[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001588

Length: 1,860

Sequence [FASTA format sequence]
ACATAGGCCG TCTTCAGCCG CAGCATCGAG TCGGCCGTCT TCAGCCGCAG CATCGAGTCG
GCCTTGTTGG TCACATAGGC CGTCTTCAGC CGCAGCATCG AGTCGGCCTT GTTGGCCTAC
TGGGGGTTCT GTGAAGGTGA TGAGATTAAC ATCCATGCTG ATTTTGAGAA TACATGTTCC
CGCATTGTGG TGCCCAAAGC TGCCATTGTA GCCCGCCACA CTTACCTTGC CAATGGCCAA
ACCAAAGTAC TGACGCAGAA GTTGTCATCG GTCAGAGGCA ATCACATTAT CTCAGGAACC
TGTGCATCAT GGCGTGGCAA GAGCCTTCGG GTGCAGAAGA TCAGGCCTTC TATCTTGGGC
TGCAACATCC TTCGAGTTGA ATACTTCTTA CTGATCTACG TTAGTGTCCC TGGCTCCAAG
AAGGTCATTC TTGACCTGCC GCTGGTAATT GGCAGCAGGT CAGGCCTCAG CAGCCGGACG
TCCAGCATGG CCAGCCGAAC CAGCTCCGAG ATGAGTTGGG TAGATCTAAA CATCCCTGAT
ACCCCCGAAG CTCCTCCATG CTATATGGAT ATCATTCCTG AAGATCACCG ATTGGAGAGC
CCCACCACTC CTCTGCTAGA TGACACAGAT GGCTCTCAAG ACAGCCCTAT CTTTATGTAT
GCTCCTGAGT TTAAGTTCAT GCCACCACCT ACTTACAGTG AGGTGGATCC CTGCATCCTC
AACAACAACG TGCAGTGAAC ATGTGGAAGG AAAGAAGCAG CTATACCTAC TTCTTTCTTT
TCACCTCTCT TCCTGGACTG ACTTTTTAGG AGACTCAACA GTCTCTGCAG TGGGGTACAG
ATCCACCCCA GCCTCTGACT CTCCGGTGTA GGAGGTGATC ATCAGGCAAT CTCTTGGGCC
TTAAAGGGTG CGCAGTCGTC CTCAGCCAGT GAGATGTTGT GACAAGGGTT TTTTTGCTGG
ATGGGTTTAA AAACACAGAC AAATTTAGGC CCATTCCATT TTCTCAGATC TTTTTTGAGA
ATTGAGGCAT TTTAAATAAG GGGTAGAAAT GGCCTCCTGG TGTGGTCTTC CCAAGGTTTT
ATGGAGGGGA TTTCAGACTG TTATAACAAT AGATCTTGAA CCTCTGCCAT GTGGAGAAAA
GCCAATTTAG CAAACTAGAA GAATGAAAAG GAAAAAAATC ATGGCCAAAA CTTTGGGAAA
AAGATGTTCT TAAAATCATT GTTCCCCTTT GTTTGTGCAC TTATAGATAA AAGAAAACAA
AAAAGAAAAA TCCTCCAGAG CTTATTTGGT TTAGAGTGAG CTTCCCATGT GAATTAAAGG
GAAGAAGCTC TAAAGTTGTC TTTGTTTAGA AAGTGCTTTA ATGTGGCGTA AAGCAGTAGT
AACTATGCCC CACCAAAGGT CTTAAAAAGC CATTTTTAGA GCCTATTGCA CTGTGTTCTT
CTGTTGGCAA ACATTTTCAT GTGGGAAAAT GTGTTTTTCT TCTCACATGA CTCCTTGGAA
TTGATTCTGA GGTGATGGTC TTAGCACTTT AGTTTGTGTC AAATTTTTTT CCCCTCTATC
TCAGATGTAA GCCAAAATTG GTCTACTGTG TCTCTGGGGT AAGCACAATG ACAAAAAAAA
AAAAAAAAAA AAAAAAAAAA GTGTTTCTCA CTACTTCTGA GACTTTGTCC CAGTGTACAG
AATTCTGCAA TTCTGACACT CTAATTATAT GAGAAGGGTT GCTGCTATCA GCCTTGCCTA
CTGTGACATC TCCNAAGCCA GGAAGAACTC GATCAAAATG CCCCAACACT GTGATTAGAG
CATCCAGATG GTGCCCATGA GAACTAGAGG GCAGGTTTTC ACAAAAGCCC CTAGGGCTCC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNIPthioredoxin-interacting protein [Homo sapiens]. 362e-100
Contig/Assembly ProteinARRDC4arrestin domain-containing protein 4 [Homo sapiens]. 1729e-43
Contig/Assembly ProteinARRDC3arrestin domain-containing protein 3 [Homo sapiens]. 1559e-38
Contig/Assembly ProteinARRDC2arrestin domain-containing protein 2 isoform 1 [Homo sapiens]. 1297e-30
Contig/Assembly ProteinARRDC2arrestin domain-containing protein 2 isoform 2 [Homo sapiens]. 1297e-30


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTxnipthioredoxin-interacting protein isoform 2 [Mus musculus]. 3502e-96
Contig/Assembly ProteinTxnipthioredoxin-interacting protein isoform 1 [Mus musculus]. 3502e-96
Contig/Assembly ProteinArrdc4arrestin domain containing 4 isoform 1 [Mus musculus]. 1673e-41
Contig/Assembly ProteinArrdc3arrestin domain-containing protein 3 [Mus musculus]. 1543e-37
Contig/Assembly ProteinArrdc2arrestin domain-containing protein 2 [Mus musculus]. 1203e-27
Contig/Assembly ProteinArrdc4arrestin domain containing 4 isoform 2 [Mus musculus]. 1005e-21


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475829PREDICTED: similar to thioredoxin interacting protein isoform 2 [Canis familiaris]. 3596e-99
Contig/Assembly ProteinLOC475829PREDICTED: similar to thioredoxin interacting protein isoform 3 [Canis familiaris]. 3442e-94
Contig/Assembly ProteinLOC488713PREDICTED: similar to arrestin domain containing 4 [Canis familiaris]. 1705e-42
Contig/Assembly ProteinLOC488912PREDICTED: similar to arrestin domain containing 3 isoform 1 [Canis familiaris]. 1512e-36
Contig/Assembly ProteinLOC488912PREDICTED: similar to arrestin domain containing 3 isoform 5 [Canis familiaris]. 1373e-32
Contig/Assembly ProteinLOC609489PREDICTED: similar to arrestin domain containing 2 isoform 1 isoform 3 [Canis familiaris]. 1266e-29
Contig/Assembly ProteinLOC609489PREDICTED: similar to arrestin domain containing 2 isoform 1 isoform 2 [Canis familiaris]. 1266e-29
Contig/Assembly ProteinLOC609489PREDICTED: similar to arrestin domain containing 2 isoform 2 isoform 1 [Canis familiaris]. 1266e-29
Contig/Assembly ProteinLOC488912PREDICTED: similar to arrestin domain containing 3 isoform 2 [Canis familiaris]. 1051e-22


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNIPthioredoxin interacting protein [Bos taurus]. 3511e-96
Contig/Assembly ProteinARRDC4arrestin domain-containing protein 4 [Bos taurus]. 1713e-42
Contig/Assembly ProteinARRDC4PREDICTED: arrestin domain containing 4 [Bos taurus]. 1713e-42
Contig/Assembly ProteinARRDC3arrestin domain-containing protein 3 [Bos taurus]. 1542e-37
Contig/Assembly ProteinARRDC2arrestin domain-containing protein 2 [Bos taurus]. 1382e-32


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNIPthioredoxin-interacting protein [Sus scrofa]. 370e-102
Contig/Assembly ProteinARRDC4PREDICTED: arrestin domain-containing protein 4 isoform 1 [Sus scrofa]. 1727e-43
Contig/Assembly ProteinLOC100620110PREDICTED: arrestin domain-containing protein 3-like [Sus scrofa]. 1557e-38
Contig/Assembly ProteinARRDC3PREDICTED: arrestin domain-containing protein 3, partial [Sus scrofa]. 1495e-36
Contig/Assembly ProteinARRDC2PREDICTED: arrestin domain-containing protein 2 isoform 2 [Sus scrofa]. 1303e-30
Contig/Assembly ProteinARRDC2PREDICTED: arrestin domain-containing protein 2 isoform 1 [Sus scrofa]. 1303e-30


Assembly Members: 59      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010019G03ADR01_0019_G03.bDB783190 
ADR010077F09ADR01_0077_F09.bDB788367 
ADR010079D05ADR01_0079_D05.bDB788525 
BMWN10050C04BMWN1_0050_C04.bHX208587 
CLNT10064E06CLNT1_0064_E06.bFS662103 
KDN010086D01KDN01_0086_D01.bFS677254 
LNG010011G05LNG01_0011_G05.bBP439286 
LNG010012H04LNG01_0012_H04.bBP440213 
LNG010046D12LNG01_0046_D12.bBP436868 
LNG010056B03LNG01_0056_B03.bBP434167 
LNG010056H05LNG01_0056_H05.bBP440328 
LNG010067D05LNG01_0067_D05.bBP436321 
LNG010071B01LNG01_0071_B01.bBP434027 
LNG010078B05LNG01_0078_B05.bBP434356 
LNG010081A10LNG01_0081_A10.bBP433800 
LNG010085E09LNG01_0085_E09.bBP437656 
LNG010087A08LNG01_0087_A08.bBP433642 
LNG010088B08LNG01_0088_B08.bBP434611 
LNG010091G07LNG01_0091_G07.bBP439514 
LNG010095B04LNG01_0095_B04.bBP434287 
LNG010101A09LNG01_0101_A09.bBP433737 
LNG010103B09LNG01_0103_B09.bBP434705 
LNG010109C01LNG01_0109_C01.bBP435034 
LNG010110D01LNG01_0110_D01.bBP436018 
LNG010110D02LNG01_0110_D02.bBP436103 
MLN010004D01MLN01_0004_D01.bCJ007982 
MLN010010B02MLN01_0010_B02.bCJ008450 
MLN010014E09MLN01_0014_E09.b  
MLN010030C03MLN01_0030_C03.bCJ009956 
MLN010034H03MLN01_0034_H03.bCJ010332 
MLN010057C01MLN01_0057_C01.bCJ012115 
MLN010077C06MLN01_0077_C06.bBW963777 
OVRT10043H11OVRT1_0043_H11.bFS689956 
OVRT10059G12OVRT1_0059_G12.b  
PBL010020B06PBL01_0020_B06.bBW969711 
SKNB10005E03SKNB1_0005_E03.bDB800372 
SKNB10064C02SKNB1_0064_C02.bDB803872 
SPL010005H05SPL01_0005_H05.bBP159154 
SPL010032G09SPL01_0032_G09.bCJ016548 
SPL010081H04SPL01_0081_H04.bCJ020356 
TCH010003H06TCH01_0003_H06.bCJ022698 
TCH010026G08TCH01_0026_G08.bCJ024393 
TCH010049F10TCH01_0049_F10.bBW975789 
TCH010054G11TCH01_0054_G11.bBW975943 
TCH010058B08TCH01_0058_B08.bCJ026540 AK399333
TCH010058C09TCH01_0058_C09.bCJ026549 
TCH010066A08TCH01_0066_A08.bCJ027139 
TCH010067A04TCH01_0067_A04.bCJ027209 
TCH010075A02TCH01_0075_A02.bCJ027810 
TCH010076F01TCH01_0076_F01.bCJ027928 
TCH010082F03TCH01_0082_F03.bCJ028392 
TCH010091G04TCH01_0091_G04.bCJ029097 
TCH010100G02TCH01_0100_G02.bCJ029774 
TCH010103C11TCH01_0103_C11.bCJ029975 
TES010111A05TES01_0111_A05.bCJ037295 
THY010015A08THY01_0015_A08.bBP160084 
THY010027E06THY01_0027_E06.bBP164875 
THY010042E02THY01_0042_E02.bBP164468 
THY010119H04THY01_0119_H04.bBP168511 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
441C200.051WSCCC/P
G3700.949CCG/P


Alignment:      TOP

20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0058_B08.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : .............ACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAGCCG
---------+---------+---------+---------+---------+---------+ 47
TCH01_0058_B08.b : xxxxxxxxxxxxxACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAGCCG
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : CAGCATCGAGTCGGCCTTGTTGGTCACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGC
---------+---------+---------+---------+---------+---------+ 107
TCH01_0058_B08.b : CAGCATCGAGTCGGCCTTGTTGGTCACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGC
SPL01_0081_H04.b : nnnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0066_A08.b : nnnngggatggacatgacagtttgtacxxxxxxx
TCH01_0100_G02.b : nnnggctaggactatnacxxxxxx
TCH01_0026_G08.b : nnnggctaggactatgac
KDN01_0086_D01.b :
LNG01_0071_B01.b : nnntttga
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : CTTGTTGGCCTACTGGGGGTTCTGTGAAGGTGATGAGATTAACATCCATGCTGATTTTGA
---------+---------+---------+---------+---------+---------+ 167
TCH01_0058_B08.b : CTTGTTGGCCTACTGGGGGTTCTGTGAAGGTGATGAGATTAACATCCATGCTGATTTTGA
SPL01_0081_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGATGAGATTAACATCCATGCTGATTTTGA
TCH01_0066_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaATCCATGCTGATTTTGA
TCH01_0100_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggTTTTGA
TCH01_0026_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0086_D01.b : nnnnaactactgttgctatggtt
LNG01_0071_B01.b : ttggaaatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0075_A02.b : nnnaagcatggactatnac
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : GAATACATGTTCCCGCATTGTGGTGCCCAAAGCTGCCATTGTAGCCCGCCACACTTACCT
---------+---------+---------+---------+---------+---------+ 227
TCH01_0058_B08.b : GAATACATGTTCCCGCATTGTGGTGCCCAAAGCTGCCATTGTAGCCCGCCACACTTACCT
SPL01_0081_H04.b : GAATACATGTTCCCGCATTGTGGTGCCCAAAGCTGCCATTGTAGCCCGCCACACTTACCT
TCH01_0066_A08.b : GAATACATGTTCCCGCATTGTGGTGCCCAAAGCTGCCATTGTAGCCCGCCACACTTACCT
TCH01_0100_G02.b : GAATACATGTTCCCGCATTGTGGTGCCCAAAGCTGCCATTGTAGCCCGCCACACTTACCT
TCH01_0026_G08.b : xxxTACATGTTCCCGCATTGTGGTGCCCAAAGCTGCCATTGTAGCCCGCCACACTTACCT
KDN01_0086_D01.b : gagataCTGTTCCCGCATTGTGGTGCCCAAAGCTGCCATTGTAGCCCGCCACACTTACCT
LNG01_0071_B01.b : xxxxxxxxGTTCCCGCATTGTGGTGCCCAAAGCTGCCATTGTAGCCCGCCACACTTACCT
TCH01_0075_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
CLNT1_0064_E06.b : nnncccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0119_H04.b : gtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0109_C01.b : nnnnnggctgtactaanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_G05.b : gcatttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0110_D01.b : nnntttggatggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_B03.b : nnnnnaattggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0067_D05.b : nnnnnggctggacttgacagtttgtcxxxxxxxxxxxxx
LNG01_0056_H05.b : nnttcccttgtacttgacxxxxxx
LNG01_0078_B05.b : nnnnttagattggacttanacagt
LNG01_0088_B08.b : nttgttggctggacttgaca
MLN01_0034_H03.b : nnnngctaggacttgacx
LNG01_0091_G07.b : ttttttagcttggacttgac
TCH01_0082_F03.b : ttttggcatgtgacttnacxxxx
SPL01_0005_H05.b : cgctctacgtgxxxxxxxxxxxxx
ADR01_0077_F09.b :
THY01_0027_E06.b : tttaxxxxxxxxxxxxxx
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : TGCCAATGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
---------+---------+---------+---------+---------+---------+ 287
TCH01_0058_B08.b : TGCCAAAGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
SPL01_0081_H04.b : TGCCAATGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
TCH01_0066_A08.b : TGCCAATGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
TCH01_0100_G02.b : TGCCAATGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
TCH01_0026_G08.b : TGCCAATGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
KDN01_0086_D01.b : TGCCAATGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
LNG01_0071_B01.b : TGCCAATGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
TCH01_0075_A02.b : TGCCAATGGCCAAACCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
CLNT1_0064_E06.b : xxxxxxxxxxxxxxCCAAAGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
THY01_0119_H04.b : xxxxxxxxxxxxgctatggGTACTGAC*CAGAAGTTGTCATCGGTCAGAGGCAATCACAT
LNG01_0109_C01.b : xxxxxxxxxxxxxxxxxxxGTACTGACGCAGAAGTTGTCATCGGTCAGAGGCAATCACAT
LNG01_0011_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGTTGTCATCGGTCAGAGGCAATCACAT
LNG01_0110_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgGGTTGTCATCGGTCAGAGGCAATCACAT
LNG01_0056_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGTCATCGGTCAGAGGCAATCACAT
LNG01_0067_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagATCGGTCAGAGGCAATCACAT
LNG01_0056_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaACAT
LNG01_0078_B05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAT
LNG01_0088_B08.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
MLN01_0034_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_G07.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0082_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgag
SPL01_0005_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0077_F09.b : nnnnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0027_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0020_B06.b : nnggatgaacaxxxxxxxxxxxxxxx
THY01_0042_E02.b : ctttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0015_A08.b : tagcaxxxxxxxxxxxxxxxxxxx
MLN01_0010_B02.b : nn
LNG01_0012_H04.b : gctx
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
---------+---------+---------+---------+---------+---------+ 347
TCH01_0058_B08.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
SPL01_0081_H04.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
TCH01_0066_A08.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
TCH01_0100_G02.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTCCGGGTGCAGAAGATCAGGCC
TCH01_0026_G08.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
KDN01_0086_D01.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0071_B01.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
TCH01_0075_A02.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
CLNT1_0064_E06.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
