBL010008H11PBL01_0008_H11.bBW968998 
PBL010009B06PBL01_0009_B06.bBW969015 
PBL010010F04PBL01_0010_F04.bBW969131 
PBL010011D01PBL01_0011_D01.bBW969195 
PBL010011E12PBL01_0011_E12.bBW969216 
PBL010011F12PBL01_0011_F12.bBW969228 
PBL010011G08PBL01_0011_G08.bBW969236 
PBL010011H09PBL01_0011_H09.bBW969246 
PBL010012B11PBL01_0012_B11.bBW969259 
PBL010012C11PBL01_0012_C11.bBW969269 
PBL010012E10PBL01_0012_E10.bBW969281 
PBL010012G01PBL01_0012_G01.bBW969290 
PBL010013B02PBL01_0013_B02.bBW969312 
PBL010013C07PBL01_0013_C07.bBW969325 
PBL010013E07PBL01_0013_E07.bBW969340 
PBL010013E08PBL01_0013_E08.bBW969341 
PBL010013F05PBL01_0013_F05.bBW969347 
PBL010013H08PBL01_0013_H08.bBW969369 
PBL010014C06PBL01_0014_C06.bBW969390 
PBL010014G03PBL01_0014_G03.bBP462430 
PBL010014H10PBL01_0014_H10.bBP462462 
PBL010015B06PBL01_0015_B06.bBW969430 
PBL010016B11PBL01_0016_B11.bBW969477 
PBL010017C02PBL01_0017_C02.bBW969506 
PBL010017G10PBL01_0017_G10.b  
PBL010018C06PBL01_0018_C06.bBW969575 
PBL010018G08PBL01_0018_G08.bBW969610 
PBL010019B05PBL01_0019_B05.bBW969639 
PBL010019B12PBL01_0019_B12.bBW969644 
PBL010019D02PBL01_0019_D02.bBW969653 
PBL010019D06PBL01_0019_D06.bBW969657 
PBL010019F04PBL01_0019_F04.bFS694614 
PBL010019F06PBL01_0019_F06.bBW969673 
PBL010019H03PBL01_0019_H03.bBW969691 
PBL010019H10PBL01_0019_H10.bBW969698 
PBL010020C11PBL01_0020_C11.bBW969724 
PBL010021C09PBL01_0021_C09.bBW969775 
PBL010021D09PBL01_0021_D09.bBW969784 
PBL010021F11PBL01_0021_F11.bBW969806 
PBL010021H06PBL01_0021_H06.b  
PBL010022B07PBL01_0022_B07.bBW969828 
PBL010022C06PBL01_0022_C06.bBW969836 
PBL010022D12PBL01_0022_D12.bBW969851 
PBL010022E07PBL01_0022_E07.bBW969856 
PBL010022E11PBL01_0022_E11.bBW969860 
PBL010022H01PBL01_0022_H01.bBW969879 
PBL010022H05PBL01_0022_H05.bBW969883 
PBL010023E01PBL01_0023_E01.bBP155834 
PBL010023F12PBL01_0023_F12.bBP156171 
PBL010023H11PBL01_0023_H11.bBP156635 
PBL010024C07PBL01_0024_C07.bBP155562 
PBL010024E06PBL01_0024_E06.bBP155896 
PBL010024G01PBL01_0024_G01.bBP156204 
PBL010024G04PBL01_0024_G04.bBP156264 
PBL010024H10PBL01_0024_H10.bBP156614 
PBL010025B01PBL01_0025_B01.bBP155267 
PBL010025C09PBL01_0025_C09.bBP155587 
PBL010025D02PBL01_0025_D02.bBP155684 
PBL010025H04PBL01_0025_H04.bBP156482 
PBL010026A03PBL01_0026_A03.bBP155049 
PBL010026B08PBL01_0026_B08.bBP155383 
PBL010026E03PBL01_0026_E03.bBP155867 
PBL010026E06PBL01_0026_E06.bBP155897 
PBL010026E10PBL01_0026_E10.bBP155947 
PBL010027C08PBL01_0027_C08.bBW969940 
PBL010027D04PBL01_0027_D04.bBW969948 
PBL010027F08PBL01_0027_F08.bBW969973 
PBL010027H08PBL01_0027_H08.bBW969995 
PBL010028A03PBL01_0028_A03.bBP155050 
PBL010028B01PBL01_0028_B01.bBW970005 
PBL010028G09PBL01_0028_G09.bBP156334 
PBL010029A07PBL01_0029_A07.bBP155129 
PBL010029B03PBL01_0029_B03.bBP155320 
PBL010029B06PBL01_0029_B06.bBP155360 
PBL010029B07PBL01_0029_B07.bBP155373 
PBL010029C03PBL01_0029_C03.bBP155514 
PBL010029G10PBL01_0029_G10.bBW970033 
PBL010030C03PBL01_0030_C03.bBP155515 
PBL010030C04PBL01_0030_C04.bBP155533 
PBL010030D05PBL01_0030_D05.bBP155727 
PBL010030D06PBL01_0030_D06.bBP155737 
PBL010030D07PBL01_0030_D07.bBP155747 
PBL010030G10PBL01_0030_G10.bBP156354 
PBL010030H03PBL01_0030_H03.bBP156469 
PBL010031A03PBL01_0031_A03.bBP155053 
PBL010031D05PBL01_0031_D05.bBW970060 
PBL010031E07PBL01_0031_E07.bBP155911 
PBL010031G07PBL01_0031_G07.bBP156309 
PBL010031H08PBL01_0031_H08.bBP156576 
PBL010032C04PBL01_0032_C04.bBP155535 
PBL010032C09PBL01_0032_C09.bBP155592 
PBL010032E07PBL01_0032_E07.bBP155912 
PBL010032G02PBL01_0032_G02.bBP156231 
PBL010032H01PBL01_0032_H01.bBP156429 
PBL010033B08PBL01_0033_B08.bBP155389 
PBL010033C03PBL01_0033_C03.bBP155518 
PBL010033D09PBL01_0033_D09.bBP155769 
PBL010033G08PBL01_0033_G08.bBP156323 
PBL010034D07PBL01_0034_D07.bBW970123 
PBL010034G01PBL01_0034_G01.bBP156208 
PBL010034H06PBL01_0034_H06.bBP156533 
PBL010034H12PBL01_0034_H12.bBP156669 
PBL010035A09PBL01_0035_A09.bBP155177 
PBL010035C08PBL01_0035_C08.bBP155581 
PBL010035H01PBL01_0035_H01.bBP156432 
PBL010036B06PBL01_0036_B06.bBP155364 
PBL010037D08PBL01_0037_D08.bBW970239 
PBL010037G02PBL01_0037_G02.bBP156234 
PBL010038A03PBL01_0038_A03.bBP155060 
PBL010038A06PBL01_0038_A06.bBP155116 
PBL010038A07PBL01_0038_A07.bBP155136 
PBL010038C08PBL01_0038_C08.bBW970280 
PBL010038D03PBL01_0038_D03.bBW970284 
PBL010038D07PBL01_0038_D07.bBW970287 
PBL010038D11PBL01_0038_D11.bBP155801 
PBL010038F01PBL01_0038_F01.bBP156021 
PBL010038F06PBL01_0038_F06.bBW970305 
PBL010039B05PBL01_0039_B05.bBW970329 
PBL010039B06PBL01_0039_B06.bBW970330 
PBL010039C02PBL01_0039_C02.bBW970336 
PBL010039D11PBL01_0039_D11.bBW970354 
PBL010040A02PBL01_0040_A02.bBW970399 
PBL010040E12PBL01_0040_E12.bBP155993 
PBL010040G02PBL01_0040_G02.bBP156235 
PBL010040H07PBL01_0040_H07.bBP156559 
PBL010040H09PBL01_0040_H09.bBW970461 
PBL010041A10PBL01_0041_A10.bBP155203 
PBL010041G10PBL01_0041_G10.bBP156361 
PBL010041H07PBL01_0041_H07.bBP156560 
PBL010041H11PBL01_0041_H11.bBP156648 
PBL010042F04PBL01_0042_F04.bBW970556 
PBL010042F05PBL01_0042_F05.bBW970557 
PBL010043A07PBL01_0043_A07.bBW970581 
PBL010043B07PBL01_0043_B07.bBW970591 
PBL010043C04PBL01_0043_C04.bBW970598 
PBL010043C07PBL01_0043_C07.bBW970601 
PBL010043F11PBL01_0043_F11.bBW970635 
PBL010043H02PBL01_0043_H02.bBW970647 
PBL010044C01PBL01_0044_C01.bBP155491 
PBL010044F06PBL01_0044_F06.bBW970713 
PBL010044H06PBL01_0044_H06.bBW970731 
PBL010044H09PBL01_0044_H09.bBW970734 
PBL010045A06PBL01_0045_A06.bBW970737 
PBL010045A09PBL01_0045_A09.bBP155182 
PBL010045D12PBL01_0045_D12.bBP155823 
PBL010045E05PBL01_0045_E05.bBW970766 
PBL010045E10PBL01_0045_E10.bBW970771 
PBL010046A02PBL01_0046_A02.bBP155035 
PBL010046A08PBL01_0046_A08.b  
PBL010046D07PBL01_0046_D07.bBW970814 
PBL010046E03PBL01_0046_E03.bBW970820 
PBL010046F08PBL01_0046_F08.b  
PBL010046H03PBL01_0046_H03.bBW970838 
PBL010047A05PBL01_0047_A05.bBP155100 
PBL010047B06PBL01_0047_B06.bBW970845 
PBL010047B12PBL01_0047_B12.bBP155468 
PBL010047E01PBL01_0047_E01.b  
PBL010047E06PBL01_0047_E06.bBW970865 
PBL010047E09PBL01_0047_E09.bBP155940 
PBL010047F09PBL01_0047_F09.bBW970875 
PBL010048A03PBL01_0048_A03.bBP155065 
PBL010048H10PBL01_0048_H10.bBP156629 
PBL010049A01PBL01_0049_A01.bBP155019 
PBL010049A07PBL01_0049_A07.bBW970947 
PBL010049B05PBL01_0049_B05.bBW970955 
PBL010049C05PBL01_0049_C05.bBW970964 
PBL010049D08PBL01_0049_D08.bBW970978 
PBL010049D12PBL01_0049_D12.bBW970981 
PBL010049F03PBL01_0049_F03.bBW970994 
PBL010050A11PBL01_0050_A11.bBW971022 
PBL010050C07PBL01_0050_C07.bBW971038 
PBL010050D11PBL01_0050_D11.bBW971050 
PBL010050G12PBL01_0050_G12.bBW971080 
PBL010050H02PBL01_0050_H02.bBP462450 
PBL010050H11PBL01_0050_H11.bBW971087 
PBL010051B06PBL01_0051_B06.bBW971091 
PBL010051D09PBL01_0051_D09.bBP155772 
PBL010051H01PBL01_0051_H01.bBW971125 
PBL010052A07PBL01_0052_A07.bBP155138 
PBL010052A10PBL01_0052_A10.bBP155207 
PBL010052B12PBL01_0052_B12.bBP155472 
PBL010052D08PBL01_0052_D08.bBW971144 
PBL010052D12PBL01_0052_D12.bBP155828 
PBL010052G11PBL01_0052_G11.bBP156391 
PBL010053A07PBL01_0053_A07.bBW971166 
PBL010053B10PBL01_0053_B10.bBW971181 
PBL010053C09PBL01_0053_C09.bBW971190 
PBL010053G06PBL01_0053_G06.bBW971233 
PBL010054B01PBL01_0054_B01.bBP462361 
PBL010054B09PBL01_0054_B09.bBW971267 
PBL010054H02PBL01_0054_H02.bBP462451 
PBL010054H11PBL01_0054_H11.bBW971332 
PBL010056F05PBL01_0056_F05.bBW971413 
PBL010056F09PBL01_0056_F09.bBP156128 
PBL010056G02PBL01_0056_G02.bBP156242 
PBL010057A01PBL01_0057_A01.bBW971427 
PBL010057C07PBL01_0057_C07.bBW971445 
PBL010057C08PBL01_0057_C08.bBW971446 
PBL010057D06PBL01_0057_D06.bBW971453 
PBL010057D07PBL01_0057_D07.bBW971454 
PBL010058A04PBL01_0058_A04.bBW971487 
PBL010058A12PBL01_0058_A12.bBP155261 
PBL010058B03PBL01_0058_B03.bBW971488 
PBL010058E02PBL01_0058_E02.bBW971506 
PBL010059A04PBL01_0059_A04.bBP155084 
PBL010059E04PBL01_0059_E04.bBW971563 
PBL010060D06PBL01_0060_D06.bBW971604 
PBL010060F06PBL01_0060_F06.bBW971621 
PBL010060F08PBL01_0060_F08.bBW971623 
PBL010061A11PBL01_0061_A11.bBW971654 
PBL010061B10PBL01_0061_B10.bBW971665 
PBL010061C01PBL01_0061_C01.bBP462388 
PBL010061C05PBL01_0061_C05.bBW971671 
PBL010061D09PBL01_0061_D09.bBW971686 
PBL010062G04PBL01_0062_G04.bBW971789 
PBL010062G12PBL01_0062_G12.bBW971794 
PBL010063G06PBL01_0063_G06.bBW971875 
PBL010063H10PBL01_0063_H10.bBW971889 
PBL010064E08PBL01_0064_E08.bBW971939 
PBL010064F05PBL01_0064_F05.bBW971946 
PBL010065B01PBL01_0065_B01.bBW971980 
PBL010065E12PBL01_0065_E12.bBW972023 
PBL010065H04PBL01_0065_H04.bBW972046 
PBL010066A09PBL01_0066_A09.bBW972059 
PBL010066G01PBL01_0066_G01.bBW972119 
PBL010067H06PBL01_0067_H06.bBW972214 
PBL010067H10PBL01_0067_H10.bBP462466 
PBL010068D07PBL01_0068_D07.bBW972254 AK399099
PBL010068F06PBL01_0068_F06.bBW972276 
PBL010069A09PBL01_0069_A09.bBW972305 
PBL010069A12PBL01_0069_A12.bBW972307 
PBL010069B12PBL01_0069_B12.bBW972317 
PBL010069C06PBL01_0069_C06.bBW972323 
PBL010069E09PBL01_0069_E09.bBW972344 
PBL010069F10PBL01_0069_F10.bBW972356 
PBL010070A09PBL01_0070_A09.bBP462326 
PBL010070C09PBL01_0070_C09.bBW972396 
PBL010070F07PBL01_0070_F07.bBW972425 
PBL010071A12PBL01_0071_A12.bBP462355 
PBL010071E04PBL01_0071_E04.bBW972487 
PBL010071F09PBL01_0071_F09.bBW972503 
PBL010072A10PBL01_0072_A10.bBW972534 
PBL010072F05PBL01_0072_F05.bBW972586 
PBL010072F10PBL01_0072_F10.bBW972590 
PBL010073A04PBL01_0073_A04.bBW972616 
