[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001686

Length: 1,248

Sequence [FASTA format sequence]
CTGGGAGCGG AATGCGCAGC TGCGCGGGGA CGCGGCTCGC CCCACCCCCG CCGCTGGTTC
TATTTTGTCA ACTTCCCTGG GCGGGACTGG CCTTGGAACC TGGTCTGCAC ATGCGGGCGG
CGGGGCAGTT ACTGAGGGCC TGTTCCCAGA CGTGGAAGTC GGTGCGGATG GCCAGCACCG
GGGTGGAGCG CCGAAAACCG CTGGAGAATA AGGTGGCACT AGTAACAGCC TCCACTGACG
GGATCGGCCT CGCCATCGCC CGGCGTCTGG CCCAGGATGG GGCCCACGTG GTGGTCAGCA
GCCGGAAGCA GGAGAATGTG GACCGGACAG TGGCAACACT GCAGGGGGAG GGGCTGAGCG
TGACGGGCAC CGTGTGCCAC GTGGGGAAGG CCGAGGACCG GGAGCGACTG GTGGCCATGG
CTGTGAACCT TCACGGGGGC GTGGACATCC TGGTCTCCAA TGCAGCCGTC AACCCATTCT
TTGGAAACAT CATAGATGCC ACTGAGGAGG TGTGGGACAA GATTCTGCAC GTTAACGTGA
AGGCCACAGT CCTGATGACA AAGGCAGTGG TGCCGGAGAT GGAGAAACGA GGAGGCGGCT
CAGTGTTGAT CGTGTCCTCC GTTGGAGCCT ACCACCCATT TCCCAATCTG GGCCCTTACA
ATGTTAGTAA AACAGCCTTG CTGGGCCTCA CCAAGAACCT GGCCGTAGAG CTGGCCCCAA
GGAACATTAG GGTGAACTGC CTGGCGCCTG GACTCATCAA GACTAACTTC AGCCAGGTGT
TGTGGATGGA TAAGGCAAGA AAGGAGTACA TGAAAGAAAG CTTGCGAATC AGAAGGTTAG
GCAATCCAGA GGACTGTGCG GGCATCGTGT CTTTCCTATG CTCTGAAGAT GCCAGCTACA
TCACTGGGGA GACAGTGGTA GTGGGTGGAG GGACCGCATC CCGCCTCTGA GGACCTGGAG
AGCATCCACC AGGGCAGAGA TTGGGCTCCA GCTCCTGTTC CAGCATTCAT CAACTGGTTT
CCCACCTCTG CCTAGCATTC TGCTCACAAT ACACCATAAC CCCTACCCAC CCCCCCCAAA
TCAGTTCTGC CCTGTGAAAA GAGCCAGCGT CCTTGTCCTC TGCTGTCAAG CTGTGGTCTA
ATGAGGATTT TCCCTGTTGC TGTAGCCTTC AATAAGACCT CCCCTGAAAC CCAAAAAAAA
AAAAAAAAAA AAAAATTCTC CTTTTCCAAG ATCCAAAAAA AAAAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRS4dehydrogenase/reductase SDR family member 4 [Homo sapiens]. 403e-112O
Contig/Assembly ProteinDHRS4L1putative dehydrogenase/reductase SDR family member 4-like 2 [Homo sapiens]. 3324e-91O
Contig/Assembly ProteinDHRS4L2dehydrogenase/reductase SDR family member 4-like 2 isoform 1 precursor [Homo sapiens]. 2994e-83O
Contig/Assembly ProteinDHRS2dehydrogenase/reductase SDR family member 2 isoform 2 [Homo sapiens]. 2889e-78O
Contig/Assembly ProteinDHRS2dehydrogenase/reductase SDR family member 2 isoform 1 [Homo sapiens]. 2524e-71O
Contig/Assembly ProteinDHRS4L2dehydrogenase/reductase SDR family member 4-like 2 isoform 2 [Homo sapiens]. 1762e-46O
Contig/Assembly ProteinDHRS4L2dehydrogenase/reductase SDR family member 4-like 2 isoform 3 [Homo sapiens]. 1541e-39O
Contig/Assembly ProteinPECRperoxisomal trans-2-enoyl-CoA reductase [Homo sapiens]. 91.32e-18O
Contig/Assembly ProteinHSD17B8estradiol 17-beta-dehydrogenase 8 [Homo sapiens]. 85.11e-16O
Contig/Assembly ProteinBDH23-hydroxybutyrate dehydrogenase type 2 [Homo sapiens]. 83.64e-16O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDhrs4dehydrogenase/reductase SDR family member 4 isoform 1 [Mus musculus]. 391e-109O
Contig/Assembly ProteinDhrs2dehydrogenase/reductase member 2 [Mus musculus]. 2702e-72O
Contig/Assembly ProteinDhrs4dehydrogenase/reductase SDR family member 4 isoform 2 [Mus musculus]. 2463e-65O
Contig/Assembly ProteinPecrperoxisomal trans-2-enoyl-CoA reductase [Mus musculus]. 1028e-22O
Contig/Assembly ProteinBdh23-hydroxybutyrate dehydrogenase type 2 isoform 1 [Mus musculus]. 82.47e-16O
Contig/Assembly ProteinBdh23-hydroxybutyrate dehydrogenase type 2 isoform 2 [Mus musculus]. 82.47e-16O
Contig/Assembly ProteinDhrs11dehydrogenase/reductase SDR family member 11 precursor [Mus musculus]. 82.47e-16O
Contig/Assembly ProteinCbr2carbonyl reductase [NADPH] 2 [Mus musculus]. 829e-16O
Contig/Assembly ProteinH2-Ke6estradiol 17-beta-dehydrogenase 8 [Mus musculus]. 81.61e-15O
Contig/Assembly ProteinDcxrL-xylulose reductase [Mus musculus]. 78.61e-14O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRS4dehydrogenase/reductase SDR family member 4 [Canis lupus familiaris]. 380e-105O
Contig/Assembly ProteinLOC490616PREDICTED: similar to dehydrogenase/reductase (SDR family) member 2 isoform 2 [Canis familiaris]. 3132e-85
Contig/Assembly ProteinLOC490617PREDICTED: similar to dehydrogenase/reductase member 2 [Canis familiaris]. 2711e-72O
Contig/Assembly ProteinLOC478901PREDICTED: similar to peroxisomal trans-2-enoyl-CoA reductase isoform 2 [Canis familiaris]. 94.72e-19O
Contig/Assembly ProteinTERPPREDICTED: similar to peroxisomal trans-2-enoyl-CoA reductase [Canis familiaris]. 94.42e-19O
Contig/Assembly ProteinLOC478497PREDICTED: similar to dehydrogenase/reductase (SDR family) member 6 [Canis familiaris]. 85.97e-17O
Contig/Assembly ProteinLOC607806PREDICTED: similar to Lung carbonyl reductase [NADPH] (NADPH-dependent carbonyl reductase) (LCR) (Adipocyte P27 protein) (AP27) [Canis familiaris]. 84.72e-16O
Contig/Assembly ProteinLOC477352PREDICTED: similar to carbonic reductase 4 [Canis familiaris]. 83.64e-16O
Contig/Assembly ProteinLOC491129PREDICTED: similar to short-chain dehydrogenase/reductase isoform 1 [Canis familiaris]. 80.14e-15O
Contig/Assembly ProteinHSD17B1417-beta-hydroxysteroid dehydrogenase 14 [Canis lupus familiaris]. 79.75e-15O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRS4dehydrogenase/reductase SDR family member 4 [Bos taurus]. 376e-104O
Contig/Assembly ProteinDCXRL-xylulose reductase [Bos taurus]. 90.53e-18O
Contig/Assembly ProteinDCXRL-xylulose reductase-like [Bos taurus]. 86.35e-17O
Contig/Assembly ProteinHSD17B8estradiol 17-beta-dehydrogenase 8 [Bos taurus]. 843e-16O
Contig/Assembly ProteinCBR4carbonyl reductase family member 4 [Bos taurus]. 81.32e-15O
Contig/Assembly ProteinBDH23-hydroxybutyrate dehydrogenase type 2 [Bos taurus]. 80.92e-15O
Contig/Assembly ProteinDHRS11dehydrogenase/reductase SDR family member 11 precursor [Bos taurus]. 78.61e-14O
Contig/Assembly ProteinHSD17B1417-beta-hydroxysteroid dehydrogenase 14 [Bos taurus]. 77.42e-14O
Contig/Assembly ProteinDECR12,4-dienoyl-CoA reductase, mitochondrial [Bos taurus]. 75.97e-14O
Contig/Assembly ProteinHSD17B4peroxisomal multifunctional enzyme type 2 [Bos taurus]. 74.32e-13O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRS4dehydrogenase/reductase SDR family member 4 [Sus scrofa]. 457e-129O
Contig/Assembly ProteinLOC100153608PREDICTED: carbonyl reductase family member 4-like [Sus scrofa]. 87.41e-17O
Contig/Assembly ProteinCBR2carbonyl reductase [NADPH] 2 [Sus scrofa]. 872e-17O
Contig/Assembly ProteinHSD17B8estradiol 17-beta-dehydrogenase 8 [Sus scrofa]. 83.62e-16O
Contig/Assembly ProteinLOC100522692PREDICTED: 3-hydroxybutyrate dehydrogenase type 2-like isoform 2 [Sus scrofa]. 82.45e-16O
Contig/Assembly ProteinLOC100522692PREDICTED: 3-hydroxybutyrate dehydrogenase type 2-like isoform 1 [Sus scrofa]. 82.45e-16O
Contig/Assembly ProteinLOC100513307PREDICTED: dehydrogenase/reductase SDR family member 11-like [Sus scrofa]. 75.94e-14
Contig/Assembly ProteinDECR12,4-dienoyl-CoA reductase, mitochondrial [Sus scrofa]. 71.21e-12O
Contig/Assembly ProteinLOC100513224PREDICTED: testosterone 17-beta-dehydrogenase 3-like [Sus scrofa]. 70.52e-12O
Contig/Assembly ProteinLOC100517329PREDICTED: LOW QUALITY PROTEIN: retinol dehydrogenase 8-like [Sus scrofa]. 69.73e-12O


Assembly Members: 711      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010007C04ADR01_0007_C04.bDB782124 
ADR010092F05ADR01_0092_F05.bDB789690 
CLNT10055E12CLNT1_0055_E12.bFS661414 
CLNT10067B12CLNT1_0067_B12.bFS662323 
CLNT10100C05CLNT1_0100_C05.bFS664325 
ITT010031H03ITT01_0031_H03.bBW978831 
ITT010071A02ITT01_0071_A02.bBW982283 
ITT010081E03ITT01_0081_E03.bBW983205 
LVR010002B06LVR01_0002_B06.bBP442248 