THY01_0119_H04.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0109_C01.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0011_G05.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0110_D01.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0056_B03.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0067_D05.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0056_H05.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0078_B05.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0088_B08.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
MLN01_0034_H03.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
LNG01_0091_G07.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
TCH01_0082_F03.b : TATCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
SPL01_0005_H05.b : xxTCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
ADR01_0077_F09.b : xxTCTCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
THY01_0027_E06.b : xxxxxCAGGAACCTGTGCATCATGGCGTGGCAAGAGCCTTCGGGTGCAGAAGATCAGGCC
PBL01_0020_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxgggtAAGAGCCTTCGGGTGCAGAAGATCAGGCC
THY01_0042_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAAGATCAGGCC
THY01_0015_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0010_B02.b : nnttcctggacaagacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0012_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0046_D12.b : tgggttttttatcgcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0103_C11.b : nnnnggctaggacttaaacxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0103_B09.b : nnnnnaagctggacatgacxxxxxxxxxxxxxxxxxxxxxx
LNG01_0101_A09.b : nnnaaagctggaaatgacagtttgtcxxxxxxxxxxxxx
TCH01_0049_F10.b : ctaggacttagacxxxxxxxxxxxxxxxxxx
ADR01_0079_D05.b : naaaanggc
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b : ntttggcttggactatnacagtttgt
TCH01_0076_F01.b : nnnnggctaggactaagacxxxxxxxxxxx
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
---------+---------+---------+---------+---------+---------+ 407
TCH01_0058_B08.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
SPL01_0081_H04.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
TCH01_0066_A08.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
TCH01_0100_G02.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
TCH01_0026_G08.b : CTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
KDN01_0086_D01.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0071_B01.b : TTCTATCTCGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
TCH01_0075_A02.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
CLNT1_0064_E06.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
THY01_0119_H04.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0109_C01.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0011_G05.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0110_D01.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0056_B03.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTGCTGATCTACGTTAGTGT
LNG01_0067_D05.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0056_H05.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0078_B05.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0088_B08.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
MLN01_0034_H03.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0091_G07.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
TCH01_0082_F03.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
SPL01_0005_H05.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
ADR01_0077_F09.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
THY01_0027_E06.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
PBL01_0020_B06.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
THY01_0042_E02.b : TTCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
THY01_0015_A08.b : xxCTATCTTGGGCTGCAACATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
MLN01_0010_B02.b : xxxxxxxxxxxxxxxxxxCATCCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0012_H04.b : xxxxxxxxxxxxxxxxxxxxxxCTTCGAGTTGAATACTTCTTACTGATCTACGTTAGTGT
LNG01_0046_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCTTACTGATCTACGTTAGTGT
TCH01_0103_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTTACTGATCTACGTTAGTGT
LNG01_0103_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTACTGATCTACGTTAGTGT
LNG01_0101_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTACTGATCTACGTTAGTGT
TCH01_0049_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagGATCTACGTTAGTGT
ADR01_0079_D05.b : gtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACGTTAGTGT
TES01_0111_A05.b : tctgctgtggctctggtatgatctCGTTAGTGT
ADR01_0019_G03.b : ggttggcctactggGTTAGTGT
SPL01_0032_G09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTAGTGT
TCH01_0076_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtcgAGTGT
SKNB1_0005_E03.b : aagnnnnnacctgcgttggctatgcgtagtg
TCH01_0003_H06.b : nnngggtaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0091_G04.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0085_E09.b : nnnnaaagctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0059_G12.b : nnttccctatcngcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_H11.b : nttatccgttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_C06.b : ctaaaatgtcctcttggactnagacagttttgtxxxxxxxxxxxxxxxxxxxxxx
TCH01_0054_G11.b : nnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0058_C09.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxxxx
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
---------+---------+---------+---------+---------+---------+ 467
TCH01_0058_B08.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
SPL01_0081_H04.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCCCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0066_A08.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0100_G02.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0026_G08.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
KDN01_0086_D01.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0071_B01.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0075_A02.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
CLNT1_0064_E06.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCCCTGGTAATTGGCAGCAGGTCAGGCCT
THY01_0119_H04.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0109_C01.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0011_G05.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0110_D01.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0056_B03.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0067_D05.b : CCCTGGCTCCAAGAGGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0056_H05.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0078_B05.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0088_B08.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
MLN01_0034_H03.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0091_G07.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0082_F03.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
SPL01_0005_H05.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
ADR01_0077_F09.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
THY01_0027_E06.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
PBL01_0020_B06.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCCCTGGTAATTGGCAGCAGGTCAGGCCT
THY01_0042_E02.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
THY01_0015_A08.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
MLN01_0010_B02.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0012_H04.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0046_D12.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0103_C11.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0103_B09.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0101_A09.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0049_F10.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
ADR01_0079_D05.b : CCCTGGCTCCA*GAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TES01_0111_A05.b : CCCTGGCTCCA*GAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
ADR01_0019_G03.b : CCCTGGCTCCA*GAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
SPL01_0032_G09.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0076_F01.b : CCCTGGCTCCAAGAAGGTCATTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
SKNB1_0005_E03.b : tCCTGGCTCCA*GAAGGTCATTCTTGACCTGCCGCTGGTCATTGGCAGCAGGTCAGGCCT
TCH01_0003_H06.b : xxxxxxxxxxxxxxxxxxxxTTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0091_G04.b : xxxxxxxxxxxxxxxxxxxxTTCTTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
LNG01_0085_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxTGACCTGCCGCTGGTAATTGGCAGCAGGTCAGGCCT
OVRT1_0059_G12.b : xxxxxxxxxxxxxctctataggtcTGACCTGCCCCTGGTAATTGGCAGCAGGTCACGCCT
OVRT1_0043_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxTGACCTGCCCCTGGTAATTGGCAGCAGGTCAGGCCT
MLN01_0077_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgGGTAATTGGCAGCAGGTCAGGCCT
TCH01_0054_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCAGCAGGTCAGGCCT
TCH01_0058_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCAGCAGGTCAGGCCT
SKNB1_0064_C02.b : nnnnnctcactgtggctctggttggAGCAGGTCAGACCT
LNG01_0110_D02.b : nnnnnggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0004_D01.b : nnnttctgctggact
MLN01_0057_C01.b : nnggctagg
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
---------+---------+---------+---------+---------+---------+ 527
TCH01_0058_B08.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
SPL01_0081_H04.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0066_A08.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0100_G02.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0026_G08.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
KDN01_0086_D01.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0071_B01.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0075_A02.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
CLNT1_0064_E06.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
THY01_0119_H04.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0109_C01.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0011_G05.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0110_D01.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0056_B03.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGGTGAGTTGGGTAGATCT
LNG01_0067_D05.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0056_H05.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0078_B05.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0088_B08.b : CAGCAGCCGGACGTCCAGCGTGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
MLN01_0034_H03.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0091_G07.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0082_F03.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
SPL01_0005_H05.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
ADR01_0077_F09.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
THY01_0027_E06.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
PBL01_0020_B06.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
THY01_0042_E02.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
THY01_0015_A08.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
MLN01_0010_B02.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0012_H04.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0046_D12.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0103_C11.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0103_B09.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0101_A09.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0049_F10.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
ADR01_0079_D05.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TES01_0111_A05.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
ADR01_0019_G03.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
SPL01_0032_G09.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0076_F01.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
SKNB1_0005_E03.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0003_H06.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0091_G04.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0085_E09.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
OVRT1_0059_G12.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
OVRT1_0043_H11.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
MLN01_0077_C06.b : CCGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0054_G11.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
TCH01_0058_C09.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAACCAGCTCCGAGATGAGTTGGGTAGATCT
SKNB1_0064_C02.b : CAGCAGCCGGACGTCCAGCATGGCCAGCCGAATCAGCTCCGAGATGAGTTGGGTAGATCT
LNG01_0110_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCGAGATGAGTTGGGTAGATCT
MLN01_0004_D01.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0057_C01.b : actatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0067_A04.b : nnnggcatggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
---------+---------+---------+---------+---------+---------+ 586
TCH01_0058_B08.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
SPL01_0081_H04.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0066_A08.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0100_G02.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0026_G08.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
KDN01_0086_D01.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0071_B01.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0075_A02.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
CLNT1_0064_E06.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
THY01_0119_H04.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0109_C01.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0011_G05.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0110_D01.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0056_B03.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0067_D05.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0056_H05.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0078_B05.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0088_B08.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
MLN01_0034_H03.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0091_G07.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0082_F03.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
SPL01_0005_H05.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