PBL010073A12PBL01_0073_A12.bBW972623 
PBL010073B11PBL01_0073_B11.bBW972633 
PBL010073D11PBL01_0073_D11.bBW972653 
PBL010073F09PBL01_0073_F09.bBW972675 
PBL010073H04PBL01_0073_H04.bBW972691 
PBL010073H11PBL01_0073_H11.bBW972697 
PBL010073H12PBL01_0073_H12.bBP462481 
PBL010074A12PBL01_0074_A12.bBW972709 
PBL010074B01PBL01_0074_B01.bBW972710 
PBL010074C07PBL01_0074_C07.bBW972728 
PBL010074D05PBL01_0074_D05.bBW972738 
PBL010074H09PBL01_0074_H09.bBW972788 
PBL010075A10PBL01_0075_A10.bBW972800 
PBL010075C10PBL01_0075_C10.bBW972823 
PBL010075E02PBL01_0075_E02.bBW972837 
PBL010075G02PBL01_0075_G02.bBW972857 
PBL010075H03PBL01_0075_H03.bBW972867 
PBL010076A02PBL01_0076_A02.bBW972876 
PBL010076B08PBL01_0076_B08.bBW972891 
PBL010076E10PBL01_0076_E10.bBW972925 
PBL010076F04PBL01_0076_F04.bBW972931 
PBL010076H12PBL01_0076_H12.bBW972960 
PBL010077B02PBL01_0077_B02.bBW972974 
PBL010077C09PBL01_0077_C09.bBW972992 
PBL010077E09PBL01_0077_E09.bBW973015 
PBL010078E09PBL01_0078_E09.bBW973105 
PBL010078F07PBL01_0078_F07.bBW973115 
PBL010079C12PBL01_0079_C12.bBW973176 
PBL010080B10PBL01_0080_B10.bBW973253 
PBL010080C07PBL01_0080_C07.bBW973262 
PBL010080F12PBL01_0080_F12.bBW973301 
PBL010080G10PBL01_0080_G10.bBW973311 
PBL010080G12PBL01_0080_G12.bBW973313 
PBL010081E07PBL01_0081_E07.bBW973376 
PBL010081G09PBL01_0081_G09.bBW973400 
PBL010082D12PBL01_0082_D12.b  
PBL010082F11PBL01_0082_F11.bBW973481 
PBL010083E04PBL01_0083_E04.bBW973553 
PBL010083F02PBL01_0083_F02.bBW973562 
PBL010083F04PBL01_0083_F04.bBW973564 
PBL010084B12PBL01_0084_B12.bBW973612 
PBL010084C08PBL01_0084_C08.bBW973619 
PBL010085C01PBL01_0085_C01.bBW973700 
PBL010085E07PBL01_0085_E07.bBW973730 
PBL010085F04PBL01_0085_F04.bBW973739 
PBL010085G02PBL01_0085_G02.bBW973748 
PBL010086A04PBL01_0086_A04.bBW973772 
PBL010086E08PBL01_0086_E08.bBW973820 
PBL010087B03PBL01_0087_B03.bBW973873 
PBL010087C11PBL01_0087_C11.bBW973893 
PBL010087F04PBL01_0087_F04.bBW973918 
PBL010087G02PBL01_0087_G02.bBW973926 
PBL010088B04PBL01_0088_B04.bBW973959 
PBL010088E05PBL01_0088_E05.bBW973995 
PBL010088H01PBL01_0088_H01.bBW974025 
PBL010089A05PBL01_0089_A05.bBW974041 
PBL010089C08PBL01_0089_C08.bBW974067 
PBL010089D04PBL01_0089_D04.bBW974075 
PBL010089F06PBL01_0089_F06.bBW974099 
PBL010090E02PBL01_0090_E02.bBW974170 
PBL010090G09PBL01_0090_G09.bBW974193 
PBL010092A03PBL01_0092_A03.bBW974276 
PBL010092C11PBL01_0092_C11.bBW974304 
PBL010092G04PBL01_0092_G04.bBW974330 
PBL010093C01PBL01_0093_C01.bBW974363 
PBL010094B01PBL01_0094_B01.bBW974417 
PBL010094B05PBL01_0094_B05.bBW974421 
PBL010094B10PBL01_0094_B10.bBW974426 
PBL010094F01PBL01_0094_F01.bBW974462 
PBL010094H06PBL01_0094_H06.bBW974487 
PBL010096C10PBL01_0096_C10.bBW974591 
PBL010096D10PBL01_0096_D10.bBW974603 
PBL010096D11PBL01_0096_D11.bBW974604 
PBL010096D12PBL01_0096_D12.bBW974605 
PBL010096E04PBL01_0096_E04.bBW974609 
PBL010096G04PBL01_0096_G04.bBW974632 
PBL010096G12PBL01_0096_G12.bBW974639 
PBL010096H06PBL01_0096_H06.bBW974645 
PBL010097A08PBL01_0097_A08.bBW974659 
PBL010097G12PBL01_0097_G12.bBW974732 
PBL010098H10PBL01_0098_H10.bBW974831 
PBL010099A01PBL01_0099_A01.bBW974834 
PBL010099B06PBL01_0099_B06.bBW974849 
PBL010099C02PBL01_0099_C02.bBW974855 
PBL010100F01PBL01_0100_F01.bBW974982 
PBL010100F10PBL01_0100_F10.bBW974991 
PBL010100G09PBL01_0100_G09.bBW975002 
PBL010101E03PBL01_0101_E03.bBW975058 
PBL010102A09PBL01_0102_A09.bBW975110 
PBL010102D04PBL01_0102_D04.bBW975138 
PBL010102E10PBL01_0102_E10.bBW975154 
PBL010103F06PBL01_0103_F06.bBW975257 
PBL010103H10PBL01_0103_H10.bBW975285 
PBL010104A10PBL01_0104_A10.bBW975297 
PBL010104B03PBL01_0104_B03.bBW975302 
PBL010104C06PBL01_0104_C06.bBW975317 
PBL010104C10PBL01_0104_C10.bBW975321 
PBL010104F05PBL01_0104_F05.bBW975352 
PBL010105A10PBL01_0105_A10.bBW975389 
PBL010105B03PBL01_0105_B03.bBW975393 
PBL010105B04PBL01_0105_B04.bBW975394 
PBL010105B10PBL01_0105_B10.bBW975400 
PBL010105D05PBL01_0105_D05.bBW975419 
PBL010106C03PBL01_0106_C03.bBW975499 
PBL010106F10PBL01_0106_F10.bBW975541 
PBL010106F11PBL01_0106_F11.bBW975542 
PBL010106H06PBL01_0106_H06.bBW975560 
PBL010106H11PBL01_0106_H11.bBW975565 
PBL010107A05PBL01_0107_A05.bBW975571 
PCT010001C05PCT01_0001_C05.bFS694646 
PCT010001C10PCT01_0001_C10.bFS694650 
PCT010001D09PCT01_0001_D09.bFS694657 
PCT010001D10PCT01_0001_D10.bFS694658 
PCT010001G04PCT01_0001_G04.bFS694684 
PCT010002A02PCT01_0002_A02.bFS694702 
PCT010002C04PCT01_0002_C04.bFS694725 
PCT010002C05PCT01_0002_C05.b  
PCT010002D07PCT01_0002_D07.bFS694736 
PCT010002G01PCT01_0002_G01.b  
PCT010003B07PCT01_0003_B07.bFS694768 
PCT010003B09PCT01_0003_B09.bHX239066 
PCT010003C06PCT01_0003_C06.bFS694776 
PCT010003D05PCT01_0003_D05.bFS694783 
PCT010003E02PCT01_0003_E02.b  
PCT010003F10PCT01_0003_F10.b  
PCT010003G01PCT01_0003_G01.bFS694808 
PCT010003G07PCT01_0003_G07.bFS694814 
PCT010003H02PCT01_0003_H02.bFS694821 
PCT010004A09PCT01_0004_A09.b  
PCT010004A10PCT01_0004_A10.b  
PCT010004B02PCT01_0004_B02.bFS694840 
PCT010004B03PCT01_0004_B03.bFS694841 
PCT010004B08PCT01_0004_B08.b  
PCT010004D12PCT01_0004_D12.b  
PCT010004H03PCT01_0004_H03.bFS694898 
PCT010005A10PCT01_0005_A10.bFS694913 
PCT010005D03PCT01_0005_D03.b  
PCT010005D04PCT01_0005_D04.bFS694935 
PCT010005D09PCT01_0005_D09.bFS694939 
PCT010006A06PCT01_0006_A06.bFS694981 
PCT010006B03PCT01_0006_B03.bFS694988 
PCT010006B04PCT01_0006_B04.bFS694989 
PCT010006B08PCT01_0006_B08.b  
PCT010006C04PCT01_0006_C04.b  
PCT010006D12PCT01_0006_D12.bFS695010 
PCT010006E04PCT01_0006_E04.bFS695014 
PCT010006H03PCT01_0006_H03.b  
PCT010006H11PCT01_0006_H11.bFS695052 
PCT010007A03PCT01_0007_A03.bFS695055 
PCT010007A06PCT01_0007_A06.b  
PCT010007B06PCT01_0007_B06.bFS695067 
PCT010007C05PCT01_0007_C05.b  
PCT010007E05PCT01_0007_E05.bHX239071 
PCT010007E06PCT01_0007_E06.b  
PCT010007H07PCT01_0007_H07.b  
PCT010007H10PCT01_0007_H10.b  
PCT010007H12PCT01_0007_H12.bFS695125 
PCT010008A03PCT01_0008_A03.bFS695128 
PCT010008A09PCT01_0008_A09.bFS695133 
PCT010008B02PCT01_0008_B02.bFS695135 
PCT010008B06PCT01_0008_B06.bFS695138 
PCT010008C02PCT01_0008_C02.bFS695145 
PCT010008C07PCT01_0008_C07.bFS695149 
PCT010008G04PCT01_0008_G04.bFS695187 
PCT010008G10PCT01_0008_G10.bFS695193 
PCT010008H01PCT01_0008_H01.bFS695196 
PCT010009B02PCT01_0009_B02.b  
PCT010009B06PCT01_0009_B06.bFS695219 
PCT010009C05PCT01_0009_C05.bFS695230 
PCT010009F10PCT01_0009_F10.bFS695260 
PCT010009G06PCT01_0009_G06.bFS695266 
PCT010009G11PCT01_0009_G11.bFS695270 
PCT010010B01PCT01_0010_B01.bFS695290 
PCT010010C03PCT01_0010_C03.bFS695301 
PCT010010C08PCT01_0010_C08.b  
PCT010010D05PCT01_0010_D05.b  
PCT010010G02PCT01_0010_G02.b  
PCT010010G11PCT01_0010_G11.bFS695346 
PCT010011E09PCT01_0011_E09.bFS695397 
PCT010011F06PCT01_0011_F06.bFS695403 
PCT010011F09PCT01_0011_F09.bFS695406 
PCT010011H04PCT01_0011_H04.b  
PCT010011H06PCT01_0011_H06.bFS695419 
PCT010012C06PCT01_0012_C06.bFS695442 
PCT010012C07PCT01_0012_C07.b  
PCT010012D06PCT01_0012_D06.bFS695452 
PCT010012G12PCT01_0012_G12.bFS695479 
PCT010012H03PCT01_0012_H03.b  
PCT010013A04PCT01_0013_A04.b  
PCT010013B06PCT01_0013_B06.b  
PCT010013C07PCT01_0013_C07.bFS695502 
PCT010013E12PCT01_0013_E12.b  
PCT010013F03PCT01_0013_F03.bFS695525 
PCT010014A05PCT01_0014_A05.b  
PCT010014C12PCT01_0014_C12.bHX239078 
PCT010014D03PCT01_0014_D03.bFS695573 
PCT010014D05PCT01_0014_D05.bFS695575 
PCT010014D08PCT01_0014_D08.bFS695578 
PCT010014E06PCT01_0014_E06.bFS695586 
PCT010014F09PCT01_0014_F09.bFS695594 
PCT010014G06PCT01_0014_G06.bFS695603 
PCT010014H01PCT01_0014_H01.bFS695608 
PCT010014H05PCT01_0014_H05.bFS695609 
PCT010014H07PCT01_0014_H07.b  
PCT010016A09PCT01_0016_A09.bFS695685 
PCT010016C01PCT01_0016_C01.bFS695695 
PCT010016C06PCT01_0016_C06.bFS695700 
PCT010016E07PCT01_0016_E07.bFS695720 
PCT010016G06PCT01_0016_G06.bFS695736 
PCT010016H07PCT01_0016_H07.b  
PCT010017A04PCT01_0017_A04.bFS695752 
PCT010017A08PCT01_0017_A08.b  
PCT010017A09PCT01_0017_A09.bFS695755 
PCT010017A11PCT01_0017_A11.bFS695757 
PCT010017C07PCT01_0017_C07.b  
PCT010017D01PCT01_0017_D01.b  
PCT010017F11PCT01_0017_F11.bFS695794 
PCT010017H05PCT01_0017_H05.bFS695807 
PCT010018A11PCT01_0018_A11.bFS695821 
PCT010018B12PCT01_0018_B12.bFS695829 
PCT010018D02PCT01_0018_D02.bFS695840 
PCT010018F04PCT01_0018_F04.bFS695857 
PCT010018G11PCT01_0018_G11.bFS695872 
PCT010019E06PCT01_0019_E06.b  
PCT010019G01PCT01_0019_G01.bFS695920 
PCT010019G10PCT01_0019_G10.b  
PCT010019H02PCT01_0019_H02.b  
PCT010019H04PCT01_0019_H04.b  
PCT010020A09PCT01_0020_A09.bFS695943 
PCT010020C01PCT01_0020_C01.b  
PCT010020C04PCT01_0020_C04.b  
PCT010020E05PCT01_0020_E05.b  
PCT010020G01PCT01_0020_G01.bFS695979 
PCT010020G11PCT01_0020_G11.bFS695984 
PCT010021A04PCT01_0021_A04.b  
PCT010021B03PCT01_0021_B03.bFS696004 
PCT010021B12PCT01_0021_B12.bFS696009 
PCT010021C09PCT01_0021_C09.bFS696017 
PCT010021E07PCT01_0021_E07.bFS696031 
PCT010021F04PCT01_0021_F04.bFS696038 
PCT010021F06PCT01_0021_F06.bFS696040 
PCT010021G04PCT01_0021_G04.bFS696048 
PCT010021G09PCT01_0021_G09.bFS696051 
PCT010021H03PCT01_0021_H03.bFS696057 
PCT010022A02PCT01_0022_A02.bFS696065 
PCT010022A03PCT01_0022_A03.b  
PCT010022C08PCT01_0022_C08.bFS696084 
PCT010022C10PCT01_0022_C10.bFS696086 
PCT010022D03PCT01_0022_D03.bFS696089 
PCT010022G02PCT01_0022_G02.bFS696119 
PCT010022G12PCT01_0022_G12.b  
PCT010022H11PCT01_0022_H11.b  
PCT010023A05PCT01_0023_A05.bFS696137 
