[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001573

Length: 1,172

Sequence [FASTA format sequence]
TGGTTACTTT GCGGCAGCGC GGAGAGCCCC ACCCCCTTTC TCTGCGGAAT CACCATGGCG
GCCGGGACCC TGTACACATA TCCTGAAAAC TGGAGGGCCT TCAAAGCCCT CATTGCCGCT
CAGTACAGCG GGGCTCAGGT CCGCGTGCTC TCCGCACCAC CCCACTTCCA TTTTGGCCAA
ACCAACCACA CCCCCGAATT TCTCCGTAAA TTTCCTGCCG GTAAGGTTCC AGCATTTGAG
GGTGACGATG GATTCTGTGT GTTCGAGAGC AATGCCATTG CCTACTACGT GAGCAACGAG
GAGCTGCGGG GAAGTACTCC TGAGGCAGCA GCCCAGGTGG TGCAGTGGGT GAGCTTTGCC
GATAGCGACA TCGTGCCCCC CGCCAGTACC TGGGTGTTCC CCACCTTGGG CATCATGCAC
TACAACAAGC AGGCCACAGA GAATGCAAAG GATGAGGTGA GGCGAGTTCT GGGGCTGCTG
GATGCTCACT TGAAGACGAG GACTTTTCTG GTGGGCGAAC GTGTGACGCT GGCTGACATC
ACAGTTGTCT GCACCCTGTT GTGGCTCTAC AAACAGGTCC TGGAGCCTTC TTTCCGCCAG
GCCTTCCCCA ATACCAACCG CTGGTTCCTC ACCTGCATTA ACCAGCCCCA GTTCCGGGCT
GTCTTGGGGG AGGTGAAGCT CTGTGAGAAG ATGGCCCAGT TTGATGCTAA AAAGTTTGCA
GAGAGTCAGC CTAAAAAGGA CACCCCACGG AAAGAGAAAG GTTCTCGAGA AGAGAAGCAG
AAGCCCCAGG CTGAGCGGAA AGAGGAGAAG AAGGCAGCTG CTCCTGCTCC TGAGGAGGAG
CTGGACGAGT GTGAGCAGGC GCTGGCTGCT GAGCCCAAGG CCAAGGATCC CTTTGCTCAC
CTACCCAAGA GTACCTTTGT GTTGGACGAA TTTAAGCGCA AGTACTCCAA CGAGGACACA
CTCTCTGTGG CGCTGCCGTA CTTCTGGGAG CACTTTGATA AGGATGGCTG GTCCTTGTGG
TACTCGGAGT ACCGCTTCCC TGAAGAGCTC ACCCAGACCT TCATGAGCTG CAACCTCATC
ACTGGAATGT TCCAGCGATT GGACAACCTG AAGAAGAATG CCTTTGCCAG TGTCATTCTC
TTTGGAACCA CAACAGCAGC TCCTTTTCTG GA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinEEF1Gelongation factor 1-gamma [Homo sapiens]. 6570.0O
Contig/Assembly ProteinVARSvalyl-tRNA synthetase [Homo sapiens]. 1203e-27O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinEef1gelongation factor 1-gamma [Mus musculus]. 6560.0O
Contig/Assembly ProteinVarsvalyl-tRNA synthetase [Mus musculus]. 1142e-25O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC611396PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 1 [Canis familiaris]. 6550.0O
Contig/Assembly ProteinLOC608086PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 12 [Canis familiaris]. 6550.0O
Contig/Assembly ProteinLOC608086PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 1 [Canis familiaris]. 6550.0O
Contig/Assembly ProteinLOC611396PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 24 [Canis familiaris]. 6550.0O
Contig/Assembly ProteinLOC611396PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 20 [Canis familiaris]. 6480.0O
Contig/Assembly ProteinLOC607438PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 13 [Canis familiaris]. 6470.0O
Contig/Assembly ProteinLOC607438PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 2 [Canis familiaris]. 6470.0O
Contig/Assembly ProteinLOC606904PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 14 [Canis familiaris]. 621e-178O
Contig/Assembly ProteinLOC606904PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 3 [Canis familiaris]. 618e-177O
Contig/Assembly ProteinLOC611396PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 22 [Canis familiaris]. 612e-175O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinEEF1Gelongation factor 1-gamma [Bos taurus]. 6540.0O
Contig/Assembly ProteinVARSPREDICTED: valyl-tRNA synthetase-like [Bos taurus]. 1195e-27O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVARSvalyl-tRNA synthetase [Sus scrofa]. 1225e-28O


Assembly Members: 454      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010026C07ADR01_0026_C07.bDB783775 AK389248
ADR010030F03ADR01_0030_F03.bDB784161 
ADR010037H09ADR01_0037_H09.bDB784822 
ADR010071E10ADR01_0071_E10.bDB787819 
ADR010086A12ADR01_0086_A12.bDB789108 
ADR010088G05ADR01_0088_G05.bDB789345 
AMP010012H10AMP01_0012_H10.bBW955905 
AMP010027F08AMP01_0027_F08.bBW957049 
BFLT10068H03BFLT1_0068_H03.bFS645453 
BFLT10094D12BFLT1_0094_D12.bFS647474 
BFLT10144D02BFLT1_0144_D02.bHX205112 
BFLT10145A02BFLT1_0145_A02.bHX205155 
BKFL10010F08BKFL1_0010_F08.bFS648607 
BKFL10034H11BKFL1_0034_H11.bFS650322 
BKFL10053A07BKFL1_0053_A07.bFS651949 
BKFL10078A04BKFL1_0078_A04.bFS653270 
BMWN10044E06BMWN1_0044_E06.bHX208182 
BMWN10068A07BMWN1_0068_A07.bHX209684 
CLNT10007D05CLNT1_0007_D05.bFS657592 
CLNT10031A07CLNT1_0031_A07.bFS659453 
CLNT10058F11CLNT1_0058_F11.bFS661654 
CLNT10072F06CLNT1_0072_F06.bFS662774 
CLNT10078E05CLNT1_0078_E05.b  
CLNT10083C10CLNT1_0083_C10.b  
CLNT10084C08CLNT1_0084_C08.b  
CLNT10089A10CLNT1_0089_A10.bFS663452 
CLNT10104C08CLNT1_0104_C08.bHX219445 
CLNT10107G10CLNT1_0107_G10.bHX219727 
CLNT10112C07CLNT1_0112_C07.bHX220063 
CLNT10114C07CLNT1_0114_C07.bHX220223 
CLNT10116B03CLNT1_0116_B03.bHX220368 
CLNT10138H09CLNT1_0138_H09.bHX222103 
CLNT10147H12CLNT1_0147_H12.bHX222819 
CLNT10148C08CLNT1_0148_C08.bHX222845 
CLNT10148F03CLNT1_0148_F03.bHX222870 
CLNT10148H06CLNT1_0148_H06.bHX222891 
DCI010001F02DCI01_0001_F02.bDB790660 
DCI010005D05DCI01_0005_D05.bDB790916 
DCI010009C10DCI01_0009_C10.bDB791118 
DCI010036H01DCI01_0036_H01.bDB793545 
DCI010038D11DCI01_0038_D11.bDB793686 
DCI010044C01DCI01_0044_C01.bDB794094 
DCI010048F10DCI01_0048_F10.bDB794386 AK391341
DCI010064D12DCI01_0064_D12.bDB795270 
DCI010115H07DCI01_0115_H07.bDB799805 
DCI010116G04DCI01_0116_G04.bDB799881 
ILNT10086B06ILNT1_0086_B06.bHX233599 
ITT010002B04ITT01_0002_B04.bBW976143 
ITT010003F12ITT01_0003_F12.bBW976285 
ITT010005B04ITT01_0005_B04.bBW976417 
ITT010011G01ITT01_0011_G01.bBW977025 
ITT010012D07ITT01_0012_D07.bBW977089 
ITT010025E07ITT01_0025_E07.bBW978268 
ITT010028B08ITT01_0028_B08.bBW978506 
ITT010028F08ITT01_0028_F08.bBW978552 
ITT010030F07ITT01_0030_F07.bBW978719 
ITT010038D03ITT01_0038_D03.bBW979420 
ITT010038E08ITT01_0038_E08.bBW979437 
ITT010048B11ITT01_0048_B11.bBW980221 
ITT010053A09ITT01_0053_A09.bBW980667 
ITT010053C01ITT01_0053_C01.bBW980682 
ITT010057G09ITT01_0057_G09.bBW981100 
ITT010058E11ITT01_0058_E11.bBW981170 
ITT010060G02ITT01_0060_G02.bBW981365 
ITT010071E08ITT01_0071_E08.bBW982336 
ITT010078B06ITT01_0078_B06.bBW982905 
ITT010079H01ITT01_0079_H01.b  
ITT010088C08ITT01_0088_C08.bBW983803 
ITT010088G07ITT01_0088_G07.bBW983843 
ITT010103H12ITT01_0103_H12.bBW985219 
LNG010005D09LNG01_0005_D09.bBP436590 
LNG010033C03LNG01_0033_C03.bBP435139 
LNG010033C09LNG01_0033_C09.bBP435641 
LNG010036G03LNG01_0036_G03.bBP439148 
LNG010067D07LNG01_0067_D07.bBP436480 
LNG010083A10LNG01_0083_A10.bBP433801 
LVR010102E10LVR01_0102_E10.bBP445266 
LVRM10027E05LVRM1_0027_E05.bBP139523 
LVRM10055E11LVRM1_0055_E11.bBP139754 
LVRM10057H10LVRM1_0057_H10.bBP141137 
LVRM10082H08LVRM1_0082_H08.bCJ002585 
LVRM10089G10LVRM1_0089_G10.bCJ003164 
LVRM10105G12LVRM1_0105_G12.bBP453759 
LVRM10113E11LVRM1_0113_E11.bBP452070 
LVRM10124D11LVRM1_0124_D11.bBP451288 
LVRM10130G12LVRM1_0130_G12.bBP453782 
LVRM10139E01LVRM1_0139_E01.bBP451432 
LVRM10141H04LVRM1_0141_H04.bBP454058 
LVRM10142E03LVRM1_0142_E03.bBP451564 
LVRM10143B04LVRM1_0143_B04.bBP449173 
LVRM10151G06LVRM1_0151_G06.bBP453372 
LVRM10159B02LVRM1_0159_B02.bBP449056 
MLN010008E08MLN01_0008_E08.bCJ008321 
MLN010019E06MLN01_0019_E06.bCJ009075 
MLN010020F12MLN01_0020_F12.bCJ009172 
MLN010027F10MLN01_0027_F10.bCJ009748 
MLN010043C10MLN01_0043_C10.bCJ011028 
MLN010048H08MLN01_0048_H08.bBW963594 
MLN010050B08MLN01_0050_B08.bCJ011507 
MLN010056F11MLN01_0056_F11.bBW963628 
MLN010060G10MLN01_0060_G10.bBW963670 
MLN010080H02MLN01_0080_H02.bCJ014045 
MLN010081E08MLN01_0081_E08.bCJ014101 
MLN010094D05MLN01_0094_D05.bCJ015197 
MLTL10001G05MLTL1_0001_G05.bFS678530 
MLTL10006D10MLTL1_0006_D10.bFS678936 
MLTL10015A02MLTL1_0015_A02.bFS679656 
MLTL10023D08MLTL1_0023_D08.bFS680395 
MLTL10028D05MLTL1_0028_D05.bFS680843 
MLTL10043C01MLTL1_0043_C01.bFS682133 
MLTL10048A10MLTL1_0048_A10.bFS682564 
MLTL10073D10MLTL1_0073_D10.bFS683929 
MLTL10085A12MLTL1_0085_A12.bFS684965 
MLTL10086A04MLTL1_0086_A04.bFS685049 
MLTL10090E09MLTL1_0090_E09.bFS685466 
MLTL10095F11MLTL1_0095_F11.bFS685910 
MLTL10100A05MLTL1_0100_A05.bFS686298 
OVR010005A12OVR01_0005_A12.bBP141662 
OVR010012B04OVR01_0012_B04.bBP141806 
OVR010012F07OVR01_0012_F07.bBP143719 
OVR010019A01OVR01_0019_A01.bBP141250 
OVR010019E10OVR01_0019_E10.bBP143380 
OVR010025B03OVR01_0025_B03.bBP141780 
OVR010025E06OVR01_0025_E06.bBP143241 
OVR010038B07OVR01_0038_B07.bBP141930 
OVR010041H12OVR01_0041_H12.bBP144837 
OVR010048D02OVR01_0048_D02.bBP142660 
OVR010054D10OVR01_0054_D10.bBW964432 
OVR010055H05OVR01_0055_H05.bBW964560 
OVR010056B12OVR01_0056_B12.bBW964586 
OVR010057G04OVR01_0057_G04.bBW964726 
OVR010069H12OVR01_0069_H12.bBW965811 
OVR010072D06OVR01_0072_D06.bBW966035 
OVR010079A11OVR01_0079_A11.bBW966582 
OVR010090C02OVR01_0090_C02.bBW967362 
OVR010094C10OVR01_0094_C10.bBW967682 
OVR010097D06OVR01_0097_D06.bBW967905 
OVR010099H05OVR01_0099_H05.bBW968105 
OVRM10003H09OVRM1_0003_H09.bBP154557 
OVRM10008G11OVRM1_0008_G11.bBP153441 
OVRM10008H11OVRM1_0008_H11.bBP154774 
OVRM10009D01OVRM1_0009_D01.bBP148658 
OVRM10013G02OVRM1_0013_G02.bBP152476 
OVRM10013G06OVRM1_0013_G06.bBP152895 
OVRM10014E05OVRM1_0014_E05.bBP150317 
OVRM10017B05OVRM1_0017_B05.bBP146561 
OVRM10019B11OVRM1_0019_B11.bBP456374 
OVRM10020C11OVRM1_0020_C11.bBP148441 
OVRM10024F04OVRM1_0024_F04.bBP459650 
OVRM10032C06OVRM1_0032_C06.bBP147915 
OVRM10033G04OVRM1_0033_G04.bBP152690 
OVRM10037D10OVRM1_0037_D10.bBP458208 
OVRM10037G01OVRM1_0037_G01.bBP460406 
OVRM10037H10OVRM1_0037_H10.b  AK347995
OVRM10038H06OVRM1_0038_H06.bBP461750 
OVRM10040E02OVRM1_0040_E02.bBP458539 
OVRM10041F01OVRM1_0041_F01.bBP459406 
OVRM10044C03OVRM1_0044_C03.bBP456695 
OVRM10048A11OVRM1_0048_A11.bBP455411 
OVRM10048H12OVRM1_0048_H12.bBP462235 
OVRM10053C01OVRM1_0053_C01.bBP147425 
OVRM10055G09OVRM1_0055_G09.bBP153243 
OVRM10058H02OVRM1_0058_H02.bBP153805 
OVRM10060F02OVRM1_0060_F02.bBP151270 
OVRM10062A07OVRM1_0062_A07.bBP145508 
OVRM10066B05OVRM1_0066_B05.bBP146591 
OVRM10075F09OVRM1_0075_F09.bBP152012 
OVRM10077E10OVRM1_0077_E10.bBP150863 
OVRM10080H01OVRM1_0080_H01.bBP153724 
OVRM10081B06OVRM1_0081_B06.bBP146709 
OVRM10082E02OVRM1_0082_E02.bBP150056 
OVRM10090D03OVRM1_0090_D03.bBP148916 
OVRM10092E12OVRM1_0092_E12.bBP151105 
OVRM10093D05OVRM1_0093_D05.bBP149130 
OVRM10094D04OVRM1_0094_D04.bBP149029 
OVRM10097F05OVRM1_0097_F05.bBP151620 
OVRM10098E02OVRM1_0098_E02.bBP150069 
OVRM10099D05OVRM1_0099_D05.bBP149135 
OVRM10102F01OVRM1_0102_F01.bBP151206 
OVRM10102F09OVRM1_0102_F09.bBP152035 
OVRM10103D08OVRM1_0103_D08.bBP149451 
OVRM10103F01OVRM1_0103_F01.bBP151207 
OVRM10107D06OVRM1_0107_D06.bBP149246 
OVRM10110B09OVRM1_0110_B09.bBP147054 
OVRM10112F08OVRM1_0112_F08.bBP151938 
OVRM10113C03OVRM1_0113_C03.bBP147661 
OVRM10115H08OVRM1_0115_H08.bBP154534 
OVRM10119H08OVRM1_0119_H08.bBP154538 
OVRM10120G01OVRM1_0120_G01.bBP152458 
OVRM10122F06OVRM1_0122_F06.bBP151742 
OVRM10124G11OVRM1_0124_G11.bBP153540 
OVRM10130B01OVRM1_0130_B01.bBP146227 
OVRM10136C12OVRM1_0136_C12.bBP148650 
OVRM10150E02OVRM1_0150_E02.bBP458549 
OVRM10151G11OVRM1_0151_G11.bBP461225 
OVRM10154C03OVRM1_0154_C03.bBP456704 
OVRM10156G02OVRM1_0156_G02.bBP460503 
OVRM10160B06OVRM1_0160_B06.bBP455991 
OVRM10162E03OVRM1_0162_E03.bBP458639 
OVRM10167A05OVRM1_0167_A05.bBP454984 
OVRM10167F05OVRM1_0167_F05.bBP459766 
OVRM10174F08OVRM1_0174_F08.bBP460020 
OVRM10176B12OVRM1_0176_B12.bBP456484 
OVRM10181C10OVRM1_0181_C10.bBP457278 
OVRM10182D02OVRM1_0182_D02.bBP457604 
OVRM10185F04OVRM1_0185_F04.bBP459691 
OVRM10186B09OVRM1_0186_B09.bBP456256 
OVRM10189A06OVRM1_0189_A06.bBP455078 
OVRM10189C02OVRM1_0189_C02.bBP456652 
OVRM10189E04OVRM1_0189_E04.bBP458743 
OVRM10192F04OVRM1_0192_F04.bBP459698 
OVRM10194A07OVRM1_0194_A07.bBP455157 
OVRM10194C01OVRM1_0194_C01.bBP456574 
OVRM10194D11OVRM1_0194_D11.bBP458341 
OVRM10195E01OVRM1_0195_E01.bBP458504 
OVRM10198D03OVRM1_0198_D03.bBP457692 
OVRM10204D06OVRM1_0204_D06.bBP457944 
OVRM10205D02OVRM1_0205_D02.bBP457625 
OVRM10209E05OVRM1_0209_E05.bBP458834 
OVRM10214B04OVRM1_0214_B04.bBP455867 
OVRM10222A12OVRM1_0222_A12.bBP455545 
OVRT10040C02OVRT1_0040_C02.bFS689651 
OVRT10043A08OVRT1_0043_A08.bFS689879 
OVRT10043C03OVRT1_0043_C03.bFS689895 
OVRT10077G12OVRT1_0077_G12.bFS692714 
OVRT10081H03OVRT1_0081_H03.bFS693045 
OVRT10125F06OVRT1_0125_F06.bHX236835 
OVRT10134H10OVRT1_0134_H10.bHX237577 
OVRT10138E07OVRT1_0138_E07.bHX237870 
OVRT10143B08OVRT1_0143_B08.bHX238253 
OVRT10145G09OVRT1_0145_G09.bHX238470 
OVRT10146B08OVRT1_0146_B08.bHX238504 
OVRT10149C02OVRT1_0149_C02.bHX238760 
PBL010009B12PBL01_0009_B12.bBW969020 
PBL010009G12PBL01_0009_G12.bBW969063 
PBL010011G12PBL01_0011_G12.bBP156397 
PBL010013C09PBL01_0013_C09.bBW969326 
PBL010016F05PBL01_0016_F05.bBW969483 
PBL010018E06PBL01_0018_E06.bBW969594 
PBL010022D04PBL01_0022_D04.bBW969844 AK396026
PBL010027E08PBL01_0027_E08.bBW969963 
PBL010034G07PBL01_0034_G07.bBW970143 
PBL010036B12PBL01_0036_B12.bBP155461 
PBL010039D08PBL01_0039_D08.bBW970351 
PBL010043H08PBL01_0043_H08.bBW970652 
PBL010053F07PBL01_0053_F07.bBW971222 
PBL010058G06PBL01_0058_G06.bBW971524 
PBL010060H09PBL01_0060_H09.bBW971642 
PBL010062F09PBL01_0062_F09.bBW971786 
PBL010063C04PBL01_0063_C04.bBW971829 
PBL010066D09PBL01_0066_D09.bBW972092 
PBL010073D01PBL01_0073_D01.bBP462403 
PBL010075A05PBL01_0075_A05.bBW972796 
PBL010077D04PBL01_0077_D04.bBW972998 
PBL010081C10PBL01_0081_C10.bBW973356 
PBL010082C09PBL01_0082_C09.bBW973446 
PBL010083C09PBL01_0083_C09.bBW973537 
PBL010084E08PBL01_0084_E08.bBW973640 
PBL010088C04PBL01_0088_C04.bBW973971 
PBL010088G07PBL01_0088_G07.bBW974019 
PBL010089C02PBL01_0089_C02.bBW974061 
PBL010089F11PBL01_0089_F11.bBW974103 
PBL010090F05PBL01_0090_F05.bBW974180 
PBL010093D02PBL01_0093_D02.bBW974375 
PBL010093D07PBL01_0093_D07.bBW974379 
PBL010094C11PBL01_0094_C11.bBW974438 
PBL010097A03PBL01_0097_A03.bBW974654 
PBL010100B12PBL01_0100_B12.bBW974947 
PCT010001B06PCT01_0001_B06.bFS694635 
PCT010004H10PCT01_0004_H10.bFS694905 
PCT010005G08PCT01_0005_G08.bFS694965 
PCT010006A03PCT01_0006_A03.bFS694979 
PCT010008C11PCT01_0008_C11.bFS695152 
PCT010011C05PCT01_0011_C05.bFS695376 
PCT010018A02PCT01_0018_A02.bHX239085 
PCT010024B05PCT01_0024_B05.bFS696222 
PCT010028G09PCT01_0028_G09.b  
PST010005F01PST01_0005_F01.bFS697398 
PST010022D04PST01_0022_D04.bFS698711 
PST010023D09PST01_0023_D09.bFS698800 
PST010045D03PST01_0045_D03.bFS700374 
PST010076B10PST01_0076_B10.bFS702811 
PST010081D04PST01_0081_D04.bFS703232 
PST010086B01PST01_0086_B01.bFS703624 
SKNB10001H01SKNB1_0001_H01.bDB800131 
SKNB10017A01SKNB1_0017_A01.bDB800904 
SKNB10036B08SKNB1_0036_B08.b  
SKNB10056E03SKNB1_0056_E03.bDB803341 
SKNB10058G02SKNB1_0058_G02.bDB803493 
SKNB10064H02SKNB1_0064_H02.bDB803917 
SKNB10068E04SKNB1_0068_E04.bDB804120 
SKNB10072F06SKNB1_0072_F06.bDB804408 
SKNB10074F06SKNB1_0074_F06.bDB804536 
SKNB10076H06SKNB1_0076_H06.bDB804662 
SKNB10082C12SKNB1_0082_C12.b  
SKNB10083G09SKNB1_0083_G09.bDB805062 
SKNB10100E04SKNB1_0100_E04.bDB806033 
SKNB10100H07SKNB1_0100_H07.b  
SMG010004G06SMG01_0004_G06.bFS713809 
SMG010015E03SMG01_0015_E03.bFS714563 
SMG010016F04SMG01_0016_F04.bFS714662 
SMG010034E04SMG01_0034_E04.bFS716265 
SMG010034F12SMG01_0034_F12.bFS716282 
SMG010040C11SMG01_0040_C11.bFS716768 
SMG010043C09SMG01_0043_C09.bFS717014 
SMG010058C01SMG01_0058_C01.bFS718268 
SMG010059E10SMG01_0059_E10.bFS718377 
SMG010071G02SMG01_0071_G02.bFS719428 
SMG010077E07SMG01_0077_E07.bFS719931 
SMG010081H03SMG01_0081_H03.bFS720309 
SMG010099D02SMG01_0099_D02.bFS721776 
SMG010101A05SMG01_0101_A05.bFS721879 
SPL010004D03SPL01_0004_D03.bBP157726 
SPL010018D01SPL01_0018_D01.bBP157676 
SPL010018G02SPL01_0018_G02.bBP158742 
SPL010020C04SPL01_0020_C04.bBP157425 
SPL010023B11SPL01_0023_B11.bBP157281 
SPL010024G09SPL01_0024_G09.bBP158954 
SPL010024H11SPL01_0024_H11.bBP159328 
SPL010026G11SPL01_0026_G11.bBP159005 
SPL010029B01SPL01_0029_B01.bCJ016213 
SPL010029E04SPL01_0029_E04.bCJ016249 
SPL010060E04SPL01_0060_E04.bCJ018420 
SPL010063D11SPL01_0063_D11.bCJ018691 
SPL010063H08SPL01_0063_H08.bCJ018735 
SPL010064B07SPL01_0064_B07.bCJ018758 
SPL010066D06SPL01_0066_D06.bCJ018956 
SPL010069H10SPL01_0069_H10.bCJ019272 
SPL010076D05SPL01_0076_D05.bCJ019854 
SPLT10029B04SPLT1_0029_B04.bHX241424 
SPLT10049C02SPLT1_0049_C02.bHX242998 
SPLT10053B04SPLT1_0053_B04.bHX243267 
SPLT10053F10SPLT1_0053_F10.bHX243311 
SPLT10061E03SPLT1_0061_E03.bHX243930 
SPLT10083F04SPLT1_0083_F04.bHX245683 
TCH010015C03TCH01_0015_C03.bCJ023529 
TCH010016D01TCH01_0016_D01.bCJ023614 
TCH010033A06TCH01_0033_A06.bCJ024860 
TCH010034H10TCH01_0034_H10.bCJ025004 
TCH010045B08TCH01_0045_B08.bCJ025790 AK399326
TCH010058H05TCH01_0058_H05.bCJ026597 
TCH010081D05TCH01_0081_D05.bCJ028294 
TES010001F02TES01_0001_F02.bCJ030063 
TES010002C03TES01_0002_C03.bCJ030102 
TES010004E07TES01_0004_E07.bCJ030258 
TES010008B04TES01_0008_B04.bCJ030507 
TES010012C09TES01_0012_C09.bCJ030796 
TES010012E02TES01_0012_E02.bCJ030806 
TES010013A05TES01_0013_A05.bCJ030839 
TES010013F06TES01_0013_F06.bCJ030885 
TES010015F09TES01_0015_F09.bCJ031027 
TES010016D02TES01_0016_D02.bCJ031073 
TES010019B04TES01_0019_B04.bCJ031261 
TES010020B04TES01_0020_B04.bCJ031323 
TES010026A07TES01_0026_A07.b  
TES010027H05TES01_0027_H05.bCJ031818 
TES010029E01TES01_0029_E01.bFS722187 
TES010030A11TES01_0030_A11.bCJ031961 
TES010030A12TES01_0030_A12.b  
TES010032H03TES01_0032_H03.bCJ032145 
TES010036F11TES01_0036_F11.bCJ032395 
TES010036H06TES01_0036_H06.bCJ032409 
TES010038F01TES01_0038_F01.bCJ032515 
TES010038G05TES01_0038_G05.bCJ032525 
TES010041H07TES01_0041_H07.bCJ032687 
TES010044B07TES01_0044_B07.bCJ032824 
TES010044F03TES01_0044_F03.bCJ032847 
TES010044H09TES01_0044_H09.bCJ032869 
TES010047F09TES01_0047_F09.bCJ033038 
TES010052A09TES01_0052_A09.bCJ033300 
TES010058H09TES01_0058_H09.bCJ033741 
TES010060F08TES01_0060_F08.bCJ033863 
TES010067G12TES01_0067_G12.bCJ034346 
TES010068C01TES01_0068_C01.bCJ034373 
TES010070C03TES01_0070_C03.bCJ034507 
TES010071F08TES01_0071_F08.bCJ034602 
TES010075E07TES01_0075_E07.bCJ034830 
TES010076A05TES01_0076_A05.bCJ034867 
TES010079D10TES01_0079_D10.b  
TES010080D10TES01_0080_D10.bCJ035156 
TES010080F06TES01_0080_F06.bCJ035170 
TES010083E04TES01_0083_E04.bCJ035362 
TES010090E03TES01_0090_E03.b  
TES010093C12TES01_0093_C12.bCJ036029 
TES010093H11TES01_0093_H11.bCJ036072 
TES010094F06TES01_0094_F06.bCJ036124 
TES010099H05TES01_0099_H05.bCJ036522 
TES010104D02TES01_0104_D02.bCJ036851 
TES010105F03TES01_0105_F03.b  
TES010108A02TES01_0108_A02.bCJ037100 
TES010108G03TES01_0108_G03.bCJ037151 
TES010109A12TES01_0109_A12.bCJ037175 
TES010110H06TES01_0110_H06.bCJ037288 
TES010111G05TES01_0111_G05.bCJ037343 
TES010112B02TES01_0112_B02.bCJ037373 
THY010002F02THY01_0002_F02.bBP165680 
THY010004F09THY01_0004_F09.bBP166415 
THY010005F09THY01_0005_F09.b  
THY010011A06THY01_0011_A06.bBP159879 
THY010011G03THY01_0011_G03.bBP167039 
THY010014A12THY01_0014_A12.bBP160486 
THY010015G03THY01_0015_G03.bBP167043 
THY010021A07THY01_0021_A07.bBP159989 
THY010036G10THY01_0036_G10.bBP167807 
THY010053C11THY01_0053_C11.bBP162912 
THY010056A04THY01_0056_A04.bBP159714 
THY010061F02THY01_0061_F02.bBP165732 
THY010063G09THY01_0063_G09.bBP167726 
THY010065C03THY01_0065_C03.bBP162093 
THY010066H12THY01_0066_H12.bBP169335 
THY010068H12THY01_0068_H12.bBP169337 
THY010069D12THY01_0069_D12.bBP164275 
THY010071C11THY01_0071_C11.bBP162930 
THY010074D04THY01_0074_D04.bBP163447 
THY010094B10THY01_0094_B10.bBP161591 
THY010095H06THY01_0095_H06.bBP168708 
THY010096D02THY01_0096_D02.bBP163261 
THY010098C02THY01_0098_C02.bBP162014 
THY010102H04THY01_0102_H04.bBP168499 
THY010109D08THY01_0109_D08.bBP163884 
THY010111A06THY01_0111_A06.bBP159952 
THY010111B01THY01_0111_B01.bBP160661 
THY010111C04THY01_0111_C04.bBP162230 
THY010112G04THY01_0112_G04.bBP167235 
THY010118C06THY01_0118_C06.bBP162436 
THY010121C04THY01_0121_C04.bBP162237 
THY010121F02THY01_0121_F02.bBP165779 
THY010123E12THY01_0123_E12.bBP165566 
THY010205A04THY01_0205_A04.bBP159771 
UTR010005B11UTR01_0005_B11.bBP170333 
UTR010012C09UTR01_0012_C09.bBP170791 
UTR010013A11UTR01_0013_A11.bBP169810 
UTR010014E06UTR01_0014_E06.bBP171728 
UTR010015C07UTR01_0015_C07.bBP170703 
UTR010017A08UTR01_0017_A08.bBP169677 
UTR010019F05UTR01_0019_F05.bBP172221 
UTR010032E10UTR01_0032_E10.bBP171922 
UTR010037G01UTR01_0037_G01.bBP172590 
UTR010038F01UTR01_0038_F01.bBP172056 
UTR010044B07UTR01_0044_B07.bBP170193 
UTR010048C08UTR01_0048_C08.bBP170778 
UTR010049B01UTR01_0049_B01.bBP169927 
UTR010051G12UTR01_0051_G12.bBP464668 
UTR010056E07UTR01_0056_E07.bBP463971 
UTR010060B06UTR01_0060_B06.bBP463091 
UTR010068E05UTR01_0068_E05.bBP463939 
UTR010070D07UTR01_0070_D07.bBP463701 
UTR010082G12UTR01_0082_G12.bCJ037604 
UTR010088C07UTR01_0088_C07.bCJ038109 
UTR010088H02UTR01_0088_H02.bCJ038163 
UTR010092C03UTR01_0092_C03.bCJ038471 
UTR010096D05UTR01_0096_D05.bCJ038855 
UTR010098A10UTR01_0098_A10.bCJ038920 
UTR010106B09UTR01_0106_B09.bCJ039671 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
288C299960.884WSTAC/Y
T5200.116TAT/Y
549A11300.297WSGTA/V
C187810.703GTC/V


Alignment:      TOP

20110601C-001573 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0045_B08.b :
OVRM1_0090_D03.b :
UTR01_0012_C09.b :
TES01_0029_E01.b :
SPLT1_0049_C02.b :
DCI01_0048_F10.b : nnnaaagtaatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0047_F09.b :
TES01_0012_E02.b :
SMG01_0043_C09.b :
TES01_0108_A02.b :
THY01_0069_D12.b :
SPL01_0026_G11.b :
TES01_0044_F03.b :
TES01_0027_H05.b :
OVR01_0090_C02.b :
MLTL1_0015_A02.b : nnncctatcaaatgagntnntnncgctctttanaanggatactaaxxxxxxxxxxxxxxx
THY01_0121_F02.b :
TES01_0038_G05.b :
UTR01_0005_B11.b :
ITT01_0057_G09.b :
TES01_0002_C03.b :
TES01_0060_F08.b :
SKNB1_0001_H01.b :
OVRM1_0182_D02.b :
OVR01_0038_B07.b :
SPL01_0023_B11.b :
OVR01_0097_D06.b :
OVR01_0094_C10.b :
UTR01_0038_F01.b :
MLN01_0019_E06.b :
PBL01_0063_C04.b :
UTR01_0096_D05.b :
ITT01_0038_D03.b :
THY01_0095_H06.b :
PBL01_0077_D04.b :
MLN01_0094_D05.b :
THY01_0123_E12.b :
THY01_0121_C04.b :
LVRM1_0142_E03.b :
OVRM1_0209_E05.b :
UTR01_0082_G12.b :
OVRM1_0119_H08.b :
SPL01_0024_H11.b :
TES01_0030_A11.b :
DCI01_0044_C01.b : ngtaactaaxxxxxxxxxxxxxxx
OVRT1_0143_B08.b :
MLTL1_0085_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0012_H10.b : nnnaaacgtaatctaagggctxxxxxxxxx
BMWN1_0068_A07.b :
UTR01_0044_B07.b :
SPLT1_0061_E03.b :
UTR01_0019_F05.b :
MLN01_0020_F12.b :
SPLT1_0083_F04.b :
OVRT1_0043_A08.b :
SPL01_0076_D05.b :
SMG01_0077_E07.b :
LNG01_0005_D09.b :
LNG01_0033_C03.b :
SKNB1_0100_H07.b :
AMP01_0027_F08.b : attttaaagaacattaaxxxxxxxxxxxxxxxx
PBL01_0060_H09.b :
SPLT1_0053_F10.b :
BMWN1_0044_E06.b :
OVR01_0025_B03.b :
BKFL1_0078_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0048_D02.b :
TES01_0008_B04.b :
LNG01_0067_D07.b :
MLN01_0080_H02.b :
TES01_0015_F09.b :
OVR01_0019_A01.b :
ITT01_0030_F07.b :
UTR01_0088_H02.b :
ITT01_0038_E08.b :
DCI01_0064_D12.b : nnnnaaacatatcaaxxxxxxxxxxxxx
OVRM1_0037_H10.b :
OVRM1_0102_F01.b :
OVRM1_0107_D06.b :
OVRM1_0154_C03.b :
THY01_0111_A06.b :
SMG01_0099_D02.b :
OVRM1_0222_A12.b :
CLNT1_0148_H06.b :
OVRM1_0009_D01.b :
TES01_0070_C03.b :
THY01_0011_A06.b :
OVRM1_0080_H01.b :
OVRM1_0122_F06.b :
OVRM1_0136_C12.b :
OVRM1_0075_F09.b :
OVRM1_0194_C01.b :
DCI01_0036_H01.b : tgtatctaaxxxxxxxxxxxx
OVRM1_0044_C03.b :
OVRM1_0037_D10.b :
OVRM1_0162_E03.b :
OVRM1_0008_G11.b :
OVRM1_0099_D05.b :
TES01_0041_H07.b :
SPL01_0029_E04.b :
TES01_0110_H06.b :
OVRM1_0205_D02.b :
LVRM1_0159_B02.b :
OVRM1_0013_G02.b :
LVRM1_0105_G12.b :
OVRM1_0115_H08.b :
OVRM1_0094_D04.b :
OVRM1_0103_D08.b :
OVR01_0072_D06.b :
OVRM1_0110_B09.b :
SPL01_0063_D11.b :
SPL01_0020_C04.b :
MLTL1_0001_G05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0043_C01.b : ngggaaatnnnnnntagatactaaxxxxxxxxxxxxx
DCI01_0115_H07.b : nnnccactannnnnaacgaatctaaxxxxxxxxxxxx
PCT01_0001_B06.b :
BKFL1_0010_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0100_A05.b : nnnccgtatnnnnnnnaagatacctaaxxxxxxxxxxxxxx
SPLT1_0029_B04.b :
TES01_0109_A12.b :
OVRT1_0149_C02.b :
TES01_0038_F01.b :
UTR01_0017_A08.b :
OVR01_0041_H12.b :
OVR01_0057_G04.b :
PBL01_0009_G12.b :
DCI01_0001_F02.b : accctctagggtatcttxxxxxxxxxxxxxx
PBL01_0036_B12.b :
OVRT1_0040_C02.b :
LNG01_0083_A10.b :
CLNT1_0148_F03.b :
OVRT1_0146_B08.b :
OVR01_0019_E10.b :
THY01_0094_B10.b :
UTR01_0051_G12.b :
CLNT1_0089_A10.b :
MLTL1_0086_A04.b : nnnnccaattnnnnnnnaatacctatagggctgctccc
THY01_0071_C11.b :
UTR01_0098_A10.b :
UTR01_0049_B01.b :
MLTL1_0090_E09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0023_D09.b :
MLTL1_0006_D10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0048_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0073_D10.b : nnncccaaannnnnntagaaccnatxxxxxxxxxxxxxx
THY01_0061_F02.b :
OVR01_0012_F07.b :
ADR01_0088_G05.b :
DCI01_0005_D05.b : nnggtaatctaagggctgctccc
ITT01_0005_B04.b :
THY01_0056_A04.b :
ITT01_0088_C08.b :
ITT01_0053_C01.b :
ITT01_0053_A09.b :
THY01_0111_C04.b :
SMG01_0058_C01.b :
OVR01_0099_H05.b :
OVRM1_0189_A06.b :
TES01_0108_G03.b :
LVRM1_0113_E11.b :
OVRM1_0195_E01.b :
OVRM1_0041_F01.b :
TES01_0093_H11.b :
SMG01_0034_E04.b :
OVRM1_0150_E02.b :
OVR01_0079_A11.b :
OVRM1_0192_F04.b :
THY01_0011_G03.b :
BFLT1_0144_D02.b :
OVR01_0069_H12.b :
OVRM1_0008_H11.b :
LVRM1_0143_B04.b :
LVRM1_0139_E01.b :
OVRM1_0167_F05.b :
OVRM1_0077_E10.b :
LVRM1_0141_H04.b :
OVRM1_0124_G11.b :
LVRM1_0130_G12.b :
UTR01_0013_A11.b :
OVRM1_0102_F09.b :
THY01_0021_A07.b :
UTR01_0068_E05.b :
UTR01_0056_E07.b :
THY01_0015_G03.b :
UTR01_0037_G01.b :
SMG01_0034_F12.b :
BFLT1_0094_D12.b :
TES01_0075_E07.b :
OVRT1_0138_E07.b :
OVR01_0055_H05.b :
SMG01_0015_E03.b :
LVR01_0102_E10.b :
CLNT1_0116_B03.b :
UTR01_0032_E10.b :
CLNT1_0112_C07.b :
UTR01_0015_C07.b :
CLNT1_0104_C08.b :
SPL01_0063_H08.b :
OVRT1_0134_H10.b :
TES01_0032_H03.b :
PCT01_0024_B05.b :
OVRT1_0081_H03.b :
PBL01_0011_G12.b :
SPL01_0029_B01.b :
SPLT1_0053_B04.b :
TES01_0094_F06.b :
PBL01_0039_D08.b :
UTR01_0106_B09.b :
PBL01_0073_D01.b :
ITT01_0028_B08.b :
PBL01_0093_D07.b :
PBL01_0043_H08.b :
TES01_0001_F02.b :
PBL01_0089_C02.b :
TES01_0019_B04.b :
TCH01_0058_H05.b :
CLNT1_0007_D05.b :
PBL01_0022_D04.b :
ITT01_0103_H12.b :
UTR01_0088_C07.b :
CLNT1_0072_F06.b :
SPL01_0066_D06.b :
PBL01_0094_C11.b :
ITT01_0003_F12.b :
PBL01_0097_A03.b :
ITT01_0002_B04.b :
ITT01_0011_G01.b :
TCH01_0015_C03.b :
OVRM1_0176_B12.b :
OVRM1_0174_F08.b :
OVRM1_0214_B04.b :
LVRM1_0089_G10.b :
THY01_0112_G04.b :
THY01_0111_B01.b :
THY01_0118_C06.b :
THY01_0005_F09.b : ttt
OVRM1_0156_G02.b :
TES01_0036_H06.b :
LVRM1_0027_E05.b :
OVRM1_0040_E02.b :
LVRM1_0082_H08.b :
OVRM1_0181_C10.b :
OVRM1_0113_C03.b :
OVRM1_0013_G06.b :
OVRM1_0198_D03.b :
OVRM1_0194_A07.b :
OVRM1_0081_B06.b :
OVRM1_0120_G01.b :
OVRM1_0189_C02.b :
OVRM1_0062_A07.b :
OVRM1_0060_F02.b :
TES01_0079_D10.b :
OVRM1_0130_B01.b :
OVR01_0056_B12.b :
LVRM1_0057_H10.b :
OVRM1_0055_G09.b :
OVRM1_0037_G01.b :
OVRM1_0151_G11.b :
OVRM1_0189_E04.b :
OVRM1_0194_D11.b :
LVRM1_0151_G06.b :
OVRM1_0053_C01.b :
OVRM1_0167_A05.b :
OVRM1_0058_H02.b :
OVRM1_0003_H09.b :
OVRM1_0024_F04.b :
OVRM1_0014_E05.b :
OVRM1_0038_H06.b :
OVRM1_0185_F04.b :
OVRM1_0019_B11.b :
OVRM1_0204_D06.b :
OVRM1_0017_B05.b :
OVRM1_0020_C11.b :
OVRM1_0092_E12.b :
OVRM1_0093_D05.b :
OVRM1_0186_B09.b :
THY01_0068_H12.b :
DCI01_0038_D11.b : nggtatctaaxxxxxxxxxxx
OVRM1_0097_F05.b :
SPL01_0024_G09.b :
THY01_0004_F09.b :
TES01_0026_A07.b :
MLTL1_0028_D05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0059_E10.b :
OVR01_0025_E06.b :
PBL01_0034_G07.b :
ADR01_0030_F03.b :
ADR01_0026_C07.b :
SMG01_0071_G02.b :
BKFL1_0034_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CLNT1_0148_C08.b :
OVRT1_0043_C03.b :
THY01_0014_A12.b :
OVRT1_0125_F06.b :
OVRT1_0145_G09.b :
MLN01_0060_G10.b :
TCH01_0016_D01.b :
CLNT1_0107_G10.b :
CLNT1_0114_C07.b :
PBL01_0018_E06.b :
SMG01_0016_F04.b :
CLNT1_0138_H09.b :
SMG01_0040_C11.b :
LNG01_0033_C09.b :
SPL01_0064_B07.b :
SMG01_0101_A05.b :
LNG01_0036_G03.b :
THY01_0066_H12.b :
THY01_0036_G10.b :
SMG01_0081_H03.b :
PCT01_0028_G09.b :
THY01_0053_C11.b :
SPL01_0060_E04.b :
BKFL1_0053_A07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0005_A12.b :
PBL01_0062_F09.b :
THY01_0096_D02.b :
PBL01_0053_F07.b :
DCI01_0116_G04.b : nnnttcgttannnnnccgatactatagggctgctc
SMG01_0004_G06.b :
MLN01_0081_E08.b :
SKNB1_0074_F06.b :
DCI01_0009_C10.b : aattctatgggatacttaxxxxxxxxxxxxx
BFLT1_0068_H03.b :
ITT01_0025_E07.b :
PBL01_0081_C10.b :
PBL01_0075_A05.b :
ITT01_0060_G02.b :
ITT01_0028_F08.b :
PBL01_0088_C04.b :
PBL01_0090_F05.b :
PBL01_0013_C09.b :
TES01_0052_A09.b :
ITT01_0058_E11.b :
ITT01_0088_G07.b :
TCH01_0034_H10.b :
MLN01_0048_H08.b :
CLNT1_0147_H12.b :
PBL01_0016_F05.b :
CLNT1_0058_F11.b :
MLN01_0008_E08.b :
TES01_0013_A05.b :
TES01_0016_D02.b :
MLN01_0043_C10.b :
PBL01_0088_G07.b :
PBL01_0089_F11.b :
ITT01_0012_D07.b :
SPL01_0018_G02.b :
THY01_0205_A04.b :
PBL01_0082_C09.b :
PBL01_0083_C09.b :
ITT01_0071_E08.b :
ITT01_0078_B06.b :
PBL01_0100_B12.b :
THY01_0098_C02.b :
MLN01_0056_F11.b :
ADR01_0071_E10.b :
OVRT1_0077_G12.b :
OVR01_0012_B04.b :
MLN01_0027_F10.b :
PBL01_0084_E08.b :
CLNT1_0031_A07.b :
PBL01_0066_D09.b :
PBL01_0093_D02.b :
TCH01_0033_A06.b :
SPL01_0018_D01.b :
OVRM1_0048_A11.b :
BFLT1_0145_A02.b :
LVRM1_0055_E11.b :
OVRM1_0066_B05.b :
OVRM1_0103_F01.b :
UTR01_0014_E06.b :
PCT01_0011_C05.b :
PBL01_0009_B12.b :
PBL01_0027_E08.b :
TES01_0080_F06.b :
UTR01_0048_C08.b :
ITT01_0079_H01.b :
UTR01_0060_B06.b :
PBL01_0058_G06.b :
PST01_0005_F01.b :
SKNB1_0082_C12.b :
OVRM1_0048_H12.b :
TES01_0090_E03.b :
TES01_0076_A05.b :
OVRM1_0033_G04.b :
TES01_0099_H05.b :
TES01_0044_B07.b :
SKNB1_0083_G09.b :
SKNB1_0036_B08.b :
MLN01_0050_B08.b :
ITT01_0048_B11.b :
TES01_0030_A12.b :
TES01_0111_G05.b :
TES01_0105_F03.b :
TES01_0093_C12.b :
TES01_0104_D02.b :
TES01_0083_E04.b :
TES01_0058_H09.b :
CLNT1_0084_C08.b :
SKNB1_0100_E04.b :
TES01_0044_H09.b :
TES01_0012_C09.b :
PST01_0086_B01.b :
SKNB1_0056_E03.b :
TES01_0020_B04.b :
PST01_0081_D04.b :
LVRM1_0124_D11.b :
TES01_0004_E07.b :
PCT01_0006_A03.b :
CLNT1_0083_C10.b :
PST01_0076_B10.b :
TES01_0036_F11.b :
ILNT1_0086_B06.b :
TES01_0112_B02.b :
TES01_0067_G12.b :
TES01_0080_D10.b :
PCT01_0018_A02.b :
PST01_0022_D04.b :
PST01_0045_D03.b :
SKNB1_0072_F06.b :
SKNB1_0064_H02.b :
TES01_0071_F08.b :
SKNB1_0076_H06.b :
PCT01_0004_H10.b :
OVRM1_0098_E02.b :
PCT01_0008_C11.b :
SKNB1_0068_E04.b :
SKNB1_0017_A01.b :
THY01_0065_C03.b :
OVRM1_0032_C06.b :
SKNB1_0058_G02.b :
TES01_0013_F06.b :
TES01_0068_C01.b :
MLTL1_0095_F11.b : nnnn
MLTL1_0023_D08.b : nnnncct
TCH01_0081_D05.b :
UTR01_0070_D07.b :
SPL01_0069_H10.b :
OVRM1_0160_B06.b :
OVRM1_0082_E02.b :
OVRM1_0112_F08.b :
CLNT1_0078_E05.b :
THY01_0002_F02.b :
THY01_0074_D04.b :
ADR01_0086_A12.b :
PCT01_0005_G08.b :
THY01_0063_G09.b :
UTR01_0092_C03.b :
SPL01_0004_D03.b :
THY01_0102_H04.b :
ADR01_0037_H09.b :
THY01_0109_D08.b :
OVR01_0054_D10.b :
20110601C-001573 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0045_B08.b : naacttggacttagacxxxxxxxxxxxxxxxxx
OVRM1_0090_D03.b : agttgtcxxxxxxxxxx
UTR01_0012_C09.b : gggttggactaxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0029_E01.b :
SPLT1_0049_C02.b : nnnnnggc
DCI01_0048_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0047_F09.b :
TES01_0012_E02.b :
SMG01_0043_C09.b :
TES01_0108_A02.b :
THY01_0069_D12.b : gggcaataggtgxxxxxxx
SPL01_0026_G11.b : cttttgggtggxxxxxxxxxx
TES01_0044_F03.b :
TES01_0027_H05.b :
OVR01_0090_C02.b : ggcttggact
MLTL1_0015_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0121_F02.b :
TES01_0038_G05.b :
UTR01_0005_B11.b : tttatggt
ITT01_0057_G09.b :
TES01_0002_C03.b :
TES01_0060_F08.b :
SKNB1_0001_H01.b :
OVRM1_0182_D02.b :
OVR01_0038_B07.b : agaaaxxxxxxxxxxxxxx
SPL01_0023_B11.b : ctxxxxxxxxxxxx
OVR01_0097_D06.b : tgtga
OVR01_0094_C10.b : gcattgg
UTR01_0038_F01.b : tggaggacxx
MLN01_0019_E06.b : nggttttcgnnggatag
PBL01_0063_C04.b :
UTR01_0096_D05.b : nnnggcttgga
ITT01_0038_D03.b :
THY01_0095_H06.b : gcatttatggtgxxxx
PBL01_0077_D04.b :
MLN01_0094_D05.b : nng
THY01_0123_E12.b :
THY01_0121_C04.b :
LVRM1_0142_E03.b :
OVRM1_0209_E05.b :
UTR01_0082_G12.b : nnttttgca
OVRM1_0119_H08.b :
SPL01_0024_H11.b : ctxxxxxxxxxxxx
TES01_0030_A11.b :
DCI01_0044_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_B08.b : nnnccgattacnnnn
MLTL1_0085_A12.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0068_A07.b :
UTR01_0044_B07.b : gxxxxxxxxx
SPLT1_0061_E03.b :
UTR01_0019_F05.b : cttttgggggxx
MLN01_0020_F12.b : nnttt
SPLT1_0083_F04.b :
OVRT1_0043_A08.b : n
SPL01_0076_D05.b : ngggctaggactataacxxxxxxxxxxxxxxxxxxx
SMG01_0077_E07.b :
LNG01_0005_D09.b : gtttttttgggcatagtgxxx
LNG01_0033_C03.b : ccatttggat
SKNB1_0100_H07.b :
AMP01_0027_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0060_H09.b :
SPLT1_0053_F10.b :
BMWN1_0044_E06.b :
OVR01_0025_B03.b : taaggagcxxxxx
BKFL1_0078_A04.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0048_D02.b : aggcxxxxxxxxxxx
TES01_0008_B04.b :
LNG01_0067_D07.b : nnnnggat
MLN01_0080_H02.b : ggggggatagga
TES01_0015_F09.b :
OVR01_0019_A01.b : ggggggggcact
ITT01_0030_F07.b :
UTR01_0088_H02.b : nnnccgcta
ITT01_0038_E08.b :
DCI01_0064_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_H10.b :
OVRM1_0102_F01.b :
OVRM1_0107_D06.b :
OVRM1_0154_C03.b :
THY01_0111_A06.b :
SMG01_0099_D02.b :
OVRM1_0222_A12.b :
CLNT1_0148_H06.b : nggcttttggcgggaaagtatatttctcaaaacn
OVRM1_0009_D01.b :
TES01_0070_C03.b :
THY01_0011_A06.b :
OVRM1_0080_H01.b :
OVRM1_0122_F06.b :
OVRM1_0136_C12.b :
OVRM1_0075_F09.b : cxxx
OVRM1_0194_C01.b :
DCI01_0036_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0044_C03.b :
OVRM1_0037_D10.b :
OVRM1_0162_E03.b :
OVRM1_0008_G11.b :
OVRM1_0099_D05.b :
TES01_0041_H07.b :
SPL01_0029_E04.b : nnnnaat
TES01_0110_H06.b :
OVRM1_0205_D02.b :
LVRM1_0159_B02.b :
OVRM1_0013_G02.b :
LVRM1_0105_G12.b :
OVRM1_0115_H08.b :
OVRM1_0094_D04.b :
OVRM1_0103_D08.b :
OVR01_0072_D06.b : nnnggc
OVRM1_0110_B09.b :
SPL01_0063_D11.b : nnggct
SPL01_0020_C04.b : tttttggttgac
MLTL1_0001_G05.b : nnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0043_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0001_B06.b :
BKFL1_0010_F08.b : nnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0029_B04.b :
TES01_0109_A12.b :
OVRT1_0149_C02.b :
TES01_0038_F01.b :
UTR01_0017_A08.b : gxxxxxxxx
OVR01_0041_H12.b : tctttgggatttagtg
OVR01_0057_G04.b : nnggctag
PBL01_0009_G12.b :
DCI01_0001_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0036_B12.b :
OVRT1_0040_C02.b :
LNG01_0083_A10.b : nnnng
CLNT1_0148_F03.b :
OVRT1_0146_B08.b :
OVR01_0019_E10.b : tttaagggtgxxx
THY01_0094_B10.b : tttagcggttgtcagcattgtgx
UTR01_0051_G12.b : gcatcxxxxxxxxx
CLNT1_0089_A10.b : nttttacgtcagcgnacgagtgxxxxxxxxxx
MLTL1_0086_A04.b : gcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0071_C11.b : ttxxxxxxxxxx
UTR01_0098_A10.b : nttttgc
UTR01_0049_B01.b : ctxxxxxxxxxx
MLTL1_0090_E09.b : nnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0023_D09.b :
MLTL1_0006_D10.b : nnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0048_A10.b : nnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_F02.b : aggtggaaccta
OVR01_0012_F07.b : caaaaattgaaaxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0088_G05.b :
DCI01_0005_D05.b : gcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0005_B04.b :
THY01_0056_A04.b : atttttggtggxx
ITT01_0088_C08.b :
ITT01_0053_C01.b :
ITT01_0053_A09.b :
THY01_0111_C04.b :
SMG01_0058_C01.b :
OVR01_0099_H05.b : ct
OVRM1_0189_A06.b :
TES01_0108_G03.b :
LVRM1_0113_E11.b :
OVRM1_0195_E01.b :
OVRM1_0041_F01.b :
TES01_0093_H11.b :
SMG01_0034_E04.b :
OVRM1_0150_E02.b :
OVR01_0079_A11.b : nnggc
OVRM1_0192_F04.b :
THY01_0011_G03.b : xxx
BFLT1_0144_D02.b :
OVR01_0069_H12.b : gctt
OVRM1_0008_H11.b :
LVRM1_0143_B04.b :
LVRM1_0139_E01.b :
OVRM1_0167_F05.b :
OVRM1_0077_E10.b :
LVRM1_0141_H04.b :
OVRM1_0124_G11.b :
LVRM1_0130_G12.b :
UTR01_0013_A11.b : agggggxx
OVRM1_0102_F09.b :
THY01_0021_A07.b : ttagcaxxxxxxxx
UTR01_0068_E05.b : ctxxxxxxxxx
UTR01_0056_E07.b : nnnnnnnnnnnn
THY01_0015_G03.b : atg
UTR01_0037_G01.b : ggaac
SMG01_0034_F12.b :
BFLT1_0094_D12.b : nggttttt
TES01_0075_E07.b :
OVRT1_0138_E07.b : nnnccgatccn
OVR01_0055_H05.b : nggtgcatt
SMG01_0015_E03.b :
LVR01_0102_E10.b : cxxxxxxxxxx
CLNT1_0116_B03.b :
UTR01_0032_E10.b : txxxxxxxx
CLNT1_0112_C07.b :
UTR01_0015_C07.b : gggggac
CLNT1_0104_C08.b :
SPL01_0063_H08.b : nggtgca
OVRT1_0134_H10.b : nnnccgataannn
TES01_0032_H03.b :
PCT01_0024_B05.b :
OVRT1_0081_H03.b :
PBL01_0011_G12.b :
SPL01_0029_B01.b : nnnnngg
SPLT1_0053_B04.b :
TES01_0094_F06.b :
PBL01_0039_D08.b :
UTR01_0106_B09.b : nnnggct
PBL01_0073_D01.b :
ITT01_0028_B08.b :
PBL01_0093_D07.b :
PBL01_0043_H08.b :
TES01_0001_F02.b :
PBL01_0089_C02.b :
TES01_0019_B04.b :
TCH01_0058_H05.b :
CLNT1_0007_D05.b : ngcttttn
PBL01_0022_D04.b :
ITT01_0103_H12.b :
UTR01_0088_C07.b : nnnggc
CLNT1_0072_F06.b : ngcgatttnn
SPL01_0066_D06.b : nnnnggc
PBL01_0094_C11.b :
ITT01_0003_F12.b :
PBL01_0097_A03.b :
ITT01_0002_B04.b :
ITT01_0011_G01.b :
TCH01_0015_C03.b : nn
OVRM1_0176_B12.b :
OVRM1_0174_F08.b :
OVRM1_0214_B04.b :
LVRM1_0089_G10.b :
THY01_0112_G04.b :
THY01_0111_B01.b :
THY01_0118_C06.b :
THY01_0005_F09.b : ttctttttttttttttttttcctttttccctttctccnctttnnttcctcagcttttagt
OVRM1_0156_G02.b :
TES01_0036_H06.b :
LVRM1_0027_E05.b :
OVRM1_0040_E02.b :
LVRM1_0082_H08.b :
OVRM1_0181_C10.b :
OVRM1_0113_C03.b :
OVRM1_0013_G06.b :
OVRM1_0198_D03.b :
OVRM1_0194_A07.b :
OVRM1_0081_B06.b :
OVRM1_0120_G01.b :
OVRM1_0189_C02.b :
OVRM1_0062_A07.b :
OVRM1_0060_F02.b :
TES01_0079_D10.b :
OVRM1_0130_B01.b :
OVR01_0056_B12.b : ntttgct
LVRM1_0057_H10.b :
OVRM1_0055_G09.b :
OVRM1_0037_G01.b :
OVRM1_0151_G11.b :
OVRM1_0189_E04.b :
OVRM1_0194_D11.b :
LVRM1_0151_G06.b :
OVRM1_0053_C01.b :
OVRM1_0167_A05.b :
OVRM1_0058_H02.b :
OVRM1_0003_H09.b :
OVRM1_0024_F04.b :
OVRM1_0014_E05.b :
OVRM1_0038_H06.b :
OVRM1_0185_F04.b :
OVRM1_0019_B11.b :
OVRM1_0204_D06.b :
OVRM1_0017_B05.b :
OVRM1_0020_C11.b :
OVRM1_0092_E12.b :
OVRM1_0093_D05.b :
OVRM1_0186_B09.b :
THY01_0068_H12.b : ggcttttagtgg
DCI01_0038_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0097_F05.b :
SPL01_0024_G09.b : ttttagggtgx
THY01_0004_F09.b : gcaxxxxxxx
TES01_0026_A07.b :
MLTL1_0028_D05.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0059_E10.b :
OVR01_0025_E06.b : ggggatttttggg
PBL01_0034_G07.b :
ADR01_0030_F03.b :
ADR01_0026_C07.b :
SMG01_0071_G02.b :
BKFL1_0034_H11.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0148_C08.b :
OVRT1_0043_C03.b :
THY01_0014_A12.b : tagcaxxxxxxx
OVRT1_0125_F06.b :
OVRT1_0145_G09.b :
MLN01_0060_G10.b : g
TCH01_0016_D01.b : nttttc
CLNT1_0107_G10.b :
CLNT1_0114_C07.b :
PBL01_0018_E06.b :
SMG01_0016_F04.b :
CLNT1_0138_H09.b :
SMG01_0040_C11.b :
LNG01_0033_C09.b : gatxxxxx
SPL01_0064_B07.b : nnngg
SMG01_0101_A05.b :
LNG01_0036_G03.b : gctttatgtg
THY01_0066_H12.b : catttaggttg
THY01_0036_G10.b : ggtggcacttactagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0081_H03.b :
PCT01_0028_G09.b :
THY01_0053_C11.b : gtttttagagcataggtgx
SPL01_0060_E04.b : ttttgggc
BKFL1_0053_A07.b : nnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_A12.b : gggggggcxxxxxxxxxxxxxxxx
PBL01_0062_F09.b :
THY01_0096_D02.b : cgcxxxxxxxxx
PBL01_0053_F07.b :
DCI01_0116_G04.b : gcgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0004_G06.b :
MLN01_0081_E08.b : ng
SKNB1_0074_F06.b :
DCI01_0009_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0068_H03.b :
ITT01_0025_E07.b :
PBL01_0081_C10.b :
PBL01_0075_A05.b :
ITT01_0060_G02.b :
ITT01_0028_F08.b :
PBL01_0088_C04.b :
PBL01_0090_F05.b :
PBL01_0013_C09.b :
TES01_0052_A09.b :
ITT01_0058_E11.b :
ITT01_0088_G07.b :
TCH01_0034_H10.b :
MLN01_0048_H08.b : nnnng
CLNT1_0147_H12.b :
PBL01_0016_F05.b :
CLNT1_0058_F11.b : ngtcttt
MLN01_0008_E08.b : nnnn
TES01_0013_A05.b :
TES01_0016_D02.b :
MLN01_0043_C10.b : nnntt
PBL01_0088_G07.b :
PBL01_0089_F11.b :
ITT01_0012_D07.b :
SPL01_0018_G02.b : cattttggtgg
THY01_0205_A04.b : ctxxxxxxxxx
PBL01_0082_C09.b :
PBL01_0083_C09.b :
ITT01_0071_E08.b :
ITT01_0078_B06.b :
PBL01_0100_B12.b :
THY01_0098_C02.b : ggcattttatgtgg
MLN01_0056_F11.b : ngggt
ADR01_0071_E10.b :
OVRT1_0077_G12.b :
OVR01_0012_B04.b : gaaaaattgxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0027_F10.b : nggct
PBL01_0084_E08.b :
CLNT1_0031_A07.b : ngcttaatn
PBL01_0066_D09.b :
PBL01_0093_D02.b :
TCH01_0033_A06.b : tg
SPL01_0018_D01.b : gcctxxxxxxx
OVRM1_0048_A11.b :
BFLT1_0145_A02.b : atttttt
LVRM1_0055_E11.b :
OVRM1_0066_B05.b :
OVRM1_0103_F01.b :
UTR01_0014_E06.b : gggt
PCT01_0011_C05.b :
PBL01_0009_B12.b :
PBL01_0027_E08.b :
TES01_0080_F06.b :
UTR01_0048_C08.b : gcttttcgt
ITT01_0079_H01.b :
UTR01_0060_B06.b : gcxxxxxxx
PBL01_0058_G06.b :
PST01_0005_F01.b :
SKNB1_0082_C12.b :
OVRM1_0048_H12.b :
TES01_0090_E03.b :
TES01_0076_A05.b :
OVRM1_0033_G04.b :
TES01_0099_H05.b :
TES01_0044_B07.b :
SKNB1_0083_G09.b :
SKNB1_0036_B08.b :
MLN01_0050_B08.b : nnn
ITT01_0048_B11.b :
TES01_0030_A12.b :
TES01_0111_G05.b :
TES01_0105_F03.b :
TES01_0093_C12.b :
TES01_0104_D02.b :
TES01_0083_E04.b :
TES01_0058_H09.b :
CLNT1_0084_C08.b : nn
SKNB1_0100_E04.b :
TES01_0044_H09.b :
TES01_0012_C09.b :
PST01_0086_B01.b :
SKNB1_0056_E03.b :
TES01_0020_B04.b :
PST01_0081_D04.b :
LVRM1_0124_D11.b :
TES01_0004_E07.b :
PCT01_0006_A03.b :
CLNT1_0083_C10.b : nnnnt
PST01_0076_B10.b :
TES01_0036_F11.b :
ILNT1_0086_B06.b :
TES01_0112_B02.b :
TES01_0067_G12.b :
TES01_0080_D10.b :
PCT01_0018_A02.b :
PST01_0022_D04.b :
PST01_0045_D03.b :
SKNB1_0072_F06.b :
SKNB1_0064_H02.b :
TES01_0071_F08.b :
SKNB1_0076_H06.b :
PCT01_0004_H10.b :
OVRM1_0098_E02.b :
PCT01_0008_C11.b :
SKNB1_0068_E04.b :
SKNB1_0017_A01.b :
THY01_0065_C03.b :
OVRM1_0032_C06.b :
SKNB1_0058_G02.b :
TES01_0013_F06.b :
TES01_0068_C01.b :
MLTL1_0095_F11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
MLTL1_0023_D08.b : gttannnnnnnnggatatcatagggctactcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0081_D05.b :
UTR01_0070_D07.b :
SPL01_0069_H10.b :
OVRM1_0160_B06.b :
OVRM1_0082_E02.b :
OVRM1_0112_F08.b :
CLNT1_0078_E05.b :
THY01_0002_F02.b :
THY01_0074_D04.b :
ADR01_0086_A12.b :
PCT01_0005_G08.b :
THY01_0063_G09.b :
UTR01_0092_C03.b :
SPL01_0004_D03.b :
THY01_0102_H04.b :
ADR01_0037_H09.b :
THY01_0109_D08.b :
OVR01_0054_D10.b :
20110601C-001573 : .......................................TGGTTACTTTGCGGCAGCGCG
---------+---------+---------+---------+---------+---------+ 21
TCH01_0045_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGTTACTTTGCGGCAGCGCG
OVRM1_0090_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTACTTTGCGGCAGCGCG
UTR01_0012_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTGCGGCAGCGCG
TES01_0029_E01.b : gtttttcctacggttgctatggaTTGCGGCAGCGCA
SPLT1_0049_C02.b : gagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCGCG
DCI01_0048_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCGCA
TES01_0047_F09.b :
TES01_0012_E02.b : c
SMG01_0043_C09.b : ggctttnnnnnttgactcaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0108_A02.b : nnt
THY01_0069_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0044_F03.b :
TES01_0027_H05.b :
OVR01_0090_C02.b : ataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0015_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0121_F02.b : gtgtcaaaacagcggtxxxxxxxxxxxxxxxxxxxxxxx
TES01_0038_G05.b : ccgctt
UTR01_0005_B11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0057_G09.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0002_C03.b : tttttcacg
TES01_0060_F08.b : ntcg
SKNB1_0001_H01.b : nnacc
OVRM1_0182_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0038_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0023_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0097_D06.b : cttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0094_C10.b : acttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0019_E06.b : gacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0063_C04.b : nggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0096_D05.b : ctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0038_D03.b : nnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0095_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0077_D04.b : nnnaatgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0094_D05.b : gctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0123_E12.b : gttgcaaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0121_C04.b : gttgcaaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_E05.b : cagtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_G12.b : tggactaagacagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0119_H08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0024_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0030_A11.b : tg
DCI01_0044_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_B08.b : nnnnccgttcagcttagagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0085_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0068_A07.b : tttttagatagtacgacgcagtagtattaaxxxxxxxxxxxxxxxxxx