ADR01_0077_F09.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
THY01_0027_E06.b : AAACATCCCTGATACCCCCGAAGCTCCTCCACGCTATATGGATATCATT*CCTGAAGATC
PBL01_0020_B06.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
THY01_0042_E02.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
THY01_0015_A08.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
MLN01_0010_B02.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0012_H04.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0046_D12.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0103_C11.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0103_B09.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0101_A09.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0049_F10.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
ADR01_0079_D05.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TES01_0111_A05.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
ADR01_0019_G03.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
SPL01_0032_G09.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0076_F01.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
SKNB1_0005_E03.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0003_H06.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0091_G04.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0085_E09.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
OVRT1_0059_G12.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
OVRT1_0043_H11.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
MLN01_0077_C06.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0054_G11.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
TCH01_0058_C09.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
SKNB1_0064_C02.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
LNG01_0110_D02.b : AAACATCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
MLN01_0004_D01.b : xxxxxTCCCTGATACCCCCGAAGCTCCTCCATGCTATATGGATATCATT*CCTGAAGATC
MLN01_0057_C01.b : xxxxxxxxxxGATACCCCCGAAGCTCCTCCATGCTATATGGATAT*ATT*CCTGAAGATC
TCH01_0067_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgATATGGATATCAATACCTGAAGATC
MLN01_0030_C03.b : nnnnggctaggacatgacagtttgtacxxxxxxxxxx
MLN01_0014_E09.b : nntttggctgga
LNG01_0095_B04.b : aaaannggctggacat
LNG01_0081_A10.b : nnnnaagc
BMWN1_0050_C04.b :
LNG01_0087_A08.b :
20110601C-001588 : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
---------+---------+---------+---------+---------+---------+ 646
TCH01_0058_B08.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
SPL01_0081_H04.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0066_A08.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0100_G02.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0026_G08.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
KDN01_0086_D01.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0071_B01.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0075_A02.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
CLNT1_0064_E06.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
THY01_0119_H04.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0109_C01.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0011_G05.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0110_D01.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0056_B03.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0067_D05.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0056_H05.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0078_B05.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0088_B08.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
MLN01_0034_H03.b : ACCGATTGGAGAGCCCCGCCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0091_G07.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0082_F03.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
SPL01_0005_H05.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
ADR01_0077_F09.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
THY01_0027_E06.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGACGGCTCTCAAGACAGCC
PBL01_0020_B06.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
THY01_0042_E02.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
THY01_0015_A08.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGACGACACAGATGGCTCTCAAGACAGCC
MLN01_0010_B02.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0012_H04.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0046_D12.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0103_C11.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0103_B09.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0101_A09.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0049_F10.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
ADR01_0079_D05.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TES01_0111_A05.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
ADR01_0019_G03.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
SPL01_0032_G09.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0076_F01.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
SKNB1_0005_E03.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0003_H06.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACGCAGATGGCTCTCAAGACAGCC
TCH01_0091_G04.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0085_E09.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
OVRT1_0059_G12.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
OVRT1_0043_H11.b : ACCGATTGGAGAGCCTCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
MLN01_0077_C06.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0054_G11.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGATACAGATGGCTCTCAAGACAGCC
TCH01_0058_C09.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
SKNB1_0064_C02.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
LNG01_0110_D02.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
MLN01_0004_D01.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
MLN01_0057_C01.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
TCH01_0067_A04.b : ACCGATTGGAGAGCCCCACCACTCCTCTGCTAGATGACACAGATGGCTCTCAAGACAGCC
MLN01_0030_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATGGCTCTCAAGACAGCC
MLN01_0014_E09.b : cttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0095_B04.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0081_A10.b : tggacatgacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0050_C04.b : nnnnccgacggtacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0087_A08.b :
20110601C-001588 : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
---------+---------+---------+---------+---------+---------+ 704
TCH01_0058_B08.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
SPL01_0081_H04.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0066_A08.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0100_G02.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0026_G08.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
KDN01_0086_D01.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0071_B01.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0075_A02.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
CLNT1_0064_E06.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
THY01_0119_H04.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0109_C01.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0011_G05.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0110_D01.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0056_B03.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0067_D05.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0056_H05.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0078_B05.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0088_B08.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
MLN01_0034_H03.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0091_G07.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0082_F03.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
SPL01_0005_H05.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
ADR01_0077_F09.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
THY01_0027_E06.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
PBL01_0020_B06.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
THY01_0042_E02.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
THY01_0015_A08.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
MLN01_0010_B02.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0012_H04.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0046_D12.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0103_C11.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0103_B09.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0101_A09.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0049_F10.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
ADR01_0079_D05.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TES01_0111_A05.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
ADR01_0019_G03.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
SPL01_0032_G09.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0076_F01.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
SKNB1_0005_E03.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0003_H06.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0091_G04.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0085_E09.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
OVRT1_0059_G12.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
OVRT1_0043_H11.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
MLN01_0077_C06.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0054_G11.b : CTATCTTTATGTATGCTCCTGAGTTTAAAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0058_C09.b : CTATCTTTATGTATGCTCCTGAGTTTAAAGTTCATGCCACCACCTACTTACAG*TGAGGT
SKNB1_0064_C02.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0110_D02.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
MLN01_0004_D01.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
MLN01_0057_C01.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
TCH01_0067_A04.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
MLN01_0030_C03.b : CTATCTTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
MLN01_0014_E09.b : xxxxxxTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAGCTGAGGT
LNG01_0095_B04.b : xxxxggTTATGTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0081_A10.b : xxxxxxxxxxxTATGCTCCTGAGTTT*AAGTTCATGCCACCACCTACTTACAG*TGAGGT
BMWN1_0050_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCATGCCACCACCTACTTACAG*TGAGGT
LNG01_0087_A08.b :
20110601C-001588 : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
---------+---------+---------+---------+---------+---------+ 764
TCH01_0058_B08.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
SPL01_0081_H04.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0066_A08.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0100_G02.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0026_G08.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
KDN01_0086_D01.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0071_B01.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0075_A02.b : GGGTCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
CLNT1_0064_E06.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
THY01_0119_H04.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0109_C01.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0011_G05.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0110_D01.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0056_B03.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0067_D05.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0056_H05.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0078_B05.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0088_B08.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
MLN01_0034_H03.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0091_G07.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0082_F03.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
SPL01_0005_H05.b : GAATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
ADR01_0077_F09.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
THY01_0027_E06.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
PBL01_0020_B06.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
THY01_0042_E02.b : GGATCCCTGCATCCTCAACTACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTGT
THY01_0015_A08.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
MLN01_0010_B02.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0012_H04.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAGGAAGCAGCTAT
LNG01_0046_D12.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0103_C11.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0103_B09.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0101_A09.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0049_F10.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
ADR01_0079_D05.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TES01_0111_A05.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
ADR01_0019_G03.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
SPL01_0032_G09.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0076_F01.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
SKNB1_0005_E03.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0003_H06.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0091_G04.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0085_E09.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
OVRT1_0059_G12.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
OVRT1_0043_H11.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
MLN01_0077_C06.b : GGATCCCTGCATCCTCTACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0054_G11.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0058_C09.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
SKNB1_0064_C02.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0110_D02.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
MLN01_0004_D01.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
MLN01_0057_C01.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
TCH01_0067_A04.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
MLN01_0030_C03.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