LVR010015E02LVR01_0015_E02.bBP444657 
LVR010016E09LVR01_0016_E09.bBP445138 
LVR010028B08LVR01_0028_B08.bBP442419 
LVR010030F08LVR01_0030_F08.bBP445959 
LVR010039H11LVR01_0039_H11.bBP448019 
LVR010088F05LVR01_0088_F05.bCJ000478 
LVR010090A01LVR01_0090_A01.bCJ000597 
LVR010097C11LVR01_0097_C11.bBP443591 
LVR010097D11LVR01_0097_D11.bBP444479 
OVR010004H02OVR01_0004_H02.bBP144431 
OVR010030H02OVR01_0030_H02.bBP144453 AK234231
OVR010034H06OVR01_0034_H06.bBP144606 
OVR010043F06OVR01_0043_F06.bBP143703 
OVR010070D12OVR01_0070_D12.bBW965857 
OVR010086D04OVR01_0086_D04.bBW967080 AK394982
OVR010102F09OVR01_0102_F09.bBW968333 
OVRM10015G07OVRM1_0015_G07.bBP153002 
OVRM10224G09OVRM1_0224_G09.bBP461121 AK348663
OVRT10017D11OVRT1_0017_D11.bFS687790 
OVRT10034E04OVRT1_0034_E04.bFS689166 
OVRT10048E08OVRT1_0048_E08.bFS690327 
PST010032B05PST01_0032_B05.b  
SMG010018E09SMG01_0018_E09.bFS714831 
SMG010019G11SMG01_0019_G11.bFS714947 
SMG010047D04SMG01_0047_D04.bFS717370 
SMG010052G07SMG01_0052_G07.bFS717829 
SMG010060D05SMG01_0060_D05.bFS718452 
SPL010022B06SPL01_0022_B06.bBP157146 
TCH010029C01TCH01_0029_C01.bCJ024572 
TCH010030F07TCH01_0030_F07.bCJ024680 
TCH010045G09TCH01_0045_G09.bCJ025825 
TCH010069B06TCH01_0069_B06.bCJ027354 
TCH010071A12TCH01_0071_A12.bCJ027504 
TCH010085B04TCH01_0085_B04.bCJ028585 
TES010001C04TES01_0001_C04.bCJ030038 
TES010001F11TES01_0001_F11.bCJ030070 
TES010001G12TES01_0001_G12.bCJ030078 
TES010001H07TES01_0001_H07.bCJ030083 
TES010002C05TES01_0002_C05.bCJ030103 
TES010002E09TES01_0002_E09.bCJ030122 
TES010002H04TES01_0002_H04.bCJ030147 
TES010002H05TES01_0002_H05.bCJ030148 
TES010002H10TES01_0002_H10.bCJ030153 
TES010003E10TES01_0003_E10.b  
TES010003F09TES01_0003_F09.bCJ030199 
TES010003F10TES01_0003_F10.bCJ030200 
TES010003G05TES01_0003_G05.bCJ030206 
TES010003G12TES01_0003_G12.bFS722154 
TES010003H11TES01_0003_H11.bCJ030217 
TES010004A08TES01_0004_A08.bCJ030225 
TES010004A10TES01_0004_A10.bCJ030227 
TES010004D06TES01_0004_D06.bCJ030251 
TES010005A10TES01_0005_A10.bCJ030295 
TES010005A12TES01_0005_A12.bCJ030297 
TES010005B12TES01_0005_B12.bCJ030306 
TES010005C03TES01_0005_C03.bCJ030309 
TES010005C07TES01_0005_C07.bCJ030312 
TES010005C11TES01_0005_C11.bCJ030316 
TES010005F11TES01_0005_F11.bCJ030345 
TES010005G05TES01_0005_G05.bCJ030350 
TES010005G09TES01_0005_G09.bCJ030353 
TES010006B04TES01_0006_B04.b  
TES010006B09TES01_0006_B09.bCJ030378 
TES010006E09TES01_0006_E09.bCJ030405 
TES010006F06TES01_0006_F06.bCJ030414 
TES010006H10TES01_0006_H10.bCJ030426 
TES010007B07TES01_0007_B07.bCJ030444 
TES010007B10TES01_0007_B10.bCJ030446 
TES010007B11TES01_0007_B11.bCJ030447 
TES010007G04TES01_0007_G04.bCJ030481 
TES010007H05TES01_0007_H05.bCJ030493 
TES010008A09TES01_0008_A09.bCJ030503 
TES010008C01TES01_0008_C01.bCJ030513 
TES010008C07TES01_0008_C07.bCJ030517 
TES010008E02TES01_0008_E02.bCJ030531 
TES010008F03TES01_0008_F03.b  
TES010008F05TES01_0008_F05.bCJ030540 
TES010008F06TES01_0008_F06.bCJ030541 
TES010009B04TES01_0009_B04.bCJ030575 
TES010009D08TES01_0009_D08.bCJ030598 
TES010009E03TES01_0009_E03.bCJ030603 
TES010009E05TES01_0009_E05.bCJ030605 
TES010009E08TES01_0009_E08.bCJ030608 
TES010009E11TES01_0009_E11.bCJ030611 
TES010009F01TES01_0009_F01.bCJ030612 
TES010009F04TES01_0009_F04.bCJ030614 
TES010009F08TES01_0009_F08.bCJ030617 
TES010009G07TES01_0009_G07.bCJ030624 
TES010010A09TES01_0010_A09.bCJ030645 
TES010010C06TES01_0010_C06.bCJ030660 
TES010010E12TES01_0010_E12.bCJ030681 
TES010010F01TES01_0010_F01.bCJ030682 
TES010010G10TES01_0010_G10.bCJ030695 
TES010010H05TES01_0010_H05.bCJ030699 
TES010010H08TES01_0010_H08.bCJ030702 
TES010011A02TES01_0011_A02.bCJ030706 
TES010011B01TES01_0011_B01.bCJ030715 
TES010011G01TES01_0011_G01.bCJ030756 
TES010011G02TES01_0011_G02.bCJ030757 
TES010011G11TES01_0011_G11.bCJ030764 
TES010012D05TES01_0012_D05.bCJ030799 
TES010012F03TES01_0012_F03.bCJ030816 
TES010012G03TES01_0012_G03.bCJ030820 
TES010012G07TES01_0012_G07.bCJ030824 
TES010012H05TES01_0012_H05.b  
TES010012H07TES01_0012_H07.bCJ030832 
TES010012H08TES01_0012_H08.bCJ030833 
TES010013C12TES01_0013_C12.bCJ030861 
TES010013D05TES01_0013_D05.bCJ030866 
TES010013F04TES01_0013_F04.bCJ030884 
TES010013G07TES01_0013_G07.bCJ030896 
TES010013G09TES01_0013_G09.bCJ030897 
TES010013H09TES01_0013_H09.bCJ030908 
TES010014A04TES01_0014_A04.bCJ030914 
TES010014B04TES01_0014_B04.bCJ030922 
TES010014B08TES01_0014_B08.b  
TES010014C02TES01_0014_C02.bCJ030928 
TES010014C07TES01_0014_C07.bCJ030931 
TES010014D04TES01_0014_D04.bCJ030937 
TES010014D11TES01_0014_D11.bCJ030943 
TES010014D12TES01_0014_D12.bCJ030944 
TES010014E10TES01_0014_E10.bCJ030950 
TES010014E12TES01_0014_E12.bCJ030951 
TES010014G10TES01_0014_G10.bFS722164 
TES010014H04TES01_0014_H04.bCJ030971 AK398140
TES010014H08TES01_0014_H08.bCJ030975 
TES010015B04TES01_0015_B04.bCJ030989 
TES010015C05TES01_0015_C05.bCJ030999 
TES010015C12TES01_0015_C12.bCJ031004 
TES010015E09TES01_0015_E09.bCJ031019 
TES010015F10TES01_0015_F10.bCJ031028 
TES010015G03TES01_0015_G03.bCJ031032 
TES010015G10TES01_0015_G10.bCJ031037 
TES010016B04TES01_0016_B04.bCJ031059 
TES010016B12TES01_0016_B12.bCJ031063 
TES010016D01TES01_0016_D01.bCJ031072 
TES010016D10TES01_0016_D10.bCJ031076 
TES010016E01TES01_0016_E01.bCJ031079 
TES010016F01TES01_0016_F01.bCJ031087 
TES010016G02TES01_0016_G02.bCJ031096 
TES010016G04TES01_0016_G04.bCJ031098 
TES010016G08TES01_0016_G08.bCJ031101 
TES010016G09TES01_0016_G09.bCJ031102 
TES010017D01TES01_0017_D01.bCJ031140 
TES010017D03TES01_0017_D03.bCJ031141 
TES010017E06TES01_0017_E06.bCJ031150 
TES010017E10TES01_0017_E10.bCJ031152 
TES010017F05TES01_0017_F05.bCJ031156 
TES010017H12TES01_0017_H12.bCJ031180 
TES010018A01TES01_0018_A01.bCJ031181 
TES010018A08TES01_0018_A08.bCJ031187 
TES010018B08TES01_0018_B08.bCJ031195 
TES010018F09TES01_0018_F09.bCJ031232 
TES010018H02TES01_0018_H02.bCJ031241 
TES010018H04TES01_0018_H04.bCJ031243 
TES010018H11TES01_0018_H11.bCJ031249 
TES010019B07TES01_0019_B07.bCJ031264 
TES010019C07TES01_0019_C07.bCJ031274 
TES010019D10TES01_0019_D10.b  
TES010019F09TES01_0019_F09.bCJ031297 
TES010019F10TES01_0019_F10.bCJ031298 
TES010019F11TES01_0019_F11.bCJ031299 
TES010019G01TES01_0019_G01.bCJ031300 
TES010019G09TES01_0019_G09.bFS722172 
TES010020A07TES01_0020_A07.b  
TES010020A11TES01_0020_A11.bCJ031319 
TES010020B01TES01_0020_B01.bCJ031321 
TES010020C03TES01_0020_C03.bCJ031331 
TES010020G09TES01_0020_G09.bCJ031368 
TES010020H09TES01_0020_H09.bCJ031375 
TES010021B12TES01_0021_B12.bCJ031393 
TES010021E03TES01_0021_E03.bCJ031412 
TES010021E05TES01_0021_E05.b  
TES010021E11TES01_0021_E11.b  
TES010021H03TES01_0021_H03.bCJ031434 
TES010022B10TES01_0022_B10.bCJ031456 
TES010022B11TES01_0022_B11.bCJ031457 
TES010022C01TES01_0022_C01.bCJ031459 
TES010022C10TES01_0022_C10.bCJ031465 AK398163
TES010022G03TES01_0022_G03.bCJ031498 
TES010022G10TES01_0022_G10.bCJ031503 
TES010022H04TES01_0022_H04.bCJ031507 
TES010022H09TES01_0022_H09.bCJ031510 
TES010023A01TES01_0023_A01.bCJ031513 
TES010023B08TES01_0023_B08.bCJ031528 
TES010023B12TES01_0023_B12.bCJ031531 
TES010023C01TES01_0023_C01.bCJ031532 
TES010023D09TES01_0023_D09.bCJ031550 
TES010023E05TES01_0023_E05.bCJ031556 
TES010023F03TES01_0023_F03.bFS722176 
TES010023G09TES01_0023_G09.bCJ031572 
TES010024A11TES01_0024_A11.bCJ031593 
TES010024C12TES01_0024_C12.bCJ031607 