PCT010023B12PCT01_0023_B12.bFS696152 
PCT010023C04PCT01_0023_C04.b  
PCT010023D05PCT01_0023_D05.b  
PCT010023D06PCT01_0023_D06.bFS696164 
PCT010023E01PCT01_0023_E01.bFS696170 
PCT010023E03PCT01_0023_E03.bFS696172 
PCT010023F03PCT01_0023_F03.bFS696183 
PCT010023F11PCT01_0023_F11.bFS696189 
PCT010023G04PCT01_0023_G04.bFS696193 
PCT010024B11PCT01_0024_B11.bFS696227 
PCT010024C04PCT01_0024_C04.bFS696231 
PCT010024D02PCT01_0024_D02.bFS696241 
PCT010024D11PCT01_0024_D11.bFS696245 
PCT010024F07PCT01_0024_F07.bFS696259 
PCT010024H02PCT01_0024_H02.bFS696273 
PCT010025B06PCT01_0025_B06.bFS696293 
PCT010025C02PCT01_0025_C02.bFS696298 
PCT010025D01PCT01_0025_D01.bFS696305 
PCT010025D05PCT01_0025_D05.b  
PCT010025D06PCT01_0025_D06.bFS696307 
PCT010025E10PCT01_0025_E10.bFS696318 
PCT010025G12PCT01_0025_G12.b  
PCT010026A08PCT01_0026_A08.bFS696350 
PCT010026B04PCT01_0026_B04.bFS696356 
PCT010026G01PCT01_0026_G01.bFS696394 
PCT010026G11PCT01_0026_G11.b  
PCT010027F09PCT01_0027_F09.bFS696458 
PCT010028A04PCT01_0028_A04.bFS696478 
PCT010028A06PCT01_0028_A06.bFS696480 
PCT010028A07PCT01_0028_A07.bFS696481 
PCT010028B09PCT01_0028_B09.bFS696488 
PCT010028C11PCT01_0028_C11.bFS696497 
PCT010028G02PCT01_0028_G02.bFS696524 
PCT010029A02PCT01_0029_A02.bFS696538 
PCT010029A07PCT01_0029_A07.bFS696543 
PCT010029B09PCT01_0029_B09.bFS696553 
PCT010029C08PCT01_0029_C08.bFS696559 
PCT010029D05PCT01_0029_D05.bFS696565 
PCT010029E05PCT01_0029_E05.b  
PCT010029G06PCT01_0029_G06.b  
PCT010029H12PCT01_0029_H12.bFS696603 
PCT010030A09PCT01_0030_A09.b  
PCT010030B08PCT01_0030_B08.b  
PCT010030D07PCT01_0030_D07.bFS696630 
PCT010030D10PCT01_0030_D10.bFS696633 
PCT010030D12PCT01_0030_D12.bFS696635 
PCT010030E06PCT01_0030_E06.b  
PCT010030E11PCT01_0030_E11.bFS696639 
PCT010030G02PCT01_0030_G02.bFS696651 
PCT010031B08PCT01_0031_B08.bFS696673 
PCT010031C04PCT01_0031_C04.bFS696676 
PCT010031C09PCT01_0031_C09.bFS696681 
PCT010031D10PCT01_0031_D10.b  
PCT010031F04PCT01_0031_F04.bFS696700 
PCT010031G04PCT01_0031_G04.b  
PCT010032A05PCT01_0032_A05.b  
PCT010032B11PCT01_0032_B11.bFS696734 
PCT010032B12PCT01_0032_B12.bFS696735 
PCT010032C03PCT01_0032_C03.bFS696737 
PCT010032C12PCT01_0032_C12.b  
PCT010032E12PCT01_0032_E12.b  
PCT010032F06PCT01_0032_F06.bFS696759 
PCT010032G03PCT01_0032_G03.b  
PCT010032H02PCT01_0032_H02.b  
PCT010033B11PCT01_0033_B11.bFS696794 
PCT010033E01PCT01_0033_E01.bFS696812 
PCT010033F05PCT01_0033_F05.b  
PCT010033F07PCT01_0033_F07.b  
PCT010034A02PCT01_0034_A02.bFS696846 
PCT010034B03PCT01_0034_B03.bFS696857 
PCT010034B05PCT01_0034_B05.bFS696859 
PCT010034B12PCT01_0034_B12.b  
PCT010034D11PCT01_0034_D11.bFS696882 
PCT010034E02PCT01_0034_E02.b  
PCT010034F08PCT01_0034_F08.bFS696900 
PCT010034H08PCT01_0034_H08.bFS696922 
PCT010035B01PCT01_0035_B01.bFS696934 
PCT010035B02PCT01_0035_B02.b  
PCT010035F01PCT01_0035_F01.bFS696968 
PCT010035F12PCT01_0035_F12.bFS696977 
PCT010036A02PCT01_0036_A02.bFS696994 
PCT010036B01PCT01_0036_B01.b  
PCT010036B06PCT01_0036_B06.bFS697008 
PCT010036B11PCT01_0036_B11.bFS697013 
PCT010036D06PCT01_0036_D06.b  
PCT010036F02PCT01_0036_F02.b  
PCT010036G01PCT01_0036_G01.b  
PCT010036G04PCT01_0036_G04.bFS697056 
PCT010036H12PCT01_0036_H12.bHX239098 
PST010013G10PST01_0013_G10.bFS698042 
PST010053F09PST01_0053_F09.bFS701044 
SKNB10081G07SKNB1_0081_G07.bDB804937 
SKNB10081H07SKNB1_0081_H07.bDB804946 
SKNB10083A06SKNB1_0083_A06.bDB805017 
SKNB10085C10SKNB1_0085_C10.bDB805165 
SMG010038D04SMG01_0038_D04.bFS716602 
SMG010061G03SMG01_0061_G03.bFS718569 
SMG010101B04SMG01_0101_B04.bFS721890 
SPL010005C04SPL01_0005_C04.bBP157413 
SPL010006A01SPL01_0006_A01.bBP156684 
SPL010008A06SPL01_0008_A06.bBP156811 
SPL010008A08SPL01_0008_A08.bBP156865 
SPL010008A09SPL01_0008_A09.bBP156891 
SPL010008B09SPL01_0008_B09.bBP157215 
SPL010008F06SPL01_0008_F06.bBP158517 
SPL010008H04SPL01_0008_H04.bBP159129 
SPL010010H07SPL01_0010_H07.bBP159216 
SPL010011D05SPL01_0011_D05.bBP157792 
SPL010014C07SPL01_0014_C07.bBP157510 
SPL010017E06SPL01_0017_E06.bBP158176 
SPL010018C03SPL01_0018_C03.bBP157393 
SPL010020B06SPL01_0020_B06.bBP157144 
SPL010020F08SPL01_0020_F08.bBP158584 
SPL010021C03SPL01_0021_C03.bBP157396 
SPL010022E06SPL01_0022_E06.bBP158181 
SPL010023H06SPL01_0023_H06.bBP159197 
SPL010024E07SPL01_0024_E07.bBP158208 
SPL010027G03SPL01_0027_G03.bBP158783 
SPL010028G02SPL01_0028_G02.bBP158752 
SPL010029H11SPL01_0029_H11.bCJ016291 
SPL010030E06SPL01_0030_E06.bCJ016345 
SPL010032G05SPL01_0032_G05.bCJ016544 
SPL010033D12SPL01_0033_D12.bCJ016608 
SPL010034B10SPL01_0034_B10.bCJ016677 
SPL010034D07SPL01_0034_D07.bCJ016698 
SPL010035H08SPL01_0035_H08.bBP159255 
SPL010038A10SPL01_0038_A10.bBP156938 
SPL010038C06SPL01_0038_C06.bBP157496 
SPL010039D02SPL01_0039_D02.bBP157722 
SPL010041F02SPL01_0041_F02.bBP158421 
SPL010041G02SPL01_0041_G02.bBP158758 
SPL010041G09SPL01_0041_G09.bBP158960 
SPL010042B04SPL01_0042_B04.bCJ016765 
SPL010042B09SPL01_0042_B09.bCJ016770 
SPL010044B04SPL01_0044_B04.bCJ016945 
SPL010044C01SPL01_0044_C01.bCJ016954 
SPL010045E04SPL01_0045_E04.bCJ017075 
SPL010046E06SPL01_0046_E06.bFS722148 
SPL010046F03SPL01_0046_F03.bCJ017174 
SPL010047D07SPL01_0047_D07.bCJ017248 
SPL010048B09SPL01_0048_B09.bCJ017318 
SPL010050D12SPL01_0050_D12.bCJ017517 
SPL010052H04SPL01_0052_H04.bCJ017740 
SPL010054D12SPL01_0054_D12.bCJ017881 
SPL010056E04SPL01_0056_E04.bCJ018062 
SPL010057B01SPL01_0057_B01.bCJ018114 
SPL010059D05SPL01_0059_D05.bCJ018320 
SPL010060E09SPL01_0060_E09.bCJ018423 
SPL010060G01SPL01_0060_G01.bCJ018437 
SPL010062G03SPL01_0062_G03.bCJ018625 
SPL010063E01SPL01_0063_E01.bCJ018693 
SPL010063E07SPL01_0063_E07.bCJ018699 
SPL010064D06SPL01_0064_D06.bCJ018781 
SPL010065B06SPL01_0065_B06.bCJ018846 
SPL010068B02SPL01_0068_B02.bCJ019106 
SPL010070H09SPL01_0070_H09.bCJ019360 
SPL010071A12SPL01_0071_A12.bCJ019374 
SPL010071H05SPL01_0071_H05.bCJ019448 
SPL010076A05SPL01_0076_A05.b  
SPL010076H08SPL01_0076_H08.bCJ019905 
SPL010077B04SPL01_0077_B04.bCJ019925 
SPL010077C10SPL01_0077_C10.bCJ019943 
SPL010077C11SPL01_0077_C11.bCJ019944 
SPL010080D07SPL01_0080_D07.bCJ020219 
SPL010081G12SPL01_0081_G12.bCJ020352 
SPL010084E11SPL01_0084_E11.bCJ020606 
SPL010085A02SPL01_0085_A02.bCJ020644 
SPL010086D08SPL01_0086_D08.bCJ020760 
SPL010088C04SPL01_0088_C04.bCJ020930 
SPL010089B01SPL01_0089_B01.bCJ021004 
SPL010090D06SPL01_0090_D06.bCJ021116 
SPL010091E12SPL01_0091_E12.bCJ021224 
SPL010092C03SPL01_0092_C03.bCJ021285 
SPL010092G06SPL01_0092_G06.bCJ021329 
SPL010093B01SPL01_0093_B01.bCJ021359 
SPL010093B10SPL01_0093_B10.bCJ021366 
SPL010093E05SPL01_0093_E05.bCJ021392 
SPL010094C03SPL01_0094_C03.bCJ021460 
SPL010094E06SPL01_0094_E06.bCJ021487 
SPL010095H05SPL01_0095_H05.bCJ021611 
SPL010096A01SPL01_0096_A01.bCJ021619 
SPL010097B09SPL01_0097_B09.bCJ021728 
SPL010098H10SPL01_0098_H10.bCJ021885 
SPL010099F06SPL01_0099_F06.bCJ021949 
SPL010102F09SPL01_0102_F09.bCJ022201 
SPL010102G03SPL01_0102_G03.bCJ022206 
SPL010103B04SPL01_0103_B04.bCJ022236 
SPL010103E06SPL01_0103_E06.bCJ022268 
SPL010103G11SPL01_0103_G11.bCJ022295 
SPL010105B12SPL01_0105_B12.bCJ022419 
SPL010105E06SPL01_0105_E06.bCJ022448 
SPLT10001A09SPLT1_0001_A09.bHX239278 
SPLT10001C08SPLT1_0001_C08.bHX239297 
SPLT10001D03SPLT1_0001_D03.bHX239303 
SPLT10001E05SPLT1_0001_E05.bHX239313 
SPLT10001E12SPLT1_0001_E12.bHX239318 
SPLT10001F02SPLT1_0001_F02.bHX239320 
SPLT10002B01SPLT1_0002_B01.bHX239360 
SPLT10002B04SPLT1_0002_B04.bHX239362 
SPLT10002F03SPLT1_0002_F03.bHX239394 
SPLT10002G09SPLT1_0002_G09.bHX239410 
SPLT10003D01SPLT1_0003_D01.b  
SPLT10004D08SPLT1_0004_D08.bHX239528 
SPLT10005A09SPLT1_0005_A09.bHX239574 
SPLT10005G09SPLT1_0005_G09.bHX239628 
SPLT10005H12SPLT1_0005_H12.bHX239641 
SPLT10006A04SPLT1_0006_A04.bHX239645 
SPLT10006F09SPLT1_0006_F09.bHX239694 
SPLT10007A08SPLT1_0007_A08.bHX239721 
SPLT10007G02SPLT1_0007_G02.bHX239775 
SPLT10008A06SPLT1_0008_A06.bHX239793 
SPLT10008C04SPLT1_0008_C04.bHX239813 
SPLT10008D08SPLT1_0008_D08.bHX239826 
SPLT10008D12SPLT1_0008_D12.bHX239828 
SPLT10008E04SPLT1_0008_E04.bHX239832 
SPLT10008F09SPLT1_0008_F09.bHX239842 
SPLT10009A12SPLT1_0009_A12.b  
SPLT10009F11SPLT1_0009_F11.bHX239918 
SPLT10009G07SPLT1_0009_G07.bHX239925 
SPLT10011F04SPLT1_0011_F04.bHX240066 
SPLT10011F06SPLT1_0011_F06.bHX240068 
SPLT10012F02SPLT1_0012_F02.bHX240142 
SPLT10012F11SPLT1_0012_F11.bHX240149 
SPLT10012G01SPLT1_0012_G01.b  
SPLT10013C08SPLT1_0013_C08.bHX240189 
SPLT10014A07SPLT1_0014_A07.bHX240241 
SPLT10014B01SPLT1_0014_B01.bHX240246 
SPLT10014C07SPLT1_0014_C07.bHX240260 
SPLT10014D05SPLT1_0014_D05.bHX240269 
SPLT10014E07SPLT1_0014_E07.bHX240280 
SPLT10014F02SPLT1_0014_F02.bHX240286 
SPLT10015F09SPLT1_0015_F09.bHX240370 
SPLT10015H01SPLT1_0015_H01.bHX240382 
SPLT10015H05SPLT1_0015_H05.bHX240385 
SPLT10017F02SPLT1_0017_F02.bHX240523 
SPLT10017G03SPLT1_0017_G03.bHX240533 
SPLT10017G06SPLT1_0017_G06.bHX240536 
SPLT10017H07SPLT1_0017_H07.bHX240547 
SPLT10018B08SPLT1_0018_B08.bHX240568 
SPLT10018F11SPLT1_0018_F11.bHX240610 
SPLT10019F05SPLT1_0019_F05.bHX240681 
SPLT10019F11SPLT1_0019_F11.bHX240686 
SPLT10020B01SPLT1_0020_B01.bHX240717 
SPLT10020B11SPLT1_0020_B11.bHX240724 
SPLT10020D02SPLT1_0020_D02.bHX240737 
SPLT10021D10SPLT1_0021_D10.bHX240829 
SPLT10021E04SPLT1_0021_E04.bHX240833 
SPLT10021E11SPLT1_0021_E11.bHX240838 
SPLT10021E12SPLT1_0021_E12.bHX240839 
