
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001552

Length: 1,461

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUBBpolyubiquitin-B precursor [Homo sapiens]. 448e-126O
Contig/Assembly ProteinUBCpolyubiquitin-C [Homo sapiens]. 445e-125
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1512e-36O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1512e-36O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1512e-36O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinNEDD8NEDD8 precursor [Homo sapiens]. 96.36e-20O
Contig/Assembly ProteinUBDubiquitin D [Homo sapiens]. 84.72e-16O
Contig/Assembly ProteinISG15ubiquitin-like protein ISG15 precursor [Homo sapiens]. 774e-14O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUbbpolyubiquitin-B [Mus musculus]. 445e-125O
Contig/Assembly ProteinUbcpolyubiquitin-C [Mus musculus]. 445e-125O
Contig/Assembly ProteinUba52ubiquitin-60S ribosomal protein L40 [Mus musculus]. 1511e-36O
Contig/Assembly ProteinRps27aubiquitin-40S ribosomal protein S27a precursor [Mus musculus]. 1511e-36O
Contig/Assembly ProteinRps27aubiquitin-40S ribosomal protein S27a precursor [Mus musculus]. 1511e-36O
Contig/Assembly ProteinGm7866PREDICTED: ubiquitin-like protein ISG15-like [Mus musculus]. 1511e-36O
Contig/Assembly ProteinGm7866PREDICTED: ubiquitin-like protein ISG15-like [Mus musculus]. 1511e-36O
Contig/Assembly ProteinGm8430PREDICTED: hypothetical protein LOC667035 [Mus musculus]. 1495e-36O
Contig/Assembly ProteinGm8430PREDICTED: hypothetical protein LOC667035 [Mus musculus]. 1489e-36O
Contig/Assembly ProteinGm4802PREDICTED: hypothetical protein LOC216818 [Mus musculus]. 1081e-23

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 1 [Canis familiaris]. 446e-125O
Contig/Assembly ProteinLOC610457PREDICTED: similar to CG11624-PA, isoform A [Canis familiaris]. 445e-125O
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 3 [Canis familiaris]. 3011e-81O
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 2 [Canis familiaris]. 2842e-76O
Contig/Assembly ProteinLOC608887PREDICTED: similar to polyubiquitin [Canis familiaris]. 1643e-40O
Contig/Assembly ProteinLOC474599PREDICTED: similar to ubiquitin and ribosomal protein S27a precursor [Canis familiaris]. 1551e-37O
Contig/Assembly ProteinLOC610074PREDICTED: similar to ubiquitin B precursor [Canis familiaris]. 1526e-37O
Contig/Assembly ProteinUB-RPL40hypothetical protein LOC612529 [Canis lupus familiaris]. 1512e-36O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Canis lupus familiaris]. 1511e-36O
Contig/Assembly ProteinLOC481020PREDICTED: similar to ubiquitin and ribosomal protein S27a precursor [Canis familiaris]. 1464e-35O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC281370polyubiquitin-B [Bos taurus]. 446e-125O
Contig/Assembly ProteinUBCpolyubiquitin-C [Bos taurus]. 445e-125
Contig/Assembly ProteinLOC100296593PREDICTED: Os05g0242100-like [Bos taurus]. 3225e-88O
Contig/Assembly ProteinLOC100296593PREDICTED: Os05g0242100-like [Bos taurus]. 3225e-88O
Contig/Assembly ProteinLOC100335189PREDICTED: Os05g0242100-like [Bos taurus]. 2672e-71
Contig/Assembly ProteinLOC100138493PREDICTED: Os05g0242100-like [Bos taurus]. 2594e-69O
Contig/Assembly ProteinLOC783718PREDICTED: ubiquitin B-like, partial [Bos taurus]. 1603e-39O
Contig/Assembly ProteinLOC783718PREDICTED: ubiquitin B-like [Bos taurus]. 1527e-37O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 [Bos taurus]. 1512e-36O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a [Bos taurus]. 1512e-36O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUBBubiquitin [Sus scrofa]. 448e-126O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 2 [Sus scrofa]. 445e-125O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 5 [Sus scrofa]. 445e-125O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 4 [Sus scrofa]. 445e-125O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 3 [Sus scrofa]. 445e-125O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 1 [Sus scrofa]. 445e-125O
Contig/Assembly ProteinLOC100627098PREDICTED: hypothetical protein LOC100627098 [Sus scrofa]. 416e-116O
Contig/Assembly ProteinLOC100514637PREDICTED: ubiquitin-40S ribosomal protein S27a-like [Sus scrofa]. 1511e-36O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 [Sus scrofa]. 1518e-37O
Contig/Assembly ProteinLOC100514637PREDICTED: ubiquitin-40S ribosomal protein S27a-like [Sus scrofa]. 1511e-36O

Assembly Members: 623      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010051A07AMP01_0051_A07.bBW958590 AK399439
HTMT10068A06HTMT1_0068_A06.bFS669041 AK392357
ITT010103F07ITT01_0103_F07.bBW985192 AK231596
LVR010067F09LVR01_0067_F09.bBP446062 AK232547
MLN010014E03MLN01_0014_E03.b  AK346579
TCH010030E05TCH01_0030_E05.bCJ024668 AK399318


SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-001552 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0030_E05.b : cgtaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0041_D05.b :
ITT01_0092_B02.b :
MLN01_0103_A06.b :
ILNT1_0057_C06.b :
AMP01_0051_A07.b : nnggagatanantaagcgtatcttgggggctgctcxx
ITT01_0003_B05.b :
PBL01_0049_B11.b :
SMG01_0042_D06.b :
THY01_0004_E09.b :
OVRT1_0028_E08.b :
MLN01_0051_B08.b :
UTR01_0043_D04.b :
ITT01_0092_F12.b :
MLN01_0076_D10.b :
MLN01_0100_H05.b :
ITT01_0025_F10.b :
ITT01_0037_H06.b :
MLN01_0086_G11.b :
MLN01_0050_H03.b :
LVRM1_0071_C06.b :
BMWN1_0018_A04.b :
BMWN1_0038_E02.b :
CBLT1_0073_B10.b :
HTMT1_0145_H02.b :
BMWN1_0030_E12.b :
HTMT1_0144_A05.b :
CBLT1_0093_C12.b :
BMWN1_0081_G12.b :
CBLT1_0023_E12.b :
LNG01_0009_A04.b :
BMWN1_0085_C01.b :
HTMT1_0091_E12.b :
SPLT1_0067_F11.b :
CBLT1_0014_A02.b :
CBLT1_0034_A05.b :
HTMT1_0068_A06.b :
SPLT1_0093_G08.b :
ILNT1_0019_A04.b :
BMWN1_0008_B08.b :
BMWN1_0033_F09.b :
CLNT1_0010_F02.b :
BMWN1_0073_C06.b :
CBLT1_0076_D08.b :
BMWN1_0099_C06.b :
BMWN1_0073_B05.b :
CBLT1_0087_H11.b :
CBLT1_0031_C05.b :
CBLT1_0076_B07.b :
ILNT1_0048_D04.b :
BMWN1_0084_G08.b :
HTMT1_0040_D03.b :
BMWN1_0064_F03.b :
BMWN1_0007_A02.b :
BMWN1_0091_E03.b :
HTMT1_0022_H02.b :
HTMT1_0077_C01.b :
HTMT1_0118_C05.b :
HTMT1_0150_A03.b :
BMWN1_0043_D11.b :
ILNT1_0091_E02.b :
CBLT1_0017_C03.b :
BMWN1_0086_B03.b :
CBLT1_0072_D08.b :
HTMT1_0025_F04.b :
SPLT1_0053_E06.b :
CBLT1_0027_E05.b :
HTMT1_0078_F02.b :
BMWN1_0085_E02.b :
CBLT1_0015_E07.b :
BMWN1_0085_B12.b :
BMWN1_0059_A10.b :
BMWN1_0059_C04.b :
CBLT1_0036_A03.b :
HTMT1_0121_C11.b :
CBLT1_0045_D03.b :
ITT01_0038_E01.b :
HTMT1_0041_B11.b :
HTMT1_0024_G08.b :
ILNT1_0021_B08.b :
BMWN1_0041_B06.b :
HTMT1_0097_A03.b :
HTMT1_0061_D09.b :
HTMT1_0111_G03.b :
CBLT1_0048_H06.b :
SPLT1_0089_A10.b :
ILNT1_0053_F12.b :
HTMT1_0051_H01.b :
CBLT1_0045_E08.b :
HTMT1_0139_D12.b :
HTMT1_0055_G09.b :
SPLT1_0091_B07.b :
ILNT1_0040_D08.b :
HTMT1_0051_H12.b :
HTMT1_0099_A07.b :
ILNT1_0021_E08.b :
LNG01_0070_H12.b :
HTMT1_0140_C01.b :
BMWN1_0035_B06.b :
ILNT1_0064_E08.b :
ILNT1_0100_A12.b :
CBLT1_0037_C03.b :
ILNT1_0016_B10.b :
BMWN1_0090_B11.b :
HTMT1_0062_F09.b :
SPLT1_0055_C12.b :
UTR01_0088_C02.b :
CBLT1_0070_H11.b :
HTMT1_0129_F10.b :
CBLT1_0069_D09.b :
ILNT1_0070_G07.b :
BMWN1_0022_G10.b :
HTMT1_0087_D12.b :
SPLT1_0002_E06.b :
BMWN1_0034_D01.b :
CBLT1_0035_G03.b :
ILNT1_0010_A07.b :
MLN01_0052_D05.b :
CBLT1_0005_F09.b :
CBLT1_0011_F05.b :
CBLT1_0045_B04.b :
CBLT1_0033_D08.b :
CBLT1_0012_C04.b :
HTMT1_0015_F05.b :
ILNT1_0061_H04.b :
SPLT1_0041_E01.b :
BMWN1_0084_E10.b :
HTMT1_0137_E02.b :
CBLT1_0037_F09.b :
CBLT1_0004_F11.b :
HTMT1_0019_C03.b :
BMWN1_0088_D12.b :
HTMT1_0051_E02.b :
BMWN1_0019_H03.b :
HTMT1_0134_A10.b :
LNG01_0105_A07.b :
CBLT1_0060_H05.b :
ILNT1_0100_C11.b :
HTMT1_0018_E09.b :
HTMT1_0120_H06.b :
HTMT1_0045_E10.b :
CBLT1_0040_C09.b :
UTR01_0103_C11.b :
SPLT1_0042_F11.b :
LNG01_0086_F01.b :
ITT01_0033_H05.b :
OVRM1_0149_D03.b :
UTR01_0074_E07.b :
LVRM1_0019_A03.b :
LVRM1_0108_H08.b :
OVR01_0077_E12.b :
LNG01_0019_A11.b :
SPL01_0022_H11.b :
UTR01_0002_C12.b :
UTR01_0028_H09.b :
UTR01_0028_H04.b :
MLN01_0091_C10.b :
UTR01_0001_G04.b :
UTR01_0041_H11.b :
UTR01_0007_F03.b :
UTR01_0007_C04.b :
UTR01_0026_F02.b :
UTR01_0030_D11.b :
UTR01_0020_G01.b :
UTR01_0026_B05.b :
UTR01_0009_E04.b :
UTR01_0030_H07.b :
UTR01_0031_G06.b :
UTR01_0042_D06.b :
THY01_0047_A12.b :
UTR01_0041_F06.b :
UTR01_0019_D10.b :
CLNT1_0104_A01.b :
UTR01_0015_C10.b :
UTR01_0042_D05.b :
UTR01_0039_B03.b :
UTR01_0018_B03.b :
UTR01_0021_E06.b :
MLN01_0054_E11.b :
UTR01_0059_F10.b :
LNG01_0033_D08.b :
UTR01_0033_D10.b :
UTR01_0003_H03.b :
UTR01_0037_G03.b :
PBL01_0014_G12.b :
ITT01_0011_A12.b :
ITT01_0007_G10.b :
ITT01_0103_F07.b :
ITT01_0103_H04.b :
ITT01_0012_H04.b :
ITT01_0080_F12.b :
ITT01_0023_C12.b :
ITT01_0094_A07.b :
ITT01_0070_D07.b :
ITT01_0013_D03.b :
ITT01_0049_C07.b :
ITT01_0023_F08.b :
ITT01_0088_A03.b :
ITT01_0032_D02.b :
ITT01_0069_G07.b :
PBL01_0031_G06.b :
PBL01_0106_A09.b :
ITT01_0035_A05.b :
ITT01_0023_H07.b :
ITT01_0025_D06.b :
ITT01_0067_C06.b :
ITT01_0055_D12.b :
ITT01_0076_E01.b :
MLN01_0056_D05.b :
ITT01_0043_G12.b :
ITT01_0102_A01.b :
UTR01_0058_E01.b :
UTR01_0102_E07.b :
MLN01_0057_H01.b :
MLN01_0104_A09.b :
ITT01_0005_F01.b :
ITT01_0053_A07.b :
ITT01_0062_F01.b :
ITT01_0041_D07.b :
ITT01_0053_A08.b :
ITT01_0065_B02.b :
HTMT1_0087_C12.b :
MLN01_0022_B12.b :
MLN01_0035_H02.b :
CLNT1_0059_E06.b :
MLN01_0001_D10.b :
MLN01_0015_F02.b :
MLN01_0059_A09.b :
MLN01_0059_F12.b :
MLN01_0063_F01.b :
UTR01_0105_C10.b :
ITT01_0072_F09.b :
UTR01_0082_E04.b :
UTR01_0084_A07.b :
UTR01_0081_D10.b :
UTR01_0091_B11.b :
UTR01_0098_H04.b :
LNG01_0024_D01.b :
MLN01_0001_C06.b :
MLN01_0086_A06.b :
ITT01_0075_E09.b :
UTR01_0049_D06.b :
MLN01_0087_C03.b :
MLN01_0086_C04.b :
CLNT1_0041_D06.b :
ITT01_0080_G11.b :
MLN01_0077_H11.b :
OVRT1_0151_F10.b :
OVRT1_0016_C04.b :
OVRT1_0128_H10.b :
SMG01_0066_E09.b :
MLN01_0063_F08.b :
BFLT1_0032_G05.b :
OVRT1_0002_D02.b :
CLNT1_0108_B11.b :
OVRT1_0080_F02.b :
OVRT1_0148_H12.b :
OVRT1_0105_G09.b :
LNG01_0056_E08.b :
THY01_0039_A08.b :
ITT01_0092_D08.b :
CLNT1_0149_E12.b :
LNG01_0058_A11.b :
MLN01_0004_C10.b :
MLN01_0018_H08.b :
LNG01_0060_E10.b :
MLN01_0079_G08.b :
OVRT1_0004_A03.b :
MLN01_0042_D08.b :
MLN01_0010_F07.b :
CLNT1_0151_E04.b :
MLN01_0015_A09.b :
MLN01_0013_G10.b :
MLN01_0063_H11.b :
ITT01_0013_A07.b :
MLN01_0036_H05.b :
MLN01_0013_B11.b :
MLN01_0059_B03.b :
MLN01_0006_E11.b :
UTR01_0091_F08.b :
MLN01_0080_H11.b :
MLN01_0091_C06.b :
LNG01_0063_D04.b :
LNG01_0080_H01.b :
MLN01_0043_C03.b :
MLN01_0055_B04.b :
MLN01_0014_B03.b :
MLN01_0071_H09.b :
MLN01_0021_G06.b :
LNG01_0070_C05.b :
MLN01_0067_D08.b :
UTR01_0043_A10.b :
MLN01_0038_H02.b :
MLN01_0066_B08.b :
MLN01_0032_A05.b :
MLN01_0037_A06.b :
OVRT1_0085_G11.b :
MLN01_0082_A11.b :
MLN01_0068_G03.b :
MLN01_0097_E02.b :
UTR01_0087_E09.b :
MLN01_0024_D02.b :
OVRT1_0073_G12.b :
MLN01_0004_A06.b :
MLN01_0005_C11.b :
UTR01_0083_H08.b :
MLN01_0081_E01.b :
MLN01_0077_E05.b :
OVRT1_0041_A03.b :
MLN01_0028_E08.b :
ITT01_0056_F06.b :
CLNT1_0008_D02.b :
LNG01_0065_A12.b :
MLN01_0002_C02.b :
MLN01_0013_B12.b :
MLN01_0035_A03.b :
MLN01_0065_C05.b :
MLN01_0028_F08.b :
UTR01_0088_E01.b :
MLN01_0088_H08.b :
MLN01_0019_F06.b :
UTR01_0074_A10.b :
UTR01_0093_C03.b :
MLN01_0064_B04.b :
UTR01_0083_B08.b :
MLN01_0047_H03.b :
UTR01_0104_H08.b :
MLN01_0040_F06.b :
MLN01_0057_G08.b :
LNG01_0044_H05.b :
LVR01_0094_E09.b :
MLN01_0002_E02.b :
UTR01_0095_C12.b :
UTR01_0096_G03.b :
UTR01_0056_D01.b :
LNG01_0023_C07.b :
MLN01_0007_B11.b :
MLN01_0062_F10.b :
UTR01_0076_G04.b :
MLN01_0080_G05.b :
UTR01_0049_F09.b :
MLN01_0068_F09.b :
MLN01_0012_E07.b :
UTR01_0099_A05.b :
UTR01_0098_G04.b :
MLN01_0015_C03.b :
UTR01_0080_C03.b :
MLN01_0005_E07.b :
MLN01_0051_E09.b :
LVR01_0067_F09.b :
UTR01_0063_H02.b :
UTR01_0066_G09.b :
UTR01_0047_G06.b :
MLN01_0060_H11.b :
UTR01_0076_H02.b :
UTR01_0061_F09.b :
UTR01_0054_C04.b :
LNG01_0005_E08.b :
UTR01_0090_G09.b :
UTR01_0100_C04.b :
UTR01_0047_H03.b :
MLN01_0068_H07.b :
SPL01_0093_E04.b :
AMP01_0013_E03.b :
AMP01_0006_G11.b :
AMP01_0004_A08.b :
AMP01_0067_H08.b : ata
AMP01_0058_E12.b :
SKNB1_0052_C11.b :
PST01_0058_H09.b :
MLN01_0035_E08.b :
CBLT1_0048_C03.b :
ITT01_0004_H07.b :
ITT01_0039_E09.b :
ITT01_0073_E11.b :
ITT01_0074_F04.b :
MLN01_0089_A07.b :
ITT01_0034_F06.b :
UTR01_0084_B02.b :
MLN01_0067_C01.b :
MLN01_0087_G02.b :
AMP01_0023_H04.b :
MLN01_0071_G05.b :
AMP01_0081_A12.b :
LNG01_0078_B09.b :
LNG01_0103_E01.b :
LNG01_0030_G07.b :
LNG01_0034_B02.b :
LNG01_0031_C04.b :
AMP01_0083_F01.b :
AMP01_0053_H11.b : nnnnnnnn
AMP01_0070_G08.b :
AMP01_0018_E10.b :
AMP01_0034_A07.b : nngggg
AMP01_0072_A06.b : nngagata