UTR01_0044_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0061_E03.b : nnnnggcgagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0019_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_F12.b : ccgtggacttgacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0083_F04.b : nnnnggcgagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_A08.b : aatccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0076_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0077_E07.b : ngactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0033_C03.b : gaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0100_H07.b : nnnnnnnnnnnnnnnntttctc
AMP01_0027_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0060_H09.b : nnnggatacagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0053_F10.b : nnnggcgagtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxx
BMWN1_0044_E06.b : nngggatagtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0025_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0078_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0048_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0008_B04.b : ntt
LNG01_0067_D07.b : ggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_H02.b : ctaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0015_F09.b : tttttc
OVR01_0019_A01.b : attagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0030_F07.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_H02.b : ggactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0038_E08.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_D06.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_C03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0111_A06.b : gttgtcaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0099_D02.b : ngggtttnnntttaagactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0222_A12.b : agttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0148_H06.b : nnnnnnnncccatagcgttacgaggttcttcgctctxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0009_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0070_C03.b : tttt
THY01_0011_A06.b : gatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0080_H01.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_F06.b : tagtttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0136_C12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0075_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0194_C01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0044_C03.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_D10.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0162_E03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0008_G11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_D05.b : tagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0041_H07.b :
SPL01_0029_E04.b : tggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0110_H06.b : ncc
OVRM1_0205_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0013_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_G12.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_H08.b : cagttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0094_D04.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0103_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_D06.b : ttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B09.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0063_D11.b : tggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0020_C04.b : tattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0001_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0043_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0001_B06.b : nncccgatanannnnnc
BKFL1_0010_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0029_B04.b : nnnaaagacagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0109_A12.b : attttc
OVRT1_0149_C02.b : nnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0038_F01.b : ncc
UTR01_0017_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0041_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0057_G04.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0009_G12.b : naaaagatgaagagctggaxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0001_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0036_B12.b : aaaagatcaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0040_C02.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0083_A10.b : gatggacatgacagttgnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0148_F03.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_B08.b : nnnggcttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0019_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0094_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0051_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0071_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0098_A10.b : atggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0049_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0023_D09.b : tcgc
MLTL1_0006_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0048_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_F02.b : atagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0088_G05.b : aaaannggactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0005_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0005_B04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0056_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_C08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_C01.b : ntttgtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_A09.b : nnnggggtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0111_C04.b : gttgcaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0058_C01.b : nnnaggcattttnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_H05.b : atggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0189_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0108_G03.b : tt
LVRM1_0113_E11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0195_E01.b : agttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_F01.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0093_H11.b : ttta
SMG01_0034_E04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
OVRM1_0150_E02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0079_A11.b : atgtactaaaacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0192_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0011_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0144_D02.b : nnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0069_H12.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0008_H11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_B04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_E01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_F05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0077_E10.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0124_G11.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_G12.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0013_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_F09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0021_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0068_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0056_E07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0015_G03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0037_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0034_F12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0094_D12.b : nnnntttcgcttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0075_E07.b : nnc
OVRT1_0138_E07.b : nnnnnnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0055_H05.b : ggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0015_E03.b : ngggattttnnnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0116_B03.b : nnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0032_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0112_C07.b : nnnnnccgtcagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0104_C08.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0063_H08.b : taggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0134_H10.b : nnnnncccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0032_H03.b :
PCT01_0024_B05.b : nnnttagtaannnnnnnngc
OVRT1_0081_H03.b : nnnccttcagcgcaggnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0011_G12.b : nnnnnggagaaacaggtggaxxxxxxxxxxxxxxxxxxxxxx
SPL01_0029_B01.b : ctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0053_B04.b : nnnggcaagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0094_F06.b : tttttc
PBL01_0039_D08.b : tgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0106_B09.b : tgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0073_D01.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0028_B08.b : nnngagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0093_D07.b : nnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0043_H08.b : nnnaagagcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0001_F02.b : tttcct
PBL01_0089_C02.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0019_B04.b : c
TCH01_0058_H05.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_D05.b : nnngggaccgttcgcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0022_D04.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0103_H12.b : nnaaagagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_C07.b : ttggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0072_F06.b : ngggnnccctcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0066_D06.b : taggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0094_C11.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0003_F12.b : nnnaagtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0097_A03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0002_B04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0011_G01.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0015_C03.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0176_B12.b : nagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0174_F08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_B04.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_G10.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0112_G04.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0111_B01.b : gttgcaaaacagcxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0118_C06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0005_F09.b : gacctatagaacagcttgtaaatcccaaaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0156_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0036_H06.b :
LVRM1_0027_E05.b : agxxxxxxxxxxx
OVRM1_0040_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_H08.b : nagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0181_C10.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_C03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0013_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0198_D03.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0194_A07.b : gagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0081_B06.b : acgtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0120_G01.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0189_C02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0062_A07.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0060_F02.b : agttgaataaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0079_D10.b : ttttg
OVRM1_0130_B01.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_B12.b : tggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_H10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0055_G09.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_G01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_G11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0189_E04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0194_D11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_G06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_C01.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_A05.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_H02.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0003_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0024_F04.b : nagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_H06.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0185_F04.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0019_B11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_D06.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0017_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0020_C11.b : agtttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0092_E12.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0093_D05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0186_B09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0097_F05.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0024_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0004_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0026_A07.b :
MLTL1_0028_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0059_E10.b : nccttattannnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0025_E06.b : ccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0034_G07.b : ngggtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0030_F03.b : nnnnnggctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0026_C07.b : nngtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_G02.b : nncggcatnnnnnnnggtatagcagcggtaxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0148_C08.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_C03.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0014_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0125_F06.b : nncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0145_G09.b : nnnnccgatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0060_G10.b : cttggcataagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0016_D01.b : gggaggacttnacantttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0107_G10.b : nnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0114_C07.b : nntttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0018_E06.b : ngatgaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0016_F04.b : nngggcatttnnnnnggagtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0138_H09.b : cttctcagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0040_C11.b : nncccattcattnnngggtcaagcagcxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0033_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0064_B07.b : ctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0101_A05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0036_G03.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0036_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0081_H03.b : ttttttagataaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0028_G09.b : nnnttgggttatnnnnnnnac
THY01_0053_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0060_E04.b : ttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0053_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0062_F09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0096_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_F07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0004_G06.b : nnnaaacgatnnnnnnggagaaacagcxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0081_E08.b : gctaggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0074_F06.b : nngggtttnnnnnnnc
DCI01_0009_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0068_H03.b : nntttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0025_E07.b : nnnnggataacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0081_C10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0075_A05.b : nnnggataaacagctggtaxxxxxxxxxxxxxxxxxxxx
ITT01_0060_G02.b : nggatatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0028_F08.b : nnnaagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0088_C04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0090_F05.b : aaaggggtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0013_C09.b : nnnaatgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0052_A09.b : tt
ITT01_0058_E11.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_G07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0034_H10.b : tgctaggactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0048_H08.b : gctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0147_H12.b : nttttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0016_F05.b : nnnnggactacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0058_F11.b : tnnnnnnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0008_E08.b : tttttgtatatgacagttgnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0013_A05.b : nnnnncc
TES01_0016_D02.b : nc
MLN01_0043_C10.b : gctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0088_G07.b : nnaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0089_F11.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_D07.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0018_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0082_C09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0083_C09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0071_E08.b : nnnngggtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_B06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0100_B12.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0098_C02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0056_F11.b : tgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0071_E10.b : nnncctgactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_G12.b : nggatttctatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0027_F10.b : tggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0084_E08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0031_A07.b : nnnnnnnacgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0066_D09.b : nnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0093_D02.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0033_A06.b : gggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0018_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_A11.b : gagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0145_A02.b : nnnnnnggcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_E11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_B05.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0103_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_E06.b : gcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0011_C05.b : nnnttcgatannnnnnncc
PBL01_0009_B12.b : naaaaatacagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0027_E08.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0080_F06.b : nncctatttnnntttccca
UTR01_0048_C08.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0079_H01.b : ttttggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0058_G06.b : nnaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0005_F01.b : nnttctttnnnnnnncc
SKNB1_0082_C12.b : nnnaactct
OVRM1_0048_H12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0090_E03.b : nnnt
TES01_0076_A05.b :
OVRM1_0033_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0099_H05.b : t
TES01_0044_B07.b :
SKNB1_0083_G09.b : nnnnnnggggnnnnnnn
SKNB1_0036_B08.b : ntttggc
MLN01_0050_B08.b : tttgcttgtactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0048_B11.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0030_A12.b :
TES01_0111_G05.b :
TES01_0105_F03.b : ttt
TES01_0093_C12.b : t
TES01_0104_D02.b : nttt
TES01_0083_E04.b : ttt
TES01_0058_H09.b : n
CLNT1_0084_C08.b : tttcgctnnnnncccttcgcgacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0100_E04.b : n
TES01_0044_H09.b : tt
TES01_0012_C09.b : ttt
PST01_0086_B01.b :
SKNB1_0056_E03.b : nnncggaannnn
TES01_0020_B04.b :
PST01_0081_D04.b :
LVRM1_0124_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0004_E07.b :
PCT01_0006_A03.b : nnnnccgctatnnn
CLNT1_0083_C10.b : ttctnnnnnnnnccttcgcgtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0076_B10.b : nn
TES01_0036_F11.b :
ILNT1_0086_B06.b : nnnnntgcagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0112_B02.b :
TES01_0067_G12.b :
TES01_0080_D10.b :
PCT01_0018_A02.b : nnnttagtaattttnn
PST01_0022_D04.b :
PST01_0045_D03.b :
SKNB1_0072_F06.b :
SKNB1_0064_H02.b : nngggaan
TES01_0071_F08.b :
SKNB1_0076_H06.b : nnnggg
PCT01_0004_H10.b : nnnggggaannn
OVRM1_0098_E02.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0008_C11.b : nnnccgctaa
SKNB1_0068_E04.b : nnnggggatn
SKNB1_0017_A01.b : nnnnagatt
THY01_0065_C03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0032_C06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0058_G02.b : nnn
TES01_0013_F06.b :
TES01_0068_C01.b :
MLTL1_0095_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0023_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0081_D05.b : nggttggactaagacxxxx
UTR01_0070_D07.b : ttagxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0069_H10.b : nnnggcttggacttaaa
OVRM1_0160_B06.b :
OVRM1_0082_E02.b :
OVRM1_0112_F08.b :
CLNT1_0078_E05.b : nnggcacacnnnnnnaacgtcgcgacgaggtacttcgctcxxxxxxxxxxxxxxx
THY01_0002_F02.b :
THY01_0074_D04.b : ctttttggtggxxxxx
ADR01_0086_A12.b :
PCT01_0005_G08.b :
THY01_0063_G09.b :
UTR01_0092_C03.b :
SPL01_0004_D03.b :
THY01_0102_H04.b :
ADR01_0037_H09.b :
THY01_0109_D08.b :
OVR01_0054_D10.b :
20110601C-001573 : GAGAGCCCCACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
---------+---------+---------+---------+---------+---------+ 77
TCH01_0045_B08.b : GAGAGCCCCACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0090_D03.b : GAGAGCCCCACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCTGGACCCTG*TACAC
UTR01_0012_C09.b : GAGAGCCCCACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0029_E01.b : GAGAGCC*CACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPLT1_0049_C02.b : GAGAGCCCCACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0048_F10.b : GAGAGCCCCACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0047_F09.b : GTGGCTATGGCTTTCT**CTGCGG*ATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0012_E02.b : tactgTGGCTATGGCTTTCT**CTGCGG*ATCACCATGGC*GGCCGGGACCCTG*TAC*C
SMG01_0043_C09.b : xxxxxxCCCACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0108_A02.b : tcacgtgGCTATGGCCTTTC**CTGCGG*ATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0069_D12.b : xxxxxxxCCACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0026_G11.b : xxxxggcCTACTGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0044_F03.b : gcggtgGCTATGGCTTTCT**CTGCGGATCA**CATGGC*GGCCGGGACCCTG*TACAC
TES01_0027_H05.b : tgtgGCTACGGCTTCT**CTGCGGA*TCACCATGGC*GGCCGGGACCCTG*TA*AC
OVR01_0090_C02.b : xxxxxxxxTTTTTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0015_A02.b : xxxxxxxxxACCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0121_F02.b : xxxxxxxxxTGGCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0038_G05.b : tggctctggCTTTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0005_B11.b : xxxxxxxxxCTGGCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0057_G09.b : xxxxxxctaCTGGCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0002_C03.b : gtggcactgACTGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0060_F08.b : cgttggctctGGCTTTTTCT**CTGCGGAATC*CCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0001_H01.b : acagtggctaTGGCCTTTCN**CTGCGGAATC*CCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0182_D02.b : xxxxxxxxxxCTTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0038_B07.b : xxxxxxxxxxCTGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0023_B11.b : xxxxxxxxxxCTTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0097_D06.b : xxxxxxxxxxCTTTTTTTCT**CTGCGGAATCACCATGGC*CGCCGGGACCCTG*TACAC
OVR01_0094_C10.b : xxxxxxxxxxCTTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0038_F01.b : xxxxxxxxxaAAACTTTTCT**CTGCGGGATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0019_E06.b : xxxxxxxxxxCTTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0063_C04.b : xxxxxxxxxxCTTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0096_D05.b : xxxxxxxxggTGGCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0038_D03.b : xxxxxxxxxcTGGCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0095_H06.b : xxxxxxxxxxCTTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0077_D04.b : xxxxxxxxxxTGGCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0094_D05.b : xxxxxxxxxxCTGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0123_E12.b : xxxxxxxxxxtGGGGCTTTT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0121_C04.b : xxxxxxxxxxxTGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0142_E03.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0209_E05.b : xxxxxxxxxxxCTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0082_G12.b : xxxxxxxxxxxCCCTTTTCT**CTGCGGAATCACCATTGC*GGCCGGGACCCTG*TACAC
OVRM1_0119_H08.b : xxxxxxxxxxxTGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0024_H11.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0030_A11.b : cggtggctatgGGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TAC*C
DCI01_0044_C01.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0143_B08.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0085_A12.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
AMP01_0012_H10.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
BMWN1_0068_A07.b : xxxxxxxxxxxGCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0044_B07.b : xxxxxxxxxxxGGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPLT1_0061_E03.b : xxxxxxxxxxxGCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0019_F05.b : xxxxxxxxxxxCCCTTTTCT**CTGCGGAATCACCTTGGC*GGCCGGGACCCTG*TACAC
MLN01_0020_F12.b : xxxxxxxxxxxTGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPLT1_0083_F04.b : xxxxxxxxxxxGCCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0043_A08.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0076_D05.b : xxxxxxxxxxxCCCTTTTCT**CTGCGGAATCACCATTGGGGGCCGGGACCCTG*TACAC
SMG01_0077_E07.b : xxxxxxxxxxxCCCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LNG01_0005_D09.b : xxxxxxxxxtcCTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LNG01_0033_C03.b : xxxxxxxxxxxTGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0100_H07.b : acgtgnctcggGGGCCTTTN**CTGCGGAATC*CCATGGC*GGCCGGGACCCTG*TACAC
AMP01_0027_F08.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0060_H09.b : xxxxxxxxxxxGGCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPLT1_0053_F10.b : xxxxxxxxxxxGCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
BMWN1_0044_E06.b : xxxxxxxxcatGCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0025_B03.b : xxxxxxxxxxxGGCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
BKFL1_0078_A04.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0048_D02.b : xxxxxxxxxxxCTTTTTTCT**CTGTGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0008_B04.b : gacgtggctatGGCCTTTC***CTGCGG*ATCACCATGGC*GGCCGGGACCCTG*TAC*C
LNG01_0067_D07.b : xxxxxxxxxxtGCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0080_H02.b : xxxxxxxxtggCTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0015_F09.b : caacgtggcacGGCTTTTCT**CTGCG**ATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0019_A01.b : xxxxxxxxxxxGCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0030_F07.b : xxxxxxxxxxxCTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0088_H02.b : xxxxxxxxxxxCTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0038_E08.b : xxxxxxxxxxxCCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0064_D12.b : xxxxxxxxxxxCCCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0037_H10.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGAACCCTG*TACAC
OVRM1_0102_F01.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0107_D06.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0154_C03.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0111_A06.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0099_D02.b : xxxxxxxxxxxxGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0222_A12.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0148_H06.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0009_D01.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0070_C03.b : cctgcgtggcacGGCCTTTC**CTGCGG*ATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0011_A06.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0080_H01.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0122_F06.b : xxxxxxxxxxxxGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0136_C12.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATC*CCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0075_F09.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0194_C01.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0036_H01.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0044_C03.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0037_D10.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0162_E03.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0008_G11.b : xxxxxxxxxxxxGGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0099_D05.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0041_H07.b : tggctctGGCCTTTG**CTGCGGA*TCACCATGGC*GGCCGGGACCCTG*TA*AC
SPL01_0029_E04.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0110_H06.b : acggtggctatgGCCTTTC***CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0205_D02.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0159_B02.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0013_G02.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0105_G12.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0115_H08.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0094_D04.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0103_D08.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0072_D06.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0110_B09.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0063_D11.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0020_C04.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0001_G05.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0043_C01.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0115_H07.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PCT01_0001_B06.b : caacggtggcacGGCTTTCT**CTGCGG*ATCAC*ATGGC*GGCCGGGACCCTG*TAC*C
BKFL1_0010_F08.b : xxxxxxxxxxxxCCCTTTCT**CCGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0100_A05.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPLT1_0029_B04.b : xxxxxxxxxxxxGCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0109_A12.b : acggtggctacgGGCTTTTTC*CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0149_C02.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0038_F01.b : gcgttggctatgGCTTTTTTTCCTGCGGAATC*CCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0017_A08.b : xxxxxxxxxxxxCCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0041_H12.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0057_G04.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0009_G12.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0001_F02.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0036_B12.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0040_C02.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LNG01_0083_A10.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0148_F03.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0146_B08.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0019_E10.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0094_B10.b : xxxxxxxxxxxxGCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0051_G12.b : xxxxxxxxxxxcACTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0089_A10.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0086_A04.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0071_C11.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0098_A10.b : xxxxxxxxxxxxTTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0049_B01.b : xxxxxxxxxxxxCCTTTTCT**CTGCGGAATCATCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0090_E09.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PST01_0023_D09.b : gttggctctggcCTTTTTCT**CTGCGGAATC*CCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0006_D10.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0048_A10.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0073_D10.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0061_F02.b : xxxxxxxxxxggTCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0012_F07.b : xxxxxxxxxxxxCCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ADR01_0088_G05.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0005_D05.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0005_B04.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0056_A04.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0088_C08.b : xxxxxxxxxxxxCTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0053_C01.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*CACAC
ITT01_0053_A09.b : xxxxxxxxxxxxCCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*CACAC
THY01_0111_C04.b : xxxxxxxxxxxxtGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0058_C01.b : xxxxxxxxxxxxxGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0099_H05.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0189_A06.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0108_G03.b : atactgttgctatGGCTTTT**CTGCGG*ATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0113_E11.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0195_E01.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0041_F01.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0093_H11.b : ctcgcgtggctatGGCTTTT**CCGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0034_E04.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0150_E02.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0079_A11.b : xxxxxxxxxxxxxTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0192_F04.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0011_G03.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
BFLT1_0144_D02.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0069_H12.b : xxxxxxxxxxxxxTTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0008_H11.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0143_B04.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0139_E01.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0167_F05.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0077_E10.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0141_H04.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0124_G11.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0130_G12.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0013_A11.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0102_F09.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0021_A07.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0068_E05.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0056_E07.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGAACCCTG*TACAC
THY01_0015_G03.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0037_G01.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACTCTG*TACAC
SMG01_0034_F12.b : nnnnnnnnnnnnnGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*AACAC
BFLT1_0094_D12.b : xxxxxxxxxxxccGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0075_E07.b : ctgcgttggctacGGCTTTC**CTGCGGAATC*CCATGGC*GGCCGGGACCCTG*TA*AC
OVRT1_0138_E07.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0055_H05.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0015_E03.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVR01_0102_E10.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0116_B03.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0032_E10.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0112_C07.b : xxxxxxxxxxxxaCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0015_C07.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATAGC*GGCCGGGACCCTG*TACAC
CLNT1_0104_C08.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0063_H08.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0134_H10.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0032_H03.b : gctgtggctatGCTTTTC**CTGCGG*ATCACCATGGC*GGCCGGGACCCTG*TACAC
PCT01_0024_B05.b : agcgttgtgcacgGCTTTTC**CTGCGGATC**CCATGGC*GGCCGGGACCCTG*TA*AC
OVRT1_0081_H03.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0011_G12.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0029_B01.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPLT1_0053_B04.b : xxxxxxxxxxxatGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0094_F06.b : catacgttggcacGGCTTTT**CCGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0039_D08.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0106_B09.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0073_D01.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0028_B08.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0093_D07.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0043_H08.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0001_F02.b : acagtggctacggCCTTTC***CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0089_C02.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0019_B04.b : acgttggctatggGGCTTTT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TCH01_0058_H05.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0007_D05.b : xxxxxxxxxxxxaGCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0022_D04.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0103_H12.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0088_C07.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0072_F06.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0066_D06.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0094_C11.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0003_F12.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0097_A03.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0002_B04.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0011_G01.b : xxxxxxxxxxxxxCTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TCH01_0015_C03.b : xxxxxxxxxxxxxCCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0176_B12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0174_F08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0214_B04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0089_G10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0112_G04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0111_B01.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0118_C06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0005_F09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0156_G02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0036_H06.b : gtggctctggCTTTCT**CG**CGGATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0027_E05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0040_E02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0082_H08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0181_C10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0113_C03.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0013_G06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0198_D03.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0194_A07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0081_B06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0120_G01.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0189_C02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0062_A07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0060_F02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0079_D10.b : ccaacgttgcacagCCTTTN**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0130_B01.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0056_B12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0057_H10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0055_G09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0037_G01.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCACGGC*GGCCGGGACCCTG*TACAC
OVRM1_0151_G11.b : xxxxxxxxxxxxxxCTTTCC**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0189_E04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0194_D11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0151_G06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0053_C01.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0167_A05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0058_H02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0003_H09.b : xxxxxxxxxxxxxaCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0024_F04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0014_E05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0038_H06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0185_F04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0019_B11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGAC*GGCCGGGACCCTG*TACAC
OVRM1_0204_D06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0017_B05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0020_C11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0092_E12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0093_D05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0186_B09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0068_H12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0038_D11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0097_F05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0024_G09.b : xxxxxxxxxxxxxgTTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0004_F09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0026_A07.b : cagtggctatggctCTTTCT**C*GCGGAA*CACCATGGC*GGCCGGGACCCTG*TACAC
MLTL1_0028_D05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0059_E10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0025_E06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0034_G07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ADR01_0030_F03.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGTC*GGCCGGGACCCTG*TACAC
ADR01_0026_C07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGACTC*CCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0071_G02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
BKFL1_0034_H11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0148_C08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0043_C03.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0014_A12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0125_F06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0145_G09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0060_G10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TCH01_0016_D01.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0107_G10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0114_C07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0018_E06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0016_F04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0138_H09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0040_C11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LNG01_0033_C09.b : xxxxxxxxxxxxxtCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0064_B07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0101_A05.b : nnnnnxxxxxxxxnCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
LNG01_0036_G03.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0066_H12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0036_G10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGCGGGCCGGGACCCTG*TACAC
SMG01_0081_H03.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PCT01_0028_G09.b : tgcgttggctacgcTTTTTTT*CTCGCGGAATCCCATGGC*GGCCGGGACCCTG*TACAC
THY01_0053_C11.b : xxxxxxxxxxxxggGTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0060_E04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
BKFL1_0053_A07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0005_A12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0062_F09.b : xxxxxxxxxxxxxxCTTTCC**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0096_D02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0053_F07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0116_G04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SMG01_0004_G06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0081_E08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0074_F06.b : ctacgttggcacgcCCTTTC**TCGCGGAAT*ACCATGGC*GGCCGGGACCCTG*TACAC
DCI01_0009_C10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