TES010024E06TES01_0024_E06.bCJ031623 
TES010024F10TES01_0024_F10.bCJ031633 
TES010024G05TES01_0024_G05.bCJ031638 
TES010024G11TES01_0024_G11.bCJ031642 
TES010024H03TES01_0024_H03.bCJ031645 
TES010024H12TES01_0024_H12.bCJ031651 
TES010025E02TES01_0025_E02.bCJ031679 
TES010025E08TES01_0025_E08.b  
TES010025E10TES01_0025_E10.bCJ031683 
TES010025H06TES01_0025_H06.bCJ031699 
TES010026A11TES01_0026_A11.bCJ031707 
TES010026B08TES01_0026_B08.bFS722183 
TES010026B11TES01_0026_B11.bCJ031718 
TES010026E03TES01_0026_E03.bCJ031733 
TES010026F05TES01_0026_F05.bCJ031743 
TES010026G06TES01_0026_G06.bCJ031750 
TES010026G07TES01_0026_G07.b  
TES010026G12TES01_0026_G12.bFS722184 
TES010027B03TES01_0027_B03.b  
TES010027B09TES01_0027_B09.bCJ031777 
TES010027C02TES01_0027_C02.bCJ031780 
TES010027C03TES01_0027_C03.bCJ031781 
TES010027D03TES01_0027_D03.bCJ031786 
TES010027E02TES01_0027_E02.bCJ031794 
TES010027E09TES01_0027_E09.bCJ031798 
TES010027G09TES01_0027_G09.bCJ031812 
TES010027H08TES01_0027_H08.b  
TES010028A07TES01_0028_A07.bCJ031826 
TES010028C05TES01_0028_C05.bCJ031842 
TES010028C06TES01_0028_C06.bCJ031843 
TES010028D09TES01_0028_D09.bCJ031851 
TES010028E06TES01_0028_E06.b  
TES010028E08TES01_0028_E08.bCJ031857 
TES010028G08TES01_0028_G08.bCJ031873 
TES010028G09TES01_0028_G09.bCJ031874 
TES010029A06TES01_0029_A06.bCJ031887 
TES010029C04TES01_0029_C04.bCJ031902 
TES010029E04TES01_0029_E04.b  
TES010029G02TES01_0029_G02.bCJ031933 
TES010029H07TES01_0029_H07.bCJ031947 
TES010030A02TES01_0030_A02.bCJ031952 
TES010030A04TES01_0030_A04.bCJ031954 
TES010030F02TES01_0030_F02.bCJ032000 
TES010030F03TES01_0030_F03.bCJ032001 
TES010030F05TES01_0030_F05.bCJ032003 
TES010030G01TES01_0030_G01.bCJ032007 
TES010031B06TES01_0031_B06.bCJ032037 
TES010031G12TES01_0031_G12.bCJ032079 
TES010031H06TES01_0031_H06.bCJ032084 
TES010032A11TES01_0032_A11.bCJ032098 
TES010032E05TES01_0032_E05.bCJ032127 
TES010032F11TES01_0032_F11.bCJ032134 
TES010032G05TES01_0032_G05.bCJ032139 
TES010032H01TES01_0032_H01.bCJ032144 
TES010032H06TES01_0032_H06.bCJ032147 
TES010033B08TES01_0033_B08.bCJ032168 
TES010033C04TES01_0033_C04.bCJ032174 
TES010034C07TES01_0034_C07.bCJ032230 
TES010034D05TES01_0034_D05.bCJ032239 
TES010034F10TES01_0034_F10.bCJ032259 
TES010035B12TES01_0035_B12.bCJ032296 
TES010035D12TES01_0035_D12.bCJ032311 
TES010035E03TES01_0035_E03.bCJ032313 
TES010035F07TES01_0035_F07.bCJ032325 
TES010035F10TES01_0035_F10.bCJ032327 
TES010035H02TES01_0035_H02.bCJ032337 
TES010035H03TES01_0035_H03.bCJ032338 
TES010035H11TES01_0035_H11.bCJ032346 
TES010036B06TES01_0036_B06.bCJ032360 
TES010036C05TES01_0036_C05.bCJ032367 
TES010036E04TES01_0036_E04.bCJ032380 
TES010036E11TES01_0036_E11.bCJ032386 
TES010036H08TES01_0036_H08.bCJ032411 
TES010036H12TES01_0036_H12.bCJ032413 
TES010037C03TES01_0037_C03.bCJ032435 
TES010037D02TES01_0037_D02.bCJ032438 
TES010037E05TES01_0037_E05.bCJ032448 
TES010038D12TES01_0038_D12.bCJ032507 
TES010038E01TES01_0038_E01.bCJ032508 
TES010038E05TES01_0038_E05.bCJ032511 
TES010038F06TES01_0038_F06.bCJ032518 
TES010038G01TES01_0038_G01.bCJ032522 
TES010038H02TES01_0038_H02.bCJ032532 
TES010039D11TES01_0039_D11.bCJ032555 
TES010039E02TES01_0039_E02.bCJ032556 
TES010039E05TES01_0039_E05.bCJ032558 
TES010039F06TES01_0039_F06.bCJ032562 
TES010040A04TES01_0040_A04.bCJ032572 
TES010040B01TES01_0040_B01.bCJ032576 
TES010040B02TES01_0040_B02.bCJ032577 
TES010040B07TES01_0040_B07.bCJ032582 
TES010040C05TES01_0040_C05.bCJ032590 
TES010040D08TES01_0040_D08.b  
TES010040D11TES01_0040_D11.b  
TES010040E07TES01_0040_E07.bCJ032606 
TES010040F03TES01_0040_F03.bCJ032610 
TES010040G02TES01_0040_G02.bCJ032619 
TES010041A05TES01_0041_A05.bCJ032636 
TES010041B08TES01_0041_B08.bCJ032647 
TES010041E03TES01_0041_E03.bCJ032664 
TES010041E06TES01_0041_E06.bCJ032666 
TES010041H05TES01_0041_H05.bCJ032685 
TES010042A01TES01_0042_A01.bCJ032690 
TES010042A03TES01_0042_A03.bCJ032692 
TES010042C04TES01_0042_C04.bCJ032706 
TES010042C10TES01_0042_C10.bCJ032710 
TES010042C11TES01_0042_C11.bCJ032711 
TES010042D03TES01_0042_D03.b  
TES010042E10TES01_0042_E10.b  
TES010042F02TES01_0042_F02.bCJ032726 
TES010042H06TES01_0042_H06.bCJ032749 
TES010042H10TES01_0042_H10.bCJ032753 
TES010042H12TES01_0042_H12.bCJ032755 
TES010043A12TES01_0043_A12.bCJ032764 
TES010043B12TES01_0043_B12.bCJ032773 AK398206
TES010043F06TES01_0043_F06.b  
TES010043H10TES01_0043_H10.b  
TES010044A05TES01_0044_A05.b  
TES010044B10TES01_0044_B10.b  
TES010044B11TES01_0044_B11.bCJ032826 
TES010044B12TES01_0044_B12.bCJ032827 
TES010044D12TES01_0044_D12.bCJ032841 
TES010044E09TES01_0044_E09.b  
TES010044G05TES01_0044_G05.bFS722209 
TES010044H05TES01_0044_H05.bFS722210 
TES010045A01TES01_0045_A01.bCJ032872 
TES010045D01TES01_0045_D01.bCJ032898 
TES010045D03TES01_0045_D03.bCJ032899 
TES010045E01TES01_0045_E01.bCJ032906 
TES010045F10TES01_0045_F10.bCJ032919 
TES010045G05TES01_0045_G05.bCJ032924 
TES010045G06TES01_0045_G06.bCJ032925 
TES010045H04TES01_0045_H04.bCJ032933 
TES010045H06TES01_0045_H06.bCJ032935 
TES010045H11TES01_0045_H11.bCJ032938 
TES010046B10TES01_0046_B10.bCJ032953 
TES010046C11TES01_0046_C11.bCJ032958 
TES010046F10TES01_0046_F10.bCJ032982 
TES010046F12TES01_0046_F12.bCJ032983 
TES010047C01TES01_0047_C01.bCJ033018 
TES010047C02TES01_0047_C02.bCJ033019 
TES010047D01TES01_0047_D01.b  
TES010047D12TES01_0047_D12.bCJ033026 
TES010047G08TES01_0047_G08.bCJ033044 
TES010047G10TES01_0047_G10.bCJ033045 
TES010047G11TES01_0047_G11.bCJ033046 
TES010047H12TES01_0047_H12.bCJ033056 
TES010048A05TES01_0048_A05.bCJ033060 
TES010048E03TES01_0048_E03.bCJ033076 
TES010048H06TES01_0048_H06.b  
TES010049B01TES01_0049_B01.bCJ033102 
TES010049C01TES01_0049_C01.bCJ033110 
TES010049G05TES01_0049_G05.bCJ033148 
TES010049G07TES01_0049_G07.bCJ033150 
TES010049H01TES01_0049_H01.bCJ033152 
TES010050C09TES01_0050_C09.bCJ033186 
TES010050E11TES01_0050_E11.bCJ033204 
TES010050F02TES01_0050_F02.bCJ033205 
TES010050F03TES01_0050_F03.bCJ033206 
TES010050G04TES01_0050_G04.bCJ033215 
TES010051A01TES01_0051_A01.bCJ033230 
TES010051A03TES01_0051_A03.bCJ033232 
TES010051A06TES01_0051_A06.bCJ033234 
TES010051B02TES01_0051_B02.bCJ033240 
TES010051B11TES01_0051_B11.bCJ033246 
TES010051E02TES01_0051_E02.bCJ033263 
TES010051F04TES01_0051_F04.bCJ033275 
TES010051F08TES01_0051_F08.bCJ033278 
TES010051G06TES01_0051_G06.bCJ033283 
TES010051H05TES01_0051_H05.bCJ033290 
TES010051H11TES01_0051_H11.bCJ033295 
TES010052C04TES01_0052_C04.bCJ033314 
TES010052F08TES01_0052_F08.bCJ033347 
TES010052G02TES01_0052_G02.bCJ033353 
TES010053C12TES01_0053_C12.b  
TES010053H08TES01_0053_H08.b  
TES010054F01TES01_0054_F01.bCJ033444 
TES010054G09TES01_0054_G09.bCJ033457 
TES010054G10TES01_0054_G10.b  
TES010055A06TES01_0055_A06.bCJ033466 
TES010055A07TES01_0055_A07.bCJ033467 
TES010055A09TES01_0055_A09.bCJ033469 
TES010055B03TES01_0055_B03.bCJ033474 
TES010055B04TES01_0055_B04.bCJ033475 
TES010055C10TES01_0055_C10.bCJ033486 
TES010055D10TES01_0055_D10.bCJ033492 
TES010055E02TES01_0055_E02.bCJ033495 
TES010055E03TES01_0055_E03.bCJ033496 
TES010055E06TES01_0055_E06.bCJ033499 
TES010056A06TES01_0056_A06.b  
TES010056B07TES01_0056_B07.bCJ033546 
TES010056D12TES01_0056_D12.bCJ033568 
TES010056E05TES01_0056_E05.bCJ033572 
TES010056E08TES01_0056_E08.bCJ033574 
TES010056F09TES01_0056_F09.bCJ033586 
TES010056H11TES01_0056_H11.bCJ033607 
TES010057D10TES01_0057_D10.bCJ033636 