MLN01_0014_E09.b : GGATCCCTGCATCCTCAACAACAACGTGCACTGAACATGTGGAAGGAAAGAATCAGCTAT
LNG01_0095_B04.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0081_A10.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
BMWN1_0050_C04.b : GGATCCCTGCATCCTCAACAACAACGTGCAGTGAACATGTGGAAGGAAAGAAGCAGCTAT
LNG01_0087_A08.b :
20110601C-001588 : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
---------+---------+---------+---------+---------+---------+ 822
TCH01_0058_B08.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
SPL01_0081_H04.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0066_A08.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0100_G02.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0026_G08.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
KDN01_0086_D01.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0071_B01.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0075_A02.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
CLNT1_0064_E06.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
THY01_0119_H04.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTCAGGAGAactcacgtcc
LNG01_0109_C01.b : ACCTACTTCTTTTTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0011_G05.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0110_D01.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0056_B03.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0067_D05.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0056_H05.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0078_B05.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0088_B08.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
MLN01_0034_H03.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTCTTTAGGAGAC*TCAACAGT
LNG01_0091_G07.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0082_F03.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
SPL01_0005_H05.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
ADR01_0077_F09.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
THY01_0027_E06.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
PBL01_0020_B06.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
THY01_0042_E02.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCTTGGACTGACTTTTTAGGAGACTTCAACAGT
THY01_0015_A08.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
MLN01_0010_B02.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0012_H04.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0046_D12.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0103_C11.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0103_B09.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0101_A09.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0049_F10.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
ADR01_0079_D05.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TES01_0111_A05.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
ADR01_0019_G03.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
SPL01_0032_G09.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0076_F01.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
SKNB1_0005_E03.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0003_H06.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0091_G04.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0085_E09.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
OVRT1_0059_G12.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
OVRT1_0043_H11.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
MLN01_0077_C06.b : GCCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0054_G11.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0058_C09.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
SKNB1_0064_C02.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACGGT
LNG01_0110_D02.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTT*AGGAGAC*TCAACAGT
MLN01_0004_D01.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
MLN01_0057_C01.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
TCH01_0067_A04.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
MLN01_0030_C03.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
MLN01_0014_E09.b : ACCTACTTCTTTCTTTTCGCCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0095_B04.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGGCTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0081_A10.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
BMWN1_0050_C04.b : ACCTACTTCTTTCTTTTCACCTCTCTTCCT*GGACTGACTTTTTAGGAGAC*TCAACAGT
LNG01_0087_A08.b :
20110601C-001588 : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
---------+---------+---------+---------+---------+---------+ 881
TCH01_0058_B08.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
SPL01_0081_H04.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0066_A08.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTANGAGGTGATCA
TCH01_0100_G02.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0026_G08.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
KDN01_0086_D01.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0071_B01.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0075_A02.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
CLNT1_0064_E06.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
THY01_0119_H04.b : tctgcgtggggtaaaaatccccccacccctagtctccggtgtagaagggacatccgggaa
LNG01_0109_C01.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0011_G05.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0110_D01.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0056_B03.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0067_D05.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0056_H05.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0078_B05.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0088_B08.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
MLN01_0034_H03.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0091_G07.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0082_F03.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
SPL01_0005_H05.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
ADR01_0077_F09.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
THY01_0027_E06.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
PBL01_0020_B06.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
THY01_0042_E02.b : CTCTAGCAGTGGGGTACAGATCCACCCCATCCTCTGACTCTCCGGTGTACGAGGTGATCA
THY01_0015_A08.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
MLN01_0010_B02.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0012_H04.b : CTCT*GCAGTGNGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0046_D12.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0103_C11.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0103_B09.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0101_A09.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0049_F10.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
ADR01_0079_D05.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TES01_0111_A05.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
ADR01_0019_G03.b : CTCT*GCAGTGGGGTACAGATTCACCCCAGCCTCTGACTCTCCGGTGTATGAGGTGATCC
SPL01_0032_G09.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0076_F01.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
SKNB1_0005_E03.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0003_H06.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0091_G04.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0085_E09.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
OVRT1_0059_G12.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
OVRT1_0043_H11.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
MLN01_0077_C06.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0054_G11.b : CTCT*GCAGTGGGGTACAGATCCACCCTAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0058_C09.b : CTCT*GCAGTGGGGTACAGATCCACCCTAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
SKNB1_0064_C02.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0110_D02.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
MLN01_0004_D01.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
MLN01_0057_C01.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
TCH01_0067_A04.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
MLN01_0030_C03.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
MLN01_0014_E09.b : CTCT*GCATTGAGGAACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAAGAGGTGATCA
LNG01_0095_B04.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0081_A10.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
BMWN1_0050_C04.b : CTCT*GCAGTGGGGTACAGATCCACCCCAGCCTCTGACTCTCCGGTGTAGGAGGTGATCA
LNG01_0087_A08.b :
20110601C-001588 : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
---------+---------+---------+---------+---------+---------+ 941
TCH01_0058_B08.b : TCAGGCAATCTCCTGGGCCTTAAAGGGTGCGCAGTCGTCTTCAGCCAGTGAAATGTTGTG
SPL01_0081_H04.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0066_A08.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0100_G02.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0026_G08.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
KDN01_0086_D01.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0071_B01.b : TCANGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0075_A02.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
CLNT1_0064_E06.b : TCAGGCAATCTCTTGGGCCTTANAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
THY01_0119_H04.b : cttttggcc
LNG01_0109_C01.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0011_G05.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0110_D01.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0056_B03.b : TCAGGCAATCTCTTGNGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0067_D05.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0056_H05.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0078_B05.b : TCANGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0088_B08.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
MLN01_0034_H03.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0091_G07.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0082_F03.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
SPL01_0005_H05.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
ADR01_0077_F09.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
THY01_0027_E06.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
PBL01_0020_B06.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
THY01_0042_E02.b : TCATGCAATCTCcttggtcctttataatggtgctctatccctccttctaccagctgatat
THY01_0015_A08.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
MLN01_0010_B02.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0012_H04.b : TCANGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0046_D12.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0103_C11.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGCTGTG
LNG01_0103_B09.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0101_A09.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0049_F10.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
ADR01_0079_D05.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TES01_0111_A05.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
ADR01_0019_G03.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCCTCTCCAGTTGGATGTTTTG
SPL01_0032_G09.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGGGATGTTGTG
TCH01_0076_F01.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
SKNB1_0005_E03.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0003_H06.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0091_G04.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0085_E09.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
OVRT1_0059_G12.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
OVRT1_0043_H11.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
MLN01_0077_C06.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCTTCCTCATCCTGTGAGATGTTGTG
TCH01_0054_G11.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0058_C09.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
SKNB1_0064_C02.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0110_D02.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
MLN01_0004_D01.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
MLN01_0057_C01.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
TCH01_0067_A04.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
MLN01_0030_C03.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
MLN01_0014_E09.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCATCCAGTGAGATGTTGTG
LNG01_0095_B04.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0081_A10.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
BMWN1_0050_C04.b : TCAGGCAATCTCTTGGGCCTTAAAGGGTGCGCAGTCGTCCTCAGCCAGTGAGATGTTGTG
LNG01_0087_A08.b : ggggggggtcgtacttgaaagtttg
20110601C-001588 : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
---------+---------+---------+---------+---------+---------+ 1000
TCH01_0058_B08.b : AACAGGTTTTTTTT*GCTGAATGGGTTTAAAA*CACAAAACAATTTTAGCCCATTCCCTT
SPL01_0081_H04.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0066_A08.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACNAATTTAGGCCCATTCCATT
TCH01_0100_G02.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAA*ACACAGACAAATTTAGGCCCATTCCATT
TCH01_0026_G08.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTANGCCCATTCCATT
KDN01_0086_D01.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTANGCCCATTCCATT
LNG01_0071_B01.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0075_A02.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
CLNT1_0064_E06.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
THY01_0119_H04.b :
LNG01_0109_C01.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0011_G05.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0110_D01.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTANGCCCATTCCATT
LNG01_0056_B03.b : ACAAGGGTTTTTTTTGCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0067_D05.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACTAATTTAGGCCCATTCCATT
LNG01_0056_H05.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0078_B05.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0088_B08.b : ACAAGGGTTTTTTT*GCTGGATGGGCTTAAAAACACAGACAAATTTAGGCCCATTCCATT
MLN01_0034_H03.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0091_G07.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0082_F03.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