AMP01_0101_B10.b : gg
LNG01_0100_A08.b :
ITT01_0020_G03.b :
SPLT1_0087_F01.b :
MLN01_0065_C12.b :
UTR01_0054_D11.b :
AMP01_0022_G07.b : nngg
MLN01_0098_A07.b :
UTR01_0090_G04.b :
SPL01_0004_F09.b :
UTR01_0057_C09.b :
UTR01_0010_F03.b :
CBLT1_0073_C02.b :
CBLT1_0066_H02.b :
HTMT1_0145_H11.b :
SPLT1_0057_H01.b :
SPLT1_0089_G06.b :
HTMT1_0094_H10.b :
ILNT1_0038_B04.b :
BMWN1_0005_E01.b :
CBLT1_0090_H04.b :
ILNT1_0070_A02.b :
HTMT1_0015_B02.b :
BMWN1_0086_G06.b :
CBLT1_0083_B11.b :
ILNT1_0084_F11.b :
HTMT1_0138_D12.b :
HTMT1_0102_C06.b :
MLN01_0084_A02.b :
BMWN1_0073_C07.b :
CBLT1_0085_G02.b :
BMWN1_0077_B12.b :
CBLT1_0060_E11.b :
BMWN1_0037_F06.b :
CBLT1_0044_H04.b :
ILNT1_0067_G10.b :
HTMT1_0102_A06.b :
ILNT1_0035_E01.b :
HTMT1_0017_D03.b :
HTMT1_0143_G08.b :
BMWN1_0063_G09.b :
ILNT1_0053_H12.b :
CBLT1_0086_E06.b :
BMWN1_0049_H08.b :
CBLT1_0017_B01.b :
CBLT1_0089_A05.b :
SPLT1_0052_D09.b :
BMWN1_0065_B08.b :
BMWN1_0049_C09.b :
BMWN1_0077_D09.b :
CBLT1_0087_B06.b :
BMWN1_0030_C05.b :
MLN01_0045_F04.b :
MLN01_0068_G01.b :
OVRT1_0088_A05.b :
CBLT1_0086_G06.b :
ILNT1_0039_C04.b :
UTR01_0048_D05.b :
MLTL1_0008_H04.b : nnnnnn
UTR01_0010_A10.b :
UTR01_0038_D01.b :
MLTL1_0098_G04.b : nnnnn
UTR01_0022_E05.b :
ITT01_0006_G11.b :
AMP01_0071_A07.b : ngg
LNG01_0101_D03.b :
AMP01_0005_C02.b :
AMP01_0028_E07.b :
LNG01_0080_A07.b :
OVRT1_0069_H10.b :
MLN01_0039_F03.b :
SPLT1_0037_C01.b :
MLN01_0032_F03.b :
BMWN1_0062_G04.b :
UTR01_0058_C01.b :
MLN01_0098_F07.b :
DCI01_0072_H09.b :
AMP01_0045_C10.b :
MLTL1_0011_A07.b :
AMP01_0080_G01.b :
AMP01_0063_E02.b : n
AMP01_0096_F10.b :
AMP01_0097_H08.b :
TCH01_0052_G04.b :
UTR01_0008_C10.b :
UTR01_0044_E11.b :
MLN01_0018_F09.b :
UTR01_0015_G10.b :
PST01_0030_G09.b :
ITT01_0010_E06.b :
HTMT1_0011_C04.b :
ITT01_0017_D05.b :
PTG01_0022_F02.b :
ITT01_0022_G04.b :
ITT01_0063_A03.b :
ITT01_0040_G05.b :
HTMT1_0003_E03.b :
CLNT1_0029_H01.b :
ITT01_0083_D01.b :
ITT01_0085_B07.b :
CLNT1_0123_E07.b :
PBL01_0046_C04.b :
ITT01_0036_C10.b :
MLN01_0001_H08.b :
ITT01_0041_E03.b :
ITT01_0071_B03.b :
MLN01_0061_F02.b :
ITT01_0014_D05.b :
ITT01_0072_G02.b :
MLN01_0071_E05.b :
ITT01_0092_B09.b :
MLN01_0080_C05.b :
MLN01_0092_H01.b :
UTR01_0096_B09.b :
ITT01_0078_B07.b :
MLN01_0041_C06.b :
ITT01_0091_A11.b :
UTR01_0059_H11.b :
MLN01_0071_F12.b :
UTR01_0086_F11.b :
MLN01_0104_H07.b :
CLNT1_0134_H07.b :
OVRT1_0002_A06.b :
MLN01_0036_C10.b :
MLN01_0027_F04.b :
MLN01_0039_F11.b :
UTR01_0090_E08.b :
MLN01_0006_H10.b :
MLN01_0029_C06.b :
CLNT1_0032_G06.b :
MLN01_0064_H08.b :
MLN01_0033_F03.b :
MLN01_0007_E11.b :
MLN01_0069_F05.b :
LNG01_0077_H03.b :
MLN01_0056_B07.b :
UTR01_0098_H07.b :
MLN01_0073_G08.b :
MLN01_0017_D09.b :
MLN01_0001_F10.b :
UTR01_0092_B05.b :
MLN01_0085_C07.b :
CLNT1_0092_C08.b :
MLN01_0044_D02.b :
LNG01_0107_C03.b :
UTR01_0106_F04.b :
LNG01_0071_H11.b :
LNG01_0108_B08.b :
OVRT1_0057_D01.b :
MLN01_0044_G08.b :
MLN01_0033_B03.b :
UTR01_0074_C05.b :
UTR01_0099_G05.b :
UTR01_0062_A07.b :
MLN01_0009_C05.b :
UTR01_0043_B11.b :
MLN01_0042_F03.b :
UTR01_0062_E12.b :
MLN01_0029_G03.b :
UTR01_0062_D05.b :
UTR01_0080_F02.b :
UTR01_0052_F05.b :
SMG01_0050_C06.b :
PCT01_0024_G05.b :
BMWN1_0005_G09.b :
KDN01_0059_D05.b :
PST01_0038_E08.b :
PST01_0099_D04.b :
PST01_0024_A09.b :
SKNB1_0056_D04.b :
PST01_0069_H12.b :
TES01_0082_H08.b :
UTR01_0034_C12.b :
PST01_0077_H10.b :
SKNB1_0096_A08.b :
SKNB1_0015_E12.b :
PST01_0047_E04.b :
PST01_0004_H05.b :
PST01_0097_D02.b :
PST01_0042_G07.b :
PST01_0090_G12.b :
TES01_0060_A07.b :
SKNB1_0086_B01.b :
PCT01_0033_A12.b :
SKNB1_0066_G12.b :
PST01_0079_G07.b :
KDN01_0010_H12.b :
PCT01_0023_D03.b :
PCT01_0017_E01.b :
PCT01_0027_E04.b :
PCT01_0017_C10.b :
PCT01_0012_D04.b :
ITT01_0018_G10.b :
PCT01_0006_G11.b :
PST01_0006_B06.b :
SKNB1_0060_H09.b :
SMG01_0029_B01.b :
HTMT1_0005_C01.b :
LNG01_0008_D02.b :
BMWN1_0062_A12.b :
BMWN1_0014_F03.b :
PST01_0010_C12.b :
PST01_0081_H10.b :
PST01_0016_A12.b :
SKNB1_0044_G03.b :
HTMT1_0045_H09.b :
UTR01_0050_A12.b :
BMWN1_0040_G06.b :
KDN01_0046_A05.b :
MLN01_0102_F06.b :
TES01_0082_D12.b :
UTR01_0089_B07.b :
HTMT1_0012_A11.b :
SKNB1_0003_E09.b :
UTR01_0075_D11.b :
MLN01_0071_A07.b :
HTMT1_0128_E05.b :
MLTL1_0019_E12.b :
MLN01_0022_D06.b :
MLN01_0014_E03.b :
CBLT1_0017_D11.b :
MLTL1_0070_E12.b :
HTMT1_0043_G05.b :
BMWN1_0053_D04.b :
SPLT1_0072_D12.b :
ILNT1_0027_C09.b :
HTMT1_0004_G02.b :
SMG01_0093_E08.b :
---------+---------+---------+---------+---------+---------+ 43
ITT01_0041_D05.b :
ITT01_0092_B02.b :
MLN01_0103_A06.b : nnnnggctag
ILNT1_0057_C06.b :
AMP01_0051_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0003_B05.b :
PBL01_0049_B11.b :
SMG01_0042_D06.b :
THY01_0004_E09.b :
OVRT1_0028_E08.b :
MLN01_0051_B08.b :
UTR01_0043_D04.b :
ITT01_0092_F12.b :
MLN01_0076_D10.b :
MLN01_0100_H05.b :
ITT01_0025_F10.b :
ITT01_0037_H06.b :
MLN01_0086_G11.b :
MLN01_0050_H03.b :
LVRM1_0071_C06.b :
BMWN1_0018_A04.b :
BMWN1_0038_E02.b :
CBLT1_0073_B10.b :
HTMT1_0145_H02.b :
BMWN1_0030_E12.b :
HTMT1_0144_A05.b :
CBLT1_0093_C12.b :
BMWN1_0081_G12.b :
CBLT1_0023_E12.b :
LNG01_0009_A04.b :
BMWN1_0085_C01.b :
HTMT1_0091_E12.b :
SPLT1_0067_F11.b :
CBLT1_0014_A02.b :
CBLT1_0034_A05.b :
HTMT1_0068_A06.b :
SPLT1_0093_G08.b :
ILNT1_0019_A04.b :
BMWN1_0008_B08.b :
BMWN1_0033_F09.b :
CLNT1_0010_F02.b :
BMWN1_0073_C06.b :
CBLT1_0076_D08.b :
BMWN1_0099_C06.b :
BMWN1_0073_B05.b :
CBLT1_0087_H11.b :
CBLT1_0031_C05.b :
CBLT1_0076_B07.b :
ILNT1_0048_D04.b :
BMWN1_0084_G08.b :
HTMT1_0040_D03.b :
BMWN1_0064_F03.b :
BMWN1_0007_A02.b :
BMWN1_0091_E03.b :
HTMT1_0022_H02.b :
HTMT1_0077_C01.b :
HTMT1_0118_C05.b :
HTMT1_0150_A03.b :
BMWN1_0043_D11.b :
ILNT1_0091_E02.b :
CBLT1_0017_C03.b :
BMWN1_0086_B03.b :
CBLT1_0072_D08.b :
HTMT1_0025_F04.b :
SPLT1_0053_E06.b :
CBLT1_0027_E05.b :
HTMT1_0078_F02.b :
BMWN1_0085_E02.b :
CBLT1_0015_E07.b :
BMWN1_0085_B12.b :
BMWN1_0059_A10.b :
BMWN1_0059_C04.b :
CBLT1_0036_A03.b :
HTMT1_0121_C11.b :
CBLT1_0045_D03.b :
ITT01_0038_E01.b :
HTMT1_0041_B11.b :
HTMT1_0024_G08.b :
ILNT1_0021_B08.b :
BMWN1_0041_B06.b :
HTMT1_0097_A03.b :
HTMT1_0061_D09.b :
HTMT1_0111_G03.b :
CBLT1_0048_H06.b :
SPLT1_0089_A10.b :
ILNT1_0053_F12.b :
HTMT1_0051_H01.b :
CBLT1_0045_E08.b :
HTMT1_0139_D12.b :
HTMT1_0055_G09.b :
SPLT1_0091_B07.b :
ILNT1_0040_D08.b :
HTMT1_0051_H12.b :
HTMT1_0099_A07.b :
ILNT1_0021_E08.b :
LNG01_0070_H12.b :
HTMT1_0140_C01.b :
BMWN1_0035_B06.b :
ILNT1_0064_E08.b :
ILNT1_0100_A12.b :
CBLT1_0037_C03.b :
ILNT1_0016_B10.b :
BMWN1_0090_B11.b :
HTMT1_0062_F09.b :
SPLT1_0055_C12.b :
UTR01_0088_C02.b :
CBLT1_0070_H11.b :
HTMT1_0129_F10.b :
CBLT1_0069_D09.b :
ILNT1_0070_G07.b :
BMWN1_0022_G10.b :
HTMT1_0087_D12.b :
SPLT1_0002_E06.b :
BMWN1_0034_D01.b :
CBLT1_0035_G03.b :
ILNT1_0010_A07.b :
MLN01_0052_D05.b :
CBLT1_0005_F09.b :
CBLT1_0011_F05.b :
CBLT1_0045_B04.b :
CBLT1_0033_D08.b :
CBLT1_0012_C04.b :
HTMT1_0015_F05.b :
ILNT1_0061_H04.b :
SPLT1_0041_E01.b :
BMWN1_0084_E10.b :
HTMT1_0137_E02.b :
CBLT1_0037_F09.b :
CBLT1_0004_F11.b :
HTMT1_0019_C03.b :
BMWN1_0088_D12.b :
HTMT1_0051_E02.b :
BMWN1_0019_H03.b :
HTMT1_0134_A10.b :
LNG01_0105_A07.b :
CBLT1_0060_H05.b :
ILNT1_0100_C11.b :
HTMT1_0018_E09.b :
HTMT1_0120_H06.b :
HTMT1_0045_E10.b :
CBLT1_0040_C09.b :
UTR01_0103_C11.b :
SPLT1_0042_F11.b :
LNG01_0086_F01.b :
ITT01_0033_H05.b :
OVRM1_0149_D03.b :
UTR01_0074_E07.b :
LVRM1_0019_A03.b :
LVRM1_0108_H08.b :
OVR01_0077_E12.b :
LNG01_0019_A11.b :
SPL01_0022_H11.b :
UTR01_0002_C12.b :
UTR01_0028_H09.b :
UTR01_0028_H04.b :
MLN01_0091_C10.b :
UTR01_0001_G04.b :
UTR01_0041_H11.b :
UTR01_0007_F03.b :
UTR01_0007_C04.b :
UTR01_0026_F02.b :
UTR01_0030_D11.b :
UTR01_0020_G01.b :
UTR01_0026_B05.b :
UTR01_0009_E04.b :
UTR01_0030_H07.b :
UTR01_0031_G06.b :
UTR01_0042_D06.b :
THY01_0047_A12.b :
UTR01_0041_F06.b :
UTR01_0019_D10.b :
CLNT1_0104_A01.b :
UTR01_0015_C10.b :
UTR01_0042_D05.b :
UTR01_0039_B03.b :
UTR01_0018_B03.b :
UTR01_0021_E06.b :
MLN01_0054_E11.b :
UTR01_0059_F10.b :
LNG01_0033_D08.b :
UTR01_0033_D10.b :
UTR01_0003_H03.b :
UTR01_0037_G03.b :
PBL01_0014_G12.b :
ITT01_0011_A12.b :
ITT01_0007_G10.b :
ITT01_0103_F07.b :
ITT01_0103_H04.b :
ITT01_0012_H04.b :
ITT01_0080_F12.b :
ITT01_0023_C12.b :
ITT01_0094_A07.b :
ITT01_0070_D07.b :
ITT01_0013_D03.b :
ITT01_0049_C07.b :
ITT01_0023_F08.b :
ITT01_0088_A03.b :
ITT01_0032_D02.b :
ITT01_0069_G07.b :
PBL01_0031_G06.b :
PBL01_0106_A09.b :
ITT01_0035_A05.b :
ITT01_0023_H07.b :
ITT01_0025_D06.b :
ITT01_0067_C06.b :
ITT01_0055_D12.b :
ITT01_0076_E01.b :
MLN01_0056_D05.b :
ITT01_0043_G12.b :
ITT01_0102_A01.b :
UTR01_0058_E01.b :
UTR01_0102_E07.b :
MLN01_0057_H01.b :
MLN01_0104_A09.b :
ITT01_0005_F01.b :
ITT01_0053_A07.b :
ITT01_0062_F01.b :
ITT01_0041_D07.b :
ITT01_0053_A08.b :
ITT01_0065_B02.b :
HTMT1_0087_C12.b :
MLN01_0022_B12.b :
MLN01_0035_H02.b :
CLNT1_0059_E06.b :
MLN01_0001_D10.b :
MLN01_0015_F02.b :
MLN01_0059_A09.b :
MLN01_0059_F12.b :
MLN01_0063_F01.b :
UTR01_0105_C10.b :
ITT01_0072_F09.b :
UTR01_0082_E04.b :
UTR01_0084_A07.b :
UTR01_0081_D10.b :
UTR01_0091_B11.b :
UTR01_0098_H04.b :
LNG01_0024_D01.b :
MLN01_0001_C06.b :
MLN01_0086_A06.b :
ITT01_0075_E09.b :
UTR01_0049_D06.b :
MLN01_0087_C03.b :
MLN01_0086_C04.b :
CLNT1_0041_D06.b :
ITT01_0080_G11.b :
MLN01_0077_H11.b :
OVRT1_0151_F10.b :
OVRT1_0016_C04.b :
OVRT1_0128_H10.b :
SMG01_0066_E09.b :
MLN01_0063_F08.b :
BFLT1_0032_G05.b :
OVRT1_0002_D02.b :
CLNT1_0108_B11.b :
OVRT1_0080_F02.b :
OVRT1_0148_H12.b :
OVRT1_0105_G09.b :
LNG01_0056_E08.b :
THY01_0039_A08.b :
ITT01_0092_D08.b :
CLNT1_0149_E12.b :
LNG01_0058_A11.b :
MLN01_0004_C10.b :
MLN01_0018_H08.b :
LNG01_0060_E10.b :
MLN01_0079_G08.b :
OVRT1_0004_A03.b :
MLN01_0042_D08.b :
MLN01_0010_F07.b :
CLNT1_0151_E04.b :
MLN01_0015_A09.b :
MLN01_0013_G10.b :
MLN01_0063_H11.b :
ITT01_0013_A07.b :
MLN01_0036_H05.b :
MLN01_0013_B11.b :
MLN01_0059_B03.b :
MLN01_0006_E11.b :
UTR01_0091_F08.b :
MLN01_0080_H11.b :
MLN01_0091_C06.b :
LNG01_0063_D04.b :
LNG01_0080_H01.b :
MLN01_0043_C03.b :
MLN01_0055_B04.b :
MLN01_0014_B03.b :
MLN01_0071_H09.b :
MLN01_0021_G06.b :
LNG01_0070_C05.b :
MLN01_0067_D08.b :
UTR01_0043_A10.b :
MLN01_0038_H02.b :
MLN01_0066_B08.b :
MLN01_0032_A05.b :
MLN01_0037_A06.b :
OVRT1_0085_G11.b :
MLN01_0082_A11.b :
MLN01_0068_G03.b :
MLN01_0097_E02.b :
UTR01_0087_E09.b :
MLN01_0024_D02.b :
OVRT1_0073_G12.b :
MLN01_0004_A06.b :
MLN01_0005_C11.b :
UTR01_0083_H08.b :
MLN01_0081_E01.b :
MLN01_0077_E05.b :
OVRT1_0041_A03.b :
MLN01_0028_E08.b :
ITT01_0056_F06.b :
CLNT1_0008_D02.b :
LNG01_0065_A12.b :
MLN01_0002_C02.b :
MLN01_0013_B12.b :
MLN01_0035_A03.b :
MLN01_0065_C05.b :
MLN01_0028_F08.b :
UTR01_0088_E01.b :
MLN01_0088_H08.b :
MLN01_0019_F06.b :
UTR01_0074_A10.b :
UTR01_0093_C03.b :
MLN01_0064_B04.b :
UTR01_0083_B08.b :
MLN01_0047_H03.b :
UTR01_0104_H08.b :
MLN01_0040_F06.b :
MLN01_0057_G08.b :
LNG01_0044_H05.b :
LVR01_0094_E09.b :
MLN01_0002_E02.b :
UTR01_0095_C12.b :
UTR01_0096_G03.b :
UTR01_0056_D01.b :
LNG01_0023_C07.b :
MLN01_0007_B11.b :
MLN01_0062_F10.b :
UTR01_0076_G04.b :
MLN01_0080_G05.b :
UTR01_0049_F09.b :
MLN01_0068_F09.b :
MLN01_0012_E07.b :
UTR01_0099_A05.b :
UTR01_0098_G04.b :
MLN01_0015_C03.b :
UTR01_0080_C03.b :
MLN01_0005_E07.b :
MLN01_0051_E09.b :
LVR01_0067_F09.b :
UTR01_0063_H02.b :
UTR01_0066_G09.b :
UTR01_0047_G06.b :
MLN01_0060_H11.b :
UTR01_0076_H02.b :
UTR01_0061_F09.b :
UTR01_0054_C04.b :
LNG01_0005_E08.b :
UTR01_0090_G09.b :
UTR01_0100_C04.b :
UTR01_0047_H03.b :
MLN01_0068_H07.b :
SPL01_0093_E04.b :
AMP01_0013_E03.b : ttttatgatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_G11.b : nntttactaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_A08.b : tttaccgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0067_H08.b : tctagtgtgggatcattggccgcctgctcgcccaccgxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0058_E12.b : atagtctaatcttggggctgctcccgcxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0052_C11.b :
PST01_0058_H09.b :
MLN01_0035_E08.b :
CBLT1_0048_C03.b :
ITT01_0004_H07.b :
ITT01_0039_E09.b :
ITT01_0073_E11.b :
ITT01_0074_F04.b :
MLN01_0089_A07.b :
ITT01_0034_F06.b :
UTR01_0084_B02.b :
MLN01_0067_C01.b :
MLN01_0087_G02.b :
AMP01_0023_H04.b : ttatagcgaattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_G05.b :
AMP01_0081_A12.b : naaaacgtattttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0078_B09.b :
LNG01_0103_E01.b :
LNG01_0030_G07.b :
LNG01_0034_B02.b :
LNG01_0031_C04.b :