BFLT1_0068_H03.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0025_E07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0081_C10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0075_A05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0060_G02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0028_F08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0088_C04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0090_F05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0013_C09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0052_A09.b : ttcctacagttgccCTTTCT**CTGCG**ATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0058_E11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0088_G07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TCH01_0034_H10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0048_H08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0147_H12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0016_F05.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0058_F11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0008_E08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0013_A05.b : tacagtggctatggCCTTTC**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0016_D02.b : tcacgtggctatggCCTTTC**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0043_C10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0088_G07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0089_F11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0012_D07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0018_G02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0205_A04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0082_C09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0083_C09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0071_E08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0078_B06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0100_B12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
THY01_0098_C02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0056_F11.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ADR01_0071_E10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRT1_0077_G12.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVR01_0012_B04.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
MLN01_0027_F10.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0084_E08.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0031_A07.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0066_D09.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0093_D02.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TCH01_0033_A06.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SPL01_0018_D01.b : xxxxxxxxxxxxxxCTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0048_A11.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
BFLT1_0145_A02.b : xxxxxxxxxxxxtcaTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTGCTACAC
LVRM1_0055_E11.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0066_B05.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0103_F01.b : xxxxxxxxxxxxxctCTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0014_E06.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PCT01_0011_C05.b : agcgtgtgcacgtgtTTTCT**CTGCGGATCA**CATGGC*GGCCGGGACCCTG*TA*AC
PBL01_0009_B12.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0027_E08.b : xxxxxxxxxxxxxxgTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0080_F06.b : cggtggcacggacggCTTCT**CTGCGGAATCACCACGGC*GGCCGGGACCCTG*TACAC
UTR01_0048_C08.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0079_H01.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
UTR01_0060_B06.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PBL01_0058_G06.b : xxxxxxxxxxxxxxxTTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PST01_0005_F01.b : tgcgttggcacggctTTTTC**CTGCG**ATCACCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0082_C12.b : acgctggctacggctTTTTC**TCGCGGAACC**CATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0048_H12.b : xxxxxxxxxxxxxtggTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0090_E03.b : ctgctgttgctctggcTTTT**CTCGCGGATTCCCATGGC*GGCCGGGACCCTG*TACAC
TES01_0076_A05.b : ttcctgctgtggctctGGCTT*TCCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0033_G04.b : xxxxxxxxxxxxxxxxTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0099_H05.b : tttactacgtggcacgCTTT**CTCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0044_B07.b : cgacgtggctatggcTTCT**CTGCGGA*TCACCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0083_G09.b : ntacacgttggcacggCTTTC*CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0036_B08.b : tcgacgtggctacggcTTTT**CTCGCGGAACAC*ATGGC*GGCCGGGACCCTG*TACAC
MLN01_0050_B08.b : xxxxxxxxxxxxxxxxTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
ITT01_0048_B11.b : xxxxxxxxxxxxxxxxTTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0030_A12.b : ctgcgttggcacgccTTC**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0111_G05.b : nttccacggtggctctgGCTT*TCCTGCGATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0105_F03.b : tgttaactgtggctatgGCTT*TCCGCGGAACACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0093_C12.b : tttactgcggtggcacgGCTT*TCCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0104_D02.b : tcctacgtggctatggcTTT**CCGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0083_E04.b : ttcctacggtggcacagCCTTTCCTGCNGATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0058_H09.b : tcgagttggctatgggaTTTC*CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
CLNT1_0084_C08.b : xxxxxxxxcccatcaaaTCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*CTT*C
SKNB1_0100_E04.b : nncccttacgctggcagGCTTTCCGCGGAATC*CCATGGC*GGCCGGGACCCTG*TACAC
TES01_0044_H09.b : tttcctacggtggcacgGCTT*TCCGCGGATCAC*ATGGC*GGCCGGGACCCTG*TACAC
TES01_0012_C09.b : ttcctaacgtggcnacgGCTT*TCCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
PST01_0086_B01.b : nnnaactgagtggcacgGCTT*TCCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0056_E03.b : nnnccatacgtggcacgGCTT*TTCGCGGAACACCATGGC*GGCCGGGACCCTG*TAC*C
TES01_0020_B04.b : ntgcagtggcacgGCTTCCTGCGGA*TCACCATGGC*GGCCGGGACCCTG*TACAC
PST01_0081_D04.b : nnncctgcgttgcacgGCTT*TCCGCGGATCAC*ATGGC*GGCCGGGACCCTG*TACAC
LVRM1_0124_D11.b : xxxxxxxxxxxxxxxxxxCT**CTGCGGAATCACCATGGC*GGCCGGGACTCTG*TACAC
TES01_0004_E07.b : cgttggctatggCT**CTGCGG*ATCACCATGGC*GGCCGGGACCCTG*TA*AC
PCT01_0006_A03.b : nnnagagcgggtgcactcCTT*TCCTGCGATCAC*ATGGC*GGCCGGGACCCTG*TA*AC
CLNT1_0083_C10.b : xxxxxxxxcccttacatgCT**CTGCGGAAT*ACCATGGC*GGCCGGGACCCTG*CTTTC
PST01_0076_B10.b : nnggccacgtggcacggcCTT*TCCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0036_F11.b : ttttcctacgtggctCTT*TCCGCNGATCACCATGGC*GGCCGGGACCCTG*TACAC
ILNT1_0086_B06.b : xxxxxxxxxxxxxxxxxgCT**CTGCGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0112_B02.b : ttttttcacgtggctatgcTT*CTCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0067_G12.b : ttaccgcagtggctatggcTT*CTCTGCGATCACCATGGC*GGCCGGGACCCTG*TACAC
TES01_0080_D10.b : ntttggcaacgttggcacggCTCTGCGATCACCATGGC*GGCCGGGACCCTG*TA*AC
PCT01_0018_A02.b : nnccaacggtggccgtgcttctCTGCGGATC**CCATGGC*GGCCGGGACCCTG*TA*AC
PST01_0022_D04.b : tttactgctgtggctatggCTCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
PST01_0045_D03.b : aaancctgcagttggcacggCTCGCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0072_F06.b : nnnggttgacgtggctacggCTCTCGGATCACCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0064_H02.b : nnannnccatacggtncacggctCGCGGATCC**CATGGC*GGCCGGGACCCTG*TA*AC
TES01_0071_F08.b : nttacggcgttggcatgctttctCTGCAGATCCCATGGC*GGGCGGGACCCTG*TACAC
SKNB1_0076_H06.b : tannnnnnnncctacgctggctttTCGCGGATCCCATGGC*GGCCGGGACCCTG*TACAC
PCT01_0004_H10.b : nnaaactgcggtggcactggttctCGCGGATCAC*ATGGC*GGCCGGGACCCTG*TAC*C
OVRM1_0098_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGGAATCACCATGGC*GGCCGGGACCCTG*TACAC
PCT01_0008_C11.b : annnnnccaacgggtgcaccttttcctgcGATCCCATGGC*GGCCGGGACCCTG*TAC*C
SKNB1_0068_E04.b : nnnnnnccacacgtggcacgctttcctgcGATCCCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0017_A01.b : nnnnnnggatacgtggctagcttttctgcGATCCCATGGC*GGCCGGGACCCTG*TACAC
THY01_0065_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCATGGC*GGCCGGGACCCTG*TACAC
OVRM1_0032_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCATGGC*GGCCGGGACCCTG*TACAC
SKNB1_0058_G02.b : aaatcacgctggcactggatttctctgggaatcCCATGGTCGGCCGGGACCCTG*TACAC
TES01_0013_F06.b : tttttnctaacggtggctatggCATGGC*GGCCGGGACCCTG*TACAC
TES01_0068_C01.b : nnncctactgtggctatggaGGC*GGCCGGGACCCTG*TACAC
MLTL1_0095_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCCTG*TACAC
MLTL1_0023_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCCTG*TACAC
TCH01_0081_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
UTR01_0070_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagggggtg
SPL01_0069_H10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0160_B06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0082_E02.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0112_F08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0078_E05.b : xxxxxxxxxxxxxxxxatcggtcatgcggcggaannnnanggnggnngggaacntgcccc
THY01_0002_F02.b : tccaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0074_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0086_A12.b : nnnnntttgactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0005_G08.b : nnnccgttgtnnnnnn
THY01_0063_G09.b : ggggggaacctataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_C03.b : nnnnggctaggacttanacxxxxxxxxxxxxx
SPL01_0004_D03.b :
THY01_0102_H04.b :
ADR01_0037_H09.b :
THY01_0109_D08.b :
OVR01_0054_D10.b :
20110601C-001573 : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
---------+---------+---------+---------+---------+---------+ 136
TCH01_0045_B08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0090_D03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0012_C09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0029_E01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPLT1_0049_C02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0048_F10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0047_F09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0012_E02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0043_C09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0108_A02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0069_D12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0026_G11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0044_F03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0027_H05.b : ATATCCTGCAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0090_C02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0015_A02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0121_F02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0038_G05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCAGGGCTC
UTR01_0005_B11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0057_G09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0002_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0060_F08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0001_H01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0182_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0038_B07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0023_B11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0097_D06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0094_C10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0038_F01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0019_E06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0063_C04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0096_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0038_D03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0095_H06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0077_D04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0094_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0123_E12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0121_C04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0142_E03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0209_E05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0082_G12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0119_H08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTATAGCGGGGCTC
SPL01_0024_H11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0030_A11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0044_C01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0143_B08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0085_A12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
AMP01_0012_H10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BMWN1_0068_A07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0044_B07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPLT1_0061_E03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0019_F05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0020_F12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPLT1_0083_F04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0043_A08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0076_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0077_E07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LNG01_0005_D09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LNG01_0033_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0100_H07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
AMP01_0027_F08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0060_H09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPLT1_0053_F10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BMWN1_0044_E06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0025_B03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BKFL1_0078_A04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0048_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0008_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LNG01_0067_D07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0080_H02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0015_F09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0019_A01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0030_F07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0088_H02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0038_E08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0064_D12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0037_H10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGAGGact
OVRM1_0102_F01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0107_D06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0154_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0111_A06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0099_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0222_A12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0148_H06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0009_D01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0070_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0011_A06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0080_H01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0122_F06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0136_C12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGNTC
OVRM1_0075_F09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0194_C01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0036_H01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0044_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0037_D10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0162_E03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0008_G11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0099_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0041_H07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0029_E04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0110_H06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0205_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0159_B02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0013_G02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0105_G12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0115_H08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0094_D04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0103_D08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0072_D06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0110_B09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0063_D11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0020_C04.b : ATATCCTAAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCAC
MLTL1_0001_G05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0043_C01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0115_H07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0001_B06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BKFL1_0010_F08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0100_A05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPLT1_0029_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0109_A12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0149_C02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0038_F01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0017_A08.b : ATATCCTGAAGACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0041_H12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0057_G04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0009_G12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0001_F02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0036_B12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0040_C02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LNG01_0083_A10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0148_F03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0146_B08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0019_E10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0094_B10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0051_G12.b : ATATCCTGGAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0089_A10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0086_A04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0071_C11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0098_A10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0049_B01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0090_E09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCGTTGCCGCTCAGTACAGCGGGGCTC
PST01_0023_D09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0006_D10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0048_A10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0073_D10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0061_F02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0012_F07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ADR01_0088_G05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0005_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0005_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCACTGCCGCTCAGTACAGCGGGGCTC
THY01_0056_A04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0088_C08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0053_C01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0053_A09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0111_C04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0058_C01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0099_H05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0189_A06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0108_G03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0113_E11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0195_E01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0041_F01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0093_H11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0034_E04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0150_E02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0079_A11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0192_F04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0011_G03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BFLT1_0144_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0069_H12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0008_H11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0143_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0139_E01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0167_F05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0077_E10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0141_H04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0124_G11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0130_G12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0013_A11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0102_F09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0021_A07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0068_E05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0056_E07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0015_G03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0037_G01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0034_F12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BFLT1_0094_D12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0075_E07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0138_E07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0055_H05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0015_E03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVR01_0102_E10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0116_B03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0032_E10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0112_C07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0015_C07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0104_C08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0063_H08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0134_H10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0032_H03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0024_B05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0081_H03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0011_G12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0029_B01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPLT1_0053_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0094_F06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0039_D08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0106_B09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0073_D01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0028_B08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0093_D07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0043_H08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0001_F02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0089_C02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGACTC
TES01_0019_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TCH01_0058_H05.b : ATATCCTAAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0007_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0022_D04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0103_H12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0088_C07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0072_F06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0066_D06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0094_C11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0003_F12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0097_A03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0002_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0011_G01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TCH01_0015_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0176_B12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0174_F08.b : ATATCCTGAAAACTG*GAGGGCCTTCGAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0214_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0089_G10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0112_G04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0111_B01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0118_C06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0005_F09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGAACCGCGGGGCTC
OVRM1_0156_G02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0036_H06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0027_E05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0040_E02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0082_H08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0181_C10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0113_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0013_G06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0198_D03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0194_A07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0081_B06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0120_G01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0189_C02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0062_A07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0060_F02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0079_D10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0130_B01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0056_B12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0057_H10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0055_G09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0037_G01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0151_G11.b : ATATCCTGAAAACTG*GAGGGCCTTCGAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0189_E04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0194_D11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0151_G06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0053_C01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0167_A05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0058_H02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0003_H09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0024_F04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0014_E05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0038_H06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0185_F04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0019_B11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0204_D06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0017_B05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0020_C11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0092_E12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCCCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0093_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0186_B09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0068_H12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0038_D11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0097_F05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0024_G09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0004_F09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0026_A07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0028_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0059_E10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0025_E06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0034_G07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ADR01_0030_F03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ADR01_0026_C07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0071_G02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BKFL1_0034_H11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0148_C08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0043_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0014_A12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0125_F06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0145_G09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0060_G10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TCH01_0016_D01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0107_G10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0114_C07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0018_E06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0016_F04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0138_H09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0040_C11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LNG01_0033_C09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0064_B07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0101_A05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LNG01_0036_G03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0066_H12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0036_G10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0081_H03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0028_G09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0053_C11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0060_E04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BKFL1_0053_A07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAATACAGCGGGGCTC
OVR01_0005_A12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0062_F09.b : ACATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0096_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCATTACAGCGGGGCTC
PBL01_0053_F07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0116_G04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SMG01_0004_G06.b : ACATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0081_E08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0074_F06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
DCI01_0009_C10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BFLT1_0068_H03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0025_E07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0081_C10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0075_A05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0060_G02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0028_F08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0088_C04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0090_F05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0013_C09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0052_A09.b : ATATCCTGAAAACTG*GAGGGCCT*CAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0058_E11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0088_G07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TCH01_0034_H10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0048_H08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0147_H12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0016_F05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0058_F11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0008_E08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0013_A05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0016_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0043_C10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0088_G07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0089_F11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0012_D07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0018_G02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0205_A04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0082_C09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0083_C09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0071_E08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0078_B06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0100_B12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0098_C02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0056_F11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ADR01_0071_E10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRT1_0077_G12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVR01_0012_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0027_F10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0084_E08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0031_A07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0066_D09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0093_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TCH01_0033_A06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0018_D01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0048_A11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
BFLT1_0145_A02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0055_E11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0066_B05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0103_F01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0014_E06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0011_C05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0009_B12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0027_E08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0080_F06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0048_C08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0079_H01.b : ATATCCTGAAAACTGAGAAGGCCTTCAAAGGCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0060_B06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PBL01_0058_G06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PST01_0005_F01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0082_C12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0048_H12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0090_E03.b : ATATCCTGAAAACTG*GAGGGACTTCAAAGCCCTCATTGCCGCTCAGTACATCGGGGCTC
TES01_0076_A05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0033_G04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0099_H05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0044_B07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0083_G09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0036_B08.b : ATATCCCGTATAAAG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLN01_0050_B08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ITT01_0048_B11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0030_A12.b : ATATCCTGACAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0111_G05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0105_F03.b : ATATCCTGCAATTTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0093_C12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0104_D02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0083_E04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0058_H09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0084_C08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0100_E04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0044_H09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0012_C09.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCGGTACAGCGGGGCTC
PST01_0086_B01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0056_E03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0020_B04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PST01_0081_D04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
LVRM1_0124_D11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0004_E07.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0006_A03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
CLNT1_0083_C10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PST01_0076_B10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0036_F11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ILNT1_0086_B06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0112_B02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0067_G12.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0080_D10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0018_A02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PST01_0022_D04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGG*CTC
PST01_0045_D03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0072_F06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0064_H02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0071_F08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0076_H06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0004_H10.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0098_E02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0008_C11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0068_E04.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0017_A01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0065_C03.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0032_C06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SKNB1_0058_G02.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0013_F06.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TES01_0068_C01.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
MLTL1_0095_F11.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACCGCGGGGCTC
MLTL1_0023_D08.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
TCH01_0081_D05.b : ATATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
UTR01_0070_D07.b : cTATCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
SPL01_0069_H10.b : xxxTCCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0160_B06.b : xxxxxCTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0082_E02.b : xxxxxxTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
OVRM1_0112_F08.b : xxxxxxTGAAAACTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCCC
CLNT1_0078_E05.b : ttaaaggGAAAANTG*GAGGGNNTTNAAAGNNNTNATTGGNGNNTAGTANAGNGGGGNTN
THY01_0002_F02.b : xxxxxxxxxxxxCTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0074_D04.b : xxxxxxxxxxxxCTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
ADR01_0086_A12.b : xxxxxxxxxxxxxTG*GAGGGCCTTCAAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
PCT01_0005_G08.b : cctacggtggcacggctggaggccttcAAGCCCTCATTGCCGCTCAGTACAGCGGGGCTC
THY01_0063_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCCGCTCAGTACAGCGGGGCTC
UTR01_0092_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCGGGGCTC
SPL01_0004_D03.b : ctttttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0102_H04.b :
ADR01_0037_H09.b :
THY01_0109_D08.b :
OVR01_0054_D10.b :
20110601C-001573 : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
---------+---------+---------+---------+---------+---------+ 196
TCH01_0045_B08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0090_D03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0012_C09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0029_E01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPLT1_0049_C02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0048_F10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0047_F09.b : AAGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0012_E02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0043_C09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0108_A02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0069_D12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0026_G11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0044_F03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0027_H05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0090_C02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0015_A02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0121_F02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0038_G05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0005_B11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0057_G09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0002_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0060_F08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0001_H01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0182_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0038_B07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0023_B11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0097_D06.b : AAGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0094_C10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0038_F01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0019_E06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0063_C04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCGACCACACCCCCG
UTR01_0096_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0038_D03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0095_H06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0077_D04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0094_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0123_E12.b : AGGTCCGCGTGCTCTCCGCACCTCCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0121_C04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0142_E03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0209_E05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0082_G12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0119_H08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0024_H11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0030_A11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0044_C01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0143_B08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0085_A12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
AMP01_0012_H10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BMWN1_0068_A07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0044_B07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPLT1_0061_E03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0019_F05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0020_F12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPLT1_0083_F04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0043_A08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0076_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCTACCACACCCCCG
SMG01_0077_E07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LNG01_0005_D09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LNG01_0033_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0100_H07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
AMP01_0027_F08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0060_H09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPLT1_0053_F10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BMWN1_0044_E06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCGCGGGCCCG
OVR01_0025_B03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BKFL1_0078_A04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0048_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0008_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LNG01_0067_D07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0080_H02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0015_F09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0019_A01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0030_F07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0088_H02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0038_E08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0064_D12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0037_H10.b : caggtccacgtgctctcgacaccatgacacttacttttaggccgcacagacaccaacacc
OVRM1_0102_F01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0107_D06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0154_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0111_A06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0099_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0222_A12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0148_H06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0009_D01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0070_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0011_A06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0080_H01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCN
OVRM1_0122_F06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0136_C12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0075_F09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0194_C01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0036_H01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0044_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0037_D10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0162_E03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0008_G11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0099_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0041_H07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0029_E04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0110_H06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0205_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0159_B02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0013_G02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0105_G12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0115_H08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0094_D04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0103_D08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0072_D06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0110_B09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0063_D11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0020_C04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0001_G05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0043_C01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0115_H07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0001_B06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BKFL1_0010_F08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0100_A05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPLT1_0029_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0109_A12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0149_C02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0038_F01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0017_A08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0041_H12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0057_G04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0009_G12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0001_F02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0036_B12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0040_C02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LNG01_0083_A10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0148_F03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAGCCAACCACACCCCCG
OVRT1_0146_B08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0019_E10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0094_B10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCN
UTR01_0051_G12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0089_A10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0086_A04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0071_C11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0098_A10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0049_B01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTCCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0090_E09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PST01_0023_D09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0006_D10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0048_A10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0073_D10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0061_F02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0012_F07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ADR01_0088_G05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0005_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0005_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0056_A04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0088_C08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0053_C01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0053_A09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0111_C04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0058_C01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0099_H05.b : ATGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0189_A06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0108_G03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0113_E11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0195_E01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0041_F01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0093_H11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0034_E04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0150_E02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0079_A11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0192_F04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0011_G03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BFLT1_0144_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0069_H12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0008_H11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0143_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0139_E01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0167_F05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0077_E10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCN
LVRM1_0141_H04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0124_G11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0130_G12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0013_A11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0102_F09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0021_A07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0068_E05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0056_E07.b : AGGTCCACGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0015_G03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0037_G01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0034_F12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BFLT1_0094_D12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0075_E07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0138_E07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0055_H05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0015_E03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVR01_0102_E10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0116_B03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0032_E10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0112_C07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0015_C07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0104_C08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0063_H08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0134_H10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0032_H03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0024_B05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0081_H03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0011_G12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0029_B01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPLT1_0053_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0094_F06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0039_D08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0106_B09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAGCCAACCACACCCCCG
PBL01_0073_D01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0028_B08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0093_D07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0043_H08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0001_F02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0089_C02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0019_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TCH01_0058_H05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0007_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0022_D04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0103_H12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0088_C07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0072_F06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0066_D06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0094_C11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0003_F12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0097_A03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0002_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0011_G01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TCH01_0015_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0176_B12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0174_F08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0214_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0089_G10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0112_G04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0111_B01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0118_C06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0005_F09.b : ATGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0156_G02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0036_H06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0027_E05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0040_E02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0082_H08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0181_C10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0113_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0013_G06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0198_D03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0194_A07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0081_B06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0120_G01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0189_C02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0062_A07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCN
OVRM1_0060_F02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0079_D10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0130_B01.b : GGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0056_B12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0057_H10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0055_G09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCN
OVRM1_0037_G01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0151_G11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0189_E04.b : AGGTCCGCGTGCTCTCCGCACCGCCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0194_D11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0151_G06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0053_C01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0167_A05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCGAACCAACCACACCCCCG
OVRM1_0058_H02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCN
OVRM1_0003_H09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0024_F04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0014_E05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0038_H06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0185_F04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0019_B11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0204_D06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0017_B05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0020_C11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0092_E12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0093_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0186_B09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0068_H12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0038_D11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0097_F05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0024_G09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0004_F09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0026_A07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0028_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0059_E10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0025_E06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0034_G07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ADR01_0030_F03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ADR01_0026_C07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0071_G02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BKFL1_0034_H11.b : AGGTCCGCGTGCTCTCCGCGCCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0148_C08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0043_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0014_A12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0125_F06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0145_G09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0060_G10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TCH01_0016_D01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0107_G10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0114_C07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0018_E06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0016_F04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0138_H09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0040_C11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LNG01_0033_C09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0064_B07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0101_A05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LNG01_0036_G03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0066_H12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0036_G10.b : AGGTCCGCGGGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0081_H03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0028_G09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0053_C11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0060_E04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BKFL1_0053_A07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0005_A12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0062_F09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0096_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0053_F07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0116_G04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SMG01_0004_G06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0081_E08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0074_F06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
DCI01_0009_C10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BFLT1_0068_H03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0025_E07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0081_C10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0075_A05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0060_G02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0028_F08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0088_C04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0090_F05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0013_C09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0052_A09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0058_E11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0088_G07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TCH01_0034_H10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0048_H08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0147_H12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0016_F05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0058_F11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0008_E08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0013_A05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0016_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0043_C10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0088_G07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0089_F11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0012_D07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0018_G02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0205_A04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0082_C09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0083_C09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0071_E08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0078_B06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0100_B12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0098_C02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0056_F11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ADR01_0071_E10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRT1_0077_G12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVR01_0012_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0027_F10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0084_E08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0031_A07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0066_D09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0093_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TCH01_0033_A06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0018_D01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0048_A11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
BFLT1_0145_A02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0055_E11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0066_B05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0103_F01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0014_E06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0011_C05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0009_B12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0027_E08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0080_F06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0048_C08.b : AAGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0079_H01.b : AAGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCC
UTR01_0060_B06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PBL01_0058_G06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PST01_0005_F01.b : GGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0082_C12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0048_H12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0090_E03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0076_A05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0033_G04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0099_H05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0044_B07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0083_G09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0036_B08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLN01_0050_B08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ITT01_0048_B11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0030_A12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0111_G05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0105_F03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0093_C12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0104_D02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0083_E04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0058_H09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0084_C08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0100_E04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0044_H09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0012_C09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PST01_0086_B01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0056_E03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0020_B04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PST01_0081_D04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
LVRM1_0124_D11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0004_E07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0006_A03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0083_C10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PST01_0076_B10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0036_F11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ILNT1_0086_B06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0112_B02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0067_G12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0080_D10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0018_A02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PST01_0022_D04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PST01_0045_D03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0072_F06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0064_H02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0071_F08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0076_H06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0004_H10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0098_E02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0008_C11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0068_E04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0017_A01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0065_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0032_C06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SKNB1_0058_G02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0013_F06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TES01_0068_C01.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAGACCAACCACACCCCCG
MLTL1_0095_F11.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
MLTL1_0023_D08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
TCH01_0081_D05.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0070_D07.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0069_H10.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0160_B06.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0082_E02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
OVRM1_0112_F08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
CLNT1_0078_E05.b : AGGTNNGNGTGGTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0002_F02.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0074_D04.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
ADR01_0086_A12.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
PCT01_0005_G08.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
THY01_0063_G09.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
UTR01_0092_C03.b : AGGTCCGCGTGCTCTCCGCACCACCCCACTTCCATTTTGGCCAAACCAACCACACCCCCG
SPL01_0004_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTGGCCAAACCAACCACACCCCCG
THY01_0102_H04.b : gtgtcaaaagcggcgtccggtccggaatcctcgagcacgtggcctac
ADR01_0037_H09.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_D08.b : gttgcaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0054_D10.b : nnnggcttggactatnacxxxxxxxx
20110601C-001573 : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
---------+---------+---------+---------+---------+---------+ 254
TCH01_0045_B08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0090_D03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0012_C09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0029_E01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPLT1_0049_C02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0048_F10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0047_F09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0012_E02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0043_C09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0108_A02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0069_D12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0026_G11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0044_F03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0027_H05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0090_C02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0015_A02.b : AATTTCTCCGTAAATTTCCCTGCCGGTAGG**TCCA*GCATTTGANGGTGACGATGGATT
THY01_0121_F02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0038_G05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0005_B11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0057_G09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0002_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0060_F08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0001_H01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0182_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0038_B07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0023_B11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0097_D06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0094_C10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0038_F01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0019_E06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0063_C04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0096_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0038_D03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0095_H06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0077_D04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0094_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0123_E12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0121_C04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0142_E03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0209_E05.b : AATTTCTCCGTAAATTTTC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0082_G12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0119_H08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0024_H11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0030_A11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0044_C01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0143_B08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0085_A12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
AMP01_0012_H10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BMWN1_0068_A07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0044_B07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPLT1_0061_E03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0019_F05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0020_F12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPLT1_0083_F04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0043_A08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0076_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0077_E07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LNG01_0005_D09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LNG01_0033_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0100_H07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
AMP01_0027_F08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0060_H09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPLT1_0053_F10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BMWN1_0044_E06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0025_B03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BKFL1_0078_A04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0048_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0008_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LNG01_0067_D07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0080_H02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0015_F09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0019_A01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0030_F07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0088_H02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0038_E08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0064_D12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0037_H10.b : caaatttcacatccaaatattatctgacagctaatgacccaaatcaacaaaacagacaag
OVRM1_0102_F01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0107_D06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0154_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0111_A06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0099_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0222_A12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0148_H06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0009_D01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0070_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0011_A06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGCTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0080_H01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0122_F06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0136_C12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0075_F09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0194_C01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0036_H01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0044_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0037_D10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0162_E03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0008_G11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0099_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0041_H07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0029_E04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0110_H06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0205_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGT*AGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0159_B02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0013_G02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0105_G12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0115_H08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0094_D04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0103_D08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0072_D06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGACT
OVRM1_0110_B09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0063_D11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0020_C04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0001_G05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0043_C01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0115_H07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0001_B06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BKFL1_0010_F08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0100_A05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPLT1_0029_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0109_A12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0149_C02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0038_F01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0017_A08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0041_H12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0057_G04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0009_G12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0001_F02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0036_B12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0040_C02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LNG01_0083_A10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0148_F03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCA*TTGAGGGTGACGATGGATT
OVRT1_0146_B08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0019_E10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0094_B10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0051_G12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0089_A10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACAATGGATT
MLTL1_0086_A04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0071_C11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0098_A10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0049_B01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0090_E09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PST01_0023_D09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0006_D10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0048_A10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0073_D10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0061_F02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0012_F07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ADR01_0088_G05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0005_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0005_B04.b : AATTTCTCCGTAAATTTCC*TACCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0056_A04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0088_C08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0053_C01.b : AATTTTTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATCTGAGGGTGACGATGGATT
ITT01_0053_A09.b : AATTTTTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATCTGAGGGTGACGATGGATT
THY01_0111_C04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0058_C01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0099_H05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0189_A06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0108_G03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0113_E11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0195_E01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0041_F01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0093_H11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0034_E04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0150_E02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0079_A11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0192_F04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0011_G03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BFLT1_0144_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0069_H12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0008_H11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0143_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0139_E01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0167_F05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0077_E10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0141_H04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0124_G11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0130_G12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0013_A11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0102_F09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0021_A07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0068_E05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0056_E07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACCATGGATT
THY01_0015_G03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0037_G01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0034_F12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BFLT1_0094_D12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0075_E07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0138_E07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0055_H05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0015_E03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVR01_0102_E10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0116_B03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0032_E10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0112_C07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0015_C07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0104_C08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0063_H08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0134_H10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0032_H03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAACGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0024_B05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCGTTTGAGGGTGACGATGGATT
OVRT1_0081_H03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0011_G12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0029_B01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPLT1_0053_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0094_F06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0039_D08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0106_B09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0073_D01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0028_B08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0093_D07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0043_H08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0001_F02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0089_C02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0019_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TCH01_0058_H05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0007_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0022_D04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0103_H12.b : GATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0088_C07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0072_F06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0066_D06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0094_C11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0003_F12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0097_A03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0002_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0011_G01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TCH01_0015_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0176_B12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0174_F08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0214_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0089_G10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0112_G04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0111_B01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0118_C06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0005_F09.b : AATTTCTCCGTAAATTTCC*TGCCGGCAAGGCTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0156_G02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0036_H06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0027_E05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCT*GCATTTGAGGGTGACGATGGATT
OVRM1_0040_E02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0082_H08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0181_C10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0113_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0013_G06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0198_D03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0194_A07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0081_B06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0120_G01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0189_C02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0062_A07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0060_F02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0079_D10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0130_B01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0056_B12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0057_H10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0055_G09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0037_G01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0151_G11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0189_E04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0194_D11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0151_G06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0053_C01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0167_A05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0058_H02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0003_H09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0024_F04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0014_E05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0038_H06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0185_F04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0019_B11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0204_D06.b : AACTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0017_B05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0020_C11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0092_E12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0093_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0186_B09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0068_H12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0038_D11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0097_F05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0024_G09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0004_F09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0026_A07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0028_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0059_E10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0025_E06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0034_G07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ADR01_0030_F03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ADR01_0026_C07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0071_G02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BKFL1_0034_H11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0148_C08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0043_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0014_A12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0125_F06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0145_G09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0060_G10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TCH01_0016_D01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0107_G10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0114_C07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0018_E06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0016_F04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0138_H09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0040_C11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LNG01_0033_C09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0064_B07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0101_A05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LNG01_0036_G03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0066_H12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0036_G10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0081_H03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0028_G09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0053_C11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0060_E04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BKFL1_0053_A07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0005_A12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0062_F09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0096_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0053_F07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0116_G04.b : AATTTCTCCGCAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SMG01_0004_G06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0081_E08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0074_F06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
DCI01_0009_C10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BFLT1_0068_H03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0025_E07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0081_C10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGATGATGGATT
PBL01_0075_A05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0060_G02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0028_F08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0088_C04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0090_F05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0013_C09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0052_A09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0058_E11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0088_G07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TCH01_0034_H10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0048_H08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0147_H12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0016_F05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0058_F11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0008_E08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0013_A05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0016_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0043_C10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0088_G07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0089_F11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0012_D07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0018_G02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0205_A04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0082_C09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0083_C09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0071_E08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0078_B06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0100_B12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0098_C02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0056_F11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ADR01_0071_E10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRT1_0077_G12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0012_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0027_F10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0084_E08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0031_A07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0066_D09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0093_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TCH01_0033_A06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0018_D01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0048_A11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