SPLT10021F09SPLT1_0021_F09.bHX240847 
SPLT10022C02SPLT1_0022_C02.bHX240893 
SPLT10022C12SPLT1_0022_C12.bHX240903 
SPLT10023C03SPLT1_0023_C03.bHX240971 
SPLT10023C11SPLT1_0023_C11.bHX240979 
SPLT10023F01SPLT1_0023_F01.bHX241000 
SPLT10023G09SPLT1_0023_G09.bHX241014 
SPLT10024B02SPLT1_0024_B02.bHX241037 
SPLT10024G10SPLT1_0024_G10.b  
SPLT10024H04SPLT1_0024_H04.bHX241099 
SPLT10024H05SPLT1_0024_H05.bHX241100 
SPLT10025A06SPLT1_0025_A06.bHX241108 
SPLT10025A11SPLT1_0025_A11.bHX241111 
SPLT10025E07SPLT1_0025_E07.bHX241147 
SPLT10025H09SPLT1_0025_H09.bHX241181 
SPLT10026B11SPLT1_0026_B11.bHX241201 
SPLT10026C12SPLT1_0026_C12.bHX241212 
SPLT10026E07SPLT1_0026_E07.bHX241226 
SPLT10027B11SPLT1_0027_B11.bHX241276 
SPLT10027B12SPLT1_0027_B12.bHX241277 
SPLT10028A01SPLT1_0028_A01.bHX241335 
SPLT10028C02SPLT1_0028_C02.bHX241352 
SPLT10028G04SPLT1_0028_G04.bHX241395 
SPLT10029C09SPLT1_0029_C09.bHX241439 
SPLT10029D04SPLT1_0029_D04.bHX241443 
SPLT10029H01SPLT1_0029_H01.bHX241477 
SPLT10030B02SPLT1_0030_B02.bHX241493 
SPLT10030B04SPLT1_0030_B04.bHX241495 
SPLT10030E03SPLT1_0030_E03.bHX241518 
SPLT10031E03SPLT1_0031_E03.bHX241593 
SPLT10031E05SPLT1_0031_E05.bHX241595 
SPLT10031G08SPLT1_0031_G08.bHX241616 
SPLT10031G12SPLT1_0031_G12.bHX241620 
SPLT10032C03SPLT1_0032_C03.bHX241652 
SPLT10032D03SPLT1_0032_D03.bHX241663 
SPLT10032D06SPLT1_0032_D06.bHX241666 
SPLT10034A06SPLT1_0034_A06.bHX241794 
SPLT10034E10SPLT1_0034_E10.bHX241840 
SPLT10034H08SPLT1_0034_H08.bHX241868 
SPLT10035A02SPLT1_0035_A02.bHX241874 
SPLT10035A11SPLT1_0035_A11.bHX241882 
SPLT10035B01SPLT1_0035_B01.b  
SPLT10035D12SPLT1_0035_D12.bHX241916 
SPLT10035F02SPLT1_0035_F02.bHX241926 
SPLT10035H07SPLT1_0035_H07.bHX241948 
SPLT10036B07SPLT1_0036_B07.bHX241969 
SPLT10036C05SPLT1_0036_C05.bHX241976 
SPLT10036H09SPLT1_0036_H09.bHX242029 
SPLT10037E09SPLT1_0037_E09.bHX242081 
SPLT10040B12SPLT1_0040_B12.bHX242286 
SPLT10040F01SPLT1_0040_F01.bHX242322 
SPLT10040G04SPLT1_0040_G04.bHX242333 
SPLT10041A09SPLT1_0041_A09.bHX242356 
SPLT10041C03SPLT1_0041_C03.bHX242371 
SPLT10041D10SPLT1_0041_D10.bHX242388 
SPLT10041E05SPLT1_0041_E05.bHX242395 
SPLT10041E11SPLT1_0041_E11.bHX242401 
SPLT10042C03SPLT1_0042_C03.bHX242451 
SPLT10042D07SPLT1_0042_D07.bHX242466 
SPLT10042E01SPLT1_0042_E01.bHX242472 
SPLT10043C03SPLT1_0043_C03.bHX242529 
SPLT10043E03SPLT1_0043_E03.bHX242553 
SPLT10043E12SPLT1_0043_E12.bHX242560 
SPLT10043F08SPLT1_0043_F08.bHX242566 
SPLT10044A05SPLT1_0044_A05.bHX242592 
SPLT10044A09SPLT1_0044_A09.bHX242596 
SPLT10044A12SPLT1_0044_A12.bHX242598 
SPLT10044G12SPLT1_0044_G12.bHX242654 
SPLT10045D06SPLT1_0045_D06.bHX242698 
SPLT10045F08SPLT1_0045_F08.bHX242719 
SPLT10045G03SPLT1_0045_G03.bHX242726 
SPLT10045G11SPLT1_0045_G11.bHX242731 
SPLT10045H11SPLT1_0045_H11.bHX242742 
SPLT10046B07SPLT1_0046_B07.bHX242759 
SPLT10046C08SPLT1_0046_C08.bHX242771 
SPLT10048B11SPLT1_0048_B11.bHX242917 
SPLT10048E12SPLT1_0048_E12.bHX242949 
SPLT10048F05SPLT1_0048_F05.bHX242954 
SPLT10048F12SPLT1_0048_F12.bHX242959 
SPLT10049B01SPLT1_0049_B01.b  
SPLT10049B07SPLT1_0049_B07.bHX242994 
SPLT10049C03SPLT1_0049_C03.bHX242999 
SPLT10049G02SPLT1_0049_G02.b  
SPLT10049H02SPLT1_0049_H02.bHX243042 
SPLT10050D10SPLT1_0050_D10.bHX243080 
SPLT10051A01SPLT1_0051_A01.bHX243114 
SPLT10051A03SPLT1_0051_A03.bHX243116 
SPLT10051B03SPLT1_0051_B03.bHX243126 
SPLT10051F03SPLT1_0051_F03.bHX243158 
SPLT10051G08SPLT1_0051_G08.bHX243172 
SPLT10052A02SPLT1_0052_A02.bHX243188 
SPLT10052C11SPLT1_0052_C11.bHX243209 
SPLT10052D02SPLT1_0052_D02.bHX243211 
SPLT10052F04SPLT1_0052_F04.bHX243231 
SPLT10053C03SPLT1_0053_C03.bHX243274 
SPLT10053C05SPLT1_0053_C05.bHX243276 
SPLT10053F04SPLT1_0053_F04.bHX243306 
SPLT10055E07SPLT1_0055_E07.bHX243455 
SPLT10055E09SPLT1_0055_E09.bHX243457 
SPLT10055G06SPLT1_0055_G06.bHX243473 
SPLT10055G12SPLT1_0055_G12.bHX243478 
SPLT10055H03SPLT1_0055_H03.bHX243481 
SPLT10056C06SPLT1_0056_C06.bHX243513 
SPLT10056G11SPLT1_0056_G11.bHX243554 
SPLT10057C02SPLT1_0057_C02.bHX243587 
SPLT10057D11SPLT1_0057_D11.bHX243607 
SPLT10057E12SPLT1_0057_E12.bHX243619 
SPLT10057H03SPLT1_0057_H03.bHX243645 
SPLT10058B08SPLT1_0058_B08.bHX243670 
SPLT10058C07SPLT1_0058_C07.bHX243680 
SPLT10058D01SPLT1_0058_D01.bHX243685 
SPLT10058G06SPLT1_0058_G06.b  
SPLT10058H11SPLT1_0058_H11.bHX243734 
SPLT10059C12SPLT1_0059_C12.bHX243763 
SPLT10059E10SPLT1_0059_E10.bHX243784 
SPLT10060B05SPLT1_0060_B05.bHX243829 
SPLT10061A04SPLT1_0061_A04.bHX243893 
SPLT10061A07SPLT1_0061_A07.bHX243896 
SPLT10061H06SPLT1_0061_H06.bHX243964 
SPLT10063D05SPLT1_0063_D05.bHX244083 
SPLT10063D07SPLT1_0063_D07.bHX244085 
SPLT10063E01SPLT1_0063_E01.bHX244089 
SPLT10064B01SPLT1_0064_B01.bHX244138 
SPLT10065B05SPLT1_0065_B05.bHX244220 
SPLT10066D04SPLT1_0066_D04.bHX244323 
SPLT10066E11SPLT1_0066_E11.bHX244339 
SPLT10067A09SPLT1_0067_A09.bHX244374 
SPLT10067B11SPLT1_0067_B11.bHX244387 
SPLT10067C05SPLT1_0067_C05.bHX244393 
SPLT10067C08SPLT1_0067_C08.bHX244396 
SPLT10067H04SPLT1_0067_H04.bHX244439 
SPLT10068C09SPLT1_0068_C09.bHX244475 
SPLT10068H01SPLT1_0068_H01.bHX244519 
SPLT10069E01SPLT1_0069_E01.bHX244566 
SPLT10069F03SPLT1_0069_F03.bHX244580 
SPLT10070D07SPLT1_0070_D07.b  
SPLT10070G06SPLT1_0070_G06.bHX244672 
SPLT10071A11SPLT1_0071_A11.bHX244697 
SPLT10072C06SPLT1_0072_C06.bHX244791 
SPLT10072G03SPLT1_0072_G03.bHX244823 
SPLT10073F04SPLT1_0073_F04.bHX244890 
SPLT10073F07SPLT1_0073_F07.bHX244893 
SPLT10074B08SPLT1_0074_B08.bHX244935 
SPLT10074H09SPLT1_0074_H09.bHX244994 
SPLT10075C01SPLT1_0075_C01.bHX245018 
SPLT10077B02SPLT1_0077_B02.bHX245163 
SPLT10077D08SPLT1_0077_D08.bHX245186 
SPLT10077F02SPLT1_0077_F02.bHX245200 
SPLT10077G07SPLT1_0077_G07.bHX245216 
SPLT10078E06SPLT1_0078_E06.bHX245275 
SPLT10079A12SPLT1_0079_A12.bHX245324 
SPLT10079B07SPLT1_0079_B07.bHX245330 
SPLT10079E10SPLT1_0079_E10.bHX245364 
SPLT10079G12SPLT1_0079_G12.bHX245386 
SPLT10080C12SPLT1_0080_C12.bHX245424 
SPLT10080G03SPLT1_0080_G03.bHX245460 
SPLT10081B01SPLT1_0081_B01.bHX245488 
SPLT10081D12SPLT1_0081_D12.bHX245520 
SPLT10081G12SPLT1_0081_G12.bHX245548 
SPLT10082A06SPLT1_0082_A06.bHX245564 
SPLT10082A08SPLT1_0082_A08.bHX245566 
SPLT10082F08SPLT1_0082_F08.bHX245615 
SPLT10083C08SPLT1_0083_C08.bHX245663 
SPLT10083E01SPLT1_0083_E01.bHX245674 
SPLT10083G01SPLT1_0083_G01.bHX245691 
SPLT10084A06SPLT1_0084_A06.bHX245714 
SPLT10084E12SPLT1_0084_E12.bHX245757 
SPLT10084G09SPLT1_0084_G09.bHX245773 
SPLT10084H11SPLT1_0084_H11.bHX245784 
SPLT10085A11SPLT1_0085_A11.bHX245794 
SPLT10085B11SPLT1_0085_B11.bHX245805 
SPLT10085D02SPLT1_0085_D02.bHX245819 
SPLT10085D12SPLT1_0085_D12.bHX245828 
SPLT10086B09SPLT1_0086_B09.bHX245880 
SPLT10086E05SPLT1_0086_E05.bHX245905 
SPLT10086G09SPLT1_0086_G09.bHX245928 
SPLT10087B01SPLT1_0087_B01.bHX245952 
SPLT10087C07SPLT1_0087_C07.bHX245966 
SPLT10087D06SPLT1_0087_D06.bHX245974 
SPLT10087E09SPLT1_0087_E09.bHX245989 
SPLT10087F06SPLT1_0087_F06.bHX245995 
SPLT10087F07SPLT1_0087_F07.bHX245996 
SPLT10087G11SPLT1_0087_G11.bHX246010 
SPLT10088B02SPLT1_0088_B02.bHX246031 
SPLT10088C05SPLT1_0088_C05.bHX246043 
SPLT10088D07SPLT1_0088_D07.bHX246055 
SPLT10089B12SPLT1_0089_B12.bHX246116 
SPLT10089C04SPLT1_0089_C04.bHX246119 
SPLT10089D07SPLT1_0089_D07.bHX246130 
SPLT10089D10SPLT1_0089_D10.bHX246132 
SPLT10089F10SPLT1_0089_F10.bHX246150 
SPLT10090C04SPLT1_0090_C04.bHX246196 
SPLT10090D02SPLT1_0090_D02.b  
SPLT10090E06SPLT1_0090_E06.bHX246219 
SPLT10090G06SPLT1_0090_G06.bHX246237 
SPLT10091E09SPLT1_0091_E09.bHX246302 
SPLT10091G12SPLT1_0091_G12.bHX246327 
SPLT10093D01SPLT1_0093_D01.bHX246450 
SPLT10093D03SPLT1_0093_D03.bHX246452 
SPLT10093D10SPLT1_0093_D10.bHX246455 
SPLT10093H12SPLT1_0093_H12.bHX246498 
SPLT10094A04SPLT1_0094_A04.bHX246501 
SPLT10094H04SPLT1_0094_H04.bHX246568 
SPLT10095F10SPLT1_0095_F10.bHX246634 
SPLT10095H01SPLT1_0095_H01.bHX246646 
SPLT10097A05SPLT1_0097_A05.bHX246739 
SPLT10097D01SPLT1_0097_D01.bHX246763 
SPLT10097E08SPLT1_0097_E08.bHX246777 
SPLT10098B10SPLT1_0098_B10.bHX246825 
SPLT10098B11SPLT1_0098_B11.bHX246826 
SPLT10098C04SPLT1_0098_C04.bHX246830 
SPLT10098E10SPLT1_0098_E10.bHX246852 
SPLT10098G03SPLT1_0098_G03.bHX246867 
SPLT10098H05SPLT1_0098_H05.bHX246880 
SPLT10099E06SPLT1_0099_E06.bHX246935 
SPLT10099F05SPLT1_0099_F05.bHX246944 
SPLT10099G05SPLT1_0099_G05.bHX246954 
SPLT10099G07SPLT1_0099_G07.bHX246956 
SPLT10100G06SPLT1_0100_G06.b  
SPLT10100H09SPLT1_0100_H09.bHX247039 
TES010010A01TES01_0010_A01.bCJ030637 
TES010010H03TES01_0010_H03.bCJ030697 
TES010019A12TES01_0019_A12.bCJ031258 
TES010047B11TES01_0047_B11.bCJ033016 
TES010048F12TES01_0048_F12.bCJ033081 
TES010063D01TES01_0063_D01.bCJ034053 
TES010081F06TES01_0081_F06.b  
TES010105E04TES01_0105_E04.b  

  

SNPs: 8      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
705A15000.097WNGAA/E
C1374230.903GCA/A
739A1110180.680OSGAA/E
G519110.320GAG/E
988C742300.425WSAGC/S
T104400.575AGT/S
1045C1674300.916WSAAC/N
T15600.084AAT/N
1282A10000.065W-
T1427160.935
1283A9000.059W-
T1410180.941
1284A8500.055W-
G1452170.945
1285A12000.084W-
C130390.916


Alignment:      TOP

20110601C-001127 : ........................................................CAGG
---------+---------+---------+---------+---------+---------+ 4
PBL01_0068_D07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagg
PBL01_0034_H06.b :
PBL01_0060_F08.b :
SPL01_0063_E07.b :
LVRM1_0066_H11.b :
SPL01_0089_B01.b :
PST01_0053_F09.b :