AMP01_0083_F01.b : nnttcgtatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_G08.b : aactctatagtgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0018_E10.b : nttttacgatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A07.b : atanannnntagatatcttgggctgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0072_A06.b : nantaatggatcccttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_B10.b : ggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0100_A08.b : nntttatagtataagttttttaaaaaaagcggt
ITT01_0020_G03.b :
SPLT1_0087_F01.b :
MLN01_0065_C12.b :
UTR01_0054_D11.b :
AMP01_0022_G07.b : gtttttttttaagaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0098_A07.b :
UTR01_0090_G04.b :
SPL01_0004_F09.b :
UTR01_0057_C09.b :
UTR01_0010_F03.b :
CBLT1_0073_C02.b :
CBLT1_0066_H02.b :
HTMT1_0145_H11.b :
SPLT1_0057_H01.b :
SPLT1_0089_G06.b :
HTMT1_0094_H10.b :
ILNT1_0038_B04.b :
BMWN1_0005_E01.b :
CBLT1_0090_H04.b :
ILNT1_0070_A02.b :
HTMT1_0015_B02.b :
BMWN1_0086_G06.b :
CBLT1_0083_B11.b :
ILNT1_0084_F11.b :
HTMT1_0138_D12.b :
HTMT1_0102_C06.b :
MLN01_0084_A02.b :
BMWN1_0073_C07.b :
CBLT1_0085_G02.b :
BMWN1_0077_B12.b :
CBLT1_0060_E11.b :
BMWN1_0037_F06.b :
CBLT1_0044_H04.b :
ILNT1_0067_G10.b :
HTMT1_0102_A06.b :
ILNT1_0035_E01.b :
HTMT1_0017_D03.b :
HTMT1_0143_G08.b :
BMWN1_0063_G09.b :
ILNT1_0053_H12.b :
CBLT1_0086_E06.b :
BMWN1_0049_H08.b :
CBLT1_0017_B01.b :
CBLT1_0089_A05.b :
SPLT1_0052_D09.b :
BMWN1_0065_B08.b :
BMWN1_0049_C09.b :
BMWN1_0077_D09.b :
CBLT1_0087_B06.b :
BMWN1_0030_C05.b :
MLN01_0045_F04.b :
MLN01_0068_G01.b :
OVRT1_0088_A05.b :
CBLT1_0086_G06.b :
ILNT1_0039_C04.b :
UTR01_0048_D05.b :
MLTL1_0008_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
UTR01_0010_A10.b :
UTR01_0038_D01.b :
MLTL1_0098_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
UTR01_0022_E05.b :
ITT01_0006_G11.b :
AMP01_0071_A07.b : gagatantatgcgaaaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0101_D03.b :
AMP01_0005_C02.b : aaaaaaggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_E07.b : ttttaaaggactcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_A07.b :
OVRT1_0069_H10.b :
MLN01_0039_F03.b :
SPLT1_0037_C01.b :
MLN01_0032_F03.b :
BMWN1_0062_G04.b :
UTR01_0058_C01.b :
MLN01_0098_F07.b :
DCI01_0072_H09.b : nnnnaatgatatcttagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0045_C10.b : attagggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0011_A07.b : atannntagatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_G01.b : tataaccgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0063_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
AMP01_0096_F10.b : ggcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_H08.b : tggataaatccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0052_G04.b : nnggtgct
UTR01_0008_C10.b :
UTR01_0044_E11.b :
MLN01_0018_F09.b :
UTR01_0015_G10.b :
PST01_0030_G09.b :
ITT01_0010_E06.b :
HTMT1_0011_C04.b :
ITT01_0017_D05.b :
PTG01_0022_F02.b :
ITT01_0022_G04.b :
ITT01_0063_A03.b :
ITT01_0040_G05.b :
HTMT1_0003_E03.b :
CLNT1_0029_H01.b :
ITT01_0083_D01.b :
ITT01_0085_B07.b :
CLNT1_0123_E07.b :
PBL01_0046_C04.b :
ITT01_0036_C10.b :
MLN01_0001_H08.b :
ITT01_0041_E03.b :
ITT01_0071_B03.b :
MLN01_0061_F02.b :
ITT01_0014_D05.b :
ITT01_0072_G02.b :
MLN01_0071_E05.b :
ITT01_0092_B09.b :
MLN01_0080_C05.b :
MLN01_0092_H01.b :
UTR01_0096_B09.b :
ITT01_0078_B07.b :
MLN01_0041_C06.b :
ITT01_0091_A11.b :
UTR01_0059_H11.b :
MLN01_0071_F12.b :
UTR01_0086_F11.b :
MLN01_0104_H07.b :
CLNT1_0134_H07.b :
OVRT1_0002_A06.b :
MLN01_0036_C10.b :
MLN01_0027_F04.b :
MLN01_0039_F11.b :
UTR01_0090_E08.b :
MLN01_0006_H10.b :
MLN01_0029_C06.b :
CLNT1_0032_G06.b :
MLN01_0064_H08.b :
MLN01_0033_F03.b :
MLN01_0007_E11.b :
MLN01_0069_F05.b :
LNG01_0077_H03.b :
MLN01_0056_B07.b :
UTR01_0098_H07.b :
MLN01_0073_G08.b :
MLN01_0017_D09.b :
MLN01_0001_F10.b :
UTR01_0092_B05.b :
MLN01_0085_C07.b :
CLNT1_0092_C08.b :
MLN01_0044_D02.b :
LNG01_0107_C03.b :
UTR01_0106_F04.b :
LNG01_0071_H11.b :
LNG01_0108_B08.b :
OVRT1_0057_D01.b :
MLN01_0044_G08.b :
MLN01_0033_B03.b :
UTR01_0074_C05.b :
UTR01_0099_G05.b :
UTR01_0062_A07.b :
MLN01_0009_C05.b :
UTR01_0043_B11.b :
MLN01_0042_F03.b :
UTR01_0062_E12.b :
MLN01_0029_G03.b :
UTR01_0062_D05.b :
UTR01_0080_F02.b :
UTR01_0052_F05.b :
SMG01_0050_C06.b :
PCT01_0024_G05.b :
BMWN1_0005_G09.b :
KDN01_0059_D05.b :
PST01_0038_E08.b :
PST01_0099_D04.b :
PST01_0024_A09.b :
SKNB1_0056_D04.b :
PST01_0069_H12.b :
TES01_0082_H08.b :
UTR01_0034_C12.b :
PST01_0077_H10.b :
SKNB1_0096_A08.b :
SKNB1_0015_E12.b :
PST01_0047_E04.b :
PST01_0004_H05.b :
PST01_0097_D02.b :
PST01_0042_G07.b :
PST01_0090_G12.b :
TES01_0060_A07.b :
SKNB1_0086_B01.b :
PCT01_0033_A12.b :
SKNB1_0066_G12.b :
PST01_0079_G07.b :
KDN01_0010_H12.b :
PCT01_0023_D03.b :
PCT01_0017_E01.b :
PCT01_0027_E04.b :
PCT01_0017_C10.b :
PCT01_0012_D04.b :
ITT01_0018_G10.b :
PCT01_0006_G11.b :
PST01_0006_B06.b :
SKNB1_0060_H09.b :
SMG01_0029_B01.b :
HTMT1_0005_C01.b :
LNG01_0008_D02.b :
BMWN1_0062_A12.b :
BMWN1_0014_F03.b :
PST01_0010_C12.b :
PST01_0081_H10.b :
PST01_0016_A12.b :
SKNB1_0044_G03.b :
HTMT1_0045_H09.b :
UTR01_0050_A12.b :
BMWN1_0040_G06.b :
KDN01_0046_A05.b :
MLN01_0102_F06.b :
TES01_0082_D12.b :
UTR01_0089_B07.b :
HTMT1_0012_A11.b :
SKNB1_0003_E09.b :
UTR01_0075_D11.b :
MLN01_0071_A07.b :
HTMT1_0128_E05.b :
MLTL1_0019_E12.b :
MLN01_0022_D06.b :
MLN01_0014_E03.b :
CBLT1_0017_D11.b :
MLTL1_0070_E12.b :
HTMT1_0043_G05.b :
BMWN1_0053_D04.b :
SPLT1_0072_D12.b :
ILNT1_0027_C09.b :
HTMT1_0004_G02.b :
SMG01_0093_E08.b :
---------+---------+---------+---------+---------+---------+ 103
ITT01_0041_D05.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA
ITT01_0092_B02.b : nnggtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0103_A06.b : gactaanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0057_C06.b : nccgcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0051_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0003_B05.b : nnnggtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0049_B11.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0042_D06.b : nnncccgatttnnnnnntgatatagcagcxx
THY01_0004_E09.b : ccxxxx
OVRT1_0028_E08.b : nnntttcgttagctgacgxxxxxxxxxx
MLN01_0051_B08.b : nnnttgcatgtacttagacxxxxxxxxxxxxxxxxxxx
UTR01_0043_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0092_F12.b : tttagatgaacax
MLN01_0076_D10.b : cgttaggatatgacxxxxxxxxxxxxxxxxxxxx
MLN01_0100_H05.b : nttccttggacttgacagtttgtxxxxxxxx
ITT01_0025_F10.b : nnnaagagtaacaxx
ITT01_0037_H06.b : nnggatgaacag
MLN01_0086_G11.b : gtgttgtgacttgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0050_H03.b : nnnngggctgtactatgacxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_C06.b : nagttgtcxxxxxxxxxxxxxx
BMWN1_0018_A04.b : nnaaaaaaaannagatttnnttttngcagagtagacxxxxxxxxxxxxxxx
BMWN1_0038_E02.b : tttcgagagaagaggxxxxxxxxxxxxx
CBLT1_0073_B10.b : ttttggacagtagaxxx
HTMT1_0145_H02.b : ttttttccaagtxxxxxxxxx
BMWN1_0030_E12.b : ttttagcagagtagagg
HTMT1_0144_A05.b : nnnaatagacggaagacgx
CBLT1_0093_C12.b : ttttggcaggtagagg
BMWN1_0081_G12.b : tttttggacggtacgacgxxxxxxxxxxx
CBLT1_0023_E12.b : ttttacacggtagagg
LNG01_0009_A04.b : ttttttttttttagcattgtgacctxxxxxxxxxxxxxxxxxxxxx
BMWN1_0085_C01.b : nntttgctagtagacg
HTMT1_0091_E12.b : ttttggatggtacgagg
SPLT1_0067_F11.b : nnngggacggtacgagg
CBLT1_0014_A02.b : ttttggcaggtacac
CBLT1_0034_A05.b : ttttggcaagtacacxxxx
HTMT1_0068_A06.b : tttttagacggtagagg
SPLT1_0093_G08.b : nnnaaccaagtacacg
ILNT1_0019_A04.b : nnnggagaaagtagagg
BMWN1_0008_B08.b : ttttaggagagtacgaxxxxxxxxxxxxxxxx
BMWN1_0033_F09.b : ttttggcagagtagaxxxx
CLNT1_0010_F02.b : caacgacagcggacgxxxxxxxxxx
BMWN1_0073_C06.b : ttttggatagtacgac
CBLT1_0076_D08.b : ttttccacagtagagg
BMWN1_0099_C06.b : ttttggagagtagag
BMWN1_0073_B05.b : tttgggatagtacgacg
CBLT1_0087_H11.b : ttttgcgcggtagagg
CBLT1_0031_C05.b : nnnggacagtagag
CBLT1_0076_B07.b : ttttggcgagtagaxxxx
ILNT1_0048_D04.b : nnnnggacggtagagg
BMWN1_0084_G08.b : tttttggcagagtxxxxxxxx
HTMT1_0040_D03.b : ttttccgaggtacgaggc
BMWN1_0064_F03.b : ttttnggatggtacgag
BMWN1_0007_A02.b : nttttacgagagtagacg
BMWN1_0091_E03.b : ttttggagagtacacgx
HTMT1_0022_H02.b : tttttagcaggtagacg
HTMT1_0077_C01.b : ttttggacggtagaggx
HTMT1_0118_C05.b : nnnnggatagtacgagg
HTMT1_0150_A03.b : nnnnccgagagagaxxx
BMWN1_0043_D11.b : nnnncgcaggtagag
ILNT1_0091_E02.b : nnnnaagcaagtacacxxxx
CBLT1_0017_C03.b : tttttggacggtagaxxxx
BMWN1_0086_B03.b : ttttccgacggtagacgx
CBLT1_0072_D08.b : nnnnggcaagtagaxxxx
HTMT1_0025_F04.b : tttgggaaggtaagaggc
SPLT1_0053_E06.b : nnnggcgagtagagg
CBLT1_0027_E05.b : ttttaccaggtacacxxx
HTMT1_0078_F02.b : ttttaggacggtagacg
BMWN1_0085_E02.b : tttttcgcaggtacgacgxxxxxxxxxxxxxx
CBLT1_0015_E07.b : ttttncgagataagaxxxxx
BMWN1_0085_B12.b : ttttccgaggaacgagg
BMWN1_0059_A10.b : ttttggatagtacgag
BMWN1_0059_C04.b : nnngggacagtacgacg
CBLT1_0036_A03.b : tttccgaagtagaxxxx
HTMT1_0121_C11.b : tttttccacagttagacgc
CBLT1_0045_D03.b : ttttccgagagtagagg
ITT01_0038_E01.b : nttgatgaacax
HTMT1_0041_B11.b : ttttccatgagtaagaxxxxx
HTMT1_0024_G08.b : ttttggcaagtagaxxxxx
ILNT1_0021_B08.b : nnnggacaagtagaggc
BMWN1_0041_B06.b : nttggacaagtagagg
HTMT1_0097_A03.b : ttttggacggtacacg
HTMT1_0061_D09.b : ttttacgacagtacgaxxx
HTMT1_0111_G03.b : nngggacggtacgacgx
CBLT1_0048_H06.b : ntttacgaggtagacg
SPLT1_0089_A10.b : nnnnggacaggtagaxxxx
ILNT1_0053_F12.b : nnnnggacggtacgaggx
HTMT1_0051_H01.b : nttattttnnnnnnggacggtagagg
CBLT1_0045_E08.b : ttttggacggtagag
HTMT1_0139_D12.b : nnnttattttttttttggatagtacacgxx
HTMT1_0055_G09.b : nttgatttttttttggatagtacgaggc
SPLT1_0091_B07.b : nnnnccgcgagtagaggc
ILNT1_0040_D08.b : nnnnaagacagtagagg
HTMT1_0051_H12.b : nttgtttttttttncgacagtagaggx
HTMT1_0099_A07.b : nnttggatagtacgaggc
ILNT1_0021_E08.b : nnncgacagtagagg
LNG01_0070_H12.b : ngtttcgctaggataagacagtttgtacxxxxxxxxxx
HTMT1_0140_C01.b : ttttttacgagatacgacgx
BMWN1_0035_B06.b : ttttggcagagtacacxxx
ILNT1_0064_E08.b : naaagcgagagtagaggxx
ILNT1_0100_A12.b : nnngggccaggtagaxxxx
CBLT1_0037_C03.b : ttttggcaggtagagg
ILNT1_0016_B10.b : ggagttacgaggc
BMWN1_0090_B11.b : tttcccaggtacgaggxxxxxxxxxxxx
HTMT1_0062_F09.b : ttttgcgacggaagaxxxxx
SPLT1_0055_C12.b : nnnggcgcggtacacxxx
UTR01_0088_C02.b : nnnnggcatggactatnacxxxxxxxxxxxxxxxxxxxxx
CBLT1_0070_H11.b : ntttaagagagtagaggx
HTMT1_0129_F10.b : ttttggacagtagaxxx
CBLT1_0069_D09.b : nnnaaccagagtagaxxxxx
ILNT1_0070_G07.b : nnnncgacggtacgaggc
BMWN1_0022_G10.b : tttggatagtacgaggcagtagtaxxxxx
HTMT1_0087_D12.b : tttttcgatggaagaggc
SPLT1_0002_E06.b : nnnaacaagtagaxxxxx
BMWN1_0034_D01.b : tttttgcaagtagaggx
CBLT1_0035_G03.b : tttggcaggtagaxxxx
ILNT1_0010_A07.b : nnnggggcgagagagg
MLN01_0052_D05.b : atttttggctaggacttgacagtttgtacxxxxxxxxxxxxxx
CBLT1_0005_F09.b : tttttccaggtagaxxxx
CBLT1_0011_F05.b : ttttagacggtagaxxxx
CBLT1_0045_B04.b : tttaagacagtagaggx
CBLT1_0033_D08.b : tttggcaagtagacg
CBLT1_0012_C04.b : tttggacggtagaxxxx
HTMT1_0015_F05.b : ttttggcagagtagaggx
ILNT1_0061_H04.b : nnnnaacgacggtagacg
SPLT1_0041_E01.b : nnnggggcagtacgacg
BMWN1_0084_E10.b : tttttggcaggtacac
HTMT1_0137_E02.b : tttttacacgagtagac
CBLT1_0037_F09.b : tttgcgacggagagg
CBLT1_0004_F11.b : ttttttccaggtagagg
HTMT1_0019_C03.b : tttttggacgagtxxxxxxxxx
BMWN1_0088_D12.b : tttttagacggtacacgcagtagtattaa
HTMT1_0051_E02.b : nnnngggacagtagagg
BMWN1_0019_H03.b : nngggatagtagagg
HTMT1_0134_A10.b : nncccctttttntttnggatagtacgaxxxx
LNG01_0105_A07.b : nnnnnccatggacttgacagtttgtcxxxxxxxxxxx
CBLT1_0060_H05.b : tttaagcaagtagaxxx
ILNT1_0100_C11.b : nnnaaccaggtagaxxxx
HTMT1_0018_E09.b : tttttggacagtagagg
HTMT1_0120_H06.b : nnngggatggtacgag
HTMT1_0045_E10.b : ttttggacagtacgaggc
CBLT1_0040_C09.b : ttttccgaggtagag
UTR01_0103_C11.b : nttggcttggactatgacxxxxxxxxxxxxxxxxxxx
SPLT1_0042_F11.b : nnnccgcggtacacgc
LNG01_0086_F01.b : nnnntgactttntttnnnntttgtannnggatggactatnaagttgnacx
ITT01_0033_H05.b : ntagatcaacax
OVRM1_0149_D03.b : nagtttgtcxxxxxxxxx
UTR01_0074_E07.b : tgggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_A03.b : agttgacxxxxxxxxx
LVRM1_0108_H08.b : tagttgtcxxxxxxxxxx
OVR01_0077_E12.b : nctagcataggactatnacxxxxxxxxxxxxxxxxxxxx
LNG01_0019_A11.b : ccaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0022_H11.b : ctttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0002_C12.b : tttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_H09.b : gggtgaactxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_H04.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0091_C10.b : ncttggactatgacxxxxxxxxxxxxxxxxxx