BFLT1_0145_A02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0055_E11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0066_B05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0103_F01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0014_E06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0011_C05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0009_B12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0027_E08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0080_F06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0048_C08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0079_H01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0060_B06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PBL01_0058_G06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PST01_0005_F01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0082_C12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0048_H12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0090_E03.b : AATTTCTCCGTAAATTCCC*TGCCGGTAAGGTTCCATGCATTTGAGGGTGACGATGGATT
TES01_0076_A05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0033_G04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0099_H05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0044_B07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0083_G09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0036_B08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLN01_0050_B08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ITT01_0048_B11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0030_A12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0111_G05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0105_F03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0093_C12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0104_D02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0083_E04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0058_H09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0084_C08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0100_E04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0044_H09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0012_C09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PST01_0086_B01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0056_E03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0020_B04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PST01_0081_D04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
LVRM1_0124_D11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0004_E07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0006_A03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0083_C10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PST01_0076_B10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0036_F11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ILNT1_0086_B06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0112_B02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0067_G12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0080_D10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0018_A02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PST01_0022_D04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PST01_0045_D03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0072_F06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0064_H02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0071_F08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0076_H06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0004_H10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0098_E02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0008_C11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0068_E04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0017_A01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0065_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0032_C06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SKNB1_0058_G02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0013_F06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TES01_0068_C01.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0095_F11.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
MLTL1_0023_D08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
TCH01_0081_D05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0070_D07.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0069_H10.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0160_B06.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0082_E02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVRM1_0112_F08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
CLNT1_0078_E05.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0002_F02.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0074_D04.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
ADR01_0086_A12.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
PCT01_0005_G08.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0063_G09.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
UTR01_0092_C03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
SPL01_0004_D03.b : AATTTCTCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0102_H04.b : tggTTCTCCGTAAATT*CC*TGCCGGTAAGGT*CCA*GCATTTGAGGGTGACGATGGATT
ADR01_0037_H09.b : xxxxxxxCCGTAAATTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
THY01_0109_D08.b : xxxxxxxxxxxctggTTCC*TGCCGGTAAGGTTCCA*GCATTTGAGGGTGACGATGGATT
OVR01_0054_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGATT
20110601C-001573 : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
---------+---------+---------+---------+---------+---------+ 314
TCH01_0045_B08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0090_D03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0012_C09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0029_E01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPLT1_0049_C02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0048_F10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0047_F09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0012_E02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0043_C09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0108_A02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0069_D12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0026_G11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0044_F03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0027_H05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0090_C02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0015_A02.b : CTGTGTNNGTCGAGAGCATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0121_F02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0038_G05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0005_B11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0057_G09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0002_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0060_F08.b : CTGTGCGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0001_H01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0182_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0038_B07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0023_B11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0097_D06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0094_C10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0038_F01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0019_E06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0063_C04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0096_D05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0038_D03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0095_H06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0077_D04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0094_D05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0123_E12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0121_C04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0142_E03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0209_E05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0082_G12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0119_H08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0024_H11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0030_A11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0044_C01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0143_B08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0085_A12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
AMP01_0012_H10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BMWN1_0068_A07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0044_B07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
SPLT1_0061_E03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0019_F05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0020_F12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPLT1_0083_F04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0043_A08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0076_D05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0077_E07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
LNG01_0005_D09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
LNG01_0033_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0100_H07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
AMP01_0027_F08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0060_H09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPLT1_0053_F10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BMWN1_0044_E06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0025_B03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BKFL1_0078_A04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0048_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0008_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LNG01_0067_D07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0080_H02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0015_F09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0019_A01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0030_F07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0088_H02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0038_E08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0064_D12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0037_H10.b : tccatcattgtgatctagaacattcccatcttataataaacaatgcacaacatacaaaat
OVRM1_0102_F01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0107_D06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0154_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0111_A06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0099_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0222_A12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0148_H06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0009_D01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0070_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0011_A06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0080_H01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0122_F06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0136_C12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0075_F09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0194_C01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0036_H01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0044_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0037_D10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0162_E03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0008_G11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0099_D05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0041_H07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0029_E04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0110_H06.b : CTGTGTGTTCAAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0205_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0159_B02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0013_G02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0105_G12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0115_H08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0094_D04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0103_D08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0072_D06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0110_B09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0063_D11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0020_C04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGG*AAG
MLTL1_0001_G05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0043_C01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0115_H07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0001_B06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BKFL1_0010_F08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0100_A05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPLT1_0029_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0109_A12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0149_C02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0038_F01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0017_A08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0041_H12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0057_G04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0009_G12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0001_F02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0036_B12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0040_C02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LNG01_0083_A10.b : CTGTATGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0148_F03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0146_B08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0019_E10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0094_B10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0051_G12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0089_A10.b : CTGTGTGTTCAAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0086_A04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0071_C11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0098_A10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0049_B01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0090_E09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PST01_0023_D09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0006_D10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0048_A10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0073_D10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0061_F02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0012_F07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ADR01_0088_G05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0005_D05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0005_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0056_A04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0088_C08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0053_C01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0053_A09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0111_C04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0058_C01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0099_H05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0189_A06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0108_G03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0113_E11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0195_E01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0041_F01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0093_H11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0034_E04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0150_E02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0079_A11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0192_F04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0011_G03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BFLT1_0144_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0069_H12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0008_H11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0143_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0139_E01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0167_F05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0077_E10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0141_H04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0124_G11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0130_G12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0013_A11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0102_F09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0021_A07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0068_E05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0056_E07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0015_G03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0037_G01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0034_F12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BFLT1_0094_D12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0075_E07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0138_E07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0055_H05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0015_E03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVR01_0102_E10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0116_B03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0032_E10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0112_C07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0015_C07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0104_C08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0063_H08.b : CTGTGTGTTCGAGAGCAATACCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0134_H10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0032_H03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0024_B05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0081_H03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0011_G12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0029_B01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPLT1_0053_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0094_F06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0039_D08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0106_B09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGTGGAGCTGCGGGGAAG
PBL01_0073_D01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0028_B08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0093_D07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0043_H08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0001_F02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0089_C02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0019_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TCH01_0058_H05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0007_D05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0022_D04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0103_H12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0088_C07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0072_F06.b : CTGTGTGCTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0066_D06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0094_C11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0003_F12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0097_A03.b : CTGTGTGTCCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0002_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0011_G01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
TCH01_0015_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0176_B12.b : CTGTGTGTTCCAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0174_F08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0214_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0089_G10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0112_G04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0111_B01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0118_C06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0005_F09.b : CTGTGTGCTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAC
OVRM1_0156_G02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0036_H06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0027_E05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCAGGGAAG
OVRM1_0040_E02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0082_H08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0181_C10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0113_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0013_G06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0198_D03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0194_A07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0081_B06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0120_G01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0189_C02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0062_A07.b : CTGTGTGTTCGAGAGCAATGCCNTTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0060_F02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0079_D10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0130_B01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0056_B12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0057_H10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0055_G09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0037_G01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0151_G11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0189_E04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0194_D11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0151_G06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0053_C01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0167_A05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0058_H02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0003_H09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0024_F04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0014_E05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0038_H06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0185_F04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0019_B11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0204_D06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0017_B05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0020_C11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0092_E12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0093_D05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0186_B09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0068_H12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0038_D11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0097_F05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0024_G09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0004_F09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0026_A07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0028_D05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0059_E10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0025_E06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0034_G07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ADR01_0030_F03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ADR01_0026_C07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0071_G02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BKFL1_0034_H11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGTGGGGAAG
CLNT1_0148_C08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0043_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0014_A12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0125_F06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0145_G09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0060_G10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TCH01_0016_D01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0107_G10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0114_C07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0018_E06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0016_F04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0138_H09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0040_C11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
LNG01_0033_C09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0064_B07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0101_A05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LNG01_0036_G03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0066_H12.b : CTGTGTGTTCGAGAGCAGTGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0036_G10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0081_H03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0028_G09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0053_C11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0060_E04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BKFL1_0053_A07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0005_A12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0062_F09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0096_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCAACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0053_F07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0116_G04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SMG01_0004_G06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0081_E08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0074_F06.b : CTGTGTGTTCGGGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
DCI01_0009_C10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BFLT1_0068_H03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0025_E07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0081_C10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0075_A05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0060_G02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0028_F08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0088_C04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0090_F05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0013_C09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0052_A09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0058_E11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0088_G07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TCH01_0034_H10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0048_H08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0147_H12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0016_F05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0058_F11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0008_E08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0013_A05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0016_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0043_C10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0088_G07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0089_F11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0012_D07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0018_G02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0205_A04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0082_C09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0083_C09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0071_E08.b : CTGCGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0078_B06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0100_B12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0098_C02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0056_F11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACAAGGAGCTGCGGGGAAG
ADR01_0071_E10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRT1_0077_G12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0012_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0027_F10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0084_E08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0031_A07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0066_D09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0093_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TCH01_0033_A06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0018_D01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0048_A11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
BFLT1_0145_A02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0055_E11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0066_B05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCCTGAAG*
OVRM1_0103_F01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0014_E06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0011_C05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0009_B12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0027_E08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0080_F06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0048_C08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0079_H01.b : CTGTGTGATCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCAGGGAAG
UTR01_0060_B06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PBL01_0058_G06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PST01_0005_F01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0082_C12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0048_H12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0090_E03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAAGAGCTGCGGGGAAG
TES01_0076_A05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0033_G04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0099_H05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0044_B07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0083_G09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0036_B08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLN01_0050_B08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ITT01_0048_B11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0030_A12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0111_G05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0105_F03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0093_C12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0104_D02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0083_E04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0058_H09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0084_C08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0100_E04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0044_H09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0012_C09.b : CTGTGTGCTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PST01_0086_B01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0056_E03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0020_B04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PST01_0081_D04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
LVRM1_0124_D11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0004_E07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0006_A03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0083_C10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PST01_0076_B10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0036_F11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ILNT1_0086_B06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0112_B02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0067_G12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0080_D10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0018_A02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PST01_0022_D04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PST01_0045_D03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0072_F06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0064_H02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0071_F08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0076_H06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0004_H10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0098_E02.b : CTGTGTGTTCGAGAGCGATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0008_C11.b : CTGTGTGTTCGGGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0068_E04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0017_A01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0065_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0032_C06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SKNB1_0058_G02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0013_F06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TES01_0068_C01.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0095_F11.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
MLTL1_0023_D08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
TCH01_0081_D05.b : CTGTGTGTTCGAGAGTAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0070_D07.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0069_H10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0160_B06.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0082_E02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
OVRM1_0112_F08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
CLNT1_0078_E05.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0002_F02.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0074_D04.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ADR01_0086_A12.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
PCT01_0005_G08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0063_G09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
UTR01_0092_C03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
SPL01_0004_D03.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0102_H04.b : CTGTGTGTTCGAGTGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
ADR01_0037_H09.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
THY01_0109_D08.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTATGTGAGCAACGAGGAGCTGCGGGGAAG
OVR01_0054_D10.b : CTGTGTGTTCGAGAGCAATGCCATTGCCTACTACGTGAGCAACGAGGAGCTGCGGGGAAG
20110601C-001573 : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
---------+---------+---------+---------+---------+---------+ 370
TCH01_0045_B08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0090_D03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0012_C09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0029_E01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPLT1_0049_C02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0048_F10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0047_F09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0012_E02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGGCA
SMG01_0043_C09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0108_A02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0069_D12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0026_G11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0044_F03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0027_H05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0090_C02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0015_A02.b : TACTCCTGAGGCAG*CAGCCCAG***TGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0121_F02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0038_G05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0005_B11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0057_G09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0002_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0060_F08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0001_H01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0182_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0038_B07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0023_B11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0097_D06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0094_C10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0038_F01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0019_E06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0063_C04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0096_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0038_D03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0095_H06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0077_D04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0094_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0123_E12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0121_C04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0142_E03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0209_E05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0082_G12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0119_H08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0024_H11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0030_A11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0044_C01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0143_B08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0085_A12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
AMP01_0012_H10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BMWN1_0068_A07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0044_B07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPLT1_0061_E03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0019_F05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0020_F12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPLT1_0083_F04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0043_A08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0076_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0077_E07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LNG01_0005_D09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LNG01_0033_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0100_H07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
AMP01_0027_F08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0060_H09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPLT1_0053_F10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BMWN1_0044_E06.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
OVR01_0025_B03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BKFL1_0078_A04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0048_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0008_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LNG01_0067_D07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0080_H02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0015_F09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0019_A01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0030_F07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0088_H02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0038_E08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0064_D12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0037_H10.b : ataaagaataagccacagggtgatatagcaacgaagcagtattttgtattataataagca
OVRM1_0102_F01.b : TACTCCTGgtngncaagcaagccccaaaagtggtgcagtgggtgagctttgccaaaaggg
OVRM1_0107_D06.b : TACTCCTGAGGCAGNCAGCCCAGNNGTGGTGCAGTGGGgtgaagcttttgcccgatagcg
OVRM1_0154_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0111_A06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0099_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0222_A12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0148_H06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0009_D01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0070_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0011_A06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0080_H01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0122_F06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0136_C12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0075_F09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0194_C01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0036_H01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0044_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0037_D10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0162_E03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0008_G11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0099_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0041_H07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0029_E04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0110_H06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0205_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0159_B02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0013_G02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0105_G12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0115_H08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0094_D04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0103_D08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0072_D06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0110_B09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0063_D11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0020_C04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0001_G05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0043_C01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0115_H07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0001_B06.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
BKFL1_0010_F08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0100_A05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPLT1_0029_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0109_A12.b : TACTCCTGAGGCAG*CAGCCCAC**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0149_C02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0038_F01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0017_A08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0041_H12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0057_G04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0009_G12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0001_F02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0036_B12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0040_C02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LNG01_0083_A10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0148_F03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0146_B08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0019_E10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTCTGCCGATAGCGACA
THY01_0094_B10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0051_G12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0089_A10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0086_A04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0071_C11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0098_A10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0049_B01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0090_E09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PST01_0023_D09.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