TES010057E02TES01_0057_E02.bCJ033639 
TES010057F04TES01_0057_F04.bCJ033651 
TES010057G11TES01_0057_G11.bCJ033665 
TES010058A02TES01_0058_A02.bCJ033676 
TES010058A04TES01_0058_A04.bCJ033678 
TES010058B02TES01_0058_B02.bCJ033687 
TES010058B05TES01_0058_B05.bCJ033690 
TES010058C09TES01_0058_C09.bCJ033704 
TES010058E01TES01_0058_E01.bCJ033715 
TES010058E10TES01_0058_E10.b  
TES010058F03TES01_0058_F03.bCJ033724 
TES010058G02TES01_0058_G02.bFS722228 
TES010059B12TES01_0059_B12.bCJ033760 
TES010059C07TES01_0059_C07.bCJ033766 
TES010059C08TES01_0059_C08.bCJ033767 
TES010059D01TES01_0059_D01.bCJ033772 
TES010059D03TES01_0059_D03.bCJ033774 
TES010059E07TES01_0059_E07.bCJ033784 
TES010059F06TES01_0059_F06.bCJ033793 
TES010060B12TES01_0060_B12.bCJ033839 
TES010060H08TES01_0060_H08.bCJ033878 
TES010061C07TES01_0061_C07.bCJ033902 
TES010062B10TES01_0062_B10.bCJ033962 
TES010062B12TES01_0062_B12.bCJ033963 
TES010062C12TES01_0062_C12.bCJ033974 
TES010062G07TES01_0062_G07.bCJ034008 
TES010062G12TES01_0062_G12.bCJ034012 
TES010062H04TES01_0062_H04.bCJ034015 
TES010063B07TES01_0063_B07.bCJ034038 
TES010063C01TES01_0063_C01.bCJ034041 
TES010063C05TES01_0063_C05.bCJ034045 
TES010063C10TES01_0063_C10.bCJ034050 
TES010063D02TES01_0063_D02.bCJ034054 
TES010063D06TES01_0063_D06.bCJ034058 
TES010063D07TES01_0063_D07.b  
TES010063D12TES01_0063_D12.bCJ034062 
TES010063E10TES01_0063_E10.bCJ034070 
TES010063E11TES01_0063_E11.bCJ034071 
TES010063F09TES01_0063_F09.bCJ034079 
TES010063H02TES01_0063_H02.bCJ034090 
TES010064C05TES01_0064_C05.bFS722234 
TES010064C09TES01_0064_C09.bCJ034118 
TES010064C10TES01_0064_C10.bCJ034119 
TES010064E02TES01_0064_E02.bCJ034129 
TES010064F11TES01_0064_F11.bCJ034140 
TES010064H12TES01_0064_H12.bCJ034157 
TES010065B04TES01_0065_B04.bFS722237 
TES010065D10TES01_0065_D10.bCJ034185 
TES010065E07TES01_0065_E07.bCJ034190 
TES010065F08TES01_0065_F08.bCJ034200 
TES010065F09TES01_0065_F09.bCJ034201 
TES010066C10TES01_0066_C10.bCJ034242 
TES010066E02TES01_0066_E02.bCJ034256 
TES010066G09TES01_0066_G09.bCJ034275 
TES010067B04TES01_0067_B04.bCJ034295 
TES010067B10TES01_0067_B10.bCJ034300 
TES010067D03TES01_0067_D03.bCJ034312 
TES010067E04TES01_0067_E04.bCJ034321 
TES010067H07TES01_0067_H07.bCJ034352 
TES010068A12TES01_0068_A12.bCJ034364 
TES010068F06TES01_0068_F06.bCJ034406 
TES010068H11TES01_0068_H11.bCJ034428 
TES010069A09TES01_0069_A09.bCJ034438 
TES010069F03TES01_0069_F03.b  
TES010069G01TES01_0069_G01.bCJ034473 
TES010070C08TES01_0070_C08.bCJ034511 
TES010070D12TES01_0070_D12.bCJ034524 
TES010070H04TES01_0070_H04.bCJ034553 
TES010070H07TES01_0070_H07.bCJ034556 
TES010070H12TES01_0070_H12.bCJ034559 
TES010071A12TES01_0071_A12.bCJ034567 
TES010071C02TES01_0071_C02.bCJ034577 
TES010071G06TES01_0071_G06.bCJ034610 
TES010071H12TES01_0071_H12.bCJ034620 
TES010072A01TES01_0072_A01.bCJ034621 
TES010072C04TES01_0072_C04.bCJ034639 
TES010072E07TES01_0072_E07.b  
TES010073A07TES01_0073_A07.bCJ034697 
TES010073B05TES01_0073_B05.b  
TES010073B06TES01_0073_B06.bCJ034704 
TES010073F01TES01_0073_F01.b  
TES010074A07TES01_0074_A07.b  
TES010074E02TES01_0074_E02.bCJ034763 AK238574
TES010074F12TES01_0074_F12.bCJ034775 
TES010074H01TES01_0074_H01.bCJ034781 
TES010075A10TES01_0075_A10.bCJ034796 
TES010075B08TES01_0075_B08.bCJ034806 
TES010075B12TES01_0075_B12.bCJ034807 
TES010075D08TES01_0075_D08.bCJ034821 AK398255
TES010075E10TES01_0075_E10.bCJ034832 
TES010075G01TES01_0075_G01.bCJ034843 
TES010076C04TES01_0076_C04.bCJ034884 
TES010076C12TES01_0076_C12.bCJ034891 
TES010076E11TES01_0076_E11.bCJ034908 
TES010076F01TES01_0076_F01.bCJ034909 
TES010077B04TES01_0077_B04.bCJ034943 
TES010077C04TES01_0077_C04.b  
TES010077C05TES01_0077_C05.b  
TES010077E11TES01_0077_E11.bCJ034964 
TES010077F01TES01_0077_F01.bCJ034965 
TES010077G03TES01_0077_G03.bCJ034974 
TES010078H01TES01_0078_H01.bCJ035043 
TES010078H03TES01_0078_H03.bCJ035044 AK398263
TES010079A09TES01_0079_A09.bCJ035058 
TES010079C02TES01_0079_C02.bCJ035071 
TES010079D06TES01_0079_D06.bCJ035083 
TES010079E04TES01_0079_E04.bCJ035091 
TES010079E11TES01_0079_E11.bCJ035097 
TES010080C01TES01_0080_C01.bCJ035139 
TES010080C02TES01_0080_C02.bCJ035140 
TES010080C05TES01_0080_C05.bCJ035143 
TES010080E04TES01_0080_E04.bCJ035162 
TES010080E05TES01_0080_E05.bCJ035163 
TES010080E12TES01_0080_E12.bCJ035168 
TES010080F09TES01_0080_F09.bCJ035173 
TES010080G06TES01_0080_G06.bCJ035181 
TES010081C06TES01_0081_C06.b  
TES010081E05TES01_0081_E05.bCJ035228 
TES010081F04TES01_0081_F04.bCJ035234 
TES010081F10TES01_0081_F10.bCJ035239 
TES010081H12TES01_0081_H12.bCJ035258 
TES010082A05TES01_0082_A05.bCJ035262 
TES010082B08TES01_0082_B08.bCJ035275 
TES010082B09TES01_0082_B09.bCJ035276 
TES010082B10TES01_0082_B10.bCJ035277 
TES010082C02TES01_0082_C02.bCJ035279 
TES010082C03TES01_0082_C03.bCJ035280 
TES010082C06TES01_0082_C06.bCJ035282 
TES010082C10TES01_0082_C10.bCJ035284 
TES010082D01TES01_0082_D01.bCJ035287 
TES010082E01TES01_0082_E01.bCJ035296 
TES010083C06TES01_0083_C06.bCJ035345 
TES010083C09TES01_0083_C09.bCJ035348 
TES010083E07TES01_0083_E07.bCJ035365 
TES010083E09TES01_0083_E09.bCJ035366 
TES010083F09TES01_0083_F09.bCJ035377 
TES010083H05TES01_0083_H05.bFS722253 
TES010084B06TES01_0084_B06.bCJ035408 
TES010084C09TES01_0084_C09.bCJ035420 
TES010084D05TES01_0084_D05.bCJ035428 
TES010084D07TES01_0084_D07.bCJ035430 
TES010084E09TES01_0084_E09.bCJ035437 
TES010085A10TES01_0085_A10.bCJ035468 
TES010085E01TES01_0085_E01.bCJ035501 
TES010085E10TES01_0085_E10.b  
TES010085G02TES01_0085_G02.bCJ035515 
TES010086E02TES01_0086_E02.bCJ035564 
TES010086F10TES01_0086_F10.bCJ035579 
TES010086H08TES01_0086_H08.bCJ035596 
TES010087A05TES01_0087_A05.bCJ035602 
TES010087E08TES01_0087_E08.bCJ035638 
TES010087F08TES01_0087_F08.bCJ035648 
TES010087F09TES01_0087_F09.bCJ035649 
TES010087G08TES01_0087_G08.bCJ035656 
TES010087G11TES01_0087_G11.bCJ035659 
TES010087H02TES01_0087_H02.bCJ035660 
TES010088E01TES01_0088_E01.bCJ035696 
TES010088E07TES01_0088_E07.bCJ035699 
TES010088F06TES01_0088_F06.bCJ035707 
TES010088G01TES01_0088_G01.bCJ035714 
TES010088G06TES01_0088_G06.bCJ035717 
TES010089E11TES01_0089_E11.bCJ035778 
TES010089G12TES01_0089_G12.bFS722266 
TES010090C11TES01_0090_C11.bCJ035828 
TES010090G09TES01_0090_G09.bCJ035850 
TES010090H02TES01_0090_H02.bCJ035853 
TES010090H04TES01_0090_H04.bCJ035855 
TES010091A09TES01_0091_A09.bCJ035865 
TES010091B03TES01_0091_B03.bCJ035869 
TES010091B04TES01_0091_B04.bCJ035870 
TES010091B09TES01_0091_B09.bCJ035873 
TES010091C09TES01_0091_C09.bCJ035880 
TES010092B04TES01_0092_B04.b  
TES010092C12TES01_0092_C12.bCJ035957 
TES010092D02TES01_0092_D02.bCJ035958 
TES010093A05TES01_0093_A05.bCJ036007 
TES010093A07TES01_0093_A07.bCJ036009 
TES010093D01TES01_0093_D01.bCJ036030 
TES010093D05TES01_0093_D05.b  
TES010093D07TES01_0093_D07.bCJ036034 
TES010093E06TES01_0093_E06.bCJ036042 
TES010094A02TES01_0094_A02.bCJ036073 
TES010094B04TES01_0094_B04.bCJ036086 
TES010094B11TES01_0094_B11.bFS722271 
TES010094D08TES01_0094_D08.bCJ036104 
TES010094D09TES01_0094_D09.bCJ036105 
TES010094E10TES01_0094_E10.bCJ036117 
TES010094E12TES01_0094_E12.bCJ036119 
TES010095A06TES01_0095_A06.bCJ036155 
TES010095B04TES01_0095_B04.bCJ036162 
TES010095C10TES01_0095_C10.bCJ036176 
TES010095E07TES01_0095_E07.b  
TES010095E12TES01_0095_E12.bCJ036197 
TES010095F02TES01_0095_F02.bCJ036198 