UTR01_0001_G04.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0041_H11.b : ttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0007_F03.b : actttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0007_C04.b : tctttggagccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_F02.b : ggtggacctatxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0030_D11.b : gttgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_G01.b : tgtgtgcactattagxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_B05.b : tggggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0009_E04.b : catttagagccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0030_H07.b : ggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0031_G06.b : cattttgttgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_D06.b : gggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0047_A12.b : cctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0041_F06.b : gggggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0019_D10.b : tgggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0104_A01.b : nttttccgttagcgnaggxxxxxxxxxxxx
UTR01_0015_C10.b : ggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_D05.b : gtgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0039_B03.b : aatttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0018_B03.b : tgggttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0021_E06.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0054_E11.b : ngcttggactatgacxxxxxxxxxxxxxxxxxxx
UTR01_0059_F10.b : cctttttggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0033_D08.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0033_D10.b : gggggaacgtatxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_H03.b : tggtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0037_G03.b : ggtgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0014_G12.b : tgtxxxxxx
ITT01_0011_A12.b : nnaagatgaac
ITT01_0007_G10.b : nnnaagagtaaca
ITT01_0103_F07.b : nnggatgaacax
ITT01_0103_H04.b : nnnggataaaca
ITT01_0012_H04.b : nnttgtgxxxx
ITT01_0080_F12.b : nnnnggatcaacaxx
ITT01_0023_C12.b : nnnaagagaaac
ITT01_0094_A07.b : nnggtgxxxxx
ITT01_0070_D07.b : nnnggtgcaaca
ITT01_0013_D03.b : ngatgaac
ITT01_0049_C07.b : nnnggtgaaacax
ITT01_0023_F08.b : nnggatgaaca
ITT01_0088_A03.b : nnggatgaacax
ITT01_0032_D02.b : nnggatgaac
ITT01_0069_G07.b : naaatgaac
PBL01_0031_G06.b : nggtgaac
PBL01_0106_A09.b : nnnggatgaaca
ITT01_0035_A05.b : nnttatgaaca
ITT01_0023_H07.b : nnnggtgaagcx
ITT01_0025_D06.b : nnnnggagtaac
ITT01_0067_C06.b : nnnggatgaacx
ITT01_0055_D12.b : nnnggagtaac
ITT01_0076_E01.b : tttgatgaaca
MLN01_0056_D05.b : gctaggactatgacagtttgtcxxxxxxxxx
ITT01_0043_G12.b : nnaagagtaaca
ITT01_0102_A01.b : tttagataaaca
UTR01_0058_E01.b : caggcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0102_E07.b : nnnggcttgtgacttnacxxxxxxxxxxxxxxxxxx
MLN01_0057_H01.b : nnngggtaggacttgacagtttgtacxxxxxxxx
MLN01_0104_A09.b : nngggtaggacttgacagtttgtacxxxxxxxx
ITT01_0005_F01.b : ntttgtgaaaca
ITT01_0053_A07.b : nnnggtgaaca
ITT01_0062_F01.b : nntttgtgaaacxx
ITT01_0041_D07.b : nnnggataaacxx
ITT01_0053_A08.b : nnttatcaacax
ITT01_0065_B02.b : nnnggtgaaaca
HTMT1_0087_C12.b : tttttggatggtacgagg
MLN01_0022_B12.b : ntttggtaggacttgacagtttgtacxxxxxxxx
MLN01_0035_H02.b : nnngggtaggacttgacagtttgtacxxxxxxxx
CLNT1_0059_E06.b : nnnnccgtcagctgacgxxxxxxxxxxx
MLN01_0001_D10.b : tttttttgcttggactatnacxxxxxxxxxxxxxxxxxxxx
MLN01_0015_F02.b : nntttacctgtacttgacagtttgtcxxxxxxxxx
MLN01_0059_A09.b : nnnnggctaggacttgacagtttgtcxxxxxxxxx
MLN01_0059_F12.b : nnttgctaggactatgacxxxxxxxxxxxxxxxxxx
MLN01_0063_F01.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxx
UTR01_0105_C10.b : nnnggctaggacttagacxxxxxxxxxxxxxxxxxx
ITT01_0072_F09.b : nnnnggatgaacax
UTR01_0082_E04.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxx
UTR01_0084_A07.b : nnnngggttgtgattagacxxxxxxxxxxxxxxxxxx
UTR01_0081_D10.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxx
UTR01_0091_B11.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxx
UTR01_0098_H04.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxx
LNG01_0024_D01.b : gcatttggctgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0001_C06.b : ttttnnggcttggactatgacxxxxxxxxxxxxxxxxxxx
MLN01_0086_A06.b : nnnngggtaggacttgacagtttgtcxxxxxxxxx
ITT01_0075_E09.b : nnnggatgaacax
UTR01_0049_D06.b : ccctttagagccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_C03.b : nnngggctggacttgacxxxxxxxxxxxx
MLN01_0086_C04.b : nnnnagctaggactatgacxxxxxxxxxxxxxxxxxx
CLNT1_0041_D06.b : atccgtttgctgacgxxxxxxxxxxx
ITT01_0080_G11.b : nnnnggatcaaca
MLN01_0077_H11.b : nggctaggacttgacxxxxxxxxxxxxxxxxxx
OVRT1_0151_F10.b : nnnnccgttagctgacgxxxxxxxxxxxx
OVRT1_0016_C04.b : ncccccgttagcgnacgxxxxxxxxxxx
OVRT1_0128_H10.b : nnccccgttagctgacgxxxxxxxxxxx
SMG01_0066_E09.b : nggctattnnnnnggataaagc
MLN01_0063_F08.b : ggacttagacxxxxxxxxxxxxxxxxxxx
BFLT1_0032_G05.b : ggactactatagctgtcngxxxxxxxxxxx
OVRT1_0002_D02.b : nnnnccgttcagctntcggxxxxxxxxxxx
CLNT1_0108_B11.b : nnnnccgttagctgacgxxxxxxxxxxx
OVRT1_0080_F02.b : nntattatttagctgcacgxxxxxxxxxxx
OVRT1_0148_H12.b : tttttccgttagcgnaggxxxxxxxxxxx
OVRT1_0105_G09.b : nnnccgtcagctgtggxxxxxxxxxxx
LNG01_0056_E08.b : ncaattnnnttcggctggacttgacxxxxxxxxxxxxxxxxxx
THY01_0039_A08.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0092_D08.b : nnnggtgaaacaxxxxxxxxxxxxxxxx
CLNT1_0149_E12.b : nnnccgttagctgtcgxxxxxxxxxx
LNG01_0058_A11.b : nnngggctttnnttcggcatggacttgacxxxxxxxxxxxxx
MLN01_0004_C10.b : nntttgcttggctatgacxxxxxxxxxxxxxxxxxx
MLN01_0018_H08.b : ccccttcatggacttnaagtttgtcxxxxxxxxx
LNG01_0060_E10.b : nntttagggctggacttgacxxxxxxxxxxxxx
MLN01_0079_G08.b : nnnnggctaggacttgacxxxxxxxxxxxxxxx
OVRT1_0004_A03.b : nnntttctctagcgnacgagtgxxxxxxx
MLN01_0042_D08.b : nnngctagtgacttgacagtttgtcxxxxxxxxx
MLN01_0010_F07.b : nnttataggacttgacagtttgtacxxxxxxxx
CLNT1_0151_E04.b : nnnncccttcgctgtggxxxxxxxxxxx
MLN01_0015_A09.b : nntttaggctggacttgacagtttgtcxxxxxxxxx
MLN01_0013_G10.b : nnnaaagtggacatgacagtttgtacxxxxxxxx
MLN01_0063_H11.b : nnggctagtgacttgacxxxxxxxxxxxxxx
ITT01_0013_A07.b : nnggactaacaxxxx
MLN01_0036_H05.b : ttcnnnggctaggactatnacagtttgtcxxxxxxxxx
MLN01_0013_B11.b : nnnttcgctggacttgacxxxxxxxxxxxxxxxxxxx
MLN01_0059_B03.b : nnnnngctaggactatgacxxxxxxxxxxxxxxxxxx
MLN01_0006_E11.b : ttttttggttgacttgacxxxxxxxxxxxxxxxxx
UTR01_0091_F08.b : nnnnggcttggactataacxxxxxxxxxxxxx
MLN01_0080_H11.b : cgttgtgacttgacagtttgtacxxxxxxxx
MLN01_0091_C06.b : ctagtgatatgacxxxxxxxxxxxxxxxxxx
LNG01_0063_D04.b : nttaggggcatggctatgacxxxxxxxxxxxxxxxxxx
LNG01_0080_H01.b : nnntttgatggtacttgacxxxxxxxxxxxxxxxxxx
MLN01_0043_C03.b : ttttngctagtactatgacxxxxxxxxxxxxxxxxxx
MLN01_0055_B04.b : nnnnggcatgtgacttgacxxxxxxxxxxxxxxxxxx
MLN01_0014_B03.b : ntttaggctggacatgacagtttgtcxxxxxxxxx
MLN01_0071_H09.b : nnttgctaggacttgacagtttgtacxxxxxxxx
MLN01_0021_G06.b : nnccgtaggacttgacagtttgtacxxxxxxxx
LNG01_0070_C05.b : ttttttcttggacttgacxxxxxxxxxxxxxx
MLN01_0067_D08.b : gctaggactatgacxxxxxxxxxxxxxxxxxx
UTR01_0043_A10.b : tttttggtgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_H02.b : nnnnggctagtactatnacxxxxxxxxxxxxxxxxxx
MLN01_0066_B08.b : ncgctaggacttgacagtttgtacxxxxxxxx
MLN01_0032_A05.b : naatagannggctggacttgacxxxxxxxxxxxxxxxxxx
MLN01_0037_A06.b : ttttnggctatgtactatnacxxxxxxxxxxxxxxxxxx
OVRT1_0085_G11.b : nncctctnnnnnnnnccgttagcgnacgxxxxxxxxxxx
MLN01_0082_A11.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxx
MLN01_0068_G03.b : nttcgggtaggacttgacagtttgtacxxxxxxxx
MLN01_0097_E02.b : nncctagtgacttgacxxxxxxxxxxxxxxxxxxx
UTR01_0087_E09.b : nnggcttgtgacttgacxxxxxxxxxxxxxxxxxx
MLN01_0024_D02.b : nnnncctaggacttgacagtttgtacxxxxxxxx
OVRT1_0073_G12.b : ncctttnnngggaaccctatagcgnacgagtgxxxxxxx
MLN01_0004_A06.b : nnntttccttgtacatgacxxxxxxxxxxxxxxxxxxx
MLN01_0005_C11.b : nttttggctaggaatatgacagtttgtacxxxxxxxx
UTR01_0083_H08.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxx
MLN01_0081_E01.b : nnncctagtgacttgacxxxxxxxxxxxxxxxxxx
MLN01_0077_E05.b : gtgctaggacttaacxxxxxxxxxxxxxxxxxx
OVRT1_0041_A03.b : nnnnccgtcagcgtacgagtgxxxxxxx
MLN01_0028_E08.b : nctaggttnggcatggacttgacxxxxxxxxxxxxxxxxxxx
ITT01_0056_F06.b : nnccgttttnnnnaagataacaxxxxxxxxxxxxxxxxxxx
CLNT1_0008_D02.b : ngggctttnnnnggacccgtcagcgttacgaggxxxxxxx
LNG01_0065_A12.b : ntttggccttggacatgacxxxxxxxxxxxxxxxxxx
MLN01_0002_C02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxx
MLN01_0013_B12.b : nnnnttgttgtacttgacxxxxxxxxxxxxxxxxxxx
MLN01_0035_A03.b : nnnnggctaggacttgacxxxxxxxxxxxxxxxxxx
MLN01_0065_C05.b : nctaggactatgacxxxxxxxxxxxxxxxxxxxx
MLN01_0028_F08.b : ctagtnnngggctggacttgacxxxxxxxxxxxxxxxxxxx
UTR01_0088_E01.b : nntttgataggactatgacxxxxxxxxxxxxxxxxxx
MLN01_0088_H08.b : nggctaggacttgacxxxxxxxxxxxxxxxxxx
MLN01_0019_F06.b : ngggttttcgnnggttgtgacttgacxxxxxxxxxxxxxxxxxx
UTR01_0074_A10.b : cttttggatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0093_C03.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxx
MLN01_0064_B04.b : ttnggttgtgacttgacxxxxxxxxxxxxxxxxxxxx
UTR01_0083_B08.b : nnnnggcttggactatnacxxxxxxxxxxxxxxxxxx
MLN01_0047_H03.b : nnnnggctgtgacttgacxxxxxxxxxxxxxxxxxx
UTR01_0104_H08.b : nnnggcttgtgacttaacxxxxxxxxxxxxxxxxxx
MLN01_0040_F06.b : nnnngggctggacatgacagtttgtacxxxxxxxx
MLN01_0057_G08.b : ngctaggacttgacxxxxxxxxxxxxxxxxxx
LNG01_0044_H05.b : cgctccccccggcattgtgxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_E09.b : atttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0002_E02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxx
UTR01_0095_C12.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxx
UTR01_0096_G03.b : nnttgctaggactatgacxxxxxxxxxxxxxxxxxx
UTR01_0056_D01.b : gcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0023_C07.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0007_B11.b : nnntttcgtgtacaagacxxxxxxxxxxxxxxxxxx
MLN01_0062_F10.b : nnggctagtgacttgacxxxxxxxxxxxxxxxxxxx
UTR01_0076_G04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_G05.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxx
UTR01_0049_F09.b : ccttatggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_F09.b : ttttcggggctaggacttgacxxxxxxxxxxxxxxxxxx
MLN01_0012_E07.b : nnntttacgtggacttgacagtttgtcxxxxxxxxxxx
UTR01_0099_A05.b : nnnttggctaggactatgacxxxxxxxxxxxxxxxxxx
UTR01_0098_G04.b : nnnnnggctaggacttanacxxxxxxxxxxxxxxxxxxxx
MLN01_0015_C03.b : nntttaggctggacttgacagtttgtcxxxxxxxxx
UTR01_0080_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0005_E07.b : ntttatgcttggaatatgacagtttgtacxxxxxxxx
MLN01_0051_E09.b : nnnnggctaggaatatgacxxxxxxxxxxxxxxxxxx
LVR01_0067_F09.b : gactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0063_H02.b : agtctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0066_G09.b : gatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0047_G06.b : ttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0060_H11.b : ctaggactatgacxxxxxxxxxxxxxxxxxx
UTR01_0076_H02.b : atttggctggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0061_F09.b : acatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0054_C04.b : gtcatttttngtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_E08.b : cgtttttttggattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_G09.b : nttggcttggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0100_C04.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxx
UTR01_0047_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_H07.b : nttcggcgcttggacttgacagtttgtcxxxxxxxxx
SPL01_0093_E04.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxx
AMP01_0013_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0067_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0058_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0052_C11.b :
PST01_0058_H09.b :
MLN01_0035_E08.b : cttggacttaaacxxxxxxxxxxxxxxxxxx
CBLT1_0048_C03.b : ttttgccagagagaxxxxxx
ITT01_0004_H07.b : nnaagtgaaac
ITT01_0039_E09.b : nnnggatgaac
ITT01_0073_E11.b : nnnggatgaac
ITT01_0074_F04.b : nnggatgaac
MLN01_0089_A07.b : nggctaggacttgacxxxxxxxxxxxxxxxxx
ITT01_0034_F06.b : nnnngatgaac
UTR01_0084_B02.b : nnnnngcttgtactaagacxxxxxxxxxxxxxxxx
MLN01_0067_C01.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxx
MLN01_0087_G02.b : nnngctaggacttgacagtttgtacxxxxxxx
AMP01_0023_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_G05.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxx
AMP01_0081_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0078_B09.b : nnnnnggctggaaaagacxxxxxxxxxxxxxxxx
LNG01_0103_E01.b : nnnnnggctggacttgacagtttgtcxxxxxxxx
LNG01_0030_G07.b : agctttagctgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_B02.b : gcatttgggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0031_C04.b : gattttcttaagcattagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0018_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0072_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0100_A08.b : ggggtcggntttttnnnnnntctgttnnnnggctgtgccttnacanttgntcxxxxxxxx
ITT01_0020_G03.b : nnggatgaa