TES01_0010_A01.b :
SKNB1_0083_A06.b :
TES01_0105_E04.b :
PST01_0013_G10.b :
PCT01_0032_G03.b :
PCT01_0014_D08.b :
PBL01_0030_D07.b :
PBL01_0054_B01.b :
SPLT1_0001_D03.b :
BMWN1_0049_C06.b :
BMWN1_0044_G07.b :
SPL01_0020_F08.b :
PCT01_0029_A02.b :
PBL01_0022_E07.b :
BMWN1_0040_G08.b :
SPLT1_0048_E12.b :
BMWN1_0046_E03.b :
BMWN1_0045_H12.b :
BMWN1_0090_D04.b :
SPL01_0088_C04.b :
BMWN1_0041_D05.b :
BMWN1_0099_E06.b :
BMWN1_0045_H02.b :
SPLT1_0090_G06.b :
PCT01_0018_G11.b :
BMWN1_0068_D01.b :
BMWN1_0088_B07.b :
BMWN1_0038_A11.b :
SPLT1_0081_B01.b :
SPLT1_0008_D08.b :
PBL01_0071_F09.b :
BMWN1_0027_E12.b :
PBL01_0089_D04.b :
SPLT1_0012_F11.b :
ILNT1_0010_F04.b :
BMWN1_0013_F03.b :
BMWN1_0010_G07.b :
SPLT1_0030_B04.b :
SPLT1_0046_B07.b :
SPLT1_0014_D05.b :
LVRM1_0102_D01.b :
SPLT1_0043_C03.b :
BMWN1_0076_F11.b :
SPLT1_0097_D01.b :
BMWN1_0064_E05.b :
BMWN1_0086_E05.b :
SPLT1_0089_F10.b :
BMWN1_0033_B12.b :
SPLT1_0014_B01.b :
BMWN1_0017_H10.b :
SPLT1_0049_H02.b :
BMWN1_0052_A01.b :
PBL01_0073_B11.b :
BMWN1_0093_G05.b :
SPLT1_0093_H12.b :
BMWN1_0065_H03.b :
BMWN1_0037_C07.b :
BMWN1_0031_A01.b :
BMWN1_0050_D07.b :
BMWN1_0023_G10.b :
BMWN1_0076_B10.b :
BMWN1_0026_C12.b :
SPLT1_0032_D06.b :
BMWN1_0038_A12.b :
SPL01_0011_D05.b :
BMWN1_0067_D09.b :
BMWN1_0007_G06.b :
SKNB1_0085_C10.b :
PBL01_0050_C07.b :
BMWN1_0081_A08.b :
SPLT1_0046_C08.b :
BMWN1_0036_B07.b :
BMWN1_0026_H07.b :
BMWN1_0081_D01.b :
BMWN1_0096_F05.b :
BMWN1_0006_B07.b :
BMWN1_0072_G12.b :
BFLT1_0002_G09.b :
BMWN1_0086_C05.b :
PBL01_0063_G06.b :
SPLT1_0086_E05.b :
PBL01_0105_B03.b :
PBL01_0069_F10.b :
PBL01_0050_H02.b :
SPLT1_0048_F12.b :
SPLT1_0043_F08.b :
BMWN1_0085_D03.b :
BMWN1_0009_C07.b :
SPLT1_0067_A09.b :
BMWN1_0058_F07.b :
BMWN1_0086_H06.b :
BMWN1_0070_F12.b :
LVRM1_0120_A04.b :
SPLT1_0091_E09.b :
BMWN1_0097_B11.b :
BMWN1_0074_A09.b :
SPLT1_0083_G01.b :
BMWN1_0049_D08.b :
BMWN1_0057_F08.b :
SPLT1_0068_C09.b :
BMWN1_0013_D01.b :
BMWN1_0098_E09.b :
BMWN1_0070_B07.b :
BMWN1_0072_C05.b :
BMWN1_0056_F01.b :
BMWN1_0091_A01.b :
BMWN1_0074_A12.b :
BMWN1_0025_E11.b :
BMWN1_0058_B09.b :
BMWN1_0024_E07.b :
SPLT1_0041_E05.b :
ILNT1_0075_C04.b :
BMWN1_0052_H11.b :
BMWN1_0033_D08.b :
BMWN1_0093_H01.b :
BMWN1_0081_E09.b :
SPLT1_0088_C05.b :
BMWN1_0076_E07.b :
BFLT1_0039_E04.b :
BMWN1_0015_B11.b :
BMWN1_0042_G06.b :
SPLT1_0098_B10.b :
SPLT1_0093_D10.b :
BMWN1_0030_F04.b :
PBL01_0058_E02.b :
PBL01_0012_C11.b :
BMWN1_0091_G01.b :
BMWN1_0026_G12.b :
BMWN1_0051_G08.b :
BMWN1_0052_A03.b :
BMWN1_0035_C08.b :
BMWN1_0047_A08.b :
BMWN1_0057_E01.b :
BMWN1_0025_E09.b :
BMWN1_0028_A11.b :
BMWN1_0017_A04.b :
BMWN1_0013_H10.b :
BMWN1_0044_C04.b :
BMWN1_0040_F08.b :
BMWN1_0062_A06.b :
SPLT1_0097_A05.b :
BMWN1_0036_H01.b :
BMWN1_0092_G08.b :
BMWN1_0014_F02.b :
BMWN1_0031_F05.b :
BMWN1_0055_C01.b :
BMWN1_0032_B08.b :
BMWN1_0079_B01.b :
TES01_0063_D01.b :
BMWN1_0038_F04.b :
BMWN1_0041_H04.b :
SPLT1_0008_E04.b :
SPLT1_0089_D10.b :
BMWN1_0019_C08.b :
BMWN1_0075_F10.b :
BMWN1_0052_D12.b :
BMWN1_0074_B05.b :
SPLT1_0029_D04.b :
BMWN1_0026_F06.b :
BMWN1_0067_F03.b :
BMWN1_0038_E10.b :
SPLT1_0025_A06.b :
BMWN1_0083_H05.b :
BMWN1_0081_G09.b :
BMWN1_0023_E10.b :
BMWN1_0074_C12.b :
BMWN1_0099_C07.b :
BMWN1_0052_G05.b :
BMWN1_0037_H07.b :
BMWN1_0041_C06.b :
BMWN1_0010_A10.b :
BMWN1_0079_D05.b :
SPLT1_0100_G06.b :
BMWN1_0080_H05.b :
SPLT1_0002_F03.b :
BMWN1_0010_C12.b :
BMWN1_0037_D06.b :
BMWN1_0007_A07.b :
BMWN1_0037_H11.b :
BMWN1_0091_E08.b :
BMWN1_0013_D11.b :
PCT01_0022_G02.b :
SPLT1_0012_G01.b :
BMWN1_0065_H02.b :
SPLT1_0048_F05.b :
BMWN1_0055_H12.b :
SPLT1_0036_C05.b :
PCT01_0036_B11.b :
PCT01_0029_C08.b :
BMWN1_0086_C10.b :
SPLT1_0069_F03.b :
SPLT1_0043_E03.b :
SPLT1_0063_D05.b :
PCT01_0016_G06.b :
BMWN1_0030_B10.b :
BMWN1_0097_D02.b :
SPLT1_0041_D10.b :
BMWN1_0003_D05.b :
BMWN1_0072_A08.b :
SPLT1_0089_D07.b :
BMWN1_0062_E07.b :
BMWN1_0014_C02.b :
BMWN1_0027_A01.b :
BMWN1_0093_E03.b :
BMWN1_0007_A09.b :
BMWN1_0062_F05.b :
BMWN1_0031_H05.b :
BMWN1_0088_E03.b :
ILNT1_0085_G05.b :
BMWN1_0014_D03.b :
BMWN1_0037_F09.b :
BMWN1_0059_E01.b :
BMWN1_0074_A01.b :
BMWN1_0097_F02.b :
SPLT1_0051_G08.b :
BMWN1_0068_H10.b :
BMWN1_0096_G08.b :
BMWN1_0015_B06.b :
BMWN1_0031_C06.b :
BMWN1_0050_A08.b :
BMWN1_0059_D11.b :
BMWN1_0060_H08.b :
BMWN1_0086_G04.b :
BMWN1_0088_G06.b :
SPLT1_0050_D10.b :
BMWN1_0027_H08.b :
BMWN1_0056_G04.b :
SPLT1_0017_G03.b :
SPLT1_0015_H01.b :
BMWN1_0073_B06.b :
BMWN1_0091_G11.b :
BMWN1_0020_C05.b :
BMWN1_0039_G09.b :
SPLT1_0023_G09.b :
BMWN1_0021_H08.b :
BMWN1_0047_F07.b :
BMWN1_0083_C05.b :
BMWN1_0089_E10.b :
SPLT1_0001_E05.b :
BMWN1_0027_G04.b :
BMWN1_0028_D09.b :
BMWN1_0057_C06.b :
BMWN1_0098_C11.b :
SPLT1_0052_D02.b :
BMWN1_0013_E08.b :
BMWN1_0050_H08.b :
BMWN1_0076_G07.b :
BMWN1_0095_H06.b :
SPLT1_0085_A11.b :
BMWN1_0085_C08.b :
BMWN1_0087_E07.b :
BMWN1_0092_G11.b :
BMWN1_0099_E11.b :
SPLT1_0063_E01.b :
BMWN1_0054_G05.b :
BMWN1_0061_D04.b :
BMWN1_0095_A06.b :
BMWN1_0095_G10.b :
BMWN1_0005_F06.b :
BMWN1_0007_C03.b :
BMWN1_0073_D12.b :
SPLT1_0035_A11.b :
BMWN1_0028_A10.b :
BMWN1_0042_B07.b :
BMWN1_0061_H10.b :
BMWN1_0074_C06.b :
SPLT1_0023_C03.b :
SPLT1_0012_F02.b :
SPLT1_0087_F07.b :
SPLT1_0082_A08.b :
SPLT1_0099_G07.b :
BMWN1_0001_H10.b :
BMWN1_0007_F09.b :
BMWN1_0006_D10.b :
BMWN1_0094_B07.b :
BMWN1_0073_B01.b :
BMWN1_0081_E11.b :
SPLT1_0095_F10.b :
BMWN1_0096_B11.b :
SPLT1_0084_G09.b :
BMWN1_0019_H05.b :
BMWN1_0046_E01.b :
BMWN1_0084_F09.b :
SPLT1_0053_F04.b :
SPLT1_0049_G02.b :
BMWN1_0060_E02.b :
SPLT1_0028_A01.b :
BMWN1_0013_B01.b :
BMWN1_0018_A01.b :
BMWN1_0053_H08.b :
BMWN1_0076_D07.b :
BMWN1_0084_B04.b :
BMWN1_0085_D07.b :
BMWN1_0005_C09.b :
BMWN1_0064_D06.b :
BMWN1_0067_A01.b :
BMWN1_0089_E01.b :
ILNT1_0061_E04.b :
BMWN1_0047_E04.b :
BMWN1_0055_F09.b :
BMWN1_0072_E05.b :
BMWN1_0073_B09.b :
BMWN1_0073_C04.b :
BMWN1_0077_H08.b :
BMWN1_0078_C11.b :
BMWN1_0078_E12.b :
SPLT1_0035_F02.b :
BMWN1_0027_G08.b :
SPLT1_0052_C11.b :
SPLT1_0073_F07.b :
SPLT1_0079_A12.b :
SPLT1_0079_E10.b :
BMWN1_0031_G08.b :
SPLT1_0099_E06.b :
BMWN1_0063_D11.b :
BMWN1_0068_B05.b :
BMWN1_0090_C01.b :
BMWN1_0098_B12.b :
BMWN1_0099_E09.b :
SPLT1_0032_C03.b :
BMWN1_0002_F12.b :
BMWN1_0019_A03.b :
BMWN1_0024_C09.b :
BMWN1_0027_H11.b :
BMWN1_0091_D04.b :
SPLT1_0026_B11.b :
SPLT1_0048_B11.b :
BMWN1_0046_D11.b :
BMWN1_0041_H06.b :
SPLT1_0008_A06.b :
SPLT1_0051_A03.b :
BMWN1_0056_G06.b :
PBL01_0013_E08.b :
PBL01_0085_F04.b :
BMWN1_0054_A07.b :
BMWN1_0080_E10.b :
BMWN1_0085_D05.b :
BMWN1_0013_B03.b :
BMWN1_0014_F01.b :
BMWN1_0030_A07.b :
BMWN1_0002_H02.b :
BMWN1_0011_F10.b :
BMWN1_0030_G07.b :
BMWN1_0057_F02.b :
BMWN1_0067_B06.b :
BMWN1_0093_H05.b :
SPLT1_0026_E07.b :
BMWN1_0045_C12.b :
SPLT1_0034_A06.b :
SPLT1_0098_E10.b :
BMWN1_0008_B09.b :
BMWN1_0001_E11.b :
BMWN1_0049_G07.b :
BMWN1_0089_E04.b :
BMWN1_0050_A06.b :
BMWN1_0057_F09.b :
BMWN1_0060_D10.b :
BMWN1_0063_H07.b :
BMWN1_0098_E12.b :
SPLT1_0023_F01.b :
BMWN1_0021_G11.b :
BMWN1_0037_G03.b :
BMWN1_0044_E12.b :
BMWN1_0057_G03.b :
BMWN1_0088_G10.b :
SPLT1_0006_A04.b :
SPLT1_0024_H05.b :
BMWN1_0003_H06.b :
BMWN1_0041_B04.b :
SPLT1_0001_A09.b :
SPLT1_0014_E07.b :
SPLT1_0018_B08.b :
SPLT1_0053_C03.b :
SPLT1_0059_E10.b :
SPLT1_0061_H06.b :
SPLT1_0074_B08.b :
SPLT1_0002_B01.b :
SPLT1_0015_F09.b :
BMWN1_0040_C03.b :
BMWN1_0036_G11.b :
BMWN1_0069_F10.b :
BMWN1_0032_A10.b :
BMWN1_0095_A11.b :
BMWN1_0024_H05.b :
BMWN1_0063_C07.b :
BMWN1_0082_A04.b :
BMWN1_0083_H04.b :
ILNT1_0026_E09.b :
BMWN1_0003_H05.b :
BMWN1_0023_H12.b :
BMWN1_0057_A04.b :
BMWN1_0077_B01.b :
BMWN1_0093_G11.b :
SPLT1_0026_C12.b :
SPLT1_0066_E11.b :
SPLT1_0085_D12.b :
BMWN1_0030_H09.b :
BMWN1_0046_A03.b :
BMWN1_0077_H04.b :
BMWN1_0097_C05.b :
SPLT1_0005_H12.b :
SPLT1_0036_B07.b :
SPLT1_0040_B12.b :
SPLT1_0049_C03.b :
SPLT1_0058_D01.b :
SPL01_0084_E11.b :
BMWN1_0068_E07.b :
BMWN1_0009_C02.b :
BMWN1_0025_E02.b :
BMWN1_0086_A10.b :
BMWN1_0097_G02.b :
BMWN1_0012_H02.b :
BMWN1_0024_A11.b :
BMWN1_0025_C08.b :
BMWN1_0027_A07.b :
BMWN1_0038_H09.b :
BMWN1_0060_A09.b :
BMWN1_0093_F02.b :
BMWN1_0021_B10.b :
BMWN1_0028_B05.b :
BMWN1_0046_E02.b :
BMWN1_0062_D08.b :
BMWN1_0062_E03.b :
BMWN1_0095_C12.b :
SPLT1_0019_F05.b :
SPLT1_0021_D10.b :
SPLT1_0021_E11.b :
SPLT1_0027_B12.b :
SPLT1_0042_D07.b :
BMWN1_0023_A01.b :
SPLT1_0080_C12.b :
SPLT1_0084_E12.b :
SPLT1_0031_G08.b :
SPLT1_0074_H09.b :
BMWN1_0055_F02.b :
SPLT1_0008_D12.b :
SPLT1_0099_F05.b :
BMWN1_0048_D06.b :
BMWN1_0064_G04.b :
BMWN1_0025_A11.b :
BMWN1_0036_C07.b :
BMWN1_0049_F05.b :
BMWN1_0053_A05.b :
BMWN1_0072_H06.b :
BMWN1_0081_H05.b :
BMWN1_0008_H10.b :
BMWN1_0052_G10.b :
BMWN1_0053_H03.b :
BMWN1_0054_C02.b :
BMWN1_0057_H10.b :
BMWN1_0062_F01.b :
BMWN1_0076_H04.b :
BMWN1_0077_A12.b :
BMWN1_0087_A04.b :
BMWN1_0089_A03.b :
SPLT1_0045_H11.b :
SPLT1_0061_A04.b :
BMWN1_0078_G02.b :
BMWN1_0088_D10.b :
BMWN1_0090_G08.b :
SPLT1_0001_E12.b :
SPLT1_0022_C02.b :
SPLT1_0024_B02.b :
SPLT1_0031_G12.b :
SPLT1_0053_C05.b :
SPLT1_0079_G12.b :
SPLT1_0081_D12.b :
BMWN1_0031_E07.b :
BMWN1_0055_D01.b :
BMWN1_0055_E03.b :
SPLT1_0011_F04.b :
SPLT1_0045_D06.b :
SPLT1_0082_A06.b :
SPLT1_0084_A06.b :
SPLT1_0087_E09.b :
SPLT1_0044_A12.b :
SPLT1_0052_A02.b :
BMWN1_0043_C07.b :
BMWN1_0093_G09.b :
BMWN1_0074_D06.b :
BMWN1_0012_G03.b :
BMWN1_0050_B07.b :
BMWN1_0085_H03.b :
SPLT1_0098_H05.b :
BMWN1_0065_A06.b :
BMWN1_0085_D04.b :
SPLT1_0002_G09.b :
SPLT1_0011_F06.b :
SPLT1_0031_E05.b :