TES010095F04TES01_0095_F04.bCJ036200 
TES010095F08TES01_0095_F08.bCJ036204 
TES010095H05TES01_0095_H05.bCJ036222 
TES010096A04TES01_0096_A04.bCJ036231 
TES010096A05TES01_0096_A05.bCJ036232 
TES010096A11TES01_0096_A11.bCJ036236 
TES010096A12TES01_0096_A12.bCJ036237 
TES010096C04TES01_0096_C04.bCJ036247 
TES010096C11TES01_0096_C11.bCJ036253 
TES010096E10TES01_0096_E10.bCJ036273 
TES010096G12TES01_0096_G12.bCJ036290 
TES010096H02TES01_0096_H02.bCJ036291 
TES010097B06TES01_0097_B06.bCJ036313 
TES010097C12TES01_0097_C12.bCJ036327 
TES010097D01TES01_0097_D01.bCJ036328 
TES010097E02TES01_0097_E02.bCJ036340 
TES010097E10TES01_0097_E10.bCJ036346 
TES010097F03TES01_0097_F03.bCJ036350 
TES010097G05TES01_0097_G05.bCJ036362 
TES010097G06TES01_0097_G06.bCJ036363 
TES010097G12TES01_0097_G12.b  
TES010098A01TES01_0098_A01.bCJ036376 
TES010098C01TES01_0098_C01.bCJ036393 
TES010098C05TES01_0098_C05.bCJ036397 
TES010098D02TES01_0098_D02.bCJ036403 
TES010098D09TES01_0098_D09.bCJ036409 
TES010098E09TES01_0098_E09.b  
TES010098F07TES01_0098_F07.bCJ036425 
TES010099A08TES01_0099_A08.bCJ036453 
TES010099A12TES01_0099_A12.bCJ036456 
TES010099C07TES01_0099_C07.bCJ036471 
TES010099D10TES01_0099_D10.bCJ036485 
TES010099E03TES01_0099_E03.bCJ036489 
TES010099F02TES01_0099_F02.bCJ036500 
TES010099G02TES01_0099_G02.bCJ036511 
TES010099H09TES01_0099_H09.bCJ036524 
TES010099H12TES01_0099_H12.bCJ036526 
TES010100B02TES01_0100_B02.bCJ036537 
TES010100B05TES01_0100_B05.bCJ036540 
TES010100B09TES01_0100_B09.bCJ036543 
TES010100D03TES01_0100_D03.bCJ036556 
TES010100D04TES01_0100_D04.b  
TES010100H02TES01_0100_H02.bCJ036588 
TES010101A12TES01_0101_A12.bCJ036607 
TES010101B02TES01_0101_B02.bCJ036609 
TES010101D01TES01_0101_D01.bCJ036626 
TES010101G05TES01_0101_G05.bCJ036653 
TES010101G12TES01_0101_G12.bCJ036658 
TES010101H03TES01_0101_H03.bCJ036661 
TES010102A05TES01_0102_A05.bCJ036670 
TES010102B03TES01_0102_B03.bCJ036679 
TES010102D05TES01_0102_D05.bCJ036700 
TES010102H12TES01_0102_H12.bCJ036745 
TES010103B04TES01_0103_B04.bCJ036756 
TES010103G01TES01_0103_G01.bCJ036797 
TES010103G07TES01_0103_G07.bCJ036803 
TES010103H03TES01_0103_H03.b  
TES010103H04TES01_0103_H04.bCJ036811 
TES010104A09TES01_0104_A09.bCJ036824 
TES010104B07TES01_0104_B07.bCJ036834 
TES010104C11TES01_0104_C11.bCJ036849 
TES010104D08TES01_0104_D08.bCJ036856 
TES010104E05TES01_0104_E05.bCJ036862 
TES010104F07TES01_0104_F07.bCJ036872 
TES010104H12TES01_0104_H12.bCJ036893 
TES010105D07TES01_0105_D07.bCJ036929 
TES010105F02TES01_0105_F02.bCJ036941 
TES010105F06TES01_0105_F06.bCJ036944 
TES010105F10TES01_0105_F10.b  
TES010105H01TES01_0105_H01.bCJ036957 
TES010106B02TES01_0106_B02.bCJ036979 
TES010106B08TES01_0106_B08.bCJ036982 
TES010106C06TES01_0106_C06.bCJ036990 
TES010106C11TES01_0106_C11.bCJ036992 
TES010106F12TES01_0106_F12.bCJ037023 
TES010106G01TES01_0106_G01.bCJ037024 
TES010106G07TES01_0106_G07.bCJ037029 
TES010107B05TES01_0107_B05.bCJ037049 
TES010107C11TES01_0107_C11.bCJ037056 
TES010107D10TES01_0107_D10.b  
TES010107E08TES01_0107_E08.bCJ037070 
TES010107F01TES01_0107_F01.bCJ037074 
TES010107F12TES01_0107_F12.bCJ037083 
TES010107G01TES01_0107_G01.bCJ037084 
TES010107G09TES01_0107_G09.bCJ037091 
TES010108A06TES01_0108_A06.b  
TES010108A10TES01_0108_A10.bCJ037106 
TES010108B06TES01_0108_B06.bCJ037113 
TES010108B08TES01_0108_B08.b  
TES010108C06TES01_0108_C06.b  
TES010108C07TES01_0108_C07.bCJ037118 
TES010108D01TES01_0108_D01.bCJ037123 
TES010108G02TES01_0108_G02.bCJ037150 
TES010108G09TES01_0108_G09.bCJ037157 
TES010109C02TES01_0109_C02.bCJ037185 
TES010109E12TES01_0109_E12.bCJ037210 
TES010109G09TES01_0109_G09.bCJ037227 
TES010109H06TES01_0109_H06.bCJ037232 
TES010110A01TES01_0110_A01.bCJ037236 
TES010110A05TES01_0110_A05.bCJ037240 
TES010110A11TES01_0110_A11.bCJ037246 
TES010110B01TES01_0110_B01.bCJ037248 
TES010110E07TES01_0110_E07.bCJ037267 
TES010111B08TES01_0111_B08.bCJ037304 
TES010111D02TES01_0111_D02.bCJ037319 
TES010111F03TES01_0111_F03.bCJ037335 
TES010111F11TES01_0111_F11.bCJ037340 
TES010112A01TES01_0112_A01.bCJ037362 
TES010112A09TES01_0112_A09.bCJ037369 
TES010112C02TES01_0112_C02.bCJ037383 
TES010112C05TES01_0112_C05.bCJ037385 
TES010112E06TES01_0112_E06.bCJ037405 
TES010112F02TES01_0112_F02.b  
TES010112F05TES01_0112_F05.bCJ037412 
TES010112F06TES01_0112_F06.bCJ037413 
TES010112H03TES01_0112_H03.bCJ037427 
TES010112H06TES01_0112_H06.bCJ037430 
UTR010033A04UTR01_0033_A04.bBP169514 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
203C32120.458WSCTC/L
G38300.542CTG/L
614A28600.431WSGTA/V
G37710.569GTG/V


Alignment:      TOP

20110601C-001686 : ....................................................CTGGGAGC
---------+---------+---------+---------+---------+---------+ 8
TES01_0078_H03.b : ttcctgcgtggctatggaagagacaCTGGGAGC
CLNT1_0067_B12.b : nngggcttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0015_G07.b : xxxxxxxxxxxx
SMG01_0047_D04.b : nccggtattnnnngg
OVR01_0004_H02.b : ggacaattggacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0030_H02.b : taggggcttttgcxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0092_F05.b : nnccgtcaannnn
TES01_0036_E04.b :
TES01_0043_B12.b :
TES01_0062_B10.b :
TES01_0101_B02.b :
TCH01_0071_A12.b : nntttgctagtgacttnacxxxxxxxxxxxxxx
CLNT1_0055_E12.b : ttcggttctgcgtcggx
TES01_0036_H08.b :
TES01_0009_E05.b :
OVR01_0070_D12.b : tggcttggactatgacxxxxxxx
TES01_0111_D02.b :
TES01_0024_C12.b :
TES01_0042_C04.b :
TES01_0043_F06.b :
TES01_0002_H04.b :
TCH01_0045_G09.b :
TES01_0053_C12.b :
TES01_0018_A01.b :
TCH01_0069_B06.b : nnnnagctaggactatgac
TES01_0019_F10.b :
TES01_0041_B08.b :
TES01_0021_B12.b :
TES01_0062_G07.b :
TES01_0062_H04.b :
TES01_0063_C10.b :
TES01_0076_C04.b :
TES01_0026_B11.b :
TES01_0085_E10.b :
TES01_0052_G02.b :
TES01_0037_E05.b :
TES01_0081_C06.b :
TES01_0105_D07.b :
TES01_0070_H12.b :
TES01_0085_G02.b :
TES01_0087_H02.b :
TES01_0030_F03.b :
TES01_0108_G02.b :
TES01_0096_C04.b :
TES01_0108_C06.b :
TES01_0112_F06.b :
TES01_0022_H04.b :
TES01_0083_F09.b :
TES01_0111_F11.b :
TES01_0064_C05.b :
TES01_0019_F09.b :
TES01_0075_A10.b :
TES01_0087_G08.b :
TES01_0088_E01.b :
TES01_0096_A12.b :
TES01_0067_H07.b :
TES01_0082_E01.b :
TES01_0108_D01.b :
TES01_0106_F12.b :
TES01_0085_E01.b :
TES01_0037_C03.b :
TES01_0022_G03.b :
TES01_0033_B08.b :
TES01_0111_B08.b :
TES01_0022_C10.b :
TES01_0092_B04.b :
TES01_0079_C02.b :
TES01_0035_D12.b :
TES01_0088_F06.b :
TES01_0019_D10.b :
TES01_0047_G08.b :
TES01_0017_F05.b :
TES01_0059_E07.b :
TES01_0035_H02.b :
TES01_0067_D03.b :
TES01_0108_A10.b :
TES01_0027_C03.b :
TES01_0067_B10.b :
TES01_0045_H04.b :
TES01_0018_A08.b :
TES01_0007_B11.b :
TES01_0005_A12.b :
TES01_0058_F03.b :
TES01_0050_E11.b :
TES01_0022_B10.b :
TES01_0051_G06.b :
TES01_0019_G01.b :
TES01_0014_A04.b :
TES01_0051_H11.b :
TES01_0083_E09.b :
TES01_0057_E02.b :
TES01_0047_C01.b :
TES01_0047_C02.b :
TES01_0009_E08.b :
TES01_0044_A05.b :
TES01_0008_F03.b :
TES01_0065_D10.b :
TES01_0050_G04.b :
TES01_0042_A03.b :
TES01_0077_F01.b :
TES01_0073_F01.b :
TES01_0064_F11.b :
TES01_0003_E10.b :
TES01_0075_D08.b :
TES01_0090_C11.b :
TES01_0063_D12.b :
TES01_0028_G08.b :
TES01_0109_E12.b :
TES01_0106_G07.b :
TES01_0027_E09.b :
TES01_0077_E11.b :
TES01_0109_H06.b :
TES01_0081_F04.b :
TES01_0022_G10.b :
TES01_0056_D12.b :
TES01_0100_B02.b :
TES01_0026_G12.b :
TES01_0095_F04.b :
TES01_0063_H02.b :
TES01_0091_B09.b :