MLTL1_0006_D10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0048_A10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0073_D10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0061_F02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0012_F07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ADR01_0088_G05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0005_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0005_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0056_A04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0088_C08.b : TACTCCTGAAGCAG*CAGCCCAG**GTGGTGCAGTGGA*TGAGCTTTGCCGATAGCGACA
ITT01_0053_C01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0053_A09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0111_C04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0058_C01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0099_H05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0189_A06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0108_G03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0113_E11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0195_E01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0041_F01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0093_H11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0034_E04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0150_E02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0079_A11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0192_F04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0011_G03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BFLT1_0144_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0069_H12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0008_H11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0143_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0139_E01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTCGCCGATAGCGACA
OVRM1_0167_F05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGTTTTGCCGATAGCGACA
OVRM1_0077_E10.b : AACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0141_H04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0124_G11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0130_G12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0013_A11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0102_F09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0021_A07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0068_E05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0056_E07.b : TACTCCTGAGGCAG*CAGCCCAC**GTGGTGCAGTGGG*TGAGCTTTGCCAATAGCGACA
THY01_0015_G03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0037_G01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0034_F12.b : TACTCCTGAGGCAG*CAACCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BFLT1_0094_D12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0075_E07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0138_E07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0055_H05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0015_E03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVR01_0102_E10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0116_B03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATGGCGACA
UTR01_0032_E10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0112_C07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0015_C07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGT*GG*TGAGCTTTGCCGATAGCGACA
CLNT1_0104_C08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0063_H08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0134_H10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0032_H03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0024_B05.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
OVRT1_0081_H03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0011_G12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0029_B01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPLT1_0053_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0094_F06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0039_D08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0106_B09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0073_D01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0028_B08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0093_D07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0043_H08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0001_F02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0089_C02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0019_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TCH01_0058_H05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0007_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0022_D04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCCTTGCCGATAGCGACA
ITT01_0103_H12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0088_C07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0072_F06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0066_D06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0094_C11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0003_F12.b : TACTCCTGAGGCAG*CAGCCCAG**ATGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0097_A03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0002_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0011_G01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TCH01_0015_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0176_B12.b : TACTCCTGAtgcacacaccaaagtggtgcaatgaggaagccttcctaaaaagtacatcat
OVRM1_0174_F08.b : TACTCCTGAGGCAG*CAGCCCAA**GTGGTGCAGTGGG*TGAGCTTTGACGATAGCAACA
OVRM1_0214_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0089_G10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0112_G04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0111_B01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0118_C06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0005_F09.b : TACTCCTGACGCAC*CAGCCCAT**GTGCCGCACCGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0156_G02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TAAGCTTTGCCGATAGCGACA
TES01_0036_H06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0027_E05.b : TACTCCTGAGGCAG*CAGCCCAA**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0040_E02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0082_H08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0181_C10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0113_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0013_G06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0198_D03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0194_A07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0081_B06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0120_G01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0189_C02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0062_A07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0060_F02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0079_D10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0130_B01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0056_B12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0057_H10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0055_G09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0037_G01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0151_G11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0189_E04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0194_D11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0151_G06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0053_C01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0167_A05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0058_H02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0003_H09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0024_F04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0014_E05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0038_H06.b : TACCCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0185_F04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0019_B11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0204_D06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0017_B05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0020_C11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0092_E12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0093_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0186_B09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0068_H12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0038_D11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0097_F05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0024_G09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0004_F09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0026_A07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0028_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0059_E10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0025_E06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0034_G07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ADR01_0030_F03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ADR01_0026_C07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0071_G02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BKFL1_0034_H11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0148_C08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0043_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0014_A12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0125_F06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0145_G09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0060_G10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TCH01_0016_D01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0107_G10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0114_C07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0018_E06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0016_F04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0138_H09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0040_C11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LNG01_0033_C09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0064_B07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0101_A05.b : TACTCCCGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LNG01_0036_G03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0066_H12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0036_G10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0081_H03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0028_G09.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
THY01_0053_C11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0060_E04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BKFL1_0053_A07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0005_A12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0062_F09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0096_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0053_F07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*CGAGCTTTGCCGATAGCGACA
DCI01_0116_G04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SMG01_0004_G06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0081_E08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0074_F06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
DCI01_0009_C10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BFLT1_0068_H03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0025_E07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0081_C10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0075_A05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0060_G02.b : TATTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0028_F08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0088_C04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0090_F05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0013_C09.b : TACTCCTGAGGCAG*CAGCCCGG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0052_A09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0058_E11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0088_G07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TCH01_0034_H10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0048_H08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0147_H12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0016_F05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0058_F11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0008_E08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0013_A05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0016_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0043_C10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0088_G07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0089_F11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0012_D07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0018_G02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0205_A04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0082_C09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0083_C09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0071_E08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0078_B06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0100_B12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0098_C02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0056_F11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCAACA
ADR01_0071_E10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRT1_0077_G12.b : TACTCCTGAGGCAA*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVR01_0012_B04.b : TACTCCTGAGGCAG****CCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0027_F10.b : TACTCCTGAGGCAG*CGGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0084_E08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0031_A07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0066_D09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0093_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TCH01_0033_A06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0018_D01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0048_A11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
BFLT1_0145_A02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
LVRM1_0055_E11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0066_B05.b : ***********CAA*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0103_F01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0014_E06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0011_C05.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
PBL01_0009_B12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0027_E08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0080_F06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0048_C08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0079_H01.b : TACTCCTGAGGCAG*CAGCCCAC**GTGGTGCACTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0060_B06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PBL01_0058_G06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PST01_0005_F01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0082_C12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0048_H12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0090_E03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAATGGG*TGAGCTTTGCCGATAGCGACA
TES01_0076_A05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0033_G04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0099_H05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0044_B07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0083_G09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0036_B08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLN01_0050_B08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ITT01_0048_B11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0030_A12.b : TACTCCTGAGGCAG*CAGACCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0111_G05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0105_F03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0093_C12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0104_D02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0083_E04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0058_H09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0084_C08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0100_E04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0044_H09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0012_C09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PST01_0086_B01.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
SKNB1_0056_E03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0020_B04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PST01_0081_D04.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
LVRM1_0124_D11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0004_E07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0006_A03.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
CLNT1_0083_C10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PST01_0076_B10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0036_F11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ILNT1_0086_B06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0112_B02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0067_G12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0080_D10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0018_A02.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
PST01_0022_D04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PST01_0045_D03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0072_F06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*CGAGCTTTGCCGATAGCGACA
SKNB1_0064_H02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0071_F08.b : TACTCCTGAGGCAG*CAGCCCAC**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0076_H06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0004_H10.b : TACGCCTGAGGCAG*CAGCCCAG**GTGATGCAGTGGG*TGAGCTTTGCTGATAGCGACA
OVRM1_0098_E02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0008_C11.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
SKNB1_0068_E04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0017_A01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0065_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0032_C06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SKNB1_0058_G02.b : TACTCCTGAGGCAG*CAACCCAC**GTGGTGCACTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0013_F06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TES01_0068_C01.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0095_F11.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
MLTL1_0023_D08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
TCH01_0081_D05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0070_D07.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0069_H10.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0160_B06.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0082_E02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
OVRM1_0112_F08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
CLNT1_0078_E05.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0002_F02.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0074_D04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ADR01_0086_A12.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
PCT01_0005_G08.b : TACGCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCTGATAGCGACA
THY01_0063_G09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
UTR01_0092_C03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
SPL01_0004_D03.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0102_H04.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
ADR01_0037_H09.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
THY01_0109_D08.b : TACTCCTGAGGCAG*CAGCCCAG**GTGGTGCAGTGGGGTGAGCTTTGCCGATAGCGACA
OVR01_0054_D10.b : TACTCCTGAGGCGG*CAGCCCAG**GTGGTGCAGTGGG*TGAGCTTTGCCGATAGCGACA
20110601C-001573 : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
---------+---------+---------+---------+---------+---------+ 429
TCH01_0045_B08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0090_D03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0012_C09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0029_E01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPLT1_0049_C02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0048_F10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0047_F09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0012_E02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0043_C09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0108_A02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0069_D12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0026_G11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0044_F03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0027_H05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0090_C02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0015_A02.b : TCGTG**CCCCCCGCAGTACCTGGGggtccccacttggggctcatgcactacacagccag
THY01_0121_F02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0038_G05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0005_B11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0057_G09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0002_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0060_F08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0001_H01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0182_D02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0038_B07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0023_B11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0097_D06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0094_C10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0038_F01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0019_E06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0063_C04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0096_D05.b : TCGTA*CCCCCCGCCAGTACTTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0038_D03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0095_H06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0077_D04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0094_D05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0123_E12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0121_C04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0142_E03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0209_E05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0082_G12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0119_H08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0024_H11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0030_A11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0044_C01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0143_B08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0085_A12.b : TCGTG*CCCCCCACCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
AMP01_0012_H10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BMWN1_0068_A07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0044_B07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPLT1_0061_E03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0019_F05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0020_F12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPLT1_0083_F04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0043_A08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0076_D05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0077_E07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LNG01_0005_D09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LNG01_0033_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0100_H07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
AMP01_0027_F08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0060_H09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPLT1_0053_F10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BMWN1_0044_E06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0025_B03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BKFL1_0078_A04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0048_D02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0008_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LNG01_0067_D07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0080_H02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0015_F09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0019_A01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0030_F07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0088_H02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0038_E08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0064_D12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0037_H10.b : cacctaacatttacaatagaccatagcgttataccaatagagaaagaaaaactatgaaca
OVRM1_0102_F01.b : aaaattcttgggccccccccnnnnnnnnnnnnnnnntttttttttttttnnntnnnnttn
OVRM1_0107_D06.b : gacatcggtggccccccgcccagtaacccggggggtttcccccaccttggggcattttgc
OVRM1_0154_C03.b : TCGTG*CCCCCCCGCAGTACCTGGGTGTTCCCCCACTTGGGCATCATGCACTACCACAAG
THY01_0111_A06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0099_D02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0222_A12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0148_H06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAAACAG
OVRM1_0009_D01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0070_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0011_A06.b : TCGTG*CCCCCCGCCAGTACCTGGGCGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0080_H01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0122_F06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0136_C12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0075_F09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0194_C01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0036_H01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0044_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0037_D10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0162_E03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0008_G11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0099_D05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0041_H07.b : TCGTG*CCCCCCGGCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0029_E04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0110_H06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0205_D02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0159_B02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0013_G02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0105_G12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0115_H08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0094_D04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0103_D08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0072_D06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0110_B09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0063_D11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0020_C04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0001_G05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0043_C01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0115_H07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0001_B06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BKFL1_0010_F08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0100_A05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPLT1_0029_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0109_A12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0149_C02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0038_F01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0017_A08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0041_H12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0057_G04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0009_G12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0001_F02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0036_B12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0040_C02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LNG01_0083_A10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0148_F03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0146_B08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0019_E10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0094_B10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0051_G12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0089_A10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0086_A04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0071_C11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0098_A10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0049_B01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAATAAG
MLTL1_0090_E09.b : TCGCG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PST01_0023_D09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0006_D10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0048_A10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0073_D10.b : TCGTGCCCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACGAG
THY01_0061_F02.b : TCGTG*CCCCCCGCCAGCACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0012_F07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCACGCACTACAACAAG
ADR01_0088_G05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0005_D05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTCCAACAAG
ITT01_0005_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0056_A04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0088_C08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0053_C01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0053_A09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0111_C04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0058_C01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0099_H05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0189_A06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0108_G03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0113_E11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0195_E01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0041_F01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0093_H11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0034_E04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0150_E02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0079_A11.b : TCGTG*CCCCCCGCCAGGACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0192_F04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0011_G03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BFLT1_0144_D02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0069_H12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0008_H11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0143_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0139_E01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCGCTACAACAAG
OVRM1_0167_F05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0077_E10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0141_H04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0124_G11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0130_G12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0013_A11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0102_F09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0021_A07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0068_E05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0056_E07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0015_G03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0037_G01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0034_F12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BFLT1_0094_D12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0075_E07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0138_E07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0055_H05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0015_E03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATTATGCACTACAACAAG
LVR01_0102_E10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0116_B03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0032_E10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0112_C07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0015_C07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0104_C08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0063_H08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0134_H10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0032_H03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0024_B05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0081_H03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0011_G12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0029_B01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPLT1_0053_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0094_F06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0039_D08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0106_B09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0073_D01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0028_B08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0093_D07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0043_H08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0001_F02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0089_C02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0019_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TCH01_0058_H05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0007_D05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0022_D04.b : TCGTG*CCCCCCGCCAGTATCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0103_H12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0088_C07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0072_F06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0066_D06.b : TCGTG*CCCCCCGCCAGTACCCGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0094_C11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0003_F12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0097_A03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0002_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0011_G01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TCH01_0015_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0176_B12.b : gccaagcgaccaaaagagataagacatcgtcacaggaccaacatcgtacacaatagaaca
OVRM1_0174_F08.b : TCGTG*CCCCaacgccaatacatgagtgatccccaacatgtgcatcatgtagtaaagaaa
OVRM1_0214_B04.b : TCGTG*TCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGTGCTCATGCACTACAACAAG
LVRM1_0089_G10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0112_G04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0111_B01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCACCATGCACTACAACAAG
THY01_0118_C06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0005_F09.b : TCCTG*TCCCCCGCCAGTACCTGGGCGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0156_G02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0036_H06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0027_E05.b : TCGTG*CCCCCCGCCAGAACCTGGGTGTTCCCCACCTTGGGCATCATGCGATACAACAAG
OVRM1_0040_E02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCGCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0082_H08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0181_C10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0113_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0013_G06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0198_D03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0194_A07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGCGCATCATGCACTACAACAAG
OVRM1_0081_B06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0120_G01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0189_C02.b : TCGTG*CCCCCCGCCAGTACTTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0062_A07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0060_F02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0079_D10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0130_B01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0056_B12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0057_H10.b : TCGTG**CCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0055_G09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0037_G01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0151_G11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0189_E04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0194_D11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0151_G06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0053_C01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0167_A05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0058_H02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0003_H09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0024_F04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0014_E05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0038_H06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0185_F04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0019_B11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0204_D06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0017_B05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0020_C11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0092_E12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0093_D05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0186_B09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0068_H12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0038_D11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0097_F05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0024_G09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0004_F09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0026_A07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0028_D05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0059_E10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0025_E06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0034_G07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ADR01_0030_F03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ADR01_0026_C07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0071_G02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BKFL1_0034_H11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0148_C08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0043_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0014_A12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0125_F06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0145_G09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0060_G10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TCH01_0016_D01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0107_G10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0114_C07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0018_E06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0016_F04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0138_H09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0040_C11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LNG01_0033_C09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0064_B07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0101_A05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LNG01_0036_G03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0066_H12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0036_G10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0081_H03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0028_G09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0053_C11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0060_E04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BKFL1_0053_A07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0005_A12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0062_F09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0096_D02.b : TCGTGCCCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0053_F07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0116_G04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SMG01_0004_G06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0081_E08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0074_F06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
DCI01_0009_C10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BFLT1_0068_H03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAC
ITT01_0025_E07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0081_C10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0075_A05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0060_G02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0028_F08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0088_C04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0090_F05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0013_C09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0052_A09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0058_E11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0088_G07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TCH01_0034_H10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0048_H08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0147_H12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0016_F05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0058_F11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0008_E08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0013_A05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0016_D02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0043_C10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0088_G07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0089_F11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0012_D07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0018_G02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0205_A04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0082_C09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0083_C09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0071_E08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0078_B06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0100_B12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0098_C02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0056_F11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ADR01_0071_E10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRT1_0077_G12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0012_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0027_F10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0084_E08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0031_A07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0066_D09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0093_D02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TCH01_0033_A06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0018_D01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0048_A11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
BFLT1_0145_A02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0055_E11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0066_B05.b : TCGAG*CCCCCCGCCAGGACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0103_F01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0014_E06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0011_C05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0009_B12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0027_E08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0080_F06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0048_C08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0079_H01.b : TCGTG*CCCCCCGCCAGAACCTGAGTGTTCCCCAACTTGGGCATCATGCACTACAACAAG
UTR01_0060_B06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PBL01_0058_G06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PST01_0005_F01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0082_C12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0048_H12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0090_E03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0076_A05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0033_G04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0099_H05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGAGCATCATGCACTACAACAAG
TES01_0044_B07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0083_G09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0036_B08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLN01_0050_B08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ITT01_0048_B11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0030_A12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0111_G05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0105_F03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0093_C12.b : TCGTG**CCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0104_D02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCTCACCTTGGGCATCATGCACTACAACAAG
TES01_0083_E04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0058_H09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0084_C08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0100_E04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0044_H09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0012_C09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PST01_0086_B01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0056_E03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0020_B04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PST01_0081_D04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
LVRM1_0124_D11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0004_E07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0006_A03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0083_C10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PST01_0076_B10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0036_F11.b : TCGTG*CCCCCCGCCAATACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ILNT1_0086_B06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0112_B02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0067_G12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAGCAAG
TES01_0080_D10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0018_A02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PST01_0022_D04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PST01_0045_D03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0072_F06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0064_H02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0071_F08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0076_H06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0004_H10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0098_E02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0008_C11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0068_E04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0017_A01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0065_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0032_C06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SKNB1_0058_G02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0013_F06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TES01_0068_C01.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0095_F11.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
MLTL1_0023_D08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
TCH01_0081_D05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
UTR01_0070_D07.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0069_H10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0160_B06.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0082_E02.b : CCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVRM1_0112_F08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
CLNT1_0078_E05.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0002_F02.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0074_D04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ADR01_0086_A12.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
PCT01_0005_G08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0063_G09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACCACAACAAG
UTR01_0092_C03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
SPL01_0004_D03.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0102_H04.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
ADR01_0037_H09.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
THY01_0109_D08.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
OVR01_0054_D10.b : TCGTG*CCCCCCGCCAGTACCTGGGTGTTCCCCACCTTGGGCATCATGCACTACAACAAG
20110601C-001573 : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
---------+---------+---------+---------+---------+---------+ 488
TCH01_0045_B08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0090_D03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0012_C09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0029_E01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPLT1_0049_C02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0048_F10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0047_F09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0012_E02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0043_C09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0108_A02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0069_D12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0026_G11.b : CAGGCCACAGAGAATGCGAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0044_F03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0027_H05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0090_C02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0015_A02.b : cctcaagaatgcaaagattaggtgagccaatctggggctgctggagtcacttgaaaacag
THY01_0121_F02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0038_G05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0005_B11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0057_G09.b : CAGGCCACAGAGAGTGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0002_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0060_F08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0001_H01.b : CAGGCCACAAANAATGCAAAGGATGAGGTG*ACCCCCCCTCTGGGGCTGCTGGATGCTCA
OVRM1_0182_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0038_B07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0023_B11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0097_D06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCAAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0094_C10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0038_F01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0019_E06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0063_C04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0096_D05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0038_D03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0095_H06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0077_D04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0094_D05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0123_E12.b : CAGGCCACAGAAAATGCAAAGGATTAAATG*AGGCGAGTTTTGGGGCTGCTGGATGCTCA
THY01_0121_C04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0142_E03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0209_E05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0082_G12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0119_H08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0024_H11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0030_A11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0044_C01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0143_B08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0085_A12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
AMP01_0012_H10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BMWN1_0068_A07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0044_B07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPLT1_0061_E03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0019_F05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0020_F12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPLT1_0083_F04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0043_A08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0076_D05.b : CAGGCCACAGAGAGTGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0077_E07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LNG01_0005_D09.b : CAGGCCACAGAGAATGCAAAGGATAAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LNG01_0033_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0100_H07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
AMP01_0027_F08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0060_H09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPLT1_0053_F10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BMWN1_0044_E06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0025_B03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGGTGCTCA
BKFL1_0078_A04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0048_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0008_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LNG01_0067_D07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0080_H02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0015_F09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0019_A01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0030_F07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0088_H02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0038_E08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0064_D12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0037_H10.b : ctctataaaaacgacgagaaagacgacagaatccaagtagcaagaataaagctgatgggc
OVRM1_0102_F01.b : nnnttnnntntnnnttttttgtttttttttttnnnttttnnggggtggngtggtgttttt
OVRM1_0107_D06.b : ccttaaaaacaaggaggggcccccaaaaaaatgcaaagggattgagggggggggcaattt
OVRM1_0154_C03.b : gcaggccacaaagaatggcaaaggatgaggttgaggccaattctgggggctgccggaatg
THY01_0111_A06.b : CAGGCCACAGAGAATGGAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0099_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0222_A12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0148_H06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AAGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0009_D01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0070_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0011_A06.b : CAGGTCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0080_H01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0122_F06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0136_C12.b : CAGGCCACAGAAGAATGCAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0075_F09.b : CAGGCCACAGAAAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGATGGATGCTCA
OVRM1_0194_C01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0036_H01.b : CAGGCCACAGAGAATGCAACGGATGAAGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0044_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0037_D10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0162_E03.b : CAGGCCACAGGGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0008_G11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0099_D05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0041_H07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0029_E04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0110_H06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0205_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0159_B02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0013_G02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0105_G12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0115_H08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0094_D04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0103_D08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0072_D06.b : CAGGCCACAGAGGATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0110_B09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0063_D11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0020_C04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0001_G05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0043_C01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0115_H07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0001_B06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BKFL1_0010_F08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0100_A05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPLT1_0029_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0109_A12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0149_C02.b : CAGGCCACAGAGGATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0038_F01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0017_A08.b : CGGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0041_H12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0057_G04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0009_G12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0001_F02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0036_B12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0040_C02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LNG01_0083_A10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0148_F03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0146_B08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0019_E10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0094_B10.b : CAGGCCACAGAGAATGTAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0051_G12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0089_A10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0086_A04.b : CAGGCCACAGAGAATGCAAAGTATGAGGTG*AGGCGGGTTCTGGGGCTGCTGGATGCTCA
THY01_0071_C11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0098_A10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0049_B01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTAGGGCTGCTGGATGCTCA
MLTL1_0090_E09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PST01_0023_D09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0006_D10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0048_A10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0073_D10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0061_F02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0012_F07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ADR01_0088_G05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0005_D05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0005_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0056_A04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0088_C08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0053_C01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0053_A09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0111_C04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0058_C01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0099_H05.b : CAGGCCACAGAGAATGCTAAGGATGAGGTG*AGGCTAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0189_A06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0108_G03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0113_E11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0195_E01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0041_F01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0093_H11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0034_E04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0150_E02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0079_A11.b : CAGGCCACAGAGAATGCCAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0192_F04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0011_G03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BFLT1_0144_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0069_H12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0008_H11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0143_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0139_E01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0167_F05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0077_E10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0141_H04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0124_G11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0130_G12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0013_A11.b : CAGGCCACAGAGAGTGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0102_F09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0021_A07.b : CAGGCCACAGAGAATGCAAAGGATGAGGCG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0068_E05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0056_E07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0015_G03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0037_G01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0034_F12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BFLT1_0094_D12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0075_E07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0138_E07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0055_H05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0015_E03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVR01_0102_E10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0116_B03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0032_E10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0112_C07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0015_C07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0104_C08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0063_H08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0134_H10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0032_H03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0024_B05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0081_H03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0011_G12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0029_B01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTCCTGGGGCTGCTGGATGCTCA
SPLT1_0053_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0094_F06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0039_D08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0106_B09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0073_D01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0028_B08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0093_D07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0043_H08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0001_F02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0089_C02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0019_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TCH01_0058_H05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0007_D05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0022_D04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0103_H12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0088_C07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0072_F06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0066_D06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0094_C11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0003_F12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0097_A03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0002_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0011_G01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TCH01_0015_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0176_B12.b : accacaatatactcccacatgagcacccttataccaaaatctatccccaatttccataat
OVRM1_0174_F08.b : tcaagcaacaaaaaatgcatacgtagacgtgacgactctctctcaagaccaaaaagagat
OVRM1_0214_B04.b : CAGGCCACAAAagaatgccataggatgaggtgaggcgtagttctggacgctgctagtatg
LVRM1_0089_G10.b : CAGGCCACAGAGAATGCACAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0112_G04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0111_B01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0118_C06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0005_F09.b : CATGCCACAGAGAATGTAAAGGATGACGTGCACGCGAGCTCTGGGGCTGCTGGATGCTCA
OVRM1_0156_G02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0036_H06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0027_E05.b : CAGGCCACAGAGAATGCAAAGGATAGACAGGAGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0040_E02.b : CAGGCCACGGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0082_H08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0181_C10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0113_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0013_G06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAATTCTGGGGCTGCTGGATGCTCA
OVRM1_0198_D03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0194_A07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0081_B06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0120_G01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0189_C02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0062_A07.b : CAGGCCACAGAGAATGCANAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0060_F02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0079_D10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0130_B01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0056_B12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0057_H10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0055_G09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0037_G01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0151_G11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0189_E04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0194_D11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0151_G06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0053_C01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0167_A05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGTGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0058_H02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0003_H09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0024_F04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0014_E05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0038_H06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0185_F04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0019_B11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0204_D06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0017_B05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0020_C11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGACTGCTGGATGCTCA
OVRM1_0092_E12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0093_D05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0186_B09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0068_H12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0038_D11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0097_F05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0024_G09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0004_F09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0026_A07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0028_D05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0059_E10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0025_E06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0034_G07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ADR01_0030_F03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ADR01_0026_C07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0071_G02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BKFL1_0034_H11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0148_C08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0043_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0014_A12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0125_F06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0145_G09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0060_G10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TCH01_0016_D01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0107_G10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0114_C07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0018_E06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0016_F04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0138_H09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0040_C11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LNG01_0033_C09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0064_B07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0101_A05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LNG01_0036_G03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0066_H12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0036_G10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTA*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0081_H03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0028_G09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0053_C11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0060_E04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BKFL1_0053_A07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0005_A12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0062_F09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCAGGGGCTGCTGGATGCTCA
THY01_0096_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0053_F07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0116_G04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SMG01_0004_G06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0081_E08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTACTGGATGCTCA
SKNB1_0074_F06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
DCI01_0009_C10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BFLT1_0068_H03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0025_E07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0081_C10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0075_A05.b : CAGGCCACAGAGAATGCAAAGGACGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0060_G02.b : CAGGCCACAGAGAGTGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0028_F08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0088_C04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0090_F05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0013_C09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0052_A09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0058_E11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCG
ITT01_0088_G07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TCH01_0034_H10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0048_H08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0147_H12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0016_F05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0058_F11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0008_E08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0013_A05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0016_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGTGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0043_C10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0088_G07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0089_F11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0012_D07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0018_G02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0205_A04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0082_C09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0083_C09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0071_E08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0078_B06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0100_B12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0098_C02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0056_F11.b : CAGGCCACAAAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ADR01_0071_E10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRT1_0077_G12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0012_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0027_F10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0084_E08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0031_A07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0066_D09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0093_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TCH01_0033_A06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0018_D01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0048_A11.b : CAGGCCACAGAGAATGCAAAGGATGACGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
BFLT1_0145_A02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0055_E11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0066_B05.b : CAGGCCACAGAGAATGCAAAGGATGATGTG*AGGCAAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0103_F01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0014_E06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0011_C05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0009_B12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0027_E08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0080_F06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0048_C08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0079_H01.b : CAAGCCACATAAAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0060_B06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PBL01_0058_G06.b : TAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PST01_0005_F01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0082_C12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0048_H12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0090_E03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0076_A05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0033_G04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0099_H05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0044_B07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0083_G09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0036_B08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLN01_0050_B08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ITT01_0048_B11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0030_A12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0111_G05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0105_F03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0093_C12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0104_D02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0083_E04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0058_H09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0084_C08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0100_E04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0044_H09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0012_C09.b : CAGGCCACAGAGAATGCGAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PST01_0086_B01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0056_E03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0020_B04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PST01_0081_D04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
LVRM1_0124_D11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0004_E07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0006_A03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0083_C10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PST01_0076_B10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0036_F11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ILNT1_0086_B06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0112_B02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0067_G12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0080_D10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0018_A02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PST01_0022_D04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PST01_0045_D03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0072_F06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0064_H02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0071_F08.b : CAGGCCACAGAGAATGCAAAGGATGATGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0076_H06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0004_H10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0098_E02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0008_C11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0068_E04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SKNB1_0017_A01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0065_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0032_C06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGCTCTGGGGCTGCTGGATGCTCA
SKNB1_0058_G02.b : CAGGCCACAGAGAATGCAAAGGATGATGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0013_F06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TES01_0068_C01.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGACTGCTGGATGCTCA
MLTL1_0095_F11.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
MLTL1_0023_D08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
TCH01_0081_D05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0070_D07.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0069_H10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0160_B06.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0082_E02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVRM1_0112_F08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
CLNT1_0078_E05.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0002_F02.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0074_D04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ADR01_0086_A12.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
PCT01_0005_G08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0063_G09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
UTR01_0092_C03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
SPL01_0004_D03.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0102_H04.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
ADR01_0037_H09.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
THY01_0109_D08.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
OVR01_0054_D10.b : CAGGCCACAGAGAATGCAAAGGATGAGGTG*AGGCGAGTTCTGGGGCTGCTGGATGCTCA
20110601C-001573 : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
---------+---------+---------+---------+---------+---------+ 547
TCH01_0045_B08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0090_D03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0012_C09.b : CTTGAAGTCGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0029_E01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPLT1_0049_C02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0048_F10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0047_F09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0012_E02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0043_C09.b : CTTGAAGACGAAGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0108_A02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0069_D12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0026_G11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0044_F03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0027_H05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0090_C02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0015_A02.b : actttcgggtggcaactttgaacctgctgaatccattgctgccccggttggcccacaaaa
THY01_0121_F02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0038_G05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0005_B11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0057_G09.b : CTTGAGGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0002_C03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0060_F08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0001_H01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0182_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0038_B07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0023_B11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0097_D06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0094_C10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0038_F01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0019_E06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0063_C04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAGCGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0096_D05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0038_D03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0095_H06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0077_D04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0094_D05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0123_E12.b : CTTTAAAAAAAAGAA*TTTTCTGtgggcgaacgtgtgaagcctgctaaaattcagttgtt
THY01_0121_C04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0142_E03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0209_E05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0082_G12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0119_H08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0024_H11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0030_A11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0044_C01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0143_B08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0085_A12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
AMP01_0012_H10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BMWN1_0068_A07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0044_B07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPLT1_0061_E03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0019_F05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0020_F12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPLT1_0083_F04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0043_A08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0076_D05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0077_E07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LNG01_0005_D09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LNG01_0033_C03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0100_H07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
AMP01_0027_F08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0060_H09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPLT1_0053_F10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BMWN1_0044_E06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0025_B03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BKFL1_0078_A04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0048_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0008_B04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LNG01_0067_D07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0080_H02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0015_F09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0019_A01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0030_F07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0088_H02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0038_E08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0064_D12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0037_H10.b : tgcataaaacacaaattatgcgcgtaaaaaatacttatattagacaaagttctccacgta
OVRM1_0102_F01.b : ggnggggtttggttttgtgtgtggtgggggttttttttggtgttggtgttgtggtgtttt
OVRM1_0107_D06.b : tccggggccccctcgggaagggcccccttgaaaaaaaaaaaagaattttttggtgggggc
OVRM1_0154_C03.b : cccccctttaaaaacaaagaatttttttgggtggggcgaaaaatgttgaacctgtgggtg
THY01_0111_A06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0099_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0222_A12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0148_H06.b : CTTGNAGACGAAGAC*TTTTCTGGGTGGCCAACGTGTGACGCTGGCTGACATCACAATTG
OVRM1_0009_D01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGCTG
TES01_0070_C03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0011_A06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGCTG
OVRM1_0080_H01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0122_F06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0136_C12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0075_F09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTAG
OVRM1_0194_C01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0036_H01.b : CTTTGAGACGAAGAA*CTTTCTGTTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0044_C03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0037_D10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0162_E03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0008_G11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0099_D05.b : CTTGAAGACGAGGACTTTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0041_H07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0029_E04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0110_H06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0205_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0159_B02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0013_G02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0105_G12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0115_H08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0094_D04.b : CTTGAAGACGAGGAC*TCTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0103_D08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0072_D06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0110_B09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0063_D11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0020_C04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0001_G05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0043_C01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0115_H07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0001_B06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BKFL1_0010_F08.b : CTTGAAGACGAGGAC*TTTCCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0100_A05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPLT1_0029_B04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0109_A12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0149_C02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0038_F01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0017_A08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0041_H12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0057_G04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0009_G12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0001_F02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGCGACGCTGGCTGACATCACAGTTG
PBL01_0036_B12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0040_C02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LNG01_0083_A10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0148_F03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0146_B08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0019_E10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0094_B10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0051_G12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0089_A10.b : CTTGAAAACAAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0086_A04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0071_C11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0098_A10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0049_B01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0090_E09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PST01_0023_D09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGCGTGACGCTGGCTGACATCACAGTTG
MLTL1_0006_D10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0048_A10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0073_D10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0061_F02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0012_F07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ADR01_0088_G05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0005_D05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0005_B04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0056_A04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0088_C08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0053_C01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0053_A09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0111_C04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0058_C01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0099_H05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAGCGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0189_A06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0108_G03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0113_E11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0195_E01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0041_F01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0093_H11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACGGTTG
SMG01_0034_E04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0150_E02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0079_A11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0192_F04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0011_G03.b : CTTGAAGACGACGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BFLT1_0144_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0069_H12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0008_H11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0143_B04.b : CTTGAAGACGAGGGC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0139_E01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0167_F05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0077_E10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0141_H04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0124_G11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0130_G12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0013_A11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0102_F09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0021_A07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0068_E05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0056_E07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACATTTG
THY01_0015_G03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0037_G01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0034_F12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BFLT1_0094_D12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0075_E07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0138_E07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0055_H05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0015_E03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCAGGCTGACATCACAGTTG
LVR01_0102_E10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0116_B03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0032_E10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACACCACAGTTG
CLNT1_0112_C07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0015_C07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0104_C08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0063_H08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0134_H10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0032_H03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0024_B05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0081_H03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0011_G12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0029_B01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPLT1_0053_B04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0094_F06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCAAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0039_D08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0106_B09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0073_D01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0028_B08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0093_D07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0043_H08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0001_F02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0089_C02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0019_B04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TCH01_0058_H05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0007_D05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0022_D04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0103_H12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0088_C07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0072_F06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0066_D06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0094_C11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0003_F12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0097_A03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0002_B04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0011_G01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TCH01_0015_C03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0176_B12.b : ataacctcgccccagacagcatagacgatgccgataacctcactagtaagaggtgtacca
OVRM1_0174_F08.b : acaaattaaaataagcatacaaacgagtatataaattactacaacacaatggagcgaaat
OVRM1_0214_B04.b : cttcacttgagaacgaggcactttgcctggtgcacacaacctgattaacctgggctgata
LVRM1_0089_G10.b : CTTGAAGACAATGAC*ATTTCTGGTGGGCAAACGTGTGACACTGGCTGACCTCACAGTTG
THY01_0112_G04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0111_B01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0118_C06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0005_F09.b : CTTGAAGACGACGACTTTTCTTGGTGGGCGAACGTGCGACGCTGGCTGACATCACACTTG
OVRM1_0156_G02.b : CTTGAAGACGAAGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0036_H06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0027_E05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGGTG
OVRM1_0040_E02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0082_H08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0181_C10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0113_C03.b : CTTGAAGACGAAGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0013_G06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0198_D03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0194_A07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0081_B06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0120_G01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0189_C02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0062_A07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0060_F02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0079_D10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0130_B01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0056_B12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0057_H10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0055_G09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0037_G01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0151_G11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0189_E04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0194_D11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0151_G06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0053_C01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0167_A05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0058_H02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0003_H09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0024_F04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0014_E05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0038_H06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0185_F04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0019_B11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0204_D06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0017_B05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0020_C11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0092_E12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0093_D05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0186_B09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0068_H12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0038_D11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0097_F05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0024_G09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0004_F09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0026_A07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0028_D05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0059_E10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0025_E06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0034_G07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ADR01_0030_F03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ADR01_0026_C07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0071_G02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BKFL1_0034_H11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0148_C08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0043_C03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0014_A12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0125_F06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0145_G09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0060_G10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TCH01_0016_D01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0107_G10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0114_C07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0018_E06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0016_F04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0138_H09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0040_C11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LNG01_0033_C09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0064_B07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0101_A05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LNG01_0036_G03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0066_H12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0036_G10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0081_H03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0028_G09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0053_C11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0060_E04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BKFL1_0053_A07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0005_A12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0062_F09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0096_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0053_F07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0116_G04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SMG01_0004_G06.b : CTTGAAGATGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0081_E08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0074_F06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
DCI01_0009_C10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BFLT1_0068_H03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0025_E07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0081_C10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0075_A05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0060_G02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0028_F08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0088_C04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0090_F05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0013_C09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0052_A09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0058_E11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0088_G07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TCH01_0034_H10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGGCGCTGGCTGACATCACAGTTG
MLN01_0048_H08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0147_H12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0016_F05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0058_F11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0008_E08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0013_A05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0016_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0043_C10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0088_G07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0089_F11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0012_D07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0018_G02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0205_A04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0082_C09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0083_C09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0071_E08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0078_B06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0100_B12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0098_C02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGTTGGCTGACATCACAGTTG
MLN01_0056_F11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ADR01_0071_E10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRT1_0077_G12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0012_B04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0027_F10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0084_E08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0031_A07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0066_D09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0093_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TCH01_0033_A06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0018_D01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0048_A11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
BFLT1_0145_A02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0055_E11.b : CTTGAAGACGAGGGC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0066_B05.b : CTTGAATACGAGGAC*TTTTCTGATGAGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0103_F01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0014_E06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0011_C05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0009_B12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACCCTGGCTGACATCACAGTTG
PBL01_0027_E08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0080_F06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0048_C08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0079_H01.b : CTTGAAGACCAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGATG
UTR01_0060_B06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PBL01_0058_G06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PST01_0005_F01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0082_C12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0048_H12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0090_E03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0076_A05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0033_G04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0099_H05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0044_B07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0083_G09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0036_B08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLN01_0050_B08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ITT01_0048_B11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0030_A12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGGACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0111_G05.b : CTTGAAGACGAGGAC**TTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0105_F03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0093_C12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0104_D02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0083_E04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0058_H09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0084_C08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0100_E04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0044_H09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0012_C09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PST01_0086_B01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0056_E03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0020_B04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PST01_0081_D04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
LVRM1_0124_D11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0004_E07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0006_A03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0083_C10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PST01_0076_B10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0036_F11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ILNT1_0086_B06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0112_B02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0067_G12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0080_D10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0018_A02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PST01_0022_D04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PST01_0045_D03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0072_F06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0064_H02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0071_F08.b : CTTGAAGACTAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0076_H06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0004_H10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0098_E02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0008_C11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0068_E04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0017_A01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0065_C03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0032_C06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SKNB1_0058_G02.b : CTTGAAGACGAGGAC*TTTTCCGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0013_F06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TES01_0068_C01.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0095_F11.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
MLTL1_0023_D08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
TCH01_0081_D05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0070_D07.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0069_H10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0160_B06.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0082_E02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVRM1_0112_F08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
CLNT1_0078_E05.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0002_F02.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0074_D04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ADR01_0086_A12.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
PCT01_0005_G08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0063_G09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
UTR01_0092_C03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
SPL01_0004_D03.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0102_H04.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
ADR01_0037_H09.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
THY01_0109_D08.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
OVR01_0054_D10.b : CTTGAAGACGAGGAC*TTTTCTGGTGGGCGAACGTGTGACGCTGGCTGACATCACAGTTG
20110601C-001573 : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
---------+---------+---------+---------+---------+---------+ 603
TCH01_0045_B08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0090_D03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0012_C09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0029_E01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPLT1_0049_C02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0048_F10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0047_F09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0012_E02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0043_C09.b : TATGCA*CCCTGTTGTGGCTCTA*CAA*CAGGTCCTGGAGCCTTCTT*TCCGCA*GGGCC
TES01_0108_A02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0069_D12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0026_G11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0044_F03.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0027_H05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0090_C02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0015_A02.b : ggctggagcttttttcccagcctccccaaacaaccgtggtcctacctgataaacaccccc
THY01_0121_F02.b : TTTGCN*CCCTGTTGTGGCTTTA*CAAACAGGTCCCTGAACCTTCTT*TTCCccgggctt
TES01_0038_G05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0005_B11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0057_G09.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0002_C03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0060_F08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAACCTTCTT*TTCGCC*AGGCC
SKNB1_0001_H01.b : TATGCA*CCCTGTTGTGCCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCC*CC*AGGGC
OVRM1_0182_D02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0038_B07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0023_B11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0097_D06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0094_C10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0038_F01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0019_E06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0063_C04.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0096_D05.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0038_D03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0095_H06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0077_D04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0094_D05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0123_E12.b : ttcccctgttgtggccttcaaaaaagttctgaaccttttttccccagccttcccaaaaca
THY01_0121_C04.b : TATGCC*CCCTGTTGTGGCTTTA*CAAAAAGGTTCTTGAACCctttttcgcccggccctt
LVRM1_0142_E03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0209_E05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0082_G12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0119_H08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0024_H11.b : TCCGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0030_A11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0044_C01.b : TATGCA*CCCTGTTGTGGCTCTA*CAA*CAGGTCCTGGAGCCTTCTT*TCCG*C*AGGCC
OVRT1_0143_B08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0085_A12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
AMP01_0012_H10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BMWN1_0068_A07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0044_B07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPLT1_0061_E03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0019_F05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0020_F12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPLT1_0083_F04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0043_A08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0076_D05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0077_E07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LNG01_0005_D09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LNG01_0033_C03.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*CCCGCC*AGGCC
SKNB1_0100_H07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
AMP01_0027_F08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0060_H09.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPLT1_0053_F10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BMWN1_0044_E06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0025_B03.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BKFL1_0078_A04.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0048_D02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0008_B04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LNG01_0067_D07.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0080_H02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0015_F09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0019_A01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0030_F07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0088_H02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0038_E08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0064_D12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0037_H10.b : tttggtacacccatttacaaaataacataaacaaacaaatagggtcccatatattaaact
OVRM1_0102_F01.b : gtgtgtggttggggttggtgggggggggggngtgggtctggggggtgggtgtgttgggtt
OVRM1_0107_D06.b : gaaaaacggtgaacaccgggggaaaaaaacaaattttctttccccccccgtttggggttt
OVRM1_0154_C03.b : aaaaaccaaaattttttctgcgccccccgggtggggggtttttcaaaaaagggtgccggg
THY01_0111_A06.b : TATGNC*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGAAGCCTTCTT*TCCGCC*AGGCC
SMG01_0099_D02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAAGCTTCTT*TCNGGC*AGGCC
OVRM1_0222_A12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0148_H06.b : TCTGCACCCTGTTTGTGGCTCTA*CAACAAGGTCCTGGAGCCCTTCT*TCCCGC*AGGGC
OVRM1_0009_D01.b : TCTGCA*CCCTGTTGCGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGTC*AGGCC
TES01_0070_C03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTTTTCCGCC*AGCCT
THY01_0011_A06.b : TATGCA*CCCTGCTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCCT*TCCG*C*AGGAC
OVRM1_0080_H01.b : TCTGCA*CCCTGTTGTGGCTCTA*CNAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0122_F06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0136_C12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0075_F09.b : TCTGCA*CCCTGTTGAGGCTCTA*CAAACAGGATCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0194_C01.b : TCCGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0036_H01.b : TATGCA*CCCTGTTGTGGCTCTA*CNAACAAGGTCCTGGACCTTCTT*TTCGCCCAGGCC
OVRM1_0044_C03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0037_D10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0162_E03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0008_G11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0099_D05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0041_H07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0029_E04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0110_H06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0205_D02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0159_B02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0013_G02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0105_G12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0115_H08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0094_D04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGTC*AGGCC
OVRM1_0103_D08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0072_D06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0110_B09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0063_D11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0020_C04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0001_G05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0043_C01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0115_H07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PCT01_0001_B06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BKFL1_0010_F08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0100_A05.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPLT1_0029_B04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0109_A12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0149_C02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0038_F01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0017_A08.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0041_H12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0057_G04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0009_G12.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0001_F02.b : TCCGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0036_B12.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0040_C02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LNG01_0083_A10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0148_F03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0146_B08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0019_E10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0094_B10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0051_G12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0089_A10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0086_A04.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0071_C11.b : TATGCA*CCCTGTTGAGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0098_A10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0049_B01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0090_E09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PST01_0023_D09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0006_D10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0048_A10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0073_D10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0061_F02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0012_F07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ADR01_0088_G05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0005_D05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0005_B04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0056_A04.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0088_C08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0053_C01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0053_A09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0111_C04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGNCC
SMG01_0058_C01.b : TCTGCA*CCCTGGTGTGGCTCTANCAAACAGGTCTGGAAGCCTTCTT*NNCGGC*AAGNN
OVR01_0099_H05.b : TATGCA*CCCTGTTGTGGCTCTA*CCAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0189_A06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0108_G03.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0113_E11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0195_E01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0041_F01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0093_H11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0034_E04.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0150_E02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0079_A11.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGGC
OVRM1_0192_F04.b : TCTGCA*CCCTGTTGTGGCTCTA*CNAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0011_G03.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BFLT1_0144_D02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TTCGCC*AGGCC
OVR01_0069_H12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0008_H11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTA*TCCGCC*AGGCC
LVRM1_0143_B04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0139_E01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0167_F05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0077_E10.b : TCTGCA*CCCTGTTGTGGCTCTA*CNA*CAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0141_H04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0124_G11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0130_G12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0013_A11.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0102_F09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0021_A07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0068_E05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0056_E07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCA*AGGCC
THY01_0015_G03.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0037_G01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0034_F12.b : TATGCA*CCCTGTTGTGACTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BFLT1_0094_D12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0075_E07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0138_E07.b : TCTGCA*CCCTGTCGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0055_H05.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0015_E03.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVR01_0102_E10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0116_B03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0032_E10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0112_C07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0015_C07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0104_C08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0063_H08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0134_H10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0032_H03.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PCT01_0024_B05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0081_H03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0011_G12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0029_B01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPLT1_0053_B04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0094_F06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0039_D08.b : TCTGCA*CCCTGTTGAGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0106_B09.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0073_D01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0028_B08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0093_D07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0043_H08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0001_F02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0089_C02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0019_B04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCTGCC*AGGCC
TCH01_0058_H05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0007_D05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0022_D04.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0103_H12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0088_C07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0072_F06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0066_D06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0094_C11.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0003_F12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0097_A03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0002_B04.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0011_G01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TCH01_0015_C03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0176_B12.b : cccggtatatatttaatccatattaactcacgcaagagacaaacgaacaataataccaaa
OVRM1_0174_F08.b : caaaaatgcactagttcagtacaaacgttcgagactgaatatataatattttaatacgaa
OVRM1_0214_B04.b : atcacaactgtttgacacacctgtataggattagtacatatcggggtaagatgtgncact
LVRM1_0089_G10.b : TCTGCG*CCCTGTTGTGGCTatccaccaggccccggcatccttcttccgccagggcatcc
THY01_0112_G04.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGCCC
THY01_0111_B01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTTTT*TCC*CC*AGGCC
THY01_0118_C06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0005_F09.b : CATGCA*CCCTcgatcgctggcctacaaacaggtcccgcagccctccttccgccaggctc
OVRM1_0156_G02.b : TCTGCA*CCCTGATGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0036_H06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAACCCTTTT*TCCGCC*AGGCC
LVRM1_0027_E05.b : ACTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0040_E02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0082_H08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0181_C10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0113_C03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGANCCTTCNT*TCCGCC*AGGCC
OVRM1_0013_G06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0198_D03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0194_A07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0081_B06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0120_G01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0189_C02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0062_A07.b : TCTGCA*CCCTGTTGTGGCTCTA*CNAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0060_F02.b : TCTGCA*CCCTGTTGTGGCTCTA*CTAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0079_D10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0130_B01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGTGCCTTCTT*TCCGCC*AGGCC
OVR01_0056_B12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0057_H10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0055_G09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0037_G01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0151_G11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0189_E04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0194_D11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LVRM1_0151_G06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0053_C01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0167_A05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0058_H02.b : TCTGCA*CCCTGTTGTGGCTCTA*CNAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0003_H09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0024_F04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAATAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0014_E05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0038_H06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0185_F04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0019_B11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0204_D06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0017_B05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0020_C11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0092_E12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0093_D05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0186_B09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0068_H12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0038_D11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAAGCTTCTTTTCCGCA*AGGCC
OVRM1_0097_F05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0024_G09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0004_F09.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0026_A07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLTL1_0028_D05.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCCGC*AGGCC
SMG01_0059_E10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0025_E06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0034_G07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ADR01_0030_F03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ADR01_0026_C07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0071_G02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BKFL1_0034_H11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0148_C08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0043_C03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0014_A12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0125_F06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0145_G09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0060_G10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TCH01_0016_D01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0107_G10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0114_C07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0018_E06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCCCAGGCC
SMG01_0016_F04.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0138_H09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0040_C11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LNG01_0033_C09.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0064_B07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0101_A05.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
LNG01_0036_G03.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0066_H12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0036_G10.b : TCTGCA*CCCTGTTGCGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0081_H03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PCT01_0028_G09.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0053_C11.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0060_E04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BKFL1_0053_A07.b : TCTGCA*CCCTGTTGCGGCTCTA*CTAACAGGTCCTGGGGCCTTCTT*TCCGCC*AGGCC
OVR01_0005_A12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0062_F09.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0096_D02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0053_F07.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0116_G04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SMG01_0004_G06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0081_E08.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SKNB1_0074_F06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
DCI01_0009_C10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
BFLT1_0068_H03.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0025_E07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0081_C10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0075_A05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0060_G02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0028_F08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0088_C04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0090_F05.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0013_C09.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0052_A09.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0058_E11.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0088_G07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TCH01_0034_H10.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0048_H08.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0147_H12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0016_F05.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0058_F11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0008_E08.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0013_A05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0016_D02.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0043_C10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0088_G07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0089_F11.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0012_D07.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0018_G02.b : TCCGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0205_A04.b : TCTGCA*CCCTGTTGTGGTTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0082_C09.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0083_C09.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0071_E08.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0078_B06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0100_B12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
THY01_0098_C02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0056_F11.b : TATGCA*CCCTGTTGTGGCTCTA*CGAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ADR01_0071_E10.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRT1_0077_G12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVR01_0012_B04.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
MLN01_0027_F10.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0084_E08.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
CLNT1_0031_A07.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0066_D09.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0093_D02.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TCH01_0033_A06.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SPL01_0018_D01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0048_A11.b : TCTGCA*CACTGATGAGGCTCTA*CGAACAAGTCCagacaaacgtcttttcaccaaaccc
BFLT1_0145_A02.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCCCC*AGGCC
LVRM1_0055_E11.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0066_B05.b : TCTGCA*CCCTGGTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCACC*AGGCC
OVRM1_0103_F01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0014_E06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PCT01_0011_C05.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0009_B12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0027_E08.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
TES01_0080_F06.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0048_C08.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
ITT01_0079_H01.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
UTR01_0060_B06.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PBL01_0058_G06.b : TGTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
PST01_0005_F01.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
SKNB1_0082_C12.b : TATGCA*CCCTGTTGTGGCTCTA*CAAACAGGTCCTGGAGCCTTCTT*TCCGCC*AGGCC
OVRM1_0048_H12.b : TCTGCA*CCCTGTTGTGGCTCTA*CAAACACGTCCTGGAGCCTTCTT*TCCGCC*AGGCC