SPLT1_0087_F01.b : nnnccgcgagaagaxx
MLN01_0065_C12.b : nnnnggcatggactatgacxxxxxxxxxxxxxxxx
UTR01_0054_D11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0098_A07.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxx
UTR01_0090_G04.b : nnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0004_F09.b : ggcttttggctgaaxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0057_C09.b : gctttatgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0010_F03.b : tttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_C02.b : ttttccacagtaga
CBLT1_0066_H02.b : nnttcttttntttnccgacggta
HTMT1_0145_H11.b : ttttttcgcaggtag
SPLT1_0057_H01.b : nnnaagcgagtag
SPLT1_0089_G06.b : nncgcgagta
HTMT1_0094_H10.b : ttttacgatagtag
ILNT1_0038_B04.b : nnnnncgacggtag
BMWN1_0005_E01.b : ttttccgaggtacg
CBLT1_0090_H04.b : ttttagacagt
ILNT1_0070_A02.b : nnnncgacggtagag
HTMT1_0015_B02.b : tttttggacagtag
BMWN1_0086_G06.b : ttttnggcaggtacg
CBLT1_0083_B11.b : tttttagcaggtaga
ILNT1_0084_F11.b : nnnnggcaggta
HTMT1_0138_D12.b : nnnaaatttttttttccacgagtaca
HTMT1_0102_C06.b : ttttcacgagaaga
MLN01_0084_A02.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxx
BMWN1_0073_C07.b : ttggcgatagtac
CBLT1_0085_G02.b : ttttcgaggtag
BMWN1_0077_B12.b : tttttggatggtacgax
CBLT1_0060_E11.b : ttttgcgacggta
BMWN1_0037_F06.b : nttgacagtac
CBLT1_0044_H04.b : nnnnccaggtagac
ILNT1_0067_G10.b : nnngggacggtacg
HTMT1_0102_A06.b : nngggatggtxxxx
ILNT1_0035_E01.b : nnnnccgaggaac
HTMT1_0017_D03.b : ttttccgagagtxxxxxxxxxxxxxxx
HTMT1_0143_G08.b : tttttaggcaagaaga
BMWN1_0063_G09.b : tttttccgagagaag
ILNT1_0053_H12.b : nnggtgcgagtag
CBLT1_0086_E06.b : ttttccgaggtacga
BMWN1_0049_H08.b : nnngtagcaggtac
CBLT1_0017_B01.b : nnnttagacggta
CBLT1_0089_A05.b : nnnccgacataa
SPLT1_0052_D09.b : nnnccgcgagtagaggccgtaxxx
BMWN1_0065_B08.b : ntttggagagtac
BMWN1_0049_C09.b : ttttggacgagtagaxxxxxxxxxxxxxxxx
BMWN1_0077_D09.b : ttttnggacgagtxxxx
CBLT1_0087_B06.b : ttttacgacggagag
BMWN1_0030_C05.b : tttttagcagagtagacxxxxxxxxxx
MLN01_0045_F04.b : nnnnngctaggacatgacxxxxxxxxxxxxxxx
MLN01_0068_G01.b : nngggggttcgggggctggacttgacagtttgtacxxxxxx
OVRT1_0088_A05.b : nncccttttnnnnnnnccgtttgcgnacgagtgxxxxx
CBLT1_0086_G06.b : ttttacgacggacgax
ILNT1_0039_C04.b : nnnggcgaggaacg
UTR01_0048_D05.b : cctttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0010_A10.b : ctttttggtgxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_D01.b : ctatagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0098_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0022_E05.b : ggggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_G11.b : nnaag
AMP01_0071_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0101_D03.b : nnnaatgctggatatgacagtttgtcxx
AMP01_0005_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_A07.b : nnnnnggctggactagacagtttgt
OVRT1_0069_H10.b : nnnttcctttagcgcacgagtgxx
MLN01_0039_F03.b : tttaaggcttggacatgacxxxxxxxx
SPLT1_0037_C01.b : nnnaaaatttttnnnnccaagt
MLN01_0032_F03.b : nnttaggggctggacttgacagtttgtcxxxx
BMWN1_0062_G04.b : tttaggatagtacga
UTR01_0058_C01.b : agggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0098_F07.b : nnggctaggactatgacxxxxxxxxxxxx
DCI01_0072_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0045_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0011_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0063_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0052_G04.b : tggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0008_C10.b : ctttttgtgccxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_E11.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0018_F09.b : nnccctggacttcacxxxxxxxxxxxxxx
UTR01_0015_G10.b : gggggtacctattagxxxxxxxxxxxxxxxxxxx
PST01_0030_G09.b :
ITT01_0010_E06.b : nnngggt
HTMT1_0011_C04.b :
ITT01_0017_D05.b : nnggatg
PTG01_0022_F02.b : nncccatttttnnnngggt
ITT01_0022_G04.b : nnnggatga
ITT01_0063_A03.b : nnnggatga
ITT01_0040_G05.b : nnggtga
HTMT1_0003_E03.b :
CLNT1_0029_H01.b : tttccgttcgcgnacgxxxxxx
ITT01_0083_D01.b : nnngatg
ITT01_0085_B07.b : n
CLNT1_0123_E07.b : nnnnnccgatagctgacgxxxxxxx
PBL01_0046_C04.b : nnnaatga
ITT01_0036_C10.b : nnnngatga
MLN01_0001_H08.b : ttcttgggcatggacttgacagtttgtcxxxx
ITT01_0041_E03.b : nnngatga
ITT01_0071_B03.b : nnnaatg
MLN01_0061_F02.b : nnngctaggacttgacagtttgtacxxxx
ITT01_0014_D05.b : nnggat
ITT01_0072_G02.b : nngatg
MLN01_0071_E05.b : nnnggctaggacttgacagtttgtacxxxx
ITT01_0092_B09.b : nnnnaatgaa
MLN01_0080_C05.b : nggctaggacttagacxxxxxxxxxxxxxxxx
MLN01_0092_H01.b : nnngggctggactatnacxxxxxxxxxxxxxx
UTR01_0096_B09.b : nnnggcttggactatnacxxxxxxxxxxxxxx
ITT01_0078_B07.b : nnnnggatg
MLN01_0041_C06.b : ttttggctaggactatgacxxxxxxxxxxxxxx
ITT01_0091_A11.b : nnggatg
UTR01_0059_H11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_F12.b : nnnttgctaggaatatnacagtttgtacxxxx
UTR01_0086_F11.b : nnnnnggctagtactatgacxxxxxxxxxxxxxxx
MLN01_0104_H07.b : nttctaggacttgacxxxxxxxxxxxxxx
CLNT1_0134_H07.b : nnnttccttctgcgtacgagtgxxx
OVRT1_0002_A06.b : nnttttctatagcgnacgagtgxxx
MLN01_0036_C10.b : tgctaggacttagacxxxxxxxxxxxxxx
MLN01_0027_F04.b : nggcttggacttgacagtttgtacxxxx
MLN01_0039_F11.b : tcggcgataggacatgacxxxxxxxxxxxxxxxx
UTR01_0090_E08.b : nnttgctaggactatnacxxxxxxxxxxxxxx
MLN01_0006_H10.b : nnnnncctgtacatgacagtttgtacxxxx
MLN01_0029_C06.b : nnnggctaggacttgacagtttgtcxxxxx
CLNT1_0032_G06.b : ggggccttcagcgnaggagtgxx
MLN01_0064_H08.b : tgtgacttgacxxxxxxxxxxxxxxxx
MLN01_0033_F03.b : nnnnngctaggacttgacagtttgtacxxxx
MLN01_0007_E11.b : nnnnncctggacatgacagtttgtacxxxx
MLN01_0069_F05.b : nnngggtaggacttgacagtttgtacxxxx
LNG01_0077_H03.b : ttttttggatgtactagacxxxxxxxxxxxxxx
MLN01_0056_B07.b : nngctaggacttgacxxxxxxxxxxxxxx
UTR01_0098_H07.b : nnnggcttgtgacttgacxxxxxxxxxxxxxx
MLN01_0073_G08.b : nnaacttgtgacttgacagtttgtacxxxx
MLN01_0017_D09.b : nnnaagtggacttgacagtttgtcxxxxx
MLN01_0001_F10.b : tttttggcttggactatnacxxxxxxxxxxxxx
UTR01_0092_B05.b : nnnnggctaggacttanacxxxxxxxxxxxxxx
MLN01_0085_C07.b : nggctaggcxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_C08.b : nggcnccgtcagcgncggxxxxxx
MLN01_0044_D02.b : nnnnngctagtacatgacxxxxxxxxxxxxxx
LNG01_0107_C03.b : ncccctagcnnnggctggacttgacagxxxxxxx
UTR01_0106_F04.b : nnnnggcttggactatgacxxxxxxxxxxxxxx
LNG01_0071_H11.b : nttttggctggacttgacagtttgtcxxxxx
LNG01_0108_B08.b : ntttgggatggacatgacagtttgtcxxxxx
OVRT1_0057_D01.b : ncctttttnnngganccgttagcgnacgagtgxxx
MLN01_0044_G08.b : nnggctaggactataacxxxxxxxxxxxxxx
MLN01_0033_B03.b : nnnnggctaggacatgacxxxxxxxxxxxxxxxx
UTR01_0074_C05.b : tttgggtgacttactagxxxxxxxxxxxxxxxxxx
UTR01_0099_G05.b : nnnnggctaggactatnacxxxxxxxxxxxxxx
UTR01_0062_A07.b : tgcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0009_C05.b : nnnnttactgtacatgacxxxxxxxxxxxxxx
UTR01_0043_B11.b : gggggcacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_F03.b : nnnngggctggacttgacxxxxxxxxxxxxxx
UTR01_0062_E12.b : gacattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0029_G03.b : nnnggctaggacttgacagtttgtcxxxxx
UTR01_0062_D05.b : cctttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0080_F02.b : tttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_F05.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0050_C06.b : nngggtttnntttaaagagtatagcagc
PCT01_0024_G05.b :
BMWN1_0005_G09.b : nnttagacggtagacgccgtagta
KDN01_0059_D05.b :
PST01_0038_E08.b :
PST01_0099_D04.b :
PST01_0024_A09.b :
SKNB1_0056_D04.b :
PST01_0069_H12.b :
TES01_0082_H08.b :
UTR01_0034_C12.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0077_H10.b :
SKNB1_0096_A08.b :
SKNB1_0015_E12.b :
PST01_0047_E04.b :
PST01_0004_H05.b :
PST01_0097_D02.b :
PST01_0042_G07.b :
PST01_0090_G12.b :
TES01_0060_A07.b :
SKNB1_0086_B01.b :
PCT01_0033_A12.b :
SKNB1_0066_G12.b :
PST01_0079_G07.b :
KDN01_0010_H12.b :
PCT01_0023_D03.b :
PCT01_0017_E01.b :
PCT01_0027_E04.b :
PCT01_0017_C10.b :
PCT01_0012_D04.b :
ITT01_0018_G10.b : nnaagat
PCT01_0006_G11.b :
PST01_0006_B06.b :
SKNB1_0060_H09.b :
SMG01_0029_B01.b : ncccgctttnnnnnagatcaac
HTMT1_0005_C01.b :
LNG01_0008_D02.b : ggggcnnnctagcatagtgxxxxxxxxxxxxxxxxxxx
BMWN1_0062_A12.b : gccacag
BMWN1_0014_F03.b : tttttagcaggtaga
PST01_0010_C12.b :
PST01_0081_H10.b :
PST01_0016_A12.b :
SKNB1_0044_G03.b :
HTMT1_0045_H09.b :
UTR01_0050_A12.b : ccaxxxxxxxxxxxxxxxxxxx
BMWN1_0040_G06.b :
KDN01_0046_A05.b :
MLN01_0102_F06.b :
TES01_0082_D12.b :
UTR01_0089_B07.b :
HTMT1_0012_A11.b :
SKNB1_0003_E09.b :
UTR01_0075_D11.b :
MLN01_0071_A07.b :
HTMT1_0128_E05.b :
MLTL1_0019_E12.b :
MLN01_0022_D06.b :
MLN01_0014_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0017_D11.b :
MLTL1_0070_E12.b :
HTMT1_0043_G05.b :
BMWN1_0053_D04.b :
SPLT1_0072_D12.b :
ILNT1_0027_C09.b :
HTMT1_0004_G02.b :
SMG01_0093_E08.b :
---------+---------+---------+---------+---------+---------+ 161
SMG01_0042_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaCTGGGTTCAGAAGCG*ACTG*
THY01_0004_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGTTCAGAAGCG*ACTG*
OVRT1_0028_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGTTCAGAAGCG*ACTG*
MLN01_0051_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaCTGGGTTCAGAAGCG*ACTG*
UTR01_0043_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGTTCAGAAGCG*ACTG*
ITT01_0092_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCGTTCAGAAGCG*ACTG*
MLN01_0076_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGTTCAGAAGCG*ACTG*
MLN01_0100_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGTTCAGAAGCG*ACTG*
ITT01_0025_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGGTTCAGAAGCG*ACTG*
ITT01_0037_H06.b : ctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGTTCAGAAGCG*ACTG*
MLN01_0086_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGTTCAGAAGCG*ACTG*
MLN01_0050_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGTTCAGAAGCG*ACTG*
LVRM1_0071_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggtGGTTCATAAGCG*ACTG*
BMWN1_0018_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0038_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0073_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCG*ACTG*
HTMT1_0145_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0030_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGACCCT*ACTG*
HTMT1_0144_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCG*ATTG*
CBLT1_0093_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0081_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0023_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCC*ACTG*
LNG01_0009_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaCGTTCAGAAGCG*ACTG*
BMWN1_0085_C01.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ATTG*
HTMT1_0091_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
SPLT1_0067_F11.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0014_A02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*CCTG*
CBLT1_0034_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0068_A06.b : ccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
SPLT1_0093_G08.b : ccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0019_A04.b : ccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0008_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0033_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CLNT1_0010_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTTCAGAAGCG*ACTG*
BMWN1_0073_C06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCACAATCG*ACTG*
CBLT1_0076_D08.b : ccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0099_C06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCG*TCTG*
BMWN1_0073_B05.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCACAAGCG*ACTG*
CBLT1_0087_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACCG*
CBLT1_0031_C05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCC*ACTG*
CBLT1_0076_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0048_D04.b : ccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0084_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0040_D03.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0064_F03.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0007_A02.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0091_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGCAATA*ACAG*
HTMT1_0022_H02.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0077_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0118_C05.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCG*ACTG*
HTMT1_0150_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0043_D11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCC*ATTG*