TES01_0080_C05.b :
TES01_0106_C06.b :
TES01_0097_E02.b :
TES01_0100_H02.b :
TES01_0084_E09.b :
TES01_0046_C11.b :
TES01_0031_H06.b :
TES01_0056_E08.b :
TES01_0101_G12.b :
TES01_0023_G09.b :
TES01_0082_C02.b :
TES01_0102_D05.b :
TES01_0091_C09.b :
TES01_0045_G06.b :
TES01_0045_G05.b :
TES01_0027_B03.b :
TES01_0047_D01.b :
TES01_0020_A07.b :
TES01_0056_E05.b :
TES01_0040_C05.b :
TES01_0019_G09.b :
TES01_0044_H05.b :
TES01_0051_A03.b :
TES01_0004_A10.b :
TES01_0054_F01.b :
TES01_0009_F08.b :
TES01_0098_D02.b :
TES01_0045_D03.b :
TES01_0056_H11.b :
TES01_0012_G03.b :
TES01_0024_E06.b :
TES01_0004_A08.b :
TES01_0011_G02.b :
TES01_0058_E01.b :
TES01_0005_G05.b :
TES01_0059_C08.b :
TES01_0065_E07.b :
TES01_0044_B11.b :
TES01_0110_E07.b :
TES01_0057_G11.b :
TES01_0024_H12.b :
TES01_0020_G09.b :
TES01_0083_E07.b :
TES01_0010_G10.b :
TES01_0005_C07.b :
TES01_0003_H11.b :
TES01_0018_H02.b :
TES01_0020_A11.b :
TES01_0043_A12.b :
TES01_0087_A05.b :
TES01_0008_F06.b :
TES01_0047_G10.b :
TES01_0010_H05.b :
TES01_0012_F03.b :
TES01_0036_B06.b :
TES01_0001_H07.b :
TES01_0012_H07.b :
TES01_0103_G01.b :
TES01_0045_A01.b :
TES01_0008_E02.b :
TES01_0023_E05.b :
TES01_0042_E10.b :
TES01_0014_E12.b :
TES01_0012_G07.b :
TES01_0010_A09.b :
TES01_0028_C06.b :
TES01_0026_A11.b :
TES01_0025_E10.b :
TES01_0040_D11.b :
TES01_0025_E08.b :
TES01_0094_D09.b :
TES01_0040_F03.b :
TES01_0040_B07.b :
TES01_0071_G06.b :
TES01_0028_E08.b :
TES01_0058_E10.b :
TES01_0090_H02.b :
TES01_0079_E11.b :
TES01_0108_G09.b :
TES01_0095_F02.b :
TES01_0103_G07.b :
TES01_0075_E10.b :
TES01_0003_F10.b :
TES01_0057_F04.b :
TES01_0096_E10.b :
TES01_0014_B08.b :
TES01_0024_G05.b :
TES01_0027_B09.b :
TES01_0097_G05.b :
TES01_0021_E11.b :
TES01_0047_D12.b :
TES01_0087_G11.b :
TES01_0096_G12.b :
TES01_0108_B08.b :
TES01_0029_E04.b :
TES01_0098_F07.b :
TES01_0099_F02.b :
TES01_0023_B08.b :
TES01_0003_F09.b :
TES01_0101_D01.b :
TES01_0058_G02.b :
TES01_0026_G06.b :
TES01_0019_B07.b :
TES01_0003_G12.b :
TES01_0019_C07.b :
TES01_0027_G09.b :
TES01_0041_E06.b :
TES01_0051_F04.b :
TES01_0035_E03.b :
TES01_0022_H09.b :
TES01_0103_B04.b :
TES01_0006_F06.b :
TES01_0002_E09.b :
TES01_0005_A10.b :
TES01_0021_E05.b :
TES01_0007_B10.b :
TES01_0055_E06.b :
TES01_0023_D09.b :
TES01_0042_D03.b :
TES01_0041_A05.b :
TES01_0024_A11.b :
TES01_0007_H05.b :
TES01_0018_F09.b :
TES01_0042_F02.b :
TES01_0020_B01.b :
PST01_0032_B05.b :
TES01_0028_G09.b :
TES01_0045_E01.b :
TES01_0035_B12.b :
TES01_0017_E06.b :
TES01_0028_A07.b :
TES01_0038_E05.b :
TES01_0012_H05.b :
TES01_0005_B12.b :
TES01_0049_B01.b :
TES01_0010_F01.b :
TES01_0014_G10.b :
TES01_0014_D11.b :
TES01_0008_C07.b :
TES01_0011_G11.b :
TES01_0006_E09.b :
TES01_0016_D10.b :
TES01_0049_H01.b :
TES01_0001_C04.b :
TES01_0039_D11.b :
TES01_0013_F04.b :
TES01_0009_D08.b :
TES01_0013_D05.b :
TES01_0014_H04.b :
TES01_0011_A02.b :
TES01_0043_H10.b :
TES01_0023_C01.b :
TES01_0014_B04.b :
TES01_0012_D05.b :
TES01_0015_B04.b :
TES01_0016_G02.b :
TES01_0011_G01.b :
TES01_0049_G05.b :
TES01_0002_H10.b :
TES01_0014_D04.b :
TES01_0006_B04.b :
TES01_0016_B12.b :
TES01_0046_F10.b :
TES01_0105_F10.b :
TES01_0082_C06.b :
TES01_0071_A12.b :
TES01_0107_G09.b :
TES01_0062_B12.b :
OVR01_0086_D04.b :
TES01_0006_B09.b :
TES01_0089_G12.b :
TES01_0045_F10.b :
TES01_0038_E01.b :
OVRT1_0017_D11.b :
TES01_0110_A01.b :
TES01_0014_D12.b :
TES01_0030_A02.b :
TES01_0055_C10.b :
TES01_0038_H02.b :
TES01_0051_H05.b :
TES01_0031_B06.b :
TES01_0055_B03.b :
TES01_0112_C05.b :
TES01_0030_G01.b :
SMG01_0052_G07.b :
ITT01_0071_A02.b :
LVR01_0002_B06.b : ttt
SMG01_0060_D05.b :
ITT01_0031_H03.b :
CLNT1_0100_C05.b :
TES01_0074_A07.b :
TES01_0076_F01.b :
TES01_0078_H01.b :
TES01_0101_H03.b :
TES01_0063_E11.b :
TES01_0093_D01.b :
TES01_0070_H07.b :
TES01_0038_F06.b :
TES01_0069_G01.b :
TES01_0108_B06.b :
TES01_0094_A02.b :
TES01_0059_D01.b :
TES01_0101_G05.b :
TES01_0080_G06.b :
TES01_0092_D02.b :
TES01_0097_F03.b :
TES01_0079_E04.b :
TES01_0097_C12.b :
TES01_0112_H06.b :
TES01_0103_H04.b :
TES01_0048_E03.b :
TES01_0062_G12.b :
TES01_0073_B06.b :
TES01_0064_H12.b :
TES01_0107_F01.b :
SPL01_0022_B06.b : cxxxxx
TES01_0070_C08.b :
TES01_0079_A09.b :
TES01_0106_B02.b :
TES01_0064_C09.b :
TES01_0071_C02.b :
TES01_0107_G01.b :
TES01_0035_H03.b :
TES01_0080_E04.b :
TES01_0084_C09.b :
TES01_0054_G10.b :
TES01_0107_C11.b :
TES01_0058_B02.b :
TES01_0063_B07.b :
TES01_0086_H08.b :
TES01_0074_F12.b :
TES01_0041_H05.b :
TES01_0102_A05.b :
TES01_0034_F10.b :
TES01_0086_E02.b :
TES01_0106_C11.b :
TES01_0082_C03.b :
TES01_0059_F06.b :
TES01_0032_E05.b :
TES01_0089_E11.b :
TES01_0080_E05.b :
TES01_0060_H08.b :
TES01_0098_D09.b :
TES01_0024_G11.b :
TES01_0055_E02.b :
TES01_0055_E03.b :
TES01_0099_E03.b :
TES01_0082_C10.b :
TES01_0098_A01.b :
TES01_0107_F12.b :
TES01_0030_A04.b :
TES01_0099_C07.b :
TES01_0051_A01.b :
TES01_0106_B08.b :
TES01_0033_C04.b :
TES01_0026_G07.b :
TES01_0099_A12.b :
TES01_0049_C01.b :
TES01_0058_C09.b :
TES01_0083_C09.b :
TES01_0112_A09.b :
TES01_0025_H06.b :
TES01_0084_D05.b :
TES01_0044_B12.b :
TES01_0104_E05.b :
TES01_0104_B07.b :
TES01_0090_H04.b :
TES01_0013_H09.b :
TES01_0016_G08.b :
TES01_0026_E03.b :
TES01_0050_F03.b :
TES01_0042_C10.b :
TES01_0055_A07.b :
TES01_0054_G09.b :
TES01_0055_A09.b :
TES01_0015_E09.b :
TES01_0022_C01.b :
TES01_0042_H10.b :
ITT01_0081_E03.b :
TES01_0042_H12.b :
TES01_0010_H08.b :
TES01_0025_E02.b :
TES01_0097_D01.b :
TES01_0063_D02.b :
TES01_0084_D07.b :
TES01_0064_E02.b :
TES01_0070_D12.b :
TES01_0075_G01.b :
OVR01_0043_F06.b : aggct
TES01_0099_H09.b :
TES01_0032_G05.b :
TES01_0080_E12.b :
TES01_0063_D07.b :
TES01_0109_C02.b :
TES01_0075_B12.b :
TES01_0080_C02.b :
TES01_0094_E12.b :
TES01_0062_C12.b :
TES01_0040_D08.b :
TES01_0077_G03.b :
TES01_0076_C12.b :
TES01_0082_A05.b :
TES01_0066_E02.b :
TES01_0079_D06.b :
TES01_0068_A12.b :
TES01_0058_A04.b :
TES01_0107_E08.b :
TES01_0069_A09.b :
TES01_0095_C10.b :
TES01_0066_G09.b :
TES01_0032_H01.b :
TES01_0112_F05.b :
TES01_0088_E07.b :
TES01_0005_C11.b :
TES01_0061_C07.b :
TES01_0091_A09.b :
TES01_0058_A02.b :
TES01_0098_C05.b :
TES01_0067_B04.b :
TES01_0065_F08.b :
TES01_0023_A01.b :
TES01_0008_F05.b :
TES01_0029_G02.b :
TES01_0040_B01.b :
TES01_0029_H07.b :
TES01_0052_F08.b :
TES01_0035_H11.b :
TES01_0104_H12.b :
TES01_0097_E10.b :
TES01_0009_E03.b :
TES01_0009_F04.b :
TES01_0104_D08.b :
TES01_0012_H08.b :
TES01_0055_A06.b :
TES01_0014_E10.b :
TES01_0042_C11.b :
TES01_0015_F10.b :
TES01_0009_B04.b :
TES01_0097_G06.b :
TES01_0001_G12.b :
TES01_0034_D05.b :
TES01_0099_G02.b :
TES01_0070_H04.b :
TES01_0094_E10.b :
TES01_0108_C07.b :
TES01_0093_D07.b :
TES01_0027_H08.b :
TES01_0101_A12.b :
TES01_0096_A05.b :
TES01_0091_B03.b :
TES01_0097_G12.b :
TES01_0112_H03.b :
TES01_0093_E06.b :
TES01_0059_C07.b :
TES01_0052_C04.b :
TES01_0095_E07.b :
TES01_0040_B02.b :
TES01_0068_H11.b :
TES01_0024_H03.b :
TES01_0056_A06.b :
TES01_0007_G04.b :
TES01_0010_C06.b :
TCH01_0085_B04.b :
TCH01_0030_F07.b :
TES01_0016_G09.b :
OVRT1_0048_E08.b :
TES01_0018_H11.b :
TES01_0005_C03.b :
TES01_0013_G09.b :
TES01_0038_D12.b :
TES01_0081_H12.b :
TES01_0064_C10.b :
TES01_0076_E11.b :
TES01_0107_D10.b :
TES01_0096_H02.b :
TES01_0063_C01.b :
TES01_0088_G06.b :
TES01_0109_G09.b :
TES01_0081_E05.b :
TES01_0048_H06.b :
TES01_0100_B05.b :
TES01_0001_F11.b :
TES01_0040_G02.b :
TES01_0056_F09.b :