SPL01_0005_H05.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
ADR01_0077_F09.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
THY01_0027_E06.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
PBL01_0020_B06.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCCATTCATT
THY01_0042_E02.b : ctgttcgcgacctaggttttctttgctggattcttccattctccctcatacctttccatc
THY01_0015_A08.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
MLN01_0010_B02.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0012_H04.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAA*CACAGACAAATTTAGGCCCATTCATTT
LNG01_0046_D12.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0103_C11.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0103_B09.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0101_A09.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0049_F10.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTTCCAT
ADR01_0079_D05.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TES01_0111_A05.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
ADR01_0019_G03.b : ACAAGGGTTTTTTT*GCTGGATGGGTTAAAAAATCCAGACAAAatttaggcccttcctat
SPL01_0032_G09.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0076_F01.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
SKNB1_0005_E03.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0003_H06.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0091_G04.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0085_E09.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
OVRT1_0059_G12.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
OVRT1_0043_H11.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
MLN01_0077_C06.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTTAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0054_G11.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0058_C09.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
SKNB1_0064_C02.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0110_D02.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
MLN01_0004_D01.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
MLN01_0057_C01.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
TCH01_0067_A04.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
MLN01_0030_C03.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
MLN01_0014_E09.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0095_B04.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
LNG01_0081_A10.b : ACAAGGGTTTTTTT*GCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCCATTCCATT
BMWN1_0050_C04.b : ACAAGGGTTTTTTTTGCTGGATGGGTTTAAAAACACAGACAAATTTAGGCCTATTCCATT
LNG01_0087_A08.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagATT
20110601C-001588 : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
---------+---------+---------+---------+---------+---------+ 1058
TCH01_0058_B08.b : TTTCCCAAATTTTTTTGGAGAATTGAGGCATTT*TAAATAAAGGGGAAAAATGGCCcccc
SPL01_0081_H04.b : TTTCTCAGATCTTTTTTGAGAAattgaggcattttaaaataaggggtaggaaatggcctc
TCH01_0066_A08.b : TT*CTCAGATCTTTTTTGAG*ATTGAGGCATTT*TAAATAAAGGGTAGAAATGGCCTCCT
TCH01_0100_G02.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCTT
TCH01_0026_G08.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
KDN01_0086_D01.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0071_B01.b : TT*CTCAGATCTTTTTTGAGAAATGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0075_A02.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
CLNT1_0064_E06.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
THY01_0119_H04.b :
LNG01_0109_C01.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0011_G05.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0110_D01.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0056_B03.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0067_D05.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0056_H05.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0078_B05.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0088_B08.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
MLN01_0034_H03.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0091_G07.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0082_F03.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
SPL01_0005_H05.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
ADR01_0077_F09.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TACATAAGGGGTAGAAATGGCCTCCT
THY01_0027_E06.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
PBL01_0020_B06.b : TT*CTCAGATCTTTTTTGAGAAATGAGGCATTT*TAAATACCGGGTAGAAATGGCCTCCT
THY01_0042_E02.b : gcccattctatttttccccatctttattttcacaatttctttctttcttactttatggcc
THY01_0015_A08.b : TT*CTCAGATCTTTTTTGAGAATTGANGCATTT*TTAATAAAGGGTAGAAATGGCCTCCT
MLN01_0010_B02.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0012_H04.b : T**CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAAGGGTAGAAATGGCCTCCC
LNG01_0046_D12.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0103_C11.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0103_B09.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0101_A09.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0049_F10.b : TTTCTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
ADR01_0079_D05.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TES01_0111_A05.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
ADR01_0019_G03.b : ttccaagatctttttgagaatgaagccttttaaattaggggaaaaaatggcctccggtgt
SPL01_0032_G09.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0076_F01.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTGGAAATGGCCTCCT
SKNB1_0005_E03.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0003_H06.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0091_G04.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0085_E09.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAACGGCCTCCT
OVRT1_0059_G12.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
OVRT1_0043_H11.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
MLN01_0077_C06.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTTTTATATAATGGGTAGAAATGGCCTCCT
TCH01_0054_G11.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0058_C09.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
SKNB1_0064_C02.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0110_D02.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
MLN01_0004_D01.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
MLN01_0057_C01.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
TCH01_0067_A04.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
MLN01_0030_C03.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
MLN01_0014_E09.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0095_B04.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0081_A10.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
BMWN1_0050_C04.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
LNG01_0087_A08.b : TT*CTCAGATCTTTTTTGAGAATTGAGGCATTT*TAAATAAGGGGTAGAAATGGCCTCCT
20110601C-001588 : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
---------+---------+---------+---------+---------+---------+ 1116
TCH01_0058_B08.b : tgggggggccctcccaaggtttaatggaggggatttcaaacgtttaaccaataaaatttg
SPL01_0081_H04.b : cgtggggtgggcctttcccaagttttttatggaagggaatttccgaactgttattaacca
TCH01_0066_A08.b : GGT*GTGG*TCTTCCAAAGTTTTATGG*AAGGGATTTCAAACTG*TTATACAATAGAATC
TCH01_0100_G02.b : GGT*GTGGTCTTCCCCAAGGTTTATGG*AGGGGAATTCAGACTGTTATAACAATAGATCT
TCH01_0026_G08.b : GGT*GTGGGTCTTCCCAGGTTTTATGGGAGGGGATTTCAGACTGTTTATAACATAGATCT
KDN01_0086_D01.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGAACTGTATAAACATAGATCT
LNG01_0071_B01.b : GGT*GTGGTCTTCCCAAGGTTTTATGGAAGGGA**TTCAGACTGTTATAACAATAGATCT
TCH01_0075_A02.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
CLNT1_0064_E06.b : GGT*GTGGTCTTCCCCAGGTTTTATGG*AGGGGATTTCAGACTGTTAATACAATAGATCT
THY01_0119_H04.b :
LNG01_0109_C01.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0011_G05.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0110_D01.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAAACATAGATCT
LNG01_0056_B03.b : GGT*GTGGTCTCCCCAAGGTTTATGG**AGGGGATTTCAAACTGTTATAACAATAGATCT
LNG01_0067_D05.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*ANGGGATTTCAGACTGTTTTATACATAGATCT
LNG01_0056_H05.b : GGT*GTGGTCTTCCCAAGGGTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0078_B05.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGGTATAACAATAGATCT
LNG01_0088_B08.b : GGT*GTGGTCTTCCAAAG*TTTTATGG**AGGGGATTCAGACTGGTATAAC*ATAGATCT
MLN01_0034_H03.b : GGT*GTGGTCTTCCC*AGGTTTTATGG**AGGGGATTCAGACTGTTATAAC*ATAGATCT
LNG01_0091_G07.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAAACATAGATCT
TCH01_0082_F03.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
SPL01_0005_H05.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
ADR01_0077_F09.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
THY01_0027_E06.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
PBL01_0020_B06.b : GGT*GTGGTCCTTCCCAACGTTTTATGGAGGGGATTTCAGAACTGTATAAACATAGATCT
THY01_0042_E02.b : cccatcggtcccctctcctctgctcctcttccatctcttttttgaactccatctctcccc
THY01_0015_A08.b : GGNAGTGGTCTTCCCAAGGTTTTATGGAGGCGGATTTCAGACTGTTATAACAATAGATCT
MLN01_0010_B02.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0012_H04.b : TGT*GTGGTCTTCCCAGGTTTTAATG**AGGGGATTcagactgttataacatagatcttg
LNG01_0046_D12.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
TCH01_0103_C11.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0103_B09.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0101_A09.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
TCH01_0049_F10.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACATAAAATCT
ADR01_0079_D05.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
TES01_0111_A05.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATTACAATAGATTC
ADR01_0019_G03.b : ggtctccccagggtttatgggaggggattcctaatggtttataccatgatcttgtacctc
SPL01_0032_G09.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
TCH01_0076_F01.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
SKNB1_0005_E03.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
TCH01_0003_H06.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
TCH01_0091_G04.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0085_E09.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
OVRT1_0059_G12.b : GGT*GTGGTCTTCCCTAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
OVRT1_0043_H11.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
MLN01_0077_C06.b : GGT*GTGGTCTTCCCAGGGTTTTCTGG*AGGGGATTTacaactgctctaacaattagatc
TCH01_0054_G11.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
TCH01_0058_C09.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
SKNB1_0064_C02.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0110_D02.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
MLN01_0004_D01.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
MLN01_0057_C01.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
TCH01_0067_A04.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
MLN01_0030_C03.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
MLN01_0014_E09.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCACACTGTTATAACAATATATCT
LNG01_0095_B04.b : GGT*GTGGCCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0081_A10.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
BMWN1_0050_C04.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
LNG01_0087_A08.b : GGT*GTGGTCTTCCCAAGGTTTTATGG*AGGGGATTTCAGACTGTTATAACAATAGATCT
20110601C-001588 : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
---------+---------+---------+---------+---------+---------+ 1174
TCH01_0058_B08.b : aaacttcggcctgtggggaaaaagcccattttccaaactggaagaaggaa
SPL01_0081_H04.b : ttaaattttgaaccctcttgccatgtggggggaaaaacccaattttgccaaactttgaag
TCH01_0066_A08.b : TGAACCTCTGCCATGTGGAGAAAAGCAA*T*TTACCAAACTAGAAGAATG**AAAAGGAA
TCH01_0100_G02.b : TGAACCTCTGGCATGTGGAGAAAGCCCA*T*TTAGCAActagaagatggaaagaaaaaaa
TCH01_0026_G08.b : TGAACCTCTGCCATGTGGAGAAAAGCCN*A*TTTAGCAACTAGAAGAATG**AAAAGGAA
KDN01_0086_D01.b : TGAAACTCTGCCATGTGGAGAAAAGCCA*A*TTAGCAAACTAGAAAGATG**AAAAGGAA
LNG01_0071_B01.b : TGAACCTCTGCCATGTGGAGAAAAGCCA*T*TTAGCAAACTAGAAAAATG**AAAAGGAA
TCH01_0075_A02.b : TGAACCCTCTGCATGTGGAGAAAAGCCAAT*TTAGCAAACTANAAGAATG*GAAAGGGAA
CLNT1_0064_E06.b : TGAACCTCTGCCATGTGGAGAAAAAGCCAT*TTTAGCAACTAGAAGAATN*G*AAAGGAA
THY01_0119_H04.b :
LNG01_0109_C01.b : TGAACCTCTGCCATGTGGAGGAAAGCCCAT*TTAGCAAACTAGAAGAATG*AAAAAGAAA
LNG01_0011_G05.b : TGAACCTCTGCCATGTGGAGAAAAG*CAAT*TTNAGCAACTAGAAGAAAT*GAAAGGAAA
LNG01_0110_D01.b : TGAACCTCTGCCATGTGGAGAAAAGCCA*T*TTTAGCAACTAGAAGAATG**AAAGGAAA
LNG01_0056_B03.b : TGGACCTCTGCCATGTGGAGAAAAGCCA*A*TTAGCAAACTAGAAGAATG*AAAAGGAAA
LNG01_0067_D05.b : TGAACCCTCTGCATGTGGAGAAAAGCAA*T*TTNAGCAACTANGAGAATG**AAAAGGAA
LNG01_0056_H05.b : TGAAACTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
LNG01_0078_B05.b : TGAAACTCTGCCATGTGGAGAAAAGCCCAT*TTAGCAAACTAGAAGAATG**AAAAGGAA
LNG01_0088_B08.b : *GAAACTCTGCCATGTGGAGAAAAGC*AAT*TTAGCNAACTAGAAGAATG**AAAAGGAA
MLN01_0034_H03.b : TGAACCTCTGCCATGTGGAGAAAAGCCATT*TTAGC*AACTAGAAGAATG**AAAAGGAA
LNG01_0091_G07.b : TGAACCTCTGCCATGTGNAGAAAAGCCAAT*TTTAGCAACTAGAAGAATG*AAAAGGGAA
TCH01_0082_F03.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG**AAAAGGAA
SPL01_0005_H05.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
ADR01_0077_F09.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTTAGCAACTANGAGAATG*AAAAGGAAA
THY01_0027_E06.b : TGAAACTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
PBL01_0020_B06.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTACCCAACCTGA*GAATG*AAAAGGAAA
THY01_0042_E02.b : ttcgctcctctccttccttctttccccctctcctccccccatctctccttttcttctcta
THY01_0015_A08.b : TGAACCTCTGCCATGTGGAGAAAAGCCCAT*TTAGCCAACTAGAAGAATG*AAAGGGAAA
MLN01_0010_B02.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG**AAAAGGAA
LNG01_0012_H04.b : aactctgccatgtggagaaagccaattagcaaactagaaaatgaaaaggaaaaaatcatg
LNG01_0046_D12.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
TCH01_0103_C11.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
LNG01_0103_B09.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTANCAAACTAGAAGAAAT*GAAAGGAAA
LNG01_0101_A09.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTANAAGAATG*AAAAGGAAA
TCH01_0049_F10.b : TGAACCTCTGCCTTGTGGAGAAAAGCCAATTTTAGCAAATTAGAAGAATGTAAAAGGAAA
ADR01_0079_D05.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