ILNT1_0091_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0017_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0086_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0072_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0025_F04.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCG*ACTG*
SPLT1_0053_E06.b : ccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0027_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACCG*
HTMT1_0078_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0085_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0015_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGTTCAGAAGCC*ACTG*
BMWN1_0085_B12.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0059_A10.b : gcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCT*ACTG*
BMWN1_0059_C04.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCACACGTG*ACTG*
CBLT1_0036_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACCG*
HTMT1_0121_C11.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGACCCT*ACTG*
CBLT1_0045_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ITT01_0038_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCC*ACTG*
HTMT1_0041_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0024_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0021_B08.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0041_B06.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCG*TTTG*
HTMT1_0097_A03.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0061_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0111_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCACACTCG*ACTG*
CBLT1_0048_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACCG*
SPLT1_0089_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0053_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0051_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0045_E08.b : gcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCC*CCTG*
HTMT1_0139_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0055_G09.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
SPLT1_0091_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0040_D08.b : ccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0051_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0099_A07.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCACAAGCG*ACTG*
ILNT1_0021_E08.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
LNG01_0070_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTTCAGAAGCG*ACTG*
HTMT1_0140_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0035_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0064_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0100_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACCG*
CBLT1_0037_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0016_B10.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCC*ACTG*
BMWN1_0090_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcatTGTTCAGAAGCG*ACTG*
HTMT1_0062_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
SPLT1_0055_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
UTR01_0088_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0070_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0129_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0069_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0070_G07.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0022_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0087_D12.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
SPLT1_0002_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0034_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCT*ACTG*
CBLT1_0035_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0010_A07.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
MLN01_0052_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctactGGTTCAGAAGCG*ACTG*
CBLT1_0005_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0011_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0045_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCC*ACTG*
CBLT1_0033_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0012_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0015_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
ILNT1_0061_H04.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
SPLT1_0041_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
BMWN1_0084_E10.b : gcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0137_E02.b : gcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0037_F09.b : cagtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACCG*
CBLT1_0004_F11.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0019_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCACAAGCG*ACTG*
BMWN1_0088_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0051_E02.b : ccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCACAAGCG*ACTG*
BMWN1_0019_H03.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCG*ACTG*
HTMT1_0134_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAACCG*ACTG*
LNG01_0105_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTTCAGAAGCG*ACTG*
CBLT1_0060_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCGCACTG*
ILNT1_0100_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACCG*
HTMT1_0018_E09.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
HTMT1_0120_H06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGACGCT*ACTG*
HTMT1_0045_E10.b : cgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
CBLT1_0040_C09.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*CCTG*
UTR01_0103_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
SPLT1_0042_F11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCAGAAGCG*ACTG*
LNG01_0086_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0033_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRM1_0149_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0074_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LVRM1_0019_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LVRM1_0108_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVR01_0077_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0019_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
SPL01_0022_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0002_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0028_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0028_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0091_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0001_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0041_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0007_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0007_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0026_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0030_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0020_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0026_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0009_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0030_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0031_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0042_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
THY01_0047_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0041_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0019_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
CLNT1_0104_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0015_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0042_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0039_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0018_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0021_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0054_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0059_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0033_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0033_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0003_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0037_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
PBL01_0014_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0011_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0007_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0103_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0103_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0012_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0080_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0023_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0094_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0070_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0013_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACCG*
ITT01_0049_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0023_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0088_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0032_D02.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0069_G07.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
PBL01_0031_G06.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
PBL01_0106_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0035_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0023_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0025_D06.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAGGCG*ACTG*
ITT01_0067_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0055_D12.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0076_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0056_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0043_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0102_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0058_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0102_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0057_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCATAAGCG*ACTG*
MLN01_0104_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0005_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0053_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0062_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0041_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0053_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0065_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
HTMT1_0087_C12.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0022_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0035_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
CLNT1_0059_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0001_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0015_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0059_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0059_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0063_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0105_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0072_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0082_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0084_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0081_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0091_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0098_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0024_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0001_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0086_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0075_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0049_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0087_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0086_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
CLNT1_0041_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0080_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0077_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0151_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0016_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0128_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
SMG01_0066_E09.b : agcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0063_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
BFLT1_0032_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0002_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
CLNT1_0108_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0080_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0148_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0105_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0056_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