BMWN1_0009_G07.b :
BMWN1_0013_H09.b :
BMWN1_0048_B12.b :
BMWN1_0074_G03.b :
BMWN1_0074_H01.b :
BMWN1_0078_A04.b :
BMWN1_0078_C02.b :
BMWN1_0094_G09.b :
BMWN1_0095_G12.b :
SPLT1_0021_E12.b :
BMWN1_0007_H11.b :
BMWN1_0036_F05.b :
BMWN1_0056_G08.b :
BMWN1_0091_G08.b :
BMWN1_0100_A10.b :
SPLT1_0067_B11.b :
SPLT1_0094_H04.b :
BMWN1_0042_B06.b :
ILNT1_0068_A03.b :
SPLT1_0088_D07.b :
SPLT1_0099_G05.b :
BMWN1_0040_A05.b :
BMWN1_0044_A10.b :
SPLT1_0007_A08.b :
SPLT1_0015_H05.b :
BMWN1_0096_C02.b :
BMWN1_0016_D01.b :
BMWN1_0024_F02.b :
BMWN1_0080_D09.b :
BMWN1_0012_E03.b :
BMWN1_0017_F03.b :
BMWN1_0073_A11.b :
BMWN1_0086_A03.b :
BMWN1_0004_A09.b :
BMWN1_0004_H09.b :
BMWN1_0007_C08.b :
BMWN1_0060_H01.b :
BMWN1_0076_H05.b :
BMWN1_0081_H01.b :
BMWN1_0084_C01.b :
BMWN1_0004_C02.b :
BMWN1_0005_F10.b :
BMWN1_0006_G02.b :
BMWN1_0011_F05.b :
BMWN1_0025_B02.b :
BMWN1_0035_G04.b :
BMWN1_0052_G11.b :
BMWN1_0065_B10.b :
BMWN1_0072_G03.b :
BMWN1_0080_H02.b :
BMWN1_0088_D01.b :
BMWN1_0088_G01.b :
BMWN1_0089_A11.b :
BMWN1_0095_H11.b :
BMWN1_0098_B08.b :
SPLT1_0018_F11.b :
SPLT1_0035_D12.b :
SPLT1_0081_G12.b :
SPLT1_0089_C04.b :
BMWN1_0001_C08.b :
BMWN1_0023_D06.b :
BMWN1_0024_D05.b :
BMWN1_0045_B08.b :
BMWN1_0051_E01.b :
BMWN1_0063_B06.b :
BMWN1_0070_A10.b :
SPLT1_0020_B11.b :
SPLT1_0044_A09.b :
SPLT1_0051_F03.b :
BMWN1_0036_A02.b :
SPLT1_0073_F04.b :
SPLT1_0077_F02.b :
SPLT1_0083_C08.b :
SPLT1_0086_B09.b :
SPLT1_0079_B07.b :
BMWN1_0071_C05.b :
BMWN1_0093_B10.b :
BMWN1_0043_G06.b :
BMWN1_0064_D07.b :
BMWN1_0077_F07.b :
BMWN1_0051_F03.b :
BMWN1_0030_B07.b :
BMWN1_0081_E12.b :
BMWN1_0032_E08.b :
SPLT1_0034_E10.b :
BMWN1_0010_F07.b :
BMWN1_0030_D01.b :
BMWN1_0031_G06.b :
BMWN1_0052_C10.b :
BMWN1_0064_F07.b :
BMWN1_0065_D05.b :
BMWN1_0068_H04.b :
BMWN1_0014_B06.b :
BMWN1_0024_H12.b :
BMWN1_0025_F03.b :
BMWN1_0056_H06.b :
BMWN1_0094_E02.b :
BMWN1_0100_D03.b :
SPLT1_0029_C09.b :
SPLT1_0069_E01.b :
SPLT1_0090_E06.b :
BMWN1_0026_B07.b :
BMWN1_0057_E03.b :
BMWN1_0059_C01.b :
SPLT1_0042_E01.b :
BMWN1_0038_H08.b :
BMWN1_0046_H09.b :
SPLT1_0041_A09.b :
SPLT1_0051_A01.b :
SPLT1_0071_A11.b :
SPLT1_0077_B02.b :
SPLT1_0094_A04.b :
SPLT1_0082_F08.b :
BMWN1_0040_D06.b :
BMWN1_0087_C05.b :
BMWN1_0007_B07.b :
BMWN1_0013_D05.b :
BMWN1_0050_D03.b :
BMWN1_0087_B04.b :
BMWN1_0005_D10.b :
BMWN1_0030_E10.b :
BMWN1_0069_F09.b :
BMWN1_0079_H10.b :
BMWN1_0028_A12.b :
BMWN1_0028_D11.b :
BMWN1_0075_G03.b :
PBL01_0034_H12.b :
SPLT1_0025_H09.b :
SPLT1_0028_G04.b :
SPLT1_0029_H01.b :
SPLT1_0055_H03.b :
SPLT1_0090_C04.b :
BMWN1_0035_C11.b :
BMWN1_0047_A10.b :
BMWN1_0072_G02.b :
BMWN1_0073_G06.b :
BMWN1_0075_A03.b :
BMWN1_0096_F10.b :
SPLT1_0040_F01.b :
SPLT1_0043_E12.b :
SPLT1_0085_D02.b :
ILNT1_0070_F12.b :
SPLT1_0045_F08.b :
SPLT1_0045_G03.b :
SPLT1_0095_H01.b :
BMWN1_0034_F05.b :
BMWN1_0039_A04.b :
BMWN1_0011_A01.b :
BMWN1_0007_D07.b :
BMWN1_0049_F12.b :
BMWN1_0055_H01.b :
BMWN1_0061_A02.b :
BMWN1_0061_B01.b :
BMWN1_0069_A07.b :
BMWN1_0069_G03.b :
BMWN1_0096_A01.b :
BMWN1_0013_C01.b :
SPLT1_0041_E11.b :
SPLT1_0070_D07.b :
BMWN1_0008_D08.b :
BMWN1_0020_B05.b :
BMWN1_0062_B03.b :
BMWN1_0082_B10.b :
SPLT1_0083_E01.b :
SPLT1_0087_G11.b :
SPLT1_0057_C02.b :
BMWN1_0043_E05.b :
BMWN1_0013_G02.b :
BMWN1_0048_H06.b :
BMWN1_0048_G05.b :
BMWN1_0096_G11.b :
BMWN1_0097_C04.b :
BMWN1_0027_B12.b :
BMWN1_0016_H06.b :
BMWN1_0052_C11.b :
BMWN1_0077_G11.b :
BMWN1_0002_F07.b :
BMWN1_0010_D01.b :
BMWN1_0015_H01.b :
BMWN1_0032_C01.b :
BMWN1_0006_D05.b :
BMWN1_0021_C05.b :
BMWN1_0048_G03.b :
BMWN1_0065_E07.b :
BMWN1_0096_B12.b :
SPLT1_0021_F09.b :
SPLT1_0041_C03.b :
BMWN1_0063_F06.b :
BMWN1_0097_D12.b :
SPLT1_0001_C08.b :
SPLT1_0044_G12.b :
BMWN1_0040_B03.b :
SPLT1_0014_F02.b :
SPLT1_0060_B05.b :
SPLT1_0058_C07.b :
BMWN1_0080_F04.b :
BMWN1_0033_E07.b :
BMWN1_0053_H11.b :
BMWN1_0034_H08.b :
BMWN1_0064_E10.b :
BMWN1_0089_B11.b :
BMWN1_0012_B11.b :
BMWN1_0052_H08.b :
BMWN1_0066_E01.b :
BMWN1_0096_H09.b :
SPLT1_0034_H08.b :
BMWN1_0004_C05.b :
BMWN1_0005_F03.b :
BMWN1_0011_B04.b :
BMWN1_0047_D05.b :
BMWN1_0078_G06.b :
BMWN1_0090_E07.b :
SPLT1_0040_G04.b :
BMWN1_0058_G12.b :
BMWN1_0084_C11.b :
BMWN1_0093_A06.b :
BMWN1_0097_G05.b :
BMWN1_0097_H07.b :
SPLT1_0055_G06.b :
BMWN1_0022_E06.b :
BMWN1_0027_G10.b :
BMWN1_0038_A05.b :
BMWN1_0044_B05.b :
BMWN1_0021_D07.b :
SPLT1_0007_G02.b :
SPLT1_0052_F04.b :
SPLT1_0085_B11.b :
SPLT1_0098_C04.b :
BMWN1_0011_D08.b :
BMWN1_0053_F12.b :
BMWN1_0004_C12.b :
BMWN1_0023_A05.b :
BMWN1_0095_D07.b :
SPLT1_0002_B04.b :
SPLT1_0006_F09.b :
SPLT1_0035_A02.b :
SPLT1_0045_G11.b :
BMWN1_0051_G06.b :
BMWN1_0055_A02.b :
BMWN1_0056_B11.b :
BMWN1_0058_F12.b :
BMWN1_0065_F06.b :
BMWN1_0078_C07.b :
BMWN1_0090_A08.b :
BMWN1_0093_G10.b :
SPLT1_0068_H01.b :
BMWN1_0062_C08.b :
BMWN1_0011_H09.b :
SPLT1_0066_D04.b :
SPLT1_0093_D03.b :
SPLT1_0008_F09.b :
BMWN1_0084_E07.b :
BMWN1_0025_D02.b :
BMWN1_0069_H03.b :
BMWN1_0072_E12.b :
BMWN1_0021_H09.b :
BMWN1_0025_H04.b :
BMWN1_0088_A04.b :
BMWN1_0021_A05.b :
SPLT1_0020_D02.b :
SPLT1_0091_G12.b :
BMWN1_0005_A04.b :
BMWN1_0006_G01.b :
BMWN1_0018_F07.b :
BMWN1_0064_D11.b :
BMWN1_0078_A09.b :
BMWN1_0006_F10.b :
BMWN1_0026_H08.b :
BMWN1_0057_B12.b :
BMWN1_0084_F07.b :
BMWN1_0022_H04.b :
BMWN1_0027_E04.b :
BMWN1_0055_E04.b :
BMWN1_0093_A12.b :
SPLT1_0005_A09.b :
SPLT1_0024_H04.b :
BMWN1_0014_E09.b :
BMWN1_0031_C05.b :
BMWN1_0059_B08.b :
SPLT1_0055_G12.b :
SPLT1_0072_G03.b :
BMWN1_0042_A04.b :
SPLT1_0057_D11.b :
SPLT1_0057_H03.b :
SPLT1_0064_B01.b :
SPLT1_0087_B01.b :
BMWN1_0090_G02.b :
BMWN1_0033_H04.b :
BMWN1_0090_B03.b :
BMWN1_0041_C07.b :
SPLT1_0013_C08.b :
BMWN1_0078_B11.b :
BMWN1_0084_F04.b :
BMWN1_0026_C03.b :
BMWN1_0073_A10.b :
BMWN1_0083_G12.b :
BMWN1_0087_E04.b :
BMWN1_0027_A10.b :
BMWN1_0064_C02.b :
BMWN1_0078_C05.b :
SPLT1_0067_C05.b :
SPLT1_0097_E08.b :
BMWN1_0014_H06.b :
BMWN1_0056_H03.b :
BMWN1_0075_F09.b :
BMWN1_0084_B12.b :
BMWN1_0086_C12.b :
SPLT1_0035_H07.b :
SPLT1_0067_H04.b :
BMWN1_0001_E02.b :
BMWN1_0077_D04.b :
SPLT1_0014_C07.b :
SPLT1_0100_H09.b :
BMWN1_0043_C09.b :
BMWN1_0041_C05.b :
BMWN1_0018_F04.b :
BMWN1_0068_F03.b :
BMWN1_0017_D10.b :
BMWN1_0089_A10.b :
BMWN1_0020_E08.b :
BMWN1_0039_F06.b :
BMWN1_0008_H07.b :
BMWN1_0066_B03.b :
HTMT1_0077_E07.b :
SPLT1_0044_A05.b :
BMWN1_0024_H04.b :
BMWN1_0066_E02.b :
ILNT1_0035_H04.b :
SPLT1_0003_D01.b :
SPLT1_0024_G10.b :
BMWN1_0039_F03.b :
BMWN1_0053_G07.b :
BMWN1_0044_B09.b :
BMWN1_0039_D07.b :
BMWN1_0060_E12.b :
CLNT1_0118_H07.b :
OVRT1_0127_A02.b :
BMWN1_0087_A06.b :
BMWN1_0012_H01.b :
BMWN1_0062_H11.b :
BMWN1_0083_A12.b :
SPLT1_0027_B11.b :
SPLT1_0030_E03.b :
BMWN1_0013_C12.b :
BMWN1_0052_C08.b :
BMWN1_0088_A11.b :
BMWN1_0020_C02.b :
BMWN1_0040_A03.b :
BMWN1_0003_H10.b :
BMWN1_0017_C02.b :
BMWN1_0079_E06.b :
BMWN1_0001_D05.b :
BMWN1_0081_E01.b :
BMWN1_0039_F05.b :
BMWN1_0040_E08.b :
BMWN1_0062_B04.b :
BMWN1_0076_H08.b :
BMWN1_0072_B02.b :
SPLT1_0087_D06.b :
SPLT1_0089_B12.b :
BMWN1_0067_B11.b :
BMWN1_0069_G05.b :
ILNT1_0038_F05.b :
SPLT1_0087_C07.b :
BMWN1_0043_F10.b :
BMWN1_0037_B06.b :
BMWN1_0027_C03.b :
BMWN1_0098_C07.b :
BMWN1_0099_B04.b :
BMWN1_0065_B03.b :
BMWN1_0068_C10.b :
BMWN1_0064_B10.b :
BMWN1_0082_B03.b :
BMWN1_0085_F05.b :
BMWN1_0046_A09.b :
BMWN1_0010_A06.b :
BMWN1_0017_B04.b :
BMWN1_0091_C10.b :
BMWN1_0069_E08.b :
BMWN1_0020_F05.b :
BMWN1_0021_H07.b :
BMWN1_0042_A07.b :
BMWN1_0100_H08.b :
BMWN1_0022_G12.b :
BMWN1_0036_B11.b :
BMWN1_0046_C07.b :
BMWN1_0054_E08.b :
BMWN1_0057_A03.b :
BMWN1_0065_E03.b :
BMWN1_0022_C11.b :
BMWN1_0024_D12.b :
BMWN1_0027_H01.b :
BMWN1_0080_B07.b :
BMWN1_0087_A09.b :
BMWN1_0039_F12.b :
BMWN1_0083_E01.b :
SPLT1_0065_B05.b :
BMWN1_0055_A07.b :
BMWN1_0077_D07.b :
BMWN1_0092_B04.b :
BMWN1_0020_A04.b :
BMWN1_0056_E04.b :
BMWN1_0041_A02.b :
BMWN1_0040_B10.b :
ILNT1_0016_H04.b :
BMWN1_0047_C12.b :
BMWN1_0047_H07.b :
BMWN1_0085_A10.b :
BMWN1_0093_A08.b :
BMWN1_0040_D03.b :
BMWN1_0066_B12.b :
BMWN1_0021_A08.b :
BMWN1_0061_C08.b :
BMWN1_0042_E01.b :
BMWN1_0043_D04.b :
BMWN1_0018_G07.b :
BMWN1_0003_G12.b :
BMWN1_0009_C11.b :
BMWN1_0036_C10.b :
BMWN1_0100_E11.b :
BFLT1_0124_D05.b :
BMWN1_0001_C09.b :
BMWN1_0046_H11.b :
BMWN1_0018_F09.b :
BMWN1_0038_H05.b :
BMWN1_0072_E11.b :
BMWN1_0046_E08.b :
BMWN1_0036_B02.b :
BMWN1_0081_G06.b :
BMWN1_0039_G03.b :
BMWN1_0095_G07.b :
BMWN1_0033_B11.b :
BMWN1_0084_B03.b :
BMWN1_0010_F12.b :
BMWN1_0028_B11.b :
BMWN1_0084_G04.b :
BMWN1_0073_H10.b :
BMWN1_0087_G10.b :
BMWN1_0042_A08.b :
BMWN1_0057_C07.b :
BMWN1_0007_D11.b :
BMWN1_0066_D06.b :
BMWN1_0100_B09.b :
BMWN1_0031_D06.b :
BMWN1_0042_G02.b :
BMWN1_0043_H12.b :
SPLT1_0020_B01.b :
BMWN1_0029_F01.b :
BMWN1_0083_B12.b :
BMWN1_0099_H07.b :
BMWN1_0025_H02.b :
BMWN1_0085_E10.b :
BMWN1_0099_H05.b :
BMWN1_0057_H07.b :
BMWN1_0020_C08.b :
BMWN1_0045_H01.b :
BMWN1_0064_H02.b :
BMWN1_0044_E05.b :
BMWN1_0077_A08.b :
BMWN1_0008_F10.b :
BMWN1_0062_C03.b :
BMWN1_0038_F11.b :
BMWN1_0008_F06.b :
BMWN1_0022_H09.b :
SPLT1_0090_D02.b :
BMWN1_0043_C12.b :
BMWN1_0008_A04.b :
SPLT1_0037_E09.b :
BMWN1_0065_E05.b :
BMWN1_0001_G09.b :
BMWN1_0006_A02.b :
BMWN1_0060_F08.b :
BMWN1_0012_C01.b :
BMWN1_0003_E11.b :
BMWN1_0031_E04.b :
BMWN1_0058_H10.b :
BMWN1_0055_D10.b :
BMWN1_0035_E08.b :
BMWN1_0092_B02.b :
BMWN1_0044_F10.b :
BMWN1_0076_H11.b :
BMWN1_0091_C02.b :
SPLT1_0049_B07.b :
BMWN1_0059_C03.b :
BMWN1_0019_H06.b :
BMWN1_0035_F05.b :
BMWN1_0035_B08.b :
BMWN1_0008_D02.b :