TES01_0111_A05.b : TGAACCTCTGCCATGTGGAGAAAAagccaatttaagcaactatgaagattgaaaagggaa
ADR01_0019_G03.b : tgcctgttggataaaaccattttcctcattttattaattcaaaggataataattcttgtc
SPL01_0032_G09.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCNAACTAGAAGAATG*AAAAGGAAA
TCH01_0076_F01.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
SKNB1_0005_E03.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGGCAACTAGAAGAATG*AAAAGGGAA
TCH01_0003_H06.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
TCH01_0091_G04.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
LNG01_0085_E09.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
OVRT1_0059_G12.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
OVRT1_0043_H11.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGGAA
MLN01_0077_C06.b : tttgaacctctgccttgtgtaaaaaagcctatttttgcttactttattaaaggaaaggta
TCH01_0054_G11.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
TCH01_0058_C09.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
SKNB1_0064_C02.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
LNG01_0110_D02.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
MLN01_0004_D01.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
MLN01_0057_C01.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
TCH01_0067_A04.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
MLN01_0030_C03.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
MLN01_0014_E09.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTACCAAACTAGAAGAATG*ACAAAGAAA
LNG01_0095_B04.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
LNG01_0081_A10.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
BMWN1_0050_C04.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAAACTAGAAGAATG*AAAAGGAAA
LNG01_0087_A08.b : TGAACCTCTGCCATGTGGAGAAAAGCCAAT*TTAGCAGACTAGAAGAATG*AAAAGGAAA
20110601C-001588 : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
---------+---------+---------+---------+---------+---------+ 1231
TCH01_0058_B08.b :
SPL01_0081_H04.b : aagtgaaaaaggaaaaaaaaatcctgggccca
TCH01_0066_A08.b : AAAATCCTGCCCAAAACTTTGGG*AAAAAGATGTT*CTAAAATCctggttccctttggtt
TCH01_0100_G02.b : tcatggcaaaactttgggaaaagaatgtctaaaacattgttccctttgtttggccctttt
TCH01_0026_G08.b : AAAATCTTGGCCAAAAC*TTGGG*AAAAAAATGTT*CTAAAatcattgtcccccttgttg
KDN01_0086_D01.b : AAATCATGGCCAAACTttgggaaaaagatgtcttaaaatcattgtccccttgtttgtgcc
LNG01_0071_B01.b : AAAATCATGGCCAAActtggggaaaagatgtcctaaaatcatggtcccctttgttgggcc
TCH01_0075_A02.b : AAAATCATGGCCAAAACTTTGGG*GAAAAGATGTT*CTTAAAATCATTGGTTCCCCTTTG
CLNT1_0064_E06.b : AAAATCTTGCCCAAACC*TTGGG*AAAAAGAAGTT*CTtaaaatcatgggtccccttgtt
THY01_0119_H04.b :
LNG01_0109_C01.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTT*CTTAAATCATTGTCCCCCTTTGTT
LNG01_0011_G05.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTTCTTAAAATCATTGTTCCCCCTTTG
LNG01_0110_D01.b : AAATCATGGCCAAActttgggaaaagatgttctaaaaatcatgttccccttgnttgtgca
LNG01_0056_B03.b : AAAATCATGGCCAAA*CTTTGGG*AAAAAGATGTT*CTTAAATCATggtcccctttgttt
LNG01_0067_D05.b : AAAATCATGGCCAAA*CTTTGGG*AAAAAGATGTT*CTaaatcattgtcccctttgttgt
LNG01_0056_H05.b : AAAATCATGGCCAAAACTTTGGG*GAAAAGATGTC*TTAAAATCATTGTTCCCCTTT**G
LNG01_0078_B05.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTC*TTAAAATCATTG**TTCCCCTTTG
LNG01_0088_B08.b : AAAATCATGGCCAAActttgggaaaagatgttctaaaatcattgtccccttggttgtgca
MLN01_0034_H03.b : AAAATCATGGCCAAAACTTTGGG*AAAAgatgtcttaaatcattgtcccctttgttgtgc
LNG01_0091_G07.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTT*CTAAAATCATTGTCCCCtttgttt
TCH01_0082_F03.b : AAAATCATGGCCAAAACTTTGGG*AAAA*GATGTT*CTTAAATCATTGTTCCCCTTgttt
SPL01_0005_H05.b : AAAATCATGGCCAAAACTTTGGGGAAAAAGATGTTCTTAAAATCATTGTTTCCCCTTTTG
ADR01_0077_F09.b : AAAATCATGGGCAAAACTTTGGG*GAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
THY01_0027_E06.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCCTTT*G
PBL01_0020_B06.b : AAAATCATGGCCCAAACTTTGGG*AAAAAGATGTC*CTAAAATCATgctcccctttgttt
THY01_0042_E02.b : catcccccccttttttaactttatcttcattttttcccttccttctcttttttttcctac
THY01_0015_A08.b : AAATCttgccaaaatttgggaaaaagatgtc
MLN01_0010_B02.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTT*CTTAAATCATTGGTCCCCTTTNG*
LNG01_0012_H04.b : gccaaactttgggaaaagatgttttaaaatcatgttccctttgttttgcactaataaata
LNG01_0046_D12.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
TCH01_0103_C11.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
LNG01_0103_B09.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
LNG01_0101_A09.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCCTAAAATCATTGTTCCCCTTT**G
TCH01_0049_F10.b : AAAATCATGGGCCAAAATTTTGG*AAAAAAAAGTTCTTAAAAACATTGTTTCCCCTTT*G
ADR01_0079_D05.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCCTTT**
TES01_0111_A05.b : aaaaatcatggcccaaactttgggaaaaaagaggttctttaaaatctttggttccccttg
ADR01_0019_G03.b : taatctttgggaaaaaatggtcttaaaatctttgtccccttggttgggcccttatcttaa
SPL01_0032_G09.b : AAAATCATGGCCCAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
TCH01_0076_F01.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCCTT**G
SKNB1_0005_E03.b : AAAATCATGGCCAAAACTTTTGGGAAAAAGATGTTCTTAAAATCATTGTTTCCCTTTT*G
TCH01_0003_H06.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
TCH01_0091_G04.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
LNG01_0085_E09.b : AA*ATCATGGCCAAAACTTTGGG*GAAAAGATGTTCTTNAAATCATTGTTCCCCTTT**G
OVRT1_0059_G12.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCCNTT*G
OVRT1_0043_H11.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
MLN01_0077_C06.b : aaaaatcctgggccaaaccttgggcgaaaaaatgttcttaaaagctttgttccccctttg
TCH01_0054_G11.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTTAAATCATTGTTTCCCCTTT*G
TCH01_0058_C09.b : AAAATCATGGCCCAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
SKNB1_0064_C02.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
LNG01_0110_D02.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
MLN01_0004_D01.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
MLN01_0057_C01.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
TCH01_0067_A04.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
MLN01_0030_C03.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
MLN01_0014_E09.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAGATCATTGTTCCCCTTT**G
LNG01_0095_B04.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
LNG01_0081_A10.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
BMWN1_0050_C04.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
LNG01_0087_A08.b : AAAATCATGGCCAAAACTTTGGG*AAAAAGATGTTCTTAAAATCATTGTTCCCCTTT**G
20110601C-001588 : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
---------+---------+---------+---------+---------+---------+ 1287
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b : gggcccttttggttaaagaaaaccaaaagaaaatccctccaagcttatttggttaaagag
TCH01_0100_G02.b : ggtaaagaaaccaaagggaaatcctcagagctatttggtttaaggggcttccggtgatta
TCH01_0026_G08.b : gtgcccttttgtttaaggaacaccaaaagaaaaatcttccaaactttt
KDN01_0086_D01.b : cttttgataaaagaaaccaaaagaaaaatcctcaaaacttatttggttaaaatggactcc
LNG01_0071_B01.b : ctttngataaaggaaaacaaaagaaaaatctccaacttaattggttaagtgacttcccat
TCH01_0075_A02.b : TTTGTGCACTT*TTGNATTAAA*GAAAACAAA*AAAGAAAATTCCTCCAGAagctaattg
CLNT1_0064_E06.b : ggacccttttggtaaagaaaaccaaaaaaaaaaaaaagccccatgggtccaactgcagtc
THY01_0119_H04.b :
LNG01_0109_C01.b : gtgccctttatgataaagaaacaaaaagaaaatcctccaagctattgggttagagtgacc
LNG01_0011_G05.b : TTTGTGCACTT*ATAAATAAAA*GAAAACAAAAAAAGAAAAATCCTCCAAAGCTT*ATTT
LNG01_0110_D01.b : cttttgatnnaagaaacaaaaagaaaatcctccagagctattggtttgagtgactcccat
LNG01_0056_B03.b : gtgccctttggataaagaaaacaaaaggaaaatcctccaaacttattgggttagaggacc
LNG01_0067_D05.b : gcactatnngataagaaaacaaaagaaaatctcagagctatttggttaatgagctccatg
LNG01_0056_H05.b : TTTGTGCACTT*ATTGGTAAAA*GAAAcaaaaaggaaatccttcgaacttatttggttta
LNG01_0078_B05.b : TTTGTGCCCTT*TTG*ATTAAA*GAAAACCAA*AAAGAAAAtcctcccgagcttatttgg
LNG01_0088_B08.b : cttatgataaagaaacaaaaagaaaatcctcagagcttattggttaaagtgactccctgt
MLN01_0034_H03.b : cttttggttaaagaaaacaaaaggaaaatcctccaacttatttgtttaaagtgacttcca
LNG01_0091_G07.b : gtgcactttatgataaagaaacaaaaaggaaaatccccagagctattggttagagtgagc
TCH01_0082_F03.b : gtgccttantgttaaagagaacaaaagaaaatcctccaaagctattgggttaaatgagct
SPL01_0005_H05.b : TTTGTGCACTT*ATAGATAAAA*AGAAAACAAAAAAAAAAAAatcctcccagagcttatt
ADR01_0077_F09.b : TTTGTGCCCTT*NTNGATAAAA*GAAAACAAAAAAG**AAAATCCTCCAAAGCTT*ATTG
THY01_0027_E06.b : TTTGTGCACTT*ATAAATAAAAAAAAACAAAAAAGAAAAAatccctcccaaactttattt
PBL01_0020_B06.b : gacccctttngattaacgaaaaccaaaagaaaattcctcccgacctatttggtttaaagg
THY01_0042_E02.b : tcctattcctcctcatattttcccctctttcctctccccccctcctaatttcccaacctt
THY01_0015_A08.b :
MLN01_0010_B02.b : *TTGTGCACTT*ATAGATAAAA*GAAA**CAAAAAAGAAAAATCCTCagagcttatttgt
LNG01_0012_H04.b : aaaaaacaaaaaagaaaaatctcccgagctaattgggttaaatggacttcccatgtaatt
LNG01_0046_D12.b : TTTGTGCACTT*ATAGATAAAAAGAAAACAAAAAAGAAAAAATCCTCCAGAGCTT*ATTT
TCH01_0103_C11.b : TTTGTGCACTT*ATNGATAAAAGAAAA**CAAAAAAAGAAAATCCTCCAGAGCTT*ATTT
LNG01_0103_B09.b : TTTGTGCACTT*ATNGATNAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTTTATTT
LNG01_0101_A09.b : TTTGTGCNCTT*ATTGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
TCH01_0049_F10.b : TTTGTGCcccttttagttaatagaaacccattaattaactttcctcccaaacttaatttg
ADR01_0079_D05.b : GTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
TES01_0111_A05.b : gtttgggcccttttttgttaaaagaaaaactaaaattgaaaatccccccaaagcttattt
ADR01_0019_G03.b : tttaatcttattataattcttccaaacctttttggttttaagaggatttctcctgtaatt
SPL01_0032_G09.b : TTTGTGCACTT*NTNGATTAAAGAAAA***CAAAAAAGAAAATCCTCCAGAGCTT*ATTT
TCH01_0076_F01.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
SKNB1_0005_E03.b : TTTGTgcacttnattgatnaaaggaaaaccaaaaaggaaaaatcctccagaagcttattt
TCH01_0003_H06.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
TCH01_0091_G04.b : TTTGTGCACTT*ATAGATAAAAGAAAA**ACAAAAAGAAAAATCCTCCAGAGCTT*ATTT
LNG01_0085_E09.b : TTTGTGCNCTT*ATAGATAAAAGAAAA**CCAAAAAGAANAATCCTCCAGAGCTT*ATT*
OVRT1_0059_G12.b : TTTGTACNCTT*NTNGATAAAAGAAA***CCAAANAGAAAAATCCTCCAGAGCTT*ATTT
OVRT1_0043_H11.b : TTTGTACNCTT*ATAGATAAAAGAAAA***CAAAAAGAAAAATCCTCCAGAGCTT*ATTT
MLN01_0077_C06.b : tttgtgtctttattgattatagatatcagttatggattatccctccccaactttctttgt
TCH01_0054_G11.b : TTTGTGCACTTTATAGATAAAAAGAAAACCAAAAAAGAAAAATtccttccagaaccttat
TCH01_0058_C09.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CCAAAAAGAAAAATCCTCCAGAGCTT*ATTT
SKNB1_0064_C02.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
LNG01_0110_D02.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
MLN01_0004_D01.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
MLN01_0057_C01.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
TCH01_0067_A04.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
MLN01_0030_C03.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
MLN01_0014_E09.b : TTTGTGCGCTT*ATACATTACAGAAAA**CCCTGAAGATGAATCCTCGAGAGCTT*ATTT
LNG01_0095_B04.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
LNG01_0081_A10.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
BMWN1_0050_C04.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
LNG01_0087_A08.b : TTTGTGCACTT*ATAGATAAAAGAAAA**CAAAAAAGAAAAATCCTCCAGAGCTT*ATTT
20110601C-001588 : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
---------+---------+---------+---------+---------+---------+ 1345
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b : gacttccctgttaaataaaggaaaaagctct
TCH01_0100_G02.b : aggaaaaactcaagttgcctttttaaagggcttaaggtggctaaccataaaacattcccc
TCH01_0026_G08.b :
KDN01_0086_D01.b : catgtgaataaaggaaaagcctctaagtgtcttttgttaaaagtgtttaaggtggctaaa
LNG01_0071_B01.b : gtaataaagaaagaactccaagttgcctttttaaaatgctttaattgctaaacaatataa
TCH01_0075_A02.b : ggtttaaatggagcttcccatgggaattaaggggaaaaaaccccaaagttgtctttggtt
CLNT1_0064_E06.b : ccggcccctaaatatctaaaaaaaacctcccccctcccctgaccgaaaaaaaagaaggaa
THY01_0119_H04.b :
LNG01_0109_C01.b : tcccatgtgaattaagggaaaaactctaaattgtctttgttagaaattgcttaatgtggc
LNG01_0011_G05.b : tggttaaaagtgagctttcccatgtgaaataaaggggaagaaagctctaaaagtttgtct
LNG01_0110_D01.b : gtaaataaaggagaagctcaaagttgcttggtaaaaatgcttaatgggcctaaacataat
LNG01_0056_B03.b : tccctgtgattaaagggaaaaactctaagttgtctttttttaaaagggttaatgtggcct
LNG01_0067_D05.b : tgaataaggnaagagtctaagtgtcttggtaaagtgcttatgggctaagcatatactatg
LNG01_0056_H05.b : aagtgacttccatgggattaaagggaagagcctctaagttgtctttgttaaaaatgctta
LNG01_0078_B05.b : ttaaaaggaactttccagggaatttaaaggaaaaaccccaaaatttcctttgtttaaaaa
LNG01_0088_B08.b : gaataaaggaagagctctaagttgcttgttaaaagtgcttatgttgctaagcataatact
MLN01_0034_H03.b : tgtgaataagggaaaagctctaagttgccttgttaaaaggctttagggggctaaagctta
LNG01_0091_G07.b : tccatgtgaattaggaaganctctaagtgtctttgttaaagtgctttatgtgctaagcag
TCH01_0082_F03.b : ccctgtgatttaaggaagaactctaagttgcttggttaaaagggtttagtggcgtaaaaa
SPL01_0005_H05.b : tttggtttaaaagtgagccttccccttt
ADR01_0077_F09.b : GGTT*ANAGTGAGCTTCCCATGTG*AATaaagggaggagctctaaagttgtcttggttaa
THY01_0027_E06.b : tggtttaaaagggagctttcccatgtggaatttaagggggaaaaaagctttcaaaagttg
PBL01_0020_B06.b : gaccttccaggtgattaaaaggaagaaactcccagttgtctttttttaaaagtgctttat
THY01_0042_E02.b : tctccccattctcctctccctcactcgcactctaatccttccttcccccccttttcttta
THY01_0015_A08.b :
MLN01_0010_B02.b : ttagagtgagcttccatgtgaattaaggaagaactctaaagtgtcttgtttaaagtgctt
LNG01_0012_H04.b : aaaggaaaaaaccccaaatttctttgtttaaaatggtttaatgggggaaagcaaaaatac
LNG01_0046_D12.b : GGgtttaaagtgagcttccccatgtgaatttaaaggggaagaagctctaaaagttgtctt
TCH01_0103_C11.b : GGTTNAGAGTGAGCTTCCCATGTG*AAT*AAANGGAAGAAagctctaagtgtctttgttt
LNG01_0103_B09.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAGGGGAAGA*GCTCTAAAGT*TGTCTTTGT
LNG01_0101_A09.b : GGTTTAAAGTGAGCTTCCCATGTG*AAT*AAAGGGAAGAAGCTCTAAAGT*TGTCTTTG*
TCH01_0049_F10.b : ggtttgaagggagcttcccattttaaatttaaggggaagaaccctcaaaaatgttctttt
ADR01_0079_D05.b : GGTTNAGAGTGAGCTTCCCATGTG*AATTCANGGGGAGAAGCTCNTAAGT*TGTCTTTTG
TES01_0111_A05.b : tggtttataagggagcttccccggtggaattaaagggaaaaaacccccaagattggcttt
ADR01_0019_G03.b : aaaggaaaaattttaaattgttttttttaaaaggtttttatggggtaaaactataattct
SPL01_0032_G09.b : GGGTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAACCTCTAAAGT*TGTCTTTGT
TCH01_0076_F01.b : GGGTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTG*
SKNB1_0005_E03.b : ggtttaaaagtgagcttcccatgggaattaaaagggaagaaagctctaaaggtggtcttt
TCH01_0003_H06.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGGAGAAGCTCTAAAGT*TGTCTTTG*
TCH01_0091_G04.b : TGGTTAGAGTGAGCTTTCCATGTGAAATTAAAGGGAAGAAGCTCTAAAGTTTGTCTTTGT
LNG01_0085_E09.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAG*GAAGAAGCTCTAAAGT**GTCTTTGT
OVRT1_0059_G12.b : GGTT*AGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGN
OVRT1_0043_H11.b : GGTTTAGAGTGAGCTTCCCATGTG*AATAAAAGGGA*GAAGCTCTAAAGT*TGTCTTTG*
MLN01_0077_C06.b : tttaaggtggccttccaatgcgattttaacgtgaaaaacctcttaacttggactttgttc
TCH01_0054_G11.b : ttgggttttaaaggtgagccttccccatggtgaaatttaaaggggaaagaaagcctccta
TCH01_0058_C09.b : GGTTTAGAGTGAGCTTCCCATGTG*AATNAAAGGGAAGAAGCTCCTAAGT*TGTCTTTG*
SKNB1_0064_C02.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
LNG01_0110_D02.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
MLN01_0004_D01.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
MLN01_0057_C01.b : GGTTTAGAGTGAGCTTCCCATGTG*ATTTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
TCH01_0067_A04.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
MLN01_0030_C03.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
MLN01_0014_E09.b : GGTTTAGAGTGAGCTTCACATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
LNG01_0095_B04.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAAG*TGTCTTTGT
LNG01_0081_A10.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
BMWN1_0050_C04.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
LNG01_0087_A08.b : GGTTTAGAGTGAGCTTCCCATGTG*AATTAAAGGGAAGAAGCTCTAAAGT*TGTCTTTGT
20110601C-001588 : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAGGTCTT
---------+---------+---------+---------+---------+---------+ 1403
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b : cagggcttaaagccttttaaccttggcggttttccttggcaattttatggga
TCH01_0026_G08.b :
KDN01_0086_D01.b : caataataatatgccccccaaggcttaaaaaccttttaaacccattcccgtgttttttct
LNG01_0071_B01.b : tatcccaccaagtctaaaagccatttagagcctgcctgtttctctgtgaaacttttaggg
TCH01_0075_A02.b : taaaaaaggcttttatgggggcataaacaatatataccatggcccacccaagggccttat
CLNT1_0064_E06.b : ttgtggttaatggttttggcccttaagggtacaaaaagatacccccaattccaaaaagat
THY01_0119_H04.b :
LNG01_0109_C01.b : gtaacaataatacttagcccaccaaagtctaaaaacctttttaaaccttttgcctgtttt
LNG01_0011_G05.b : ttggtttaaaaagggggcttttaat
LNG01_0110_D01.b : actttgcccaccaagtctaaaaagcattttaagctatgcctggttctttgtggcaatttc
LNG01_0056_B03.b : aaacaataataacttgccccacaaaggtttttaagacctttttaagccttttgcctgttc
LNG01_0067_D05.b : ccacaagtctaaagcttttaagccatgcatggtttcgtgcaaatttcggggaaaggttct
LNG01_0056_H05.b : atggtgcgtaaacaataataatttgccccacaaaggtttaaaaccatttttaagacattg
LNG01_0078_B05.b : tgctttaaggtggctaaagcaatattacttgtccccccaaagtcttaaaaaccattttta
LNG01_0088_B08.b : tgcccacaaggctaaaaaccttttaaaccatgcctggtcttcgtggcactttctgggaaa
MLN01_0034_H03.b : tacctggcccccaaggtcttaaacccttttaaagctatgccgggttcttgttggaaactt
LNG01_0091_G07.b : tatactagccccacaagtctaaaagcattttaagctatgcctggttctccgtgcaaaatt
TCH01_0082_F03.b : atatacttgccccccaaggctaaaaaccttttaaaccatgccgggttctctgtggcaatt
SPL01_0005_H05.b :
ADR01_0077_F09.b : aaagtgcttaatgtgccgtaaagcagtagtaactatgccccaccaagggtctaaaaagca
THY01_0027_E06.b : gtcttttggttttaaaaaagggctttttaatggggggggggaaaaaaaaagataaaaaaa
PBL01_0020_B06.b : gtggccttaagccttattaccttcccccccccaaggccttaaaagccctttttaaaaccc
THY01_0042_E02.b : tcccgcttaccccctttttttttctctcctctcccattccttatttcctcctctcctact
THY01_0015_A08.b :
MLN01_0010_B02.b : tatnggcgtaagcatagtactagccccacaagtctaaaaacattttgagctatgactggt
LNG01_0012_H04.b : tatgcccccaaaggcttaaaaagccttttaaacccttttgcttgttttttttgttggaaa
LNG01_0046_D12.b : tgtttaagaaagttgctttaatgttggcgtaaaagcattaataaactatgcccccaccaa
TCH01_0103_C11.b : agaagtgcttttaatgtgcgtaagcagtagtaactatgccccaccaaagtcttaaaagcc
LNG01_0103_B09.b : TTAGAAAGTGCTTTTATG*TGGCGTAAAGCAATAG*TACTATGCCCC*ACCAAAGtccta
LNG01_0101_A09.b : TTTAAAAGTGCTTTAATG*TGGCGTAAAGCAGTAG*TACTATGCCCC*ACAAAAGGTCTT
TCH01_0049_F10.b : gttttaaaaggtgcttttaatggtgggcgttaatgcattatttccatatgtgcccatccg
ADR01_0079_D05.b : TTAGGAAGTGCTTTNATG*TGNCGTAAAGCAGTAGNTACTATGCCCC*ANCCAAGGGTCT
TES01_0111_A05.b : tgtttaaaaaggggctttaatgtggggtaaaaccgtaaataattttgcccccccaaaggt
ADR01_0019_G03.b : ttccccccaagggttaaaatcctttttaaccttttgactggtttcttgttgaaaattttt
SPL01_0032_G09.b : TTAGAAAGTGCTTTTATG*TGGCGTAAAGCATTATTAACTATGGCCCccccaaaggtctt
TCH01_0076_F01.b : TTTAGAAGTGCTTTTATG*TGGCGTTAAGCATTAG*TACTATGCCCC*ACCCAAGGTCTT
SKNB1_0005_E03.b : ggtttaaaaagtgcctttaatgggggcgtaaaaccagtaattacctatgccccccccaaa
TCH01_0003_H06.b : TTTAGAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAGGTCTT
TCH01_0091_G04.b : TTAGAAAGTGCTTTTATGGTGGCGTAAAGCAGTAGTACCTATGCCCC*CCCCAAGGTCCT
LNG01_0085_E09.b : TTAGAAAGTGCTTatggtgcgtaaagcagtataactatgccccacaaaggtctaaaaagc
OVRT1_0059_G12.b : TTTAGAAGTGCTTTTATG*TGGCGTTAAGCAGTAttaatatgccccccccaaagtctaaa
OVRT1_0043_H11.b : TTTAGAAGTGGCTTAATG*TGGCGTAAAGCAGTAGTTACTATGCCCC*ACCAAAGGTCTT
MLN01_0077_C06.b : taaaactgctcttattgtgtcgtaatatcgcttattaatttttccccacataaggtttta
TCH01_0054_G11.b : aaagtttgttcttttgggtttaaaaaaaaggtgctttttaatggggggccgtaaaaggcc
TCH01_0058_C09.b : GTTAGAAAGTGTTTTAtgtgccgtaaagcagttattaactatgccccccaaagggtctta
SKNB1_0064_C02.b : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAGGTCTT
LNG01_0110_D02.b : TTAGAAAGTGCTTTTATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAAGTCTT
MLN01_0004_D01.b : TTA*AAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAAGTCTT
MLN01_0057_C01.b : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCCCACCAAAGGTCTT
TCH01_0067_A04.b : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAAGTCTT
MLN01_0030_C03.b : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAGGTCTT
MLN01_0014_E09.b : CTAGAAAGTGCTTTAATG*TGGCGTATAGCAGTAGTAACTATGCCCC*ACCAAACGTCTT
LNG01_0095_B04.b : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACC*AAGGTCTT
LNG01_0081_A10.b : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAGGTCTT
BMWN1_0050_C04.b : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAGGTCTT
LNG01_0087_A08.b : TTAGAAAGTGCTTTAATG*TGGCGTAAAGCAGTAGTAACTATGCCCC*ACCAAAGGTCTT
20110601C-001588 : AAAAAGCCATTTTTA*GAGCCTATTGCACTGTG*TTCTTCTGTTGGCAAACATTTTCATG
---------+---------+---------+---------+---------+---------+ 1461
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b : tggcaaattttcagggggaaaggtttttctcccccgaccctggaattttcggaggggggc
LNG01_0071_B01.b : gaaagtttttctcaaaaacccggaaaattcgagggggccacccttttttggaattttccc
TCH01_0075_A02.b : aaaaccttttttaaa
CLNT1_0064_E06.b : ttttcgcgccccttggggtgcaacccaaggttatttggggggccgggaaagcaaaattct
THY01_0119_H04.b :
LNG01_0109_C01.b : ttggtggaaactttctggggaaattggtttctctccaaacccctgaattatccaggaagg
LNG01_0011_G05.b :
LNG01_0110_D01.b : aggggggaagggttttttcccataaccctgaattactcaaggaggctaaccttattggcc
LNG01_0056_B03.b : ttctgtggcaaaaattccaggggaaaagggtttttctccccaaacccctggaatttttga
LNG01_0067_D05.b : cccagacctgatgttgaggagctacctatttggaatttccttccaagaccaagccgggtt
LNG01_0056_H05.b : ctgtgttttttgtggcaacatttcggggggaatgtgtttttctccagaacccctggaata
LNG01_0078_B05.b : agcctatggcctggttcttggttgcaacatttctggggaaaagggttttctcccccgaac
LNG01_0088_B08.b : gggttcttccagaccttgatgatcaaggaggctaacctaatgggcatttttccccaccaa
MLN01_0034_H03.b : tctggggaaaaggttttttcccagcacctgaattatcagaggagcctaccattattgggc
LNG01_0091_G07.b : cagtggaaagtgtttccttccatgaccctgatgatcaaggagggctaccttattggtaat
TCH01_0082_F03.b : tttggggaaagggttttctcccagacccggaattatttgagggggctaacttttttggca
SPL01_0005_H05.b :
ADR01_0077_F09.b : tttttaaagctattgcctgggttcctctggtgcaaactttcatgtgggaaaagggttttc
THY01_0027_E06.b : cttttttcccccccccccccaaaggggtttttttaaaaaaaaacccccttttttttttta
PBL01_0020_B06.b : atgccccgggtcttccgttggcaacattttcgtggggaaaagggttttccccccaccaac
THY01_0042_E02.b : ctcttttatattcctttttctcttcccctttcttctttctcctcctttctttttttcctc
THY01_0015_A08.b :
MLN01_0010_B02.b : cttcgtggcaaattctgtgggaaaggtttctctcctgatcttgatgatccgaggaggcta
LNG01_0012_H04.b : atttttctggggaaaatggttttttctccccagaaccctcggaattaattcaaggggggg
LNG01_0046_D12.b : aaggtcttaaaaaagcccattttttaaaaaccttatttgcacttggggtttcttttggtt
TCH01_0103_C11.b : atttttagagctaatgcactggggtcttcgttggaaacttttcatggggaaaaagggttt
LNG01_0103_B09.b : aaagcatttttaaagctattgcactgggtcctcggttggcaacattttctgtgggaaaag
LNG01_0101_A09.b : AAAAAccattttaaagctattgcactgtgtcctccgttggcaacattttcgggggaaaag
TCH01_0049_F10.b : aatggtctttaagataccctttctataaacccaatatgccacgtttttctctcgtgtggg
ADR01_0079_D05.b : TAAAAGCCCATTTTA*GAGCCTATTtgcactgtgtcttctgntgggcaacattttcatgt
TES01_0111_A05.b : ctttaaaaacccattttttaaaccctatggccctgggtttcctcttgttgggaaaaattt
ADR01_0019_G03.b : gggaaaaaggtttttttccaatattctgcgcattatctgagtgggctttcaatttatttg
SPL01_0032_G09.b : aaaagcccttttttaaaccctatgccctgggttctccttttgggaaacattttcttgggg
TCH01_0076_F01.b : AAAAgccatttttaaagccattgcacgttgtctttctgtggcaaaattttcaggtgggaa
SKNB1_0005_E03.b : aggtcttaaaaaaacccattttttataagcccaattgtcactgggggtcctttctggttg
TCH01_0003_H06.b : AAAAgccattttagaggctattgcactgtgttctctggtggcaaacatttcatgtgggaa
TCH01_0091_G04.b : TAAAAGCCATTTTTAAGAGCCTATTGCACTGTG*TTCCTCTGTTGGCAAA*Cttttcatg
LNG01_0085_E09.b : atttttagagctatgcactgtgtcttctgttgcaacatttcatgtggaaaagttttttct
OVRT1_0059_G12.b : aaggcattttagaagctattgccctgggttcttccgttgcaaaatttttcaggtgggaaa
OVRT1_0043_H11.b : AAAAgccacttttaaaggctattgcctgggtttcttcgttggcaacattttcctggggaa
MLN01_0077_C06.b : taaggctaattttctaaggccattgtgcccggggttctcttgttggcataatctttctcg
TCH01_0054_G11.b : cgttaagttaaacctttggcccccaaccccaaaaggggtcctttaaaaaaaagccccatt
TCH01_0058_C09.b : aaagccctttttaaagccctttgcccggtgttcttttgttgggcaaaattttccggtggg
SKNB1_0064_C02.b : AAAAAGCCATTTTTA*GAGCCTATTGCACTGTG*TTtcttctgtggcaacattttctgtg
LNG01_0110_D02.b : AAAAAGCCATTTTTA*GAGCCCTATGCACTGTG*TTTCTCTGTTGGCAAC*ATTTTCATG
MLN01_0004_D01.b : TAAAAGGCATTTTTA*GAGCCTA*TGCACTGTG*TTCTTCTGTTGGCAAACATTTTCATG
MLN01_0057_C01.b : AAAAAGCCATTTTTA*GAGCCTATTGCACTGTGTTTCTTCTGTTGGCCAACATTTTCATG
TCH01_0067_A04.b : AAAA*GCCATTTTTA*GAGCCTATTGCACTGTG*TTCTTCTGTTGGCAAACATTTTCATG
MLN01_0030_C03.b : AAAAAGCCATTTTTA*GAGCCTATTGCACTGTG*TTCTTCTGTTGGCAAACATTTTCATG
MLN01_0014_E09.b : AGAAAGCCATTTTTA*GAGCCTATAGCACTGTG*TTCTTCTGATGGCAAACATTTTCATG
LNG01_0095_B04.b : AAAAAGCCATTTTTA*GAGCCTATTGCACTGTG*TTCTTCTGTTGGCAAACATTTTCATG
LNG01_0081_A10.b : AAAAAGCCATTTTTA*GAGCCTATTGCACTGTG*TTCTTCTGTTGGCAAACATTTTCATG
BMWN1_0050_C04.b : AAAAAGCCATTTTTA*GAGCCTATTGCACTGTG*TTCTTCTGTTTGGCAACATTTTCATG
LNG01_0087_A08.b : AAAAAGCCATTTTTA*GAGCCTATTGCACTGTG*TTCTTCTGTTGGCAAACATTTTCATG
20110601C-001588 : TGGGAAAATGTGTTTTTCTTCTCACATGACTCCTTGGAATTGATTCTGAGGTGATGGTCT
---------+---------+---------+---------+---------+---------+ 1521
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b : tacccttttttggaaaattttcccctctccgaaaaccaattggtcttt
LNG01_0071_B01.b : ctaccaaaacaaatatcatgtctggtgcactaaaaaaaaaaaagcctttccttggggcca
TCH01_0075_A02.b :
CLNT1_0064_E06.b : ttccctcccacaaaacgccgggtggggggggggtcctcctgggggtgtttccccggggac
THY01_0119_H04.b :
LNG01_0109_C01.b : ccaacattattttggcaattttcccaacccaaaaaaaattttacggttctgtaacagaaa
LNG01_0011_G05.b :
LNG01_0110_D01.b : aattttccccaaccaagaaccaatgcccattgtctgggaaccaaaaaaaaaaaaagcatg
LNG01_0056_B03.b : ggagagcttcccctt
LNG01_0067_D05.b : ggaacagaaaaaaaaagaggttatgggggctaacgggcacccctttagctagttaaggtc
LNG01_0056_H05.b : ttcgaaggaggcc
LNG01_0078_B05.b : cctggaaagattcgggggagggctataccttatttggcaaatttttcccttcccaaataa
LNG01_0088_B08.b : gaacaaatgttctggtccggtacaaacaaaaaaaaaacatctcagagcggcccaatcccg
MLN01_0034_H03.b : aaatttcccccctccaaaaaccaatggcactttctgggaacccatacaaaaaaaaaaggc
LNG01_0091_G07.b : tttccctcatcaataccaatggccagggtcgggaaacaagcaaaaaaaagcatgttcaat
TCH01_0082_F03.b : ttt
SPL01_0005_H05.b :
ADR01_0077_F09.b : ttcccaggaactcttgaaattatctcaagggaggccttacaccttagttgggacaatttt
THY01_0027_E06.b : aaaaaaccccctatttttttggtcaccccgtgttggtgggtttttctctcttttctc
PBL01_0020_B06.b : ccctggaattaattccaagggagggctcaccaccttaattggccaaatttttccccccca
THY01_0042_E02.b : cctcccttccctctctattcattcttcttcttcttctctccttttcttttcctctcttct
THY01_0015_A08.b :
MLN01_0010_B02.b : cccttattggcatttttcccttccaataccaatgtcagggcccggtacacggaaaaaaaa
LNG01_0012_H04.b : gctttaacctttattttgggtcaaatttttttccccctccccccaaaaaaaaca
LNG01_0046_D12.b : tgggaaaaaaattt
TCH01_0103_C11.b : tctctcccagacccctgaaataatcctagggaaggcttacaacttaatttgggcaatttt
LNG01_0103_B09.b : ggtttttcttccccatacccttggaataatctgaggggaggcctaccctttanttgggca
LNG01_0101_A09.b : tggttttcttccactgaccctttgaatgatcgaagggatgtctaacatttattgggtcaa
TCH01_0049_F10.b : aaaaactttttcaggagggaaaagtgatgtttttctttctccatgaaatccgtggaaaat
ADR01_0079_D05.b : ggggaatgtgttnnttctctcactgactcctgggaaatgatctgagggatgtnctagcct
TES01_0111_A05.b : ttcttgtggggaaaaagggttttttctttccccagataccccctggaatttatttctcaa
ADR01_0019_G03.b : gaaatttttcccctttccaagagaccataatctcctgtgcctggttacctcctcaaataa
SPL01_0032_G09.b : gaaatggggtttttcttcccacataccccttgggaatgatttctaaggggagggcctaac
TCH01_0076_F01.b : aaggggtttttcttctcatggatcccttgaaatgattccaagggaagggctaacccttta
SKNB1_0005_E03.b : ggcaaaccattttcctgggggggggaaaagggggtttttctcttcctcacaaggacttcc
TCH01_0003_H06.b : aaggggtttcctcccacatgacccctggaatgattcggaggggagggcctacactttagt
TCH01_0091_G04.b : tggaaaatgtggttttcctctccaatgactccttggaattgatccgaagggatgtcctta
LNG01_0085_E09.b : tccactgactcctggaatgatctgagggatggctaccctttaattgtgcaatttttccct
OVRT1_0059_G12.b : atggtgttttcttcccacatgatccctggaattgaatcggaagggatgcccttaaccctt
OVRT1_0043_H11.b : aatgggttttcctcccccctgacccttggaatgaatccagaagggaggccttaccctttt
MLN01_0077_C06.b : tggtgaaaaagtgttatttttcttcaccataccactttggagattgattccctagagtac
TCH01_0054_G11.b : ttttttataagagcccctatttgtgcccccggtggggattcccttctccggc
TCH01_0058_C09.b : gaaaagggggtttttcctcccccctggaccccctgggaatggttcctgaaggtgagggcc
SKNB1_0064_C02.b : ggaaaatgtgtttttcctctccatgactccttgaattggattctgagggatggtctaagc
LNG01_0110_D02.b : TGGGGAAATGTGTTTTTCTTCTC*CATGACTCCTTGGAATgattctggagtgatggtctg
MLN01_0004_D01.b : TGGGAAAATGTGTTTTTCTTCTCcatgactccttgaattgattctgaggtgagggcctag
MLN01_0057_C01.b : TGGGAAAATGTGTTTTTCTTCTCGCATGACTCCTTGGAAATTGATtcgaaggggagggcc
TCH01_0067_A04.b : TGGGGAAATGTGTTTTTC*TCTCACATGACTCCTTGGAAATTGATCTGAGGTGAGGGTCT
MLN01_0030_C03.b : TGGGAAAATGTGTTTTTC*TCTCACATGACTCCCTGGAA*TGAATCTGAGGTGATGGTCT
MLN01_0014_E09.b : TGGGAAAATGTGATTTTGCTCTCACATGACTCCTTGcaatgattcagaggagatggtctt
LNG01_0095_B04.b : TGGGAAAATGTGTTTTTCTTCTCACATGACTCCTTTGGATTGATTCTGAAGTGATGGTCT
LNG01_0081_A10.b : TGGGAAAATGTGTTTTTCTTCTCACATGACTCCTTGGAAATTGATCTGAAGTGATGGTCT
BMWN1_0050_C04.b : TGGGAAAATGTGTTTTTCTTCTCACATGACTCCTTGGAA*TGATTCTGAAGTGATGGTCT
LNG01_0087_A08.b : TGGGAAAATGTGTTTTTCTTCTCACATGACTCCTTGGAATTGATTCTGAGGTGATGGTCT
20110601C-001588 : TAGCACTTTAGTTTGTGTCAAATTTTTTTCCCCTCTATCTCAGATGTAAGCCAAAATTGG
---------+---------+---------+---------+---------+---------+ 1581
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b : caattt
TCH01_0075_A02.b :
CLNT1_0064_E06.b : aaaatattgccccccccccaccg
THY01_0119_H04.b :
LNG01_0109_C01.b : aaaaaaaaaaaaccatttgttgggggccctaaccggccattcccctttatctttataatt
LNG01_0011_G05.b :
LNG01_0110_D01.b : ttctatggggcccttattcccgg
LNG01_0056_B03.b :
LNG01_0067_D05.b : gggacgttgatgtggccaaaaaaaaaaannttaaaaaaattaactttccattgt
LNG01_0056_H05.b :
LNG01_0078_B05.b : ccaaaggctctggtcctggggtcccattcaaaaaaaaaaaaaaaggccttgtccaacgag