THY01_0039_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0092_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
CLNT1_0149_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0058_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0004_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0018_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0060_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0079_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0004_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0042_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0010_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
CLNT1_0151_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0015_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0013_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0063_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0013_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAACCT*ACTG*
MLN01_0036_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0013_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0059_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0006_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0091_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0080_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0091_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0063_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0080_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0043_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0055_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0014_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0071_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0021_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0070_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0067_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0043_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0038_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0066_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0032_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0037_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0085_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0082_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0068_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0097_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0087_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0024_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0073_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0004_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0005_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0083_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0081_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0077_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
OVRT1_0041_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0028_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
ITT01_0056_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxgtcggccttgttggactggGTTCAGAAGCG*ACTG*
CLNT1_0008_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0065_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0002_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0013_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0035_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0065_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0028_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0088_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0088_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0019_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0074_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0093_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0064_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0083_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0047_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0104_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0040_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0057_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0044_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LVR01_0094_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0002_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0095_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0096_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0056_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LNG01_0023_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0007_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0062_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0076_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0080_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0049_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0068_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0012_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0099_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0098_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0015_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0080_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0005_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0051_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
LVR01_0067_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0063_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*GCTG*
UTR01_0066_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0047_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0060_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0076_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0061_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0054_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCGGAAGCG*ACTG*
LNG01_0005_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0090_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0100_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
UTR01_0047_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
MLN01_0068_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
SPL01_0093_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCAGAAGCG*ACTG*
AMP01_0013_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCATAAGCG*ACTG*
AMP01_0006_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
AMP01_0004_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTCACAAGCG*ACTG*
AMP01_0067_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTCAGAAGCG*ACTG*
AMP01_0058_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
SKNB1_0052_C11.b : nnttatccgctgtggctcggGTTCGAAGCG*ACTG*
PST01_0058_H09.b : nnnnttgctgcgttggctctggaaaGTTCGAAGCG*ACTG*
MLN01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCATAAGCG*ACTG*
CBLT1_0048_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTGT
ITT01_0004_H07.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
ITT01_0039_E09.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
ITT01_0073_E11.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
ITT01_0074_F04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
MLN01_0089_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
ITT01_0034_F06.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
UTR01_0084_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
MLN01_0067_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
MLN01_0087_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
AMP01_0023_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
MLN01_0071_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
AMP01_0081_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTCAGAAGCG*ACTG*
LNG01_0078_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
LNG01_0103_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
LNG01_0030_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
LNG01_0034_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
LNG01_0031_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
AMP01_0083_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
AMP01_0053_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACAG*
AMP01_0070_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTCAGAAGCG*ACTG*
AMP01_0018_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTCAGAAGCG*ACTG*
AMP01_0034_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAGAAGCG*ACTG*
AMP01_0072_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTCAGAAGCG*ACTG*
AMP01_0101_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTCAGAAGCG*ACTG*
LNG01_0100_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCAGAAGCG*ACTG*
ITT01_0020_G03.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGAAGCG*ACTG*
SPLT1_0087_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAAGCG*ACTG*
MLN01_0065_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGAAGCG*ACTG*
UTR01_0054_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcTCAGAAGCG*ACTG*
AMP01_0022_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGAAGCG*ACTG*
MLN01_0098_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGAAGCG*ACTG*
UTR01_0090_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgttggcctacTCAGAAGCG*ACTG*
SPL01_0004_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgGCAGAAGCG*ACTG*
UTR01_0057_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggGAGAAGCG*ACTG*
UTR01_0010_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGAAGCG*ACTG*
CBLT1_0073_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
CBLT1_0066_H02.b : cacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
HTMT1_0145_H11.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCAGAAGCG*ACTG*
SPLT1_0057_H01.b : aggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
SPLT1_0089_G06.b : gaggccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
HTMT1_0094_H10.b : aggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
ILNT1_0038_B04.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
BMWN1_0005_E01.b : acgcagtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACCG*
CBLT1_0090_H04.b : agaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
ILNT1_0070_A02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
HTMT1_0015_B02.b : aggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
BMWN1_0086_G06.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACCG*
CBLT1_0083_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
ILNT1_0084_F11.b : gaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
HTMT1_0138_D12.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
HTMT1_0102_C06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
MLN01_0084_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAGAAGCG*ACTG*
BMWN1_0073_C07.b : gacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCC*ACTG*
CBLT1_0085_G02.b : aggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
BMWN1_0077_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGAGAAGCG*ACTG*
CBLT1_0060_E11.b : gaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACCG*
BMWN1_0037_F06.b : acngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCC*ACTG*
CBLT1_0044_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
ILNT1_0067_G10.b : aggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
HTMT1_0102_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
ILNT1_0035_E01.b : gaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
HTMT1_0017_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
HTMT1_0143_G08.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
BMWN1_0063_G09.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
ILNT1_0053_H12.b : aggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
CBLT1_0086_E06.b : ggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
BMWN1_0049_H08.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
CBLT1_0017_B01.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
CBLT1_0089_A05.b : gaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
SPLT1_0052_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
BMWN1_0065_B08.b : gacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*CCTT*
BMWN1_0049_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttaaGAGAAGCG*ACTG*
BMWN1_0077_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
CBLT1_0087_B06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCAGAAGCG*ACTG*
BMWN1_0030_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
MLN01_0045_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGAAGCG*ACTG*
MLN01_0068_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAGAAGCG*ACTG*