BMWN1_0003_E10.b :
BMWN1_0021_E03.b :
BMWN1_0001_A06.b :
BMWN1_0035_H09.b :
BMWN1_0059_C09.b :
SPLT1_0009_G07.b :
BMWN1_0082_G03.b :
BMWN1_0042_A05.b :
BMWN1_0046_A04.b :
SPLT1_0025_E07.b :
BMWN1_0046_D12.b :
BMWN1_0043_E04.b :
BMWN1_0008_B07.b :
SPLT1_0017_F02.b :
BMWN1_0042_B10.b :
BMWN1_0075_H03.b :
BMWN1_0067_B08.b :
BMWN1_0002_G01.b :
BMWN1_0021_E07.b :
SPLT1_0009_F11.b :
BMWN1_0037_B09.b :
BMWN1_0063_F05.b :
BMWN1_0043_D01.b :
BMWN1_0092_H09.b :
BMWN1_0067_E08.b :
BMWN1_0066_D08.b :
BMWN1_0063_H08.b :
BMWN1_0086_G08.b :
BMWN1_0020_A09.b :
BMWN1_0031_B11.b :
BMWN1_0031_A06.b :
SPLT1_0059_C12.b :
TES01_0081_F06.b :
PBL01_0046_F08.b :
TES01_0019_A12.b :
TES01_0048_F12.b :
PCT01_0007_H10.b :
SPLT1_0051_B03.b :
SPLT1_0030_B02.b :
BMWN1_0009_E10.b :
PCT01_0021_B12.b :
BMWN1_0057_B08.b :
PBL01_0040_G02.b :
PBL01_0086_E08.b :
PBL01_0093_C01.b :
SPLT1_0072_C06.b :
PBL01_0027_D04.b :
PBL01_0047_B06.b :
PBL01_0106_H11.b :
PBL01_0027_H08.b :
ADR01_0017_C07.b :
BMWN1_0090_D08.b :
SPLT1_0080_G03.b :
PBL01_0026_A03.b :
BMWN1_0051_C11.b :
SPLT1_0086_G09.b :
BMWN1_0075_E10.b :
SPLT1_0001_F02.b :
PBL01_0071_A12.b :
PBL01_0047_A05.b :
PBL01_0043_H02.b :
PBL01_0077_B02.b :
PBL01_0047_E09.b :
PBL01_0097_A08.b :
PBL01_0013_F05.b :
PBL01_0052_D08.b :
PBL01_0092_A03.b :
PBL01_0059_A04.b :
SPLT1_0057_E12.b :
ILNT1_0065_H03.b :
PBL01_0015_B06.b :
BMWN1_0026_A04.b :
PBL01_0085_E07.b :
BMWN1_0087_C02.b :
BMWN1_0028_F08.b :
BMWN1_0029_F08.b :
BMWN1_0099_D08.b :
BMWN1_0061_A01.b :
BMWN1_0057_H06.b :
PBL01_0053_B10.b :
BMWN1_0018_D06.b :
BMWN1_0053_E04.b :
BMWN1_0034_D10.b :
BMWN1_0012_B07.b :
BMWN1_0018_A05.b :
BMWN1_0005_B06.b :
BMWN1_0050_E07.b :
BMWN1_0072_G06.b :
SPLT1_0028_C02.b :
SPLT1_0056_C06.b :
PBL01_0040_E12.b :
BMWN1_0093_B06.b :
SPLT1_0070_G06.b :
BMWN1_0100_H02.b :
SPLT1_0017_G06.b :
SPLT1_0008_C04.b :
BMWN1_0096_C12.b :
BMWN1_0016_F07.b :
BFLT1_0003_E05.b :
BMWN1_0079_C10.b :
SPLT1_0004_D08.b :
SPLT1_0031_E03.b :
BMWN1_0080_C03.b :
SPLT1_0078_E06.b :
BMWN1_0087_H04.b :
BMWN1_0075_C03.b :
SPL01_0092_G06.b :
OVRT1_0033_D02.b :
BMWN1_0002_B07.b :
SPLT1_0023_C11.b :
BKFL1_0116_D11.b :
DCI01_0050_H02.b :
LVRM1_0005_C10.b :
PBL01_0088_H01.b :
LVRM1_0086_B05.b :
LVRM1_0205_A08.b :
PBL01_0043_C04.b :
PBL01_0033_C03.b :
PBL01_0034_D07.b :
PBL01_0053_C09.b :
LVRM1_0043_A05.b :
LVRM1_0151_H02.b :
PBL01_0041_A10.b :
PBL01_0026_E03.b :
PBL01_0019_B05.b :
PBL01_0005_H07.b :
PBL01_0007_H06.b :
PCT01_0031_C09.b :
PBL01_0029_G10.b :
PBL01_0022_E11.b :
PCT01_0022_G12.b :
PBL01_0030_C04.b :
PCT01_0020_C01.b :
PCT01_0030_D10.b :
PBL01_0018_C06.b :
PCT01_0025_D01.b :
PBL01_0027_C08.b :
PBL01_0078_F07.b :
PBL01_0080_G12.b :
BMWN1_0031_A02.b :
OVRM1_0037_E02.b :
LVRM1_0086_C08.b :
PBL01_0084_B12.b :
PBL01_0039_D11.b :
LVRM1_0164_H11.b :
PBL01_0088_B04.b :
PBL01_0014_H10.b :
PBL01_0096_D11.b :
PBL01_0022_H05.b :
PBL01_0040_H09.b :
PBL01_0066_G01.b :
PBL01_0021_C09.b :
PBL01_0032_H01.b :
PBL01_0038_F01.b :
PCT01_0006_B04.b :
BMWN1_0070_A12.b :
PBL01_0045_E10.b :
PBL01_0050_G12.b :
PBL01_0089_A05.b :
PBL01_0038_A06.b :
BMWN1_0090_D09.b :
PBL01_0043_C07.b :
PBL01_0061_C01.b :
PBL01_0003_H01.b :
PBL01_0029_A07.b :
PBL01_0048_H10.b :
PBL01_0104_F05.b :
PBL01_0085_C01.b :
PBL01_0106_C03.b :
PBL01_0024_E06.b :
PBL01_0035_H01.b :
PBL01_0038_C08.b :
PBL01_0038_D07.b :
PBL01_0040_H07.b :
PBL01_0023_E01.b :
PBL01_0039_B05.b :
PBL01_0039_B06.b :
PBL01_0022_B07.b :
PBL01_0061_B10.b :
PBL01_0019_H10.b :
PBL01_0035_C08.b :
PBL01_0096_D12.b :
PBL01_0011_D01.b :
PBL01_0031_A03.b :
PBL01_0044_H06.b :
PBL01_0021_D09.b :
PBL01_0064_E08.b :
BMWN1_0098_G12.b :
PBL01_0050_D11.b :
ITT01_0088_B05.b :
PBL01_0041_H11.b :
PBL01_0068_F06.b :
PBL01_0073_H04.b :
PBL01_0080_G10.b :
PBL01_0047_B12.b :
PBL01_0019_F06.b :
PBL01_0031_H08.b :
SPLT1_0098_G03.b :
PBL01_0051_D09.b :
PBL01_0022_H01.b :
PBL01_0024_H10.b :
PBL01_0025_H04.b :
PBL01_0030_D05.b :
PBL01_0046_H03.b :
PBL01_0052_D12.b :
PBL01_0076_A02.b :
PBL01_0076_F04.b :
PBL01_0086_A04.b :
PBL01_0096_C10.b :
PBL01_0028_A03.b :
PBL01_0032_C09.b :
PBL01_0045_E05.b :
PBL01_0046_A02.b :
PBL01_0063_H10.b :
PBL01_0096_E04.b :
PBL01_0031_D05.b :
PBL01_0057_D07.b :
SPL01_0054_D12.b :
LVRM1_0008_D08.b :
PBL01_0001_C09.b :
PBL01_0043_A07.b :
PBL01_0103_H10.b :
PBL01_0011_F12.b :
PBL01_0013_H08.b :
PBL01_0043_B07.b :
PBL01_0052_A10.b :
PBL01_0094_B01.b :
PBL01_0094_B10.b :
PBL01_0096_H06.b :
PBL01_0097_G12.b :
PBL01_0047_E06.b :
PBL01_0065_H04.b :
PBL01_0077_E09.b :
PBL01_0099_A01.b :
PBL01_0100_F01.b :
PBL01_0047_F09.b :
PBL01_0049_A07.b :
PBL01_0073_H11.b :
PBL01_0074_A12.b :
PBL01_0083_E04.b :
PBL01_0083_F04.b :
PBL01_0087_B03.b :
PBL01_0022_C06.b :
PBL01_0029_C03.b :
PBL01_0034_G01.b :
LVRM1_0145_F05.b :
SPLT1_0036_H09.b :
BMWN1_0085_G12.b :
PBL01_0001_E11.b :
PBL01_0011_E12.b :
PBL01_0016_B11.b :
PBL01_0100_F10.b :
PBL01_0102_A09.b :
PBL01_0011_H09.b :
PBL01_0103_F06.b :
ADR01_0013_C06.b :
PBL01_0057_C07.b :
PBL01_0057_D06.b :
PBL01_0094_B05.b :
PBL01_0027_F08.b :
BMWN1_0021_B11.b :
PBL01_0106_H06.b :
PBL01_0019_H03.b :
PBL01_0054_B09.b :
PBL01_0054_H02.b :
PBL01_0022_D12.b :
PBL01_0040_A02.b :
PBL01_0053_G06.b :
LVRM1_0107_E09.b :
LVRM1_0140_C10.b :
PBL01_0004_D01.b :
PBL01_0046_E03.b :
PBL01_0092_G04.b :
PBL01_0051_B06.b :
PBL01_0043_F11.b :
PBL01_0049_F03.b :
PBL01_0070_C09.b :
PBL01_0071_E04.b :
PBL01_0008_G07.b :
BMWN1_0066_H11.b :
LVRM1_0122_H01.b :
PBL01_0002_D01.b :
PBL01_0007_C09.b :
PBL01_0101_E03.b :
PBL01_0076_B08.b :
PBL01_0082_F11.b :
BMWN1_0036_A09.b :
LVRM1_0032_E07.b :
PBL01_0004_D10.b :
PBL01_0099_C02.b :
PBL01_0065_E12.b :
PBL01_0088_E05.b :
PBL01_0020_C11.b :
PBL01_0044_F06.b :
BMWN1_0084_H07.b :
PBL01_0098_H10.b :
PBL01_0107_A05.b :
PBL01_0087_G02.b :
LVRM1_0002_G10.b :
PBL01_0005_B07.b :
PBL01_0008_E10.b :
PBL01_0010_F04.b :
BMWN1_0021_E11.b :
SMG01_0061_G03.b :
PBL01_0045_A06.b :
PBL01_0079_C12.b :
SMG01_0101_B04.b :
SPLT1_0014_A07.b :
PBL01_0001_C03.b :
PBL01_0008_H09.b :
SPLT1_0058_B08.b :
PBL01_0053_A07.b :
PBL01_0081_G09.b :
BMWN1_0085_D01.b :
PBL01_0008_H11.b :
PBL01_0073_H12.b :
SMG01_0038_D04.b :
BMWN1_0009_A01.b :
PBL01_0037_D08.b :
PBL01_0026_E10.b :
BMWN1_0023_B04.b :
LVRM1_0153_B06.b :
PBL01_0073_F09.b :
BMWN1_0064_H08.b :
BMWN1_0070_E03.b :
PBL01_0008_C09.b :
BMWN1_0099_A11.b :
SPLT1_0005_G09.b :
BFLT1_0115_C10.b :
BFLT1_0116_G01.b :
BMWN1_0093_B08.b :
BMWN1_0037_E09.b :
BMWN1_0079_D07.b :
BMWN1_0093_D01.b :
BMWN1_0012_C12.b :
PBL01_0002_E09.b :
PBL01_0054_H11.b :
PBL01_0029_B03.b :
BFLT1_0003_A12.b :
OVRT1_0017_G01.b :
OVRT1_0011_B11.b :
PBL01_0001_D04.b :
OVRT1_0143_D02.b :
SPL01_0063_E01.b :
OVRT1_0148_C11.b :
MLN01_0057_H11.b :
SPL01_0070_H09.b :
SPLT1_0017_H07.b :
SPL01_0046_E06.b :
SPL01_0071_A12.b :
SPL01_0103_G11.b :
SPL01_0021_C03.b :
SPL01_0033_D12.b :
SPL01_0064_D06.b :
SPL01_0093_E05.b :
SPL01_0098_H10.b :
SPL01_0062_G03.b :
SPL01_0095_H05.b :
PBL01_0012_E10.b :
PBL01_0044_H09.b :
SPL01_0047_D07.b :
SPL01_0096_A01.b :
SPL01_0065_B06.b :
SPL01_0048_B09.b :
SPL01_0038_C06.b :
SPL01_0091_E12.b :
SPL01_0071_H05.b :
OVRT1_0093_G06.b :
SPL01_0105_E06.b :
SPL01_0008_F06.b :
SPL01_0020_B06.b :
SPL01_0057_B01.b :
OVRT1_0129_C10.b :
SPL01_0008_A06.b :
SPL01_0018_C03.b :
PBL01_0024_G04.b :
OVRT1_0141_B11.b :
SPL01_0008_A09.b :
SPL01_0046_F03.b :
SPL01_0077_C10.b :
SPL01_0035_H08.b :
SPL01_0034_B10.b :
SPL01_0094_C03.b :
SPL01_0044_C01.b :
SPL01_0076_A05.b :
SPL01_0022_E06.b :
SPL01_0005_C04.b :
BMWN1_0055_D12.b :
SPLT1_0035_B01.b :
SPL01_0041_G02.b :
SPL01_0076_H08.b :
SPL01_0093_B10.b :
BMWN1_0058_G09.b :
SPL01_0093_B01.b :
PBL01_0005_H11.b :
SPL01_0008_A08.b :
SPL01_0008_H04.b :
BMWN1_0047_A07.b :
PCT01_0030_E06.b :
PBL01_0017_G10.b :
PCT01_0029_G06.b :
BMWN1_0041_F05.b :
TES01_0047_B11.b :
PCT01_0023_C04.b :
PCT01_0003_G01.b :
PCT01_0021_E07.b :
PCT01_0023_A05.b :
PCT01_0023_F11.b :
PCT01_0021_C09.b :
PCT01_0036_G01.b :
SKNB1_0081_G07.b :
PCT01_0008_A09.b :
PCT01_0012_D06.b :
PBL01_0080_C07.b :
BMWN1_0058_F06.b :
BMWN1_0006_H08.b :
PCT01_0007_H07.b :
BMWN1_0004_G01.b :
BMWN1_0011_G06.b :
BFLT1_0028_C05.b :
SPL01_0039_D02.b :
LVRM1_0065_G12.b :
LVRM1_0179_B02.b :
SPL01_0008_B09.b :
PBL01_0047_E01.b :
TES01_0010_H03.b :
PCT01_0008_A03.b :
PCT01_0017_A08.b :
PBL01_0094_F01.b :
PBL01_0061_D09.b :
PCT01_0004_H03.b :
PCT01_0017_A04.b :
PCT01_0023_F03.b :
PCT01_0016_A09.b :
PCT01_0035_F12.b :
PCT01_0002_G01.b :
PCT01_0017_A09.b :
PCT01_0008_C02.b :
PCT01_0017_A11.b :
PCT01_0011_H04.b :
PCT01_0023_E03.b :
PCT01_0006_H03.b :
PCT01_0006_C04.b :
PCT01_0028_G02.b :
PCT01_0028_C11.b :
PCT01_0028_B09.b :
PCT01_0019_H04.b :
BMWN1_0041_A09.b :
PCT01_0032_H02.b :
PCT01_0034_E02.b :
PBL01_0006_B12.b :
PBL01_0083_F02.b :
BMWN1_0002_H09.b :
PBL01_0012_G01.b :
PBL01_0033_B08.b :
PBL01_0073_A04.b :
PBL01_0069_A12.b :
PBL01_0074_D05.b :
PBL01_0049_A01.b :
PBL01_0025_B01.b :
PBL01_0075_H03.b :
PBL01_0031_G07.b :
PBL01_0069_B12.b :
PBL01_0069_C06.b :
PBL01_0106_F11.b :
BMWN1_0066_F07.b :
BMWN1_0013_A11.b :
BMWN1_0046_B06.b :
BMWN1_0092_B01.b :
BMWN1_0100_E06.b :
BMWN1_0024_C01.b :
BMWN1_0041_D02.b :
BMWN1_0005_G02.b :
BMWN1_0045_F03.b :
BMWN1_0098_G11.b :
SPL01_0014_C07.b :
SPL01_0099_F06.b :
SPL01_0027_G03.b :
PBL01_0003_C04.b :
BMWN1_0058_H07.b :
BMWN1_0003_D02.b :
BMWN1_0045_D12.b :
BMWN1_0043_H06.b :
BMWN1_0085_G11.b :
PBL01_0076_E10.b :
LVRM1_0011_G09.b :
BMWN1_0032_E11.b :
PCT01_0006_H11.b :
PBL01_0064_F05.b :