LNG01_0088_B08.b : ggcctacaccctttgaaggccaggtataagcgcgttcccgggaaacggttgaactggatg
MLN01_0034_H03.b : cg
LNG01_0091_G07.b : ggtggccctaatcccaggcccaccaccctttaaggcttagttaaaacgggctttccggaa
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b : ttcccccttcccaaagaaacacaatggtcctcggtttcgggagaaccctgccacaaaaaa
THY01_0027_E06.b :
PBL01_0020_B06.b : cccaaggaaccccaaccc
THY01_0042_E02.b : ctttctatttaattatctaccttctcctcctcttccttctcctcccttcttctctcttct
THY01_0015_A08.b :
MLN01_0010_B02.b : aagcctggccggagcggcccaaacccaggcattccccctttaaagccaagctaaaagggc
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b : tcccccatccccaagtaaccaaatggttttgggttccggggtaacaaaaa
LNG01_0103_B09.b : atttttccccctatcccaagtacccaaatgtctatgtttctcggtaccaattcaaaaaaa
LNG01_0101_A09.b : ttttttccccctccccaagaaaccaaatgcccctgttcctggggaaccatgcaaaaaaaa
TCH01_0049_F10.b : ctatcctcgagggtatcggctctaccacacctactatgcggcatcacatttttttctcct
ADR01_0079_D05.b : ttattggggcaaattttttcccccatcccaagaaacaaaatgttcatgggttcctgggaa
TES01_0111_A05.b : agggtgaggcctatcacctttatattttgtggaaaattttttctctccctctctctcaaa
ADR01_0019_G03.b : aaaaaactttctccttcgtgttacgccctatatatccgggggcatctctcacactctttt
SPL01_0032_G09.b : cacttaattttgtgcaaat
TCH01_0076_F01.b : gtttggtgcaaat
SKNB1_0005_E03.b : ctgggatattgaattctggagggggaatgggtctttaaccaccttttaaattgtggggcc
TCH01_0003_H06.b : tttgtcaaattttttcccccatcccaaagaaaccaaatgggcctcggggttctggggtac
TCH01_0091_G04.b : accttttatttgggcacaattttttcccctcttctccaatgaagccaaattggtctcctt
LNG01_0085_E09.b : ctatccaagaagccaatggctatggtcctggggaaccaggcaaaaaaaaaaagccctggg
OVRT1_0059_G12.b : tagttggggcccattttttttcccccctattccaaaagtaaacccaaatcgccctccggg
OVRT1_0043_H11.b : atttggggcaatttttttcccccattcccaagggaccaaaatcgttcttgtggttcgggg
MLN01_0077_C06.b : gggttttcacactttatattgggtaaataattatttcacccccacgccgaaatacacccc
TCH01_0054_G11.b :
TCH01_0058_C09.b : ctaaccctttaatttgggggcaaatttttttccccctcttcccacaatggaagccaaaat
SKNB1_0064_C02.b : actttagttgggtcaaattttttcccctcatctccaagtaacccaaattgtccacggggt
LNG01_0110_D02.b : cacttaagttgtgtcaaattttttcctctatcccgatgtaaccaaaatggtctatgtgtc
MLN01_0004_D01.b : cactttagtttgtgtccaaatttttcccctctacccgaaggtaacccaaaatggttctac
MLN01_0057_C01.b : taagccctttagtttgggtccaaattttttcccctccatcccaaaaggaacccaaaatgg
TCH01_0067_A04.b : TAGCACTTTAGTTTGGTGTCAATTTTTTTCCCCTCTATCTCAGATGTAAGCCAAAATTGG
MLN01_0030_C03.b : TAGCACTTTAGTT*GTGTCAAAATTTTTTCCCCTCTATCTCAAATGTAAAGCCAAATTGG
MLN01_0014_E09.b : agcactttagtttgtgtcacattttgtaccctctatctcagatgtagccaaaattggcta
LNG01_0095_B04.b : TAACACTTTAGTTTGTGGTCAATTTTTTTCCCCTCTATCTCAGATGTAAGCCCAAATTGG
LNG01_0081_A10.b : TAGCACTTTAGTTTGTGTCAAATTTTTTTCCCCTCTATCTCAGATGTAAAGCAAAAATGG
BMWN1_0050_C04.b : TAGCACTTTAGTTTGTGTCAAATTTTTTTC*CCTCTATCTCAAT**GTAACCAAAATTGG
LNG01_0087_A08.b : TAGCACTTTAGTTTGTGTCAAATTTTTTTCCCCTCTATCTCAGATGTAAGCCAAAATTGG
20110601C-001588 : TCTACTGTGTCTCTGGGGTAAGCACAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
---------+---------+---------+---------+---------+---------+ 1641
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b : tgcgcccctcaattcccgggggcaatacccaccctttgaaaaggcctagaaaataaaagg
LNG01_0088_B08.b : accaaagaatatgaacccgggnnaaaaaaatttttnnnnntattttccaattattaccgg
MLN01_0034_H03.b :
LNG01_0091_G07.b : acgggttaaatttgggacacaacaaaattaaacgcnnnnnaaaaannnttttttnnnttt
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b : aaaaaagcgccctggttctctcggtgc
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b : taac
THY01_0015_A08.b :
MLN01_0010_B02.b : ttaccgggaagtggttgacttgggtgacaaaaaaataaaaacccgtggnaaaaaaanttt
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b : aaaaaaggcctgtttcggcgcggccggccctcaaattctcggggcccctcccaccctctt
LNG01_0101_A09.b : aaaagcccttgcctaatctagcggccctcaaataccttagggccattccccacccttttt
TCH01_0049_F10.b : ctcaatccttcgatgattaacccaaat
ADR01_0079_D05.b : cccatggcaaaaaaaaaaaaaagggccctgcttcactggggcgggccctaaaattctcgg
TES01_0111_A05.b : gatagacaccaaatgggcaatctgtggttcctgggggggaaccccgttgtcacaaaaaaa
ADR01_0019_G03.b : atggctctaatgatatatacaccctcctttcctcttgataacatctgttttgaaactctt
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b : aaaatttttatttcccccc
TCH01_0003_H06.b : cccatggcaaaaaaaaaaaaaaaaaggg
TCH01_0091_G04.b : ggttctgggggtaccccaagacaaaaaaaaaaaaaaaaaaggcccacgggcccaactgca
LNG01_0085_E09.b : ccaaccggtcggcgctaaatcctaggggcacttaccacacctttgtgaaaggccctagga
OVRT1_0059_G12.b : ttttcttgggggaaaccccttgccaaaaaaaaaaaaaaaaaaagagcccttgtggtccca
OVRT1_0043_H11.b : gaaccccagccaaaaaaaaaaaaaaaggccctgtgtccaatgtggggggggccctaaaat
MLN01_0077_C06.b : atatgttcttcctgtgctactcgggcgatacctcttgctactaaaataacataacgtgtt
TCH01_0054_G11.b :
TCH01_0058_C09.b : tgggcctccgtgggccctggggaaacccccagggcacaaaaaaaa
SKNB1_0064_C02.b : cctcgggtagccccatggcaaaaaaaaaaaaaaagggccctgtggtcagatccagtccgg
LNG01_0110_D02.b : ctggggtacccatgacaaaaaaaaaaaaaaaggccctggccaagctgagtcgccgcctaa
MLN01_0004_D01.b : gggttcctggggtagcccatggacaaaaaaaaaaaaaaaaagcccaaggtcttcaacttc
MLN01_0057_C01.b : tctactgggtccctgggggtagcccaatggccaaaaaaaaaaaaaaaaaaaaaaggccca
TCH01_0067_A04.b : TCTACTGGTGTCTCTGGGGGTAGCCAATGGCCaaaaaaaaaaaaaaaaaaaagggccaat
MLN01_0030_C03.b : TCTACTGTGTCTCTGGGGGTAGCCCAATGACCAAAAAAAAAAAAAAAAAxxxxxxxxxxx
MLN01_0014_E09.b : ctgtgtctctggggtagcacatgacaagaaacaaaacaaaaaaatgttctcactacttga
LNG01_0095_B04.b : TCTAC*GGTGTCTCTGGGGTAGCACAATGACaaaaaaaaaaaaaaaaaaaaaaggcacat
LNG01_0081_A10.b : TCTACTG*TGTCTCTGGGGTAGCACAATGACaaaaaaaaaaaaaaaaaaaaggxxxxxxx
BMWN1_0050_C04.b : TCTACTG*TGTCTCTGGGGTAAGCACATGACaaaaaaaaaaaaaaaaaaaaggtgttccc
LNG01_0087_A08.b : TCTACTGTGTCTCTGGGGTAAGCACAATGACaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
20110601C-001588 : TGTTTCTCACTACTTCTGAGACTTTGTCCCAGTGTACAGAATTCTGCAATTCTGACACTC
---------+---------+---------+---------+---------+---------+ 1701
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b : ccgcgttttacgggggaaaatt
LNG01_0088_B08.b : cagaggnnnnnnnt
MLN01_0034_H03.b :
LNG01_0091_G07.b : tttacattattcgtcgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b : nnnnnnnaaaatccaattatttacaaatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b : ttaaaggcccaagggcataaatcaagcggcctttaaccccggaaatccttgttttgaaat
LNG01_0101_A09.b : aaaggtcctatagccataaagagggccgctttcacctccggaaaaacctgatttagaaac
TCH01_0049_F10.b :
ADR01_0079_D05.b : ggccagtaccgaccccttttggaagggccaaggaggatataaaggcccgcgttacaccgg
TES01_0111_A05.b : taataaaaataaagagccctttgtttcttaattgtgggtgccgccctcataataa
ADR01_0019_G03.b : ctgggatgtaactaacatatgatata
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b : gccgcgcccctctaaatccctgggggccagtttacggcccattttttgtaaaggcgccta
LNG01_0085_E09.b : ggaaaaacaagcggcgtttaaacctcgggaagccttggatttaaaactttcggggaatgg
OVRT1_0059_G12.b : aactgggaggccggg
OVRT1_0043_H11.b : ttttaaaaacccccccccccccgaaaaaaaaaaaagaaaaaatttttttaa
MLN01_0077_C06.b : ctatgtgtctcaatttttggagtcggccctctatatctattcttcggaggatcactctct
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b : ccccaaaaaatccaaaaaaaacccccccccccccc
LNG01_0110_D02.b : attccctcagggcaagttacctacagcttttgtaaaggtcccaggggcaattagcagccg
MLN01_0004_D01.b : aggtcggcccctttagaattcctcggggggcacagttaacggaccagctttttgtaaaga
MLN01_0057_C01.b : atttgctccaacttcaggtcccggccccctttaagtttccctcgaggggccaaagttaaa
TCH01_0067_A04.b : tgtgctcaaccttcaggttccgcccccttataatatccctcggggggccaaacctatacg
MLN01_0030_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0014_E09.b : aatttgtccatgaaaaaatttgcatttcgacctctaataatgaaagggtgctgctacacc
LNG01_0095_B04.b : gtgctcaagctgcagtcgcgggcgctctaaatatcctcgaggggccaagctaccgtaacc
LNG01_0081_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0050_C04.b : actactttgaaacttggtccgggtgaagaattctgcaatccgaaactctaattaaggaaa
LNG01_0087_A08.b : TGTTTCTCACTACTTCTGAGACTTTGTCCCAGTGTACAGAATTCTGCAATTCTGACACTC
20110601C-001588 : TAATTATATGAGAAGGGTTGCTGCTATCAGCCTTGCCTACTGTGACATCTCCNAAGCCAG
---------+---------+---------+---------+---------+---------+ 1761
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b : nn
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b : ctttggggtgccccccaatcccgaaaatttnagtaaccccctttgtaaaaaaaattatcn
LNG01_0101_A09.b : tttggggatgcaccccaaaacccgaaaattttttggtacccccccggtttcaataaaaca
TCH01_0049_F10.b :
ADR01_0079_D05.b : gggaccacttgatttggaaactcttggaatggaaaccaaaaaacagaaaataa
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b : g
LNG01_0085_E09.b : aaccccgataccggaaaaatttgtaggtaccccccctgtgtttgattaataacggagttt
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b : tatctctacctttttttagtaaaggtgctcatagtggagtggttaattgtccgccatgcg
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b : gcccctttaccctgaggaaagctattggatttaaacctcttgggggcatggacccccgat
MLN01_0004_D01.b : gggcccaaagaggg
MLN01_0057_C01.b : cctatcacactttcgtgtaaaaga
TCH01_0067_A04.b : gtaccagctttctggtaaaaggggcccatatagggat
MLN01_0030_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0014_E09.b : tgctactggaatctcaagccaggaaaccgttaaaggccaacctgtgtaaagctcaaggtc
LNG01_0095_B04.b : cactttcttgacaagggtcccaaagggagcgataaaaccaggctgggcgtgtttacaatc
LNG01_0081_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0050_C04.b : aggttggtgccatcaccttgcctaggtgaatccccaacccagaaaaatcgataaatgccc
LNG01_0087_A08.b : TAATTATATGAGAAGGGTTGCTGCTATCAGCCTTGCCTACTGTGACATCTCCNAAGCCAG
20110601C-001588 : GAAGAACTCGATCAAAATGCCCCAACACTGTGATTAGAGCATCCAGATGGTGCCCATGAG
---------+---------+---------+---------+---------+---------+ 1821
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b : nnnnnnnnnnnnnntnnnnttannnnccacaatcacgtacgacatatgtagtgcgnnnnn
LNG01_0101_A09.b : attttttcgcgcccccnnnnnnnnnnnnnncccnnnnnnnnnccctttgtttagtttatc
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b : gttatccgtgccctgctacttgttttccccccaagggtgtttaaatatcttgtctgccgg
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b : ctctctca
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b : agccggaaaatttgtgggtaaccctctgcgatgtctgaataaataaaagaatttttatca
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaattcggggggg
MLN01_0014_E09.b : ctgaaactaaggagtttcaaaaccctggtccttcccagtaaaaaggatttaacctcttat
LNG01_0095_B04.b : cgactggaaaacgcactggatttttgaagaactttttgggtggactatttgacaacccaa
LNG01_0081_A10.b : xxxxxxxxxxxxxxxxxxgcactgggattttgtgagaacctactctggggggcatatttg
BMWN1_0050_C04.b : cacctggaataaacctccaatggggcgaaaaacaaaagggggtttcaaaaccctagggcc
LNG01_0087_A08.b : GAAGAACTCGATCAAAATGCCCCAACACTGTGATTAGAGCATCCAGATGGTGCCCATGAG
20110601C-001588 : AACTAGAGGGCAGGTTTTCACAAAAGCCCCTAGGGCTCC.....................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0101_A09.b : tgttaacacnnnnnnnnnnnnnnnnccnnnnnnnnt
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b : gcg
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b : gctccccctttaacaagtgttaacccccaat
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b : gcaattggacaactccccacaaattagcccctaggaaattaaatttttagggtaaggggt
MLN01_0014_E09.b : gaccaactggagttcccctaactttggttctgttacctatccctcggaaatgggaagggg
LNG01_0095_B04.b : gaatttaacccaggaaataaatttagggaagggtaaaaccgccacctcgcggagattttc
LNG01_0081_A10.b : aaaacactaaaaaattaagcccagggaaaaaattttaagttaagggtaaccacgcaacct
BMWN1_0050_C04.b : ctccccggttggaacgggagtgtaacccttcctggccccccactgggggttctcaccaaa
LNG01_0087_A08.b : AACTAGAGGGCAGGTTTTCACAAAAGCCCCTAGGGCTCCcttccccccagtgtaggagac
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b : aaacacccccacctgcgcgtagaattcctccgaatattttaaaatttacccggcccggct
MLN01_0014_E09.b : attttgtttttatactttaaaaatttgtccaattcccgggggtttaaaaattttgaaaaa
LNG01_0095_B04.b : gggaaattaaaataacggcgcggttttttgtgttttattcccaggttttgccccccccgt
LNG01_0081_A10.b : ccgcctgaaattttctcgattaatttaaaattaaccgggccgggcctttttgttttaata
BMWN1_0050_C04.b : tttgtcgtcgggaaaccgcctccccccgaaaaggggaaagggcttttttttgttttattt
LNG01_0087_A08.b : agggatgttgatagcccctctctcactgcagccaccagcactgggtcagtcattctcagc
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b : tttttttgttttttactcccccgctt
MLN01_0014_E09.b : aaaaaaaaaagccggccctccggcccctttccttatagccccggnnnggggaaaaataat
LNG01_0095_B04.b : gttttacccccttgagtttgttaaccccccccaaaaaaaagtggtttttgtataaaaaat
LNG01_0081_A10.b : aacccgggttttggccctcccccttgtgtaaaaccccacttaggttggttaaaccccccc
BMWN1_0050_C04.b : ttttgtaaatatttttacattttcccggggttttaaaaaattttatgaaaaaaaaaaaaa
LNG01_0087_A08.b : cttaaccttttttcgctgtcctgtgtcaaagccttgaactcaccctctccgaaaaatatg
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b : tgtatatctattnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0095_B04.b : aaatttttgtcttcttttaccnnnnnnnnnnncggggggggcccgctaatctaaaagann
LNG01_0081_A10.b : cacgaaaaaat
BMWN1_0050_C04.b : aannannnnnnngccccccggaaaaaaaaaaatagattaacagcgtggcggcgcgcgccg
LNG01_0087_A08.b : tggccaaaanggggccatttttttggtgtggtttttaatgaaaacctttggaggacaaac
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0095_B04.b : nnnnnnnnnnnnnncnnnnnnnt
LNG01_0081_A10.b :
BMWN1_0050_C04.b : ccgggnnnnnnnannnnnnnnnnnnt
LNG01_0087_A08.b : aaatttgaactaaccaattaatttcccccgttggggattcttgaaaaaaaaaaaaatttt
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b : taataaaaaaaaaaaggccctttccaacccggtccgcccccaaaatcccggggccaatac
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b : n
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b : caccacttttgtaaagtcctaaggcattaacaaccgccctttccctgcgaaaccattatt
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b : ttgaacttcggggctgacacccaaacccaaaattaatgaccctcgtggttaaatattagt
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b : cctnnnnnnnnnttannntcttctacagtcccctgcnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-001588 : ............................................................
---------+---------+---------+---------+---------+---------+ 1860
TCH01_0058_B08.b :
SPL01_0081_H04.b :
TCH01_0066_A08.b :
TCH01_0100_G02.b :
TCH01_0026_G08.b :
KDN01_0086_D01.b :
LNG01_0071_B01.b :
TCH01_0075_A02.b :
CLNT1_0064_E06.b :
THY01_0119_H04.b :
LNG01_0109_C01.b :
LNG01_0011_G05.b :
LNG01_0110_D01.b :
LNG01_0056_B03.b :
LNG01_0067_D05.b :
LNG01_0056_H05.b :
LNG01_0078_B05.b :
LNG01_0088_B08.b :
MLN01_0034_H03.b :
LNG01_0091_G07.b :
TCH01_0082_F03.b :
SPL01_0005_H05.b :
ADR01_0077_F09.b :
THY01_0027_E06.b :
PBL01_0020_B06.b :
THY01_0042_E02.b :
THY01_0015_A08.b :
MLN01_0010_B02.b :
LNG01_0012_H04.b :
LNG01_0046_D12.b :
TCH01_0103_C11.b :
LNG01_0103_B09.b :
LNG01_0101_A09.b :
TCH01_0049_F10.b :
ADR01_0079_D05.b :
TES01_0111_A05.b :
ADR01_0019_G03.b :
SPL01_0032_G09.b :
TCH01_0076_F01.b :
SKNB1_0005_E03.b :
TCH01_0003_H06.b :
TCH01_0091_G04.b :
LNG01_0085_E09.b :
OVRT1_0059_G12.b :
OVRT1_0043_H11.b :
MLN01_0077_C06.b :
TCH01_0054_G11.b :
TCH01_0058_C09.b :
SKNB1_0064_C02.b :
LNG01_0110_D02.b :
MLN01_0004_D01.b :
MLN01_0057_C01.b :
TCH01_0067_A04.b :
MLN01_0030_C03.b :
MLN01_0014_E09.b :
LNG01_0095_B04.b :
LNG01_0081_A10.b :
BMWN1_0050_C04.b :
LNG01_0087_A08.b : nn