TES01_0059_D03.b :
TES01_0017_H12.b :
TES01_0032_F11.b :
TES01_0031_G12.b :
TES01_0027_C02.b :
TES01_0099_H12.b :
TES01_0015_G10.b :
TES01_0041_E03.b :
TES01_0050_C09.b :
TES01_0014_C07.b :
TES01_0016_B04.b :
TES01_0014_C02.b :
TES01_0015_G03.b :
TES01_0095_E12.b :
TES01_0063_E10.b :
TES01_0063_F09.b :
TES01_0072_C04.b :
TES01_0095_F08.b :
TES01_0037_D02.b :
TES01_0087_F09.b :
TES01_0110_A05.b :
TES01_0090_G09.b :
TES01_0028_C05.b :
TES01_0077_C05.b :
TES01_0046_B10.b :
TES01_0050_F02.b :
TES01_0091_B04.b :
TES01_0083_H05.b :
TES01_0039_E05.b :
TES01_0042_H06.b :
TES01_0026_B08.b :
TES01_0029_C04.b :
TES01_0112_E06.b :
TES01_0021_H03.b :
TES01_0045_H11.b :
TES01_0055_D10.b :
TES01_0017_D01.b :
OVR01_0034_H06.b : ggggtxxxxx
TES01_0106_G01.b :
TES01_0021_E03.b :
TES01_0034_C07.b :
TES01_0009_E11.b :
TES01_0097_B06.b :
TES01_0036_H12.b :
TES01_0042_A01.b :
TES01_0016_E01.b :
TES01_0009_F01.b :
TES01_0093_A07.b :
TES01_0077_B04.b :
TES01_0063_D06.b :
TES01_0100_D04.b :
TES01_0077_C04.b :
TES01_0069_F03.b :
TES01_0096_A04.b :
TES01_0094_B11.b :
TES01_0095_B04.b :
TES01_0112_C02.b :
TES01_0082_B09.b :
TES01_0048_A05.b :
TES01_0063_C05.b :
TES01_0110_B01.b :
TES01_0107_B05.b :
TES01_0084_B06.b :
TES01_0044_E09.b :
TES01_0080_F09.b :
TES01_0108_A06.b :
TES01_0099_D10.b :
TES01_0102_B03.b :
TES01_0096_A11.b :
TES01_0051_B11.b :
TES01_0005_G09.b :
TES01_0004_D06.b :
TES01_0003_G05.b :
TES01_0067_E04.b :
TES01_0027_E02.b :
TES01_0016_D01.b :
TES01_0015_C12.b :
TES01_0112_A01.b :
TES01_0055_B04.b :
TES01_0047_H12.b :
TES01_0015_C05.b :
TES01_0016_G04.b :
TES01_0038_G01.b :
TES01_0010_E12.b :
TES01_0002_H05.b :
TES01_0073_B05.b :
OVRM1_0224_G09.b :
TES01_0028_E06.b :
TES01_0082_B10.b :
TES01_0074_H01.b :
OVR01_0102_F09.b : ttggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0103_H03.b :
LVR01_0030_F08.b :
TES01_0087_E08.b :
TES01_0100_D03.b :
TES01_0087_F08.b :
TES01_0105_F02.b :
TES01_0105_H01.b :
TES01_0112_F02.b :
SMG01_0019_G11.b :
TES01_0095_A06.b :
TES01_0102_H12.b :
TES01_0093_D05.b :
LVR01_0039_H11.b :
SMG01_0018_E09.b :
UTR01_0033_A04.b :
LVR01_0088_F05.b :
LVR01_0097_D11.b :
TES01_0023_F03.b :
TES01_0065_F09.b :
TES01_0059_B12.b :
TES01_0110_A11.b :
TES01_0051_A06.b :
TES01_0085_A10.b :
OVRT1_0034_E04.b :
LVR01_0016_E09.b :
TES01_0030_F05.b :
TES01_0065_B04.b :
LVR01_0097_C11.b : gggtt
TES01_0051_F08.b :
TES01_0009_G07.b :
TES01_0098_E09.b :
TES01_0046_F12.b :
ADR01_0007_C04.b :
TES01_0045_D01.b :
TES01_0044_D12.b :
TES01_0035_F10.b :
TES01_0016_F01.b :
TES01_0039_E02.b :
TCH01_0029_C01.b :
TES01_0083_C06.b :
TES01_0026_F05.b :
LVR01_0015_E02.b :
TES01_0030_F02.b :
TES01_0008_A09.b :
TES01_0104_A09.b :
TES01_0104_F07.b :
TES01_0074_E02.b :
TES01_0035_F07.b :
TES01_0105_F06.b :
TES01_0095_H05.b :
TES01_0094_D08.b :
TES01_0100_B09.b :
TES01_0088_G01.b :
TES01_0086_F10.b :
TES01_0082_D01.b :
TES01_0036_C05.b :
TES01_0111_F03.b :
TES01_0049_G07.b :
TES01_0028_D09.b :
TES01_0014_H08.b :
TES01_0094_B04.b :
TES01_0051_B02.b :
TES01_0022_B11.b :
TES01_0068_F06.b :
TES01_0029_A06.b :
TES01_0104_C11.b :
TES01_0007_B07.b :
TES01_0019_F11.b :
TES01_0002_C05.b :
TES01_0056_B07.b :
TES01_0057_D10.b :
TES01_0008_C01.b :
TES01_0073_A07.b :
TES01_0093_A05.b :
TES01_0066_C10.b :
TES01_0047_G11.b :
TES01_0072_A01.b :
TES01_0058_B05.b :
TES01_0044_B10.b :
TES01_0060_B12.b :
TES01_0044_G05.b :
TES01_0039_F06.b :
TES01_0017_D03.b :
TES01_0018_H04.b :
TES01_0032_A11.b :
TES01_0011_B01.b :
TES01_0017_E10.b :
TES01_0024_F10.b :
TES01_0096_C11.b :
TES01_0040_E07.b :
TES01_0020_C03.b :
TES01_0018_B08.b :
TES01_0036_E11.b :
TES01_0081_F10.b :
TES01_0040_A04.b :
TES01_0032_H06.b :
TES01_0013_G07.b :
TES01_0005_F11.b :
TES01_0098_C01.b :
TES01_0006_H10.b :
TES01_0092_C12.b :
TES01_0020_H09.b :
TES01_0045_H06.b :
TES01_0099_A08.b :
TES01_0053_H08.b :
TES01_0080_C01.b :
TES01_0051_E02.b :
TES01_0013_C12.b :
TES01_0082_B08.b :
LVR01_0028_B08.b :
LVR01_0090_A01.b :
TES01_0071_H12.b :
TES01_0027_D03.b :
TES01_0072_E07.b :
TES01_0075_B08.b :
TES01_0023_B12.b :
20110601C-001686 : GGAATGCGCAGCTGCGCGGGGACGCGGCTCGCCCCACCCCCGCCGCTGGTTCTATTTTGT
---------+---------+---------+---------+---------+---------+ 68
TES01_0078_H03.b : GGAATGCGCAGCTGCGCGGGGACGCGGCTCGCCCCACCCCCGCCGCTGGTTCTATTTTGT
CLNT1_0067_B12.b : xxxxxxxxxxxxxxxxxxxxxxxGCGGCTCGCCCCACCCCCGCCGCTGGTTCTATTTTGT
OVRM1_0015_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATTTTGT
SMG01_0047_D04.b : ataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATTTTGT
OVR01_0004_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATTTTGT
OVR01_0030_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATTTTGT
ADR01_0092_F05.b : ggactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATTTTGT
TES01_0036_E04.b : ctgctgtggctctggTATTTTGT
TES01_0043_B12.b : tgtggctctggATTTTGT
TES01_0062_B10.b : tttcccgcgtggctcggctTTTTGT
TES01_0101_B02.b : ntttcctgcgtggctctactTTTTGT
TCH01_0071_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggtatatttTTTTGT
CLNT1_0055_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGT
TES01_0036_H08.b : ntcgcattggctatggaTTTGT
TES01_0009_E05.b : nttcctgcgtggctctggaTTTGT
OVR01_0070_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGT
TES01_0111_D02.b : tttcctgcgttgctcgggTTTG
TES01_0024_C12.b : gtggctctgg
TES01_0042_C04.b : cgtggctctggtattttg
TES01_0043_F06.b : ttttcctgcgttgctatggattg
TES01_0002_H04.b : ttttcctgctgtggctatgg
TCH01_0045_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0053_C12.b : tttcctgacgttgctc
TES01_0018_A01.b : ttcctgcgtggcacgg
TCH01_0069_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0019_F10.b :
TES01_0041_B08.b :
TES01_0021_B12.b :
TES01_0062_G07.b :
TES01_0062_H04.b :
TES01_0063_C10.b :
TES01_0076_C04.b :
TES01_0026_B11.b :
TES01_0085_E10.b :
TES01_0052_G02.b :
TES01_0037_E05.b :
TES01_0081_C06.b :
TES01_0105_D07.b :
TES01_0070_H12.b :
TES01_0085_G02.b :
TES01_0087_H02.b :
TES01_0030_F03.b :
TES01_0108_G02.b :
TES01_0096_C04.b :
TES01_0108_C06.b :
TES01_0112_F06.b :
TES01_0022_H04.b :
TES01_0083_F09.b :
TES01_0111_F11.b :
TES01_0064_C05.b :
TES01_0019_F09.b :
TES01_0075_A10.b :
TES01_0087_G08.b :
TES01_0088_E01.b :
TES01_0096_A12.b :
TES01_0067_H07.b :
TES01_0082_E01.b :
TES01_0108_D01.b :
TES01_0106_F12.b :
TES01_0085_E01.b :
TES01_0037_C03.b :
TES01_0022_G03.b :
TES01_0033_B08.b :
TES01_0111_B08.b :
TES01_0022_C10.b :
TES01_0092_B04.b :
TES01_0079_C02.b :
TES01_0035_D12.b :
TES01_0088_F06.b :
TES01_0019_D10.b :
TES01_0047_G08.b :
TES01_0017_F05.b :
TES01_0059_E07.b :
TES01_0035_H02.b :
TES01_0067_D03.b :
TES01_0108_A10.b :
TES01_0027_C03.b :
TES01_0067_B10.b :
TES01_0045_H04.b :
TES01_0018_A08.b :
TES01_0007_B11.b :
TES01_0005_A12.b :
TES01_0058_F03.b :
TES01_0050_E11.b :
TES01_0022_B10.b :
TES01_0051_G06.b :
TES01_0019_G01.b :
TES01_0014_A04.b :
TES01_0051_H11.b :
TES01_0083_E09.b :
TES01_0057_E02.b :
TES01_0047_C01.b :
TES01_0047_C02.b :
TES01_0009_E08.b :
TES01_0044_A05.b :
TES01_0008_F03.b :
TES01_0065_D10.b :
TES01_0050_G04.b :
TES01_0042_A03.b :
TES01_0077_F01.b :
TES01_0073_F01.b :
TES01_0064_F11.b :
TES01_0003_E10.b :
TES01_0075_D08.b :
TES01_0090_C11.b :
TES01_0063_D12.b :
TES01_0028_G08.b :
TES01_0109_E12.b :
TES01_0106_G07.b :
TES01_0027_E09.b :
TES01_0077_E11.b :
TES01_0109_H06.b :
TES01_0081_F04.b :
TES01_0022_G10.b :
TES01_0056_D12.b :
TES01_0100_B02.b :
TES01_0026_G12.b :
TES01_0095_F04.b :
TES01_0063_H02.b :