PBL01_0051_H01.b :
PCT01_0019_G01.b :
PCT01_0002_A02.b :
PCT01_0030_B08.b :
PCT01_0020_A09.b :
PCT01_0021_G09.b :
PCT01_0019_H02.b :
PCT01_0011_H06.b :
PCT01_0012_H03.b :
PCT01_0004_D12.b :
PCT01_0024_C04.b :
PCT01_0033_F07.b :
PCT01_0034_D11.b :
PCT01_0023_G04.b :
PCT01_0016_E07.b :
PCT01_0034_A02.b :
PCT01_0007_E06.b :
PBL01_0050_A11.b :
PCT01_0008_H01.b :
PBL01_0038_F06.b :
PBL01_0032_C04.b :
PBL01_0105_B10.b :
PBL01_0032_G02.b :
PBL01_0075_E02.b :
PBL01_0087_F04.b :
PBL01_0105_A10.b :
PBL01_0025_D02.b :
PBL01_0007_A09.b :
PBL01_0056_F09.b :
PBL01_0072_F05.b :
PBL01_0042_F04.b :
PBL01_0106_F10.b :
PBL01_0025_C09.b :
PBL01_0060_F06.b :
LVRM1_0140_A05.b :
OVRT1_0041_H10.b :
SPL01_0056_E04.b :
OVRT1_0007_E03.b :
SPL01_0103_E06.b :
SPL01_0077_B04.b :
SPL01_0024_E07.b :
SPL01_0085_A02.b :
PCT01_0031_D10.b :
PCT01_0009_B02.b :
PCT01_0010_B01.b :
PCT01_0009_G06.b :
PCT01_0035_B02.b :
PCT01_0032_E12.b :
PCT01_0014_H07.b :
PCT01_0010_G02.b :
PCT01_0003_B09.b :
PCT01_0019_G10.b :
PCT01_0014_H01.b :
PCT01_0016_H07.b :
PCT01_0014_A05.b :
PCT01_0014_D05.b :
PCT01_0030_G02.b :
PCT01_0033_F05.b :
PCT01_0020_C04.b :
PCT01_0002_D07.b :
PCT01_0003_D05.b :
PCT01_0029_B09.b :
PCT01_0014_H05.b :
PCT01_0017_F11.b :
PCT01_0018_F04.b :
PCT01_0034_B12.b :
PCT01_0001_C10.b :
PCT01_0036_H12.b :
PCT01_0021_B03.b :
PCT01_0036_B06.b :
PCT01_0020_E05.b :
PCT01_0031_G04.b :
PCT01_0036_F02.b :
PCT01_0013_C07.b :
PBL01_0031_E07.b :
PCT01_0034_F08.b :
PBL01_0021_H06.b :
PBL01_0092_C11.b :
PCT01_0013_F03.b :
PBL01_0059_E04.b :
SPL01_0028_G02.b :
PCT01_0011_E09.b :
PCT01_0024_D02.b :
BMWN1_0078_B08.b :
BMWN1_0044_C05.b :
BMWN1_0073_G03.b :
BMWN1_0060_H03.b :
PBL01_0062_G12.b :
PCT01_0001_C05.b :
PCT01_0003_E02.b :
PCT01_0010_C08.b :
PCT01_0027_F09.b :
PCT01_0032_F06.b :
BMWN1_0058_H01.b :
PCT01_0029_A07.b :
PCT01_0032_C12.b :
PCT01_0007_A06.b :
PCT01_0003_F10.b :
PCT01_0010_D05.b :
PCT01_0007_H12.b :
PCT01_0036_B01.b :
SKNB1_0081_H07.b :
BMWN1_0066_A11.b :
PCT01_0013_B06.b :
BMWN1_0099_F12.b :
PBL01_0008_E01.b :
LVRM1_0113_D06.b :
PCT01_0024_B11.b :
BMWN1_0055_H11.b :
BMWN1_0022_A09.b :
PCT01_0004_A10.b :
PCT01_0004_B08.b :
PBL01_0074_C07.b :
SPLT1_0055_E07.b :
SPLT1_0077_D08.b :
SPLT1_0087_F06.b :
PCT01_0002_C05.b :
BMWN1_0051_G10.b :
PCT01_0024_D11.b :
PCT01_0004_A09.b :
PCT01_0028_A07.b :
PBL01_0026_B08.b :
PBL01_0061_C05.b :
PBL01_0042_F05.b :
PBL01_0105_B04.b :
PBL01_0011_G08.b :
PBL01_0024_C07.b :
PBL01_0018_G08.b :
PBL01_0052_A07.b :
PBL01_0041_H07.b :
PBL01_0065_B01.b :
PBL01_0102_E10.b :
SPL01_0042_B09.b :
SPL01_0060_G01.b :
SPL01_0029_H11.b :
PBL01_0038_D03.b :
PBL01_0036_B06.b :
PBL01_0075_A10.b :
PBL01_0080_F12.b :
PBL01_0096_G04.b :
PBL01_0049_C05.b :
PBL01_0021_F11.b :
PBL01_0057_C08.b :
PCT01_0030_A09.b :
PBL01_0037_G02.b :
PBL01_0077_C09.b :
PBL01_0033_G08.b :
PBL01_0076_H12.b :
PBL01_0014_G03.b :
PBL01_0074_H09.b :
PBL01_0070_F07.b :
PBL01_0099_B06.b :
PBL01_0056_F05.b :
PBL01_0058_A04.b :
PBL01_0069_E09.b :
PBL01_0030_G10.b :
PBL01_0060_D06.b :
PBL01_0104_B03.b :
PBL01_0105_D05.b :
PBL01_0049_D12.b :
PBL01_0013_C07.b :
LVRM1_0112_E12.b :
LVRM1_0143_H07.b :
PBL01_0002_G10.b :
SPL01_0097_B09.b :
PBL01_0033_D09.b :
SPL01_0090_D06.b :
SPL01_0081_G12.b :
SPL01_0059_D05.b :
SPL01_0052_H04.b :
SPL01_0032_G05.b :
SPL01_0044_B04.b :
PCT01_0007_A03.b :
PCT01_0022_A03.b :
PCT01_0026_B04.b :
PCT01_0031_B08.b :
PCT01_0010_C03.b :
PCT01_0014_G06.b :
PCT01_0003_G07.b :
PCT01_0032_B12.b :
PCT01_0033_B11.b :
PCT01_0014_C12.b :
PCT01_0018_B12.b :
PCT01_0022_A02.b :
PCT01_0023_E01.b :
PCT01_0035_B01.b :
PCT01_0031_F04.b :
PCT01_0022_D03.b :
PCT01_0021_F06.b :
PCT01_0023_B12.b :
PBL01_0074_B01.b :
PBL01_0104_C10.b :
PBL01_0030_C03.b :
PCT01_0003_B07.b :
PCT01_0005_A10.b :
PBL01_0069_A09.b :
LVRM1_0024_G06.b :
SPL01_0086_D08.b :
SPL01_0038_A10.b :
SPL01_0023_H06.b :
PCT01_0006_B08.b :
OVRM1_0081_F02.b :
PCT01_0036_A02.b :
PCT01_0003_H02.b :
PCT01_0006_E04.b :
PCT01_0032_A05.b :
PCT01_0019_E06.b :
PCT01_0025_D06.b :
PBL01_0014_C06.b :
PBL01_0066_A09.b :
PBL01_0013_E07.b :
LVRM1_0096_C11.b :
PBL01_0028_G09.b :
PBL01_0029_B06.b :
PBL01_0029_B07.b :
PBL01_0067_H06.b :
PBL01_0026_E06.b :
PBL01_0058_B03.b :
PBL01_0102_D04.b :
PCT01_0009_G11.b :
PBL01_0044_C01.b :
PCT01_0033_E01.b :
PBL01_0039_C02.b :
PCT01_0009_B06.b :
PCT01_0014_E06.b :
PCT01_0029_E05.b :
PCT01_0012_G12.b :
SPL01_0050_D12.b :
PBL01_0072_A10.b :
PBL01_0035_A09.b :
PBL01_0067_H10.b :
PBL01_0028_B01.b :
PBL01_0080_B10.b :
PBL01_0096_D10.b :
PBL01_0070_A09.b :
PBL01_0013_B02.b :
PBL01_0073_D11.b :
PBL01_0046_D07.b :
PBL01_0073_A12.b :
PBL01_0049_B05.b :
PBL01_0100_G09.b :
PBL01_0075_G02.b :
LVRM1_0171_C01.b :
PBL01_0087_C11.b :
PBL01_0096_G12.b :
LVRM1_0150_G11.b :
PBL01_0057_A01.b :
PBL01_0078_E09.b :
LVRM1_0006_F04.b :
PBL01_0002_F08.b :
SPL01_0045_E04.b :
SPL01_0080_D07.b :
SPL01_0034_D07.b :
SPL01_0103_B04.b :
SPL01_0041_F02.b :
SPL01_0006_A01.b :
SPL01_0094_E06.b :
SPL01_0105_B12.b :
PCT01_0008_B02.b :
PCT01_0002_C04.b :
PCT01_0009_F10.b :
PCT01_0029_H12.b :
PCT01_0004_B02.b :
PCT01_0005_D09.b :
PCT01_0006_A06.b :
PCT01_0008_G10.b :
PBL01_0019_F04.b :
BMWN1_0081_C02.b :
PCT01_0014_D03.b :
PCT01_0025_E10.b :
PCT01_0001_D10.b :
PCT01_0006_D12.b :
PCT01_0023_D06.b :
PCT01_0012_C06.b :
PCT01_0008_G04.b :
SPL01_0102_G03.b :
PBL01_0003_F12.b :
PCT01_0030_D07.b :
PCT01_0022_C10.b :
PCT01_0030_D12.b :
PCT01_0025_C02.b :
PCT01_0026_A08.b :
PCT01_0005_D04.b :
PCT01_0028_A06.b :
PCT01_0032_B11.b :
PCT01_0030_E11.b :
PCT01_0007_C05.b :
PCT01_0025_B06.b :
PCT01_0036_G04.b :
PCT01_0024_H02.b :
PCT01_0014_F09.b :
PCT01_0036_D06.b :
PCT01_0020_G01.b :
PCT01_0031_C04.b :
PCT01_0024_F07.b :
PCT01_0016_C06.b :
PCT01_0022_C08.b :
PBL01_0085_G02.b :
PCT01_0013_A04.b :
PCT01_0020_G11.b :
PCT01_0007_E05.b :
PCT01_0010_G11.b :
PCT01_0013_E12.b :
PCT01_0026_G11.b :
PCT01_0017_H05.b :
PCT01_0034_B05.b :
PCT01_0012_C07.b :
PCT01_0004_B03.b :
PCT01_0018_A11.b :
PBL01_0050_H11.b :
PBL01_0023_H11.b :
PBL01_0094_H06.b :
SPL01_0042_B04.b :
SPL01_0068_B02.b :
PCT01_0008_B06.b :
PCT01_0007_B06.b :
PBL01_0089_C08.b :
PBL01_0038_A03.b :
PCT01_0009_C05.b :
PBL01_0089_F06.b :
PBL01_0056_G02.b :
PBL01_0030_H03.b :
BMWN1_0066_C12.b :
PCT01_0022_H11.b :
BMWN1_0083_A08.b :
PCT01_0023_D05.b :
PCT01_0025_D05.b :
PCT01_0021_H03.b :
SPL01_0030_E06.b :
PBL01_0104_A10.b :
PBL01_0072_F10.b :
PBL01_0081_E07.b :
PBL01_0084_C08.b :
SPL01_0010_H07.b :
PCT01_0017_D01.b :
PBL01_0017_C02.b :
BMWN1_0083_A09.b :
SPLT1_0021_E04.b :
PCT01_0021_F04.b :
PCT01_0029_D05.b :
PCT01_0016_C01.b :
SPLT1_0061_A07.b :
PCT01_0011_F06.b :
PBL01_0019_D06.b :
SPL01_0017_E06.b :
BMWN1_0014_A01.b :
PCT01_0034_B03.b :
PCT01_0032_C03.b :
PCT01_0035_F01.b :
PCT01_0003_C06.b :
PCT01_0028_A04.b :
PCT01_0005_D03.b :
SPL01_0041_G09.b :
PCT01_0011_F09.b :
BMWN1_0084_B05.b :
SPLT1_0055_E09.b :
PBL01_0090_G09.b :
PBL01_0104_C06.b :
PCT01_0001_G04.b :
PCT01_0018_D02.b :
HTMT1_0093_A06.b :
PCT01_0021_G04.b :
PCT01_0026_G01.b :
PCT01_0008_C07.b :
PCT01_0034_H08.b :
PBL01_0082_D12.b :
PBL01_0019_D02.b :
PBL01_0052_B12.b :
PCT01_0006_B03.b :
PCT01_0025_G12.b :
PBL01_0003_H03.b :
SPLT1_0056_G11.b :
SPLT1_0042_C03.b :
SPLT1_0077_G07.b :
BMWN1_0095_D01.b :
PBL01_0058_A12.b :
SPL01_0060_E09.b :
SPL01_0092_C03.b :
PBL01_0012_B11.b :
PBL01_0032_E07.b :
PBL01_0002_C03.b :
SPL01_0102_F09.b :
PBL01_0062_G04.b :
BMWN1_0065_D11.b :
PBL01_0038_D11.b :
PBL01_0038_A07.b :
SPLT1_0058_H11.b :
PCT01_0001_D09.b :
PBL01_0048_A03.b :
PBL01_0075_C10.b :
PBL01_0030_D06.b :
BMWN1_0099_E10.b :
BMWN1_0073_E02.b :
BMWN1_0051_H09.b :
BMWN1_0054_D11.b :
SPL01_0077_C11.b :
PBL01_0045_A09.b :
BMWN1_0066_E10.b :
PBL01_0023_F12.b :
BMWN1_0086_H07.b :
PBL01_0024_G01.b :
BMWN1_0055_A01.b :
SPLT1_0084_H11.b :
SPLT1_0022_C12.b :
PBL01_0061_A11.b :
BMWN1_0059_F10.b :
SPLT1_0088_B02.b :
PBL01_0046_A08.b :
SPLT1_0025_A11.b :
PBL01_0045_D12.b :
PBL01_0019_B12.b :
BMWN1_0046_G04.b :
BMWN1_0068_A01.b :
BMWN1_0059_D10.b :
PBL01_0041_G10.b :
PBL01_0009_B06.b :
SPLT1_0063_D07.b :
PCT01_0021_A04.b :
PBL01_0049_D08.b :
PBL01_0090_E02.b :
SPLT1_0067_C08.b :
SPLT1_0098_B11.b :
PBL01_0052_G11.b :
SPLT1_0019_F11.b :
PCT01_0017_C07.b :
SPLT1_0075_C01.b :
SPLT1_0032_D03.b :
BKFL1_0086_F04.b :
SPLT1_0093_D01.b :
SPLT1_0058_G06.b :
BMWN1_0093_E08.b :
SPLT1_0049_B01.b :
BMWN1_0012_B10.b :
SPLT1_0009_A12.b :
20110601C-001127 : GATAACTGGCTTGTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGT
---------+---------+---------+---------+---------+---------+ 64
PBL01_0068_D07.b : gataactggcttgtggcggccaagcgttcatagcgacgtcgctttttgatccttcgatgt
PBL01_0034_H06.b :
PBL01_0060_F08.b :
SPL01_0063_E07.b :
LVRM1_0066_H11.b :
SPL01_0089_B01.b :
PST01_0053_F09.b :
TES01_0010_A01.b :
SKNB1_0083_A06.b :
TES01_0105_E04.b :
PST01_0013_G10.b :
PCT01_0032_G03.b :
PCT01_0014_D08.b :
PBL01_0030_D07.b :
PBL01_0054_B01.b :
SPLT1_0001_D03.b :
BMWN1_0049_C06.b :
BMWN1_0044_G07.b :
SPL01_0020_F08.b :
PCT01_0029_A02.b :
PBL01_0022_E07.b :
BMWN1_0040_G08.b :
SPLT1_0048_E12.b :
BMWN1_0046_E03.b :
BMWN1_0045_H12.b :
BMWN1_0090_D04.b :
SPL01_0088_C04.b :
BMWN1_0041_D05.b :
BMWN1_0099_E06.b :
BMWN1_0045_H02.b :
SPLT1_0090_G06.b :
PCT01_0018_G11.b :
BMWN1_0068_D01.b :
BMWN1_0088_B07.b :
BMWN1_0038_A11.b :
SPLT1_0081_B01.b :
SPLT1_0008_D08.b :
PBL01_0071_F09.b :
BMWN1_0027_E12.b :
PBL01_0089_D04.b :
SPLT1_0012_F11.b :
ILNT1_0010_F04.b :
BMWN1_0013_F03.b :