OVRT1_0088_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctccttaaGAGAAGCG*ACTG*
CBLT1_0086_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
ILNT1_0039_C04.b : aggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGAAGCG*ACTG*
UTR01_0048_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGAAGCG*ACTG*
MLTL1_0008_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
UTR01_0010_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
UTR01_0038_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
MLTL1_0098_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
UTR01_0022_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaAGAAGCG*ACTG*
ITT01_0006_G11.b : ataaacagctggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
AMP01_0071_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
LNG01_0101_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
AMP01_0005_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
AMP01_0028_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
LNG01_0080_A07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
OVRT1_0069_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGAAGCG*ACTG*
MLN01_0039_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
SPLT1_0037_C01.b : acacgcagtacgtatttnacgactcctatagggaatttaatgaattgAGAAGCG*ACTG*
MLN01_0032_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
BMWN1_0062_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
UTR01_0058_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
MLN01_0098_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
DCI01_0072_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
AMP01_0045_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
MLTL1_0011_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
AMP01_0080_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
AMP01_0063_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
AMP01_0096_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
AMP01_0097_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCG*ACTG*
TCH01_0052_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0008_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0044_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCA*ACTG*
MLN01_0018_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0015_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
PST01_0030_G09.b : tcggcgttggctatgAGAGCG*ACTG*
ITT01_0010_E06.b : gaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
HTMT1_0011_C04.b : nnnncatactataggatttaatgattggttcGAAGCG*ACTG*
ITT01_0017_D05.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
PTG01_0022_F02.b : aaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0022_G04.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0063_A03.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0040_G05.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
HTMT1_0003_E03.b : nnnaaatatcttgggatttaatgattggttcGAAGCG*ACTG*
CLNT1_0029_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0083_D01.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0085_B07.b : nnnggtcaacagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
CLNT1_0123_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
PBL01_0046_C04.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0036_C10.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0001_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0041_E03.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0071_B03.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0061_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0014_D05.b : gaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0072_G02.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACCG*
MLN01_0071_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0092_B09.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0080_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0092_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0096_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0078_B07.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0041_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
ITT01_0091_A11.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0059_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0071_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0086_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0104_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
CLNT1_0134_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
OVRT1_0002_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0036_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0027_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0039_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0090_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0006_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0029_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
CLNT1_0032_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0064_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0033_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0007_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0069_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
LNG01_0077_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0056_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0098_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0073_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0017_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0001_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0092_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0085_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
CLNT1_0092_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0044_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
LNG01_0107_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0106_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
LNG01_0071_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
LNG01_0108_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
OVRT1_0057_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0044_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0033_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0074_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0099_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0062_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0009_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0043_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0042_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0062_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
MLN01_0029_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0062_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0080_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
UTR01_0052_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCG*ACTG*
SMG01_0050_C06.b : ggntccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcttcttAACCG*ACTA*
PCT01_0024_G05.b : nnnaaaagttttnnnnnnncctgcgttgtgcacggcaAAGCG*ACTG*
BMWN1_0005_G09.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctgtaAAGCG*ACTG*
KDN01_0059_D05.b : tggcgttggctatggagAGCG*ACTG*
PST01_0038_E08.b : gctgtggctctggagAGCG*ACTG*
PST01_0099_D04.b : ttttcctgctgtggctctggagAGCG*ACTG*
PST01_0024_A09.b : nnnnggtcgctgtggctctggagAGCG*ACTG*
SKNB1_0056_D04.b : nnncccgtttnnnnntnccagccgtggcctctggagAGCG*ACTG*
PST01_0069_H12.b : tttttacagcggtggctctgggttcgAGCG*ACTG*
TES01_0082_H08.b : gttggctgttcgaACG*ACTG*
UTR01_0034_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCG*ACTG*
PST01_0077_H10.b : nnnncctgcggtggctctgggttcgaACG*ACTG*
SKNB1_0096_A08.b : nnnttcaactgtggctctggtggtcgaACG*ACTG*
SKNB1_0015_E12.b : nnnggatttnnnnnccctgcgttgactcgggttcgaACG*ACTG*
PST01_0047_E04.b : nnnnncctgcggtggctatgggttcgaACG*ACTG*
PST01_0004_H05.b : ttcctagcgttggctctgggttcgaACG*ACTG*
PST01_0097_D02.b : nnnccagctgtggctctgggttcgaACG*ACTG*
PST01_0042_G07.b : nnntttcgcagtggctctgggttcgaACG*ACTG*
PST01_0090_G12.b : nnnncctgaggtggctatgggttcgaACG*ACTG*
TES01_0060_A07.b : nncctgcgctggctctgggtcagaACG*ACTG*
SKNB1_0086_B01.b : nnnttttagctgtggctctgggttcgaACG*ACTG*
PCT01_0033_A12.b : nnnccgttttcnnnnnccctgcggtggctctggattcaaACG*ACTG*
SKNB1_0066_G12.b : nnnttcctgactgtggcctgggttagaACG*ACTG*
PST01_0079_G07.b : nnncctgcgttggctctgggttagaACG*ACTG*
KDN01_0010_H12.b : gaaaagggggncctgcgtttgctatgggttcgaACG*ACTG*
PCT01_0023_D03.b : nncccgttttnnnnnnncctgcgttgtgcacggattcnaACG*ACTG*
PCT01_0017_E01.b : nnntcgtttannannaaactgaggttgctcggatcanaACG*ACTG*
PCT01_0027_E04.b : nnntttgtatatnnnnnncctgcgggtgcacgtgagACG*ACTG*
PCT01_0017_C10.b : nngggatttttnnnnnnggctgaggtgtgctcggnatcanaACG*ACTG*
PCT01_0012_D04.b : nnnnaacttttnnnnnnncctgcgttgtgcttttcaaACG*ACTG*
ITT01_0018_G10.b : gaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCG*ACTG*
PCT01_0006_G11.b : nnnnggagttannnnnanccagcggtggctatggattcaaACG*ACTG*
PST01_0006_B06.b : ncctttnnnnnnnncctgcggtggctcgggttcaaACG*ACTG*
SKNB1_0060_H09.b : nnnnnttggtannnnnaaaacacacgttgtgctcgntccaACG*ACTG*
SMG01_0029_B01.b : agcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaaggGCG*ACTG*
HTMT1_0005_C01.b : nnnggccatacttaggattaatgaattgagaaCG*ACTG*
LNG01_0008_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG*ACTG*
BMWN1_0062_A12.b : aagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagaacccCTG*
BMWN1_0014_F03.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggttcagaccctCTG*
PST01_0010_C12.b : nnncctcgctgtggctctggagagcgaTG*
PST01_0081_H10.b : nnnaccactgtggctctggagagcgaCG*
PST01_0016_A12.b : nnaaactgctgtggctctggagagcgaTG*
SKNB1_0044_G03.b : nngggatttnnnnncctgcgttggctcggagagcgaTG*
HTMT1_0045_H09.b : ttttacgacggaagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_G06.b : gatttgagaagcgccct
KDN01_0046_A05.b :
MLN01_0102_F06.b : nnngggtaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0082_D12.b :
UTR01_0089_B07.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0012_A11.b : ttttaggcatactataggnatttaatgaaattggtttntacacgaactagatatt
SKNB1_0003_E09.b :
UTR01_0075_D11.b : txxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_A07.b :
HTMT1_0128_E05.b :
MLTL1_0019_E12.b :
MLN01_0022_D06.b :
MLN01_0014_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngatcataccccac
CBLT1_0017_D11.b :
MLTL1_0070_E12.b :
HTMT1_0043_G05.b :
BMWN1_0053_D04.b :
SPLT1_0072_D12.b :
ILNT1_0027_C09.b :
HTMT1_0004_G02.b :
SMG01_0093_E08.b :
---------+---------+---------+---------+---------+---------+ 217
UTR01_0089_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGATT*CGGTGTGATTGGCTTCAC
HTMT1_0012_A11.b : ggttggtcggntgctgccgtgttcactctcttagtgttatcagntgtgattggaCTTCAC
SKNB1_0003_E09.b : nccattttnnnncccacggtggccacggctcC
UTR01_0075_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLN01_0071_A07.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0128_E05.b :
MLTL1_0019_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxx
MLN01_0022_D06.b :
MLN01_0014_E03.b : tcggcattgttggcggtttcgcctgcttgcggtcaatgtgaggtcgcgcccattaggtgt
CBLT1_0017_D11.b :
MLTL1_0070_E12.b :
HTMT1_0043_G05.b :
BMWN1_0053_D04.b :
SPLT1_0072_D12.b :
ILNT1_0027_C09.b :
HTMT1_0004_G02.b :
SMG01_0093_E08.b :
---------+---------+---------+---------+---------+---------+ 272
MLN01_0071_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCAGA*TCTT*CGTGAAGACCCTG*AC
HTMT1_0128_E05.b : tttttggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0019_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0022_D06.b :
MLN01_0014_E03.b : acacttaccgcgcctatacactggcgtattgccgtccatcttgccgacagaccactgcta
CBLT1_0017_D11.b :
MLTL1_0070_E12.b :
HTMT1_0043_G05.b :
BMWN1_0053_D04.b :
SPLT1_0072_D12.b :
ILNT1_0027_C09.b :
HTMT1_0004_G02.b :
SMG01_0093_E08.b :
---------+---------+---------+---------+---------+---------+ 330
MLTL1_0019_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGGCC
MLN01_0022_D06.b : nnnnggtaggacttgacagtttgtcxxxxxxx
MLN01_0014_E03.b : tggttccaactcatgatgataggtggacccatattgacgatgcgcaggctgtgagagcgc
CBLT1_0017_D11.b :
MLTL1_0070_E12.b :
HTMT1_0043_G05.b :
BMWN1_0053_D04.b :
SPLT1_0072_D12.b :
ILNT1_0027_C09.b :
HTMT1_0004_G02.b :
SMG01_0093_E08.b :
---------+---------+---------+---------+---------+---------+ 390
MLN01_0022_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggggTTGCAGGCAAG
MLN01_0014_E03.b : ctattttccatcaggacggcattccccatcatgatgtcacgctcatctttgcccgcgacc
CBLT1_0017_D11.b :
MLTL1_0070_E12.b :
HTMT1_0043_G05.b :
BMWN1_0053_D04.b :
SPLT1_0072_D12.b :
ILNT1_0027_C09.b :
HTMT1_0004_G02.b :
SMG01_0093_E08.b :
---------+---------+---------+---------+---------+---------+ 444