TES01_0091_B09.b :
TES01_0080_C05.b :
TES01_0106_C06.b :
TES01_0097_E02.b :
TES01_0100_H02.b :
TES01_0084_E09.b :
TES01_0046_C11.b :
TES01_0031_H06.b :
TES01_0056_E08.b :
TES01_0101_G12.b :
TES01_0023_G09.b :
TES01_0082_C02.b :
TES01_0102_D05.b :
TES01_0091_C09.b :
TES01_0045_G06.b :
TES01_0045_G05.b :
TES01_0027_B03.b :
TES01_0047_D01.b :
TES01_0020_A07.b :
TES01_0056_E05.b :
TES01_0040_C05.b :
TES01_0019_G09.b :
TES01_0044_H05.b :
TES01_0051_A03.b :
TES01_0004_A10.b :
TES01_0054_F01.b :
TES01_0009_F08.b :
TES01_0098_D02.b :
TES01_0045_D03.b :
TES01_0056_H11.b :
TES01_0012_G03.b :
TES01_0024_E06.b :
TES01_0004_A08.b :
TES01_0011_G02.b :
TES01_0058_E01.b :
TES01_0005_G05.b :
TES01_0059_C08.b :
TES01_0065_E07.b :
TES01_0044_B11.b :
TES01_0110_E07.b :
TES01_0057_G11.b :
TES01_0024_H12.b :
TES01_0020_G09.b :
TES01_0083_E07.b :
TES01_0010_G10.b :
TES01_0005_C07.b :
TES01_0003_H11.b :
TES01_0018_H02.b :
TES01_0020_A11.b :
TES01_0043_A12.b :
TES01_0087_A05.b :
TES01_0008_F06.b :
TES01_0047_G10.b :
TES01_0010_H05.b :
TES01_0012_F03.b :
TES01_0036_B06.b :
TES01_0001_H07.b :
TES01_0012_H07.b :
TES01_0103_G01.b :
TES01_0045_A01.b :
TES01_0008_E02.b :
TES01_0023_E05.b :
TES01_0042_E10.b :
TES01_0014_E12.b :
TES01_0012_G07.b :
TES01_0010_A09.b :
TES01_0028_C06.b :
TES01_0026_A11.b :
TES01_0025_E10.b :
TES01_0040_D11.b :
TES01_0025_E08.b :
TES01_0094_D09.b :
TES01_0040_F03.b :
TES01_0040_B07.b :
TES01_0071_G06.b :
TES01_0028_E08.b :
TES01_0058_E10.b :
TES01_0090_H02.b :
TES01_0079_E11.b :
TES01_0108_G09.b :
TES01_0095_F02.b :
TES01_0103_G07.b :
TES01_0075_E10.b :
TES01_0003_F10.b :
TES01_0057_F04.b :
TES01_0096_E10.b :
TES01_0014_B08.b :
TES01_0024_G05.b :
TES01_0027_B09.b :
TES01_0097_G05.b :
TES01_0021_E11.b :
TES01_0047_D12.b :
TES01_0087_G11.b :
TES01_0096_G12.b :
TES01_0108_B08.b :
TES01_0029_E04.b :
TES01_0098_F07.b :
TES01_0099_F02.b :
TES01_0023_B08.b :
TES01_0003_F09.b :
TES01_0101_D01.b :
TES01_0058_G02.b :
TES01_0026_G06.b :
TES01_0019_B07.b :
TES01_0003_G12.b :
TES01_0019_C07.b :
TES01_0027_G09.b :
TES01_0041_E06.b :
TES01_0051_F04.b :
TES01_0035_E03.b :
TES01_0022_H09.b :
TES01_0103_B04.b :
TES01_0006_F06.b :
TES01_0002_E09.b :
TES01_0005_A10.b :
TES01_0021_E05.b :
TES01_0007_B10.b :
TES01_0055_E06.b :
TES01_0023_D09.b :
TES01_0042_D03.b :
TES01_0041_A05.b :
TES01_0024_A11.b :
TES01_0007_H05.b :
TES01_0018_F09.b :
TES01_0042_F02.b :
TES01_0020_B01.b :
PST01_0032_B05.b :
TES01_0028_G09.b :
TES01_0045_E01.b :
TES01_0035_B12.b :
TES01_0017_E06.b :
TES01_0028_A07.b :
TES01_0038_E05.b :
TES01_0012_H05.b :
TES01_0005_B12.b :
TES01_0049_B01.b :
TES01_0010_F01.b :
TES01_0014_G10.b :
TES01_0014_D11.b :
TES01_0008_C07.b :
TES01_0011_G11.b :
TES01_0006_E09.b :
TES01_0016_D10.b :
TES01_0049_H01.b :
TES01_0001_C04.b :
TES01_0039_D11.b :
TES01_0013_F04.b :
TES01_0009_D08.b :
TES01_0013_D05.b :
TES01_0014_H04.b :
TES01_0011_A02.b :
TES01_0043_H10.b :
TES01_0023_C01.b :
TES01_0014_B04.b :
TES01_0012_D05.b :
TES01_0015_B04.b :
TES01_0016_G02.b :
TES01_0011_G01.b :
TES01_0049_G05.b :
TES01_0002_H10.b :
TES01_0014_D04.b :
TES01_0006_B04.b :
TES01_0016_B12.b :
TES01_0046_F10.b :
TES01_0105_F10.b :
TES01_0082_C06.b :
TES01_0071_A12.b :
TES01_0107_G09.b :
TES01_0062_B12.b :
OVR01_0086_D04.b : nnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0006_B09.b :
TES01_0089_G12.b :
TES01_0045_F10.b :
TES01_0038_E01.b :
OVRT1_0017_D11.b : ntttcttctgcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0110_A01.b :
TES01_0014_D12.b :
TES01_0030_A02.b :
TES01_0055_C10.b :
TES01_0038_H02.b :
TES01_0051_H05.b :
TES01_0031_B06.b :
TES01_0055_B03.b :
TES01_0112_C05.b :
TES01_0030_G01.b :
SMG01_0052_G07.b : nnggggttnnnnnnnggagtatagcagcxxxxxxxxxxxxxxxxxxxxxx
ITT01_0071_A02.b : nttgtgaacaxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_B06.b : ggtgcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0060_D05.b : nnccggttattnnnnggctaaagcagcxxxxxxxxxxxxxxxxxxxxx
ITT01_0031_H03.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0100_C05.b : nggatccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0074_A07.b :
TES01_0076_F01.b :
TES01_0078_H01.b :
TES01_0101_H03.b :
TES01_0063_E11.b :
TES01_0093_D01.b :
TES01_0070_H07.b :
TES01_0038_F06.b :
TES01_0069_G01.b :
TES01_0108_B06.b :
TES01_0094_A02.b :
TES01_0059_D01.b :
TES01_0101_G05.b :
TES01_0080_G06.b : nntt
TES01_0092_D02.b :
TES01_0097_F03.b :
TES01_0079_E04.b :
TES01_0097_C12.b :
TES01_0112_H06.b :
TES01_0103_H04.b :
TES01_0048_E03.b :
TES01_0062_G12.b :
TES01_0073_B06.b :
TES01_0064_H12.b :
TES01_0107_F01.b :
SPL01_0022_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0070_C08.b :
TES01_0079_A09.b :
TES01_0106_B02.b :
TES01_0064_C09.b :
TES01_0071_C02.b :
TES01_0107_G01.b :
TES01_0035_H03.b :
TES01_0080_E04.b :
TES01_0084_C09.b :
TES01_0054_G10.b :
TES01_0107_C11.b :
TES01_0058_B02.b :
TES01_0063_B07.b :
TES01_0086_H08.b :
TES01_0074_F12.b :
TES01_0041_H05.b :
TES01_0102_A05.b :
TES01_0034_F10.b :
TES01_0086_E02.b :
TES01_0106_C11.b :
TES01_0082_C03.b :
TES01_0059_F06.b :
TES01_0032_E05.b :
TES01_0089_E11.b :
TES01_0080_E05.b :
TES01_0060_H08.b :
TES01_0098_D09.b :
TES01_0024_G11.b :
TES01_0055_E02.b :
TES01_0055_E03.b :
TES01_0099_E03.b :
TES01_0082_C10.b :
TES01_0098_A01.b :
TES01_0107_F12.b :
TES01_0030_A04.b :
TES01_0099_C07.b :
TES01_0051_A01.b :
TES01_0106_B08.b :
TES01_0033_C04.b :
TES01_0026_G07.b :
TES01_0099_A12.b :
TES01_0049_C01.b :
TES01_0058_C09.b :
TES01_0083_C09.b :
TES01_0112_A09.b :
TES01_0025_H06.b : tt
TES01_0084_D05.b :
TES01_0044_B12.b :
TES01_0104_E05.b :
TES01_0104_B07.b :
TES01_0090_H04.b :
TES01_0013_H09.b :
TES01_0016_G08.b :
TES01_0026_E03.b :
TES01_0050_F03.b :
TES01_0042_C10.b :
TES01_0055_A07.b :
TES01_0054_G09.b :
TES01_0055_A09.b :
TES01_0015_E09.b :
TES01_0022_C01.b :
TES01_0042_H10.b :
ITT01_0081_E03.b : nnnggtgaacaxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0042_H12.b :
TES01_0010_H08.b :
TES01_0025_E02.b :
TES01_0097_D01.b :
TES01_0063_D02.b :
TES01_0084_D07.b :
TES01_0064_E02.b :
TES01_0070_D12.b :
TES01_0075_G01.b :
OVR01_0043_F06.b : ctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0099_H09.b :
TES01_0032_G05.b :
TES01_0080_E12.b :
TES01_0063_D07.b :
TES01_0109_C02.b : tttt
TES01_0075_B12.b :
TES01_0080_C02.b :
TES01_0094_E12.b :
TES01_0062_C12.b :
TES01_0040_D08.b :
TES01_0077_G03.b :
TES01_0076_C12.b :
TES01_0082_A05.b :
TES01_0066_E02.b :
TES01_0079_D06.b : nn
TES01_0068_A12.b :
TES01_0058_A04.b :
TES01_0107_E08.b :
TES01_0069_A09.b :
TES01_0095_C10.b :
TES01_0066_G09.b :
TES01_0032_H01.b :
TES01_0112_F05.b :
TES01_0088_E07.b :
TES01_0005_C11.b :
TES01_0061_C07.b :
TES01_0091_A09.b : nttttcctcgcgtggct
TES01_0058_A02.b :
TES01_0098_C05.b :
TES01_0067_B04.b :
TES01_0065_F08.b :
TES01_0023_A01.b :
TES01_0008_F05.b :
TES01_0029_G02.b :
TES01_0040_B01.b :
TES01_0029_H07.b :
TES01_0052_F08.b :
TES01_0035_H11.b :
TES01_0104_H12.b :
TES01_0097_E10.b :
TES01_0009_E03.b :
TES01_0009_F04.b :
TES01_0104_D08.b :
TES01_0012_H08.b :
TES01_0055_A06.b :
TES01_0014_E10.b :
TES01_0042_C11.b :
TES01_0015_F10.b :
TES01_0009_B04.b :
TES01_0097_G06.b :
TES01_0001_G12.b :
TES01_0034_D05.b :
TES01_0099_G02.b :
TES01_0070_H04.b :
TES01_0094_E10.b :
TES01_0108_C07.b :
TES01_0093_D07.b :
TES01_0027_H08.b :
TES01_0101_A12.b :
TES01_0096_A05.b :
TES01_0091_B03.b :
TES01_0097_G12.b :
TES01_0112_H03.b :
TES01_0093_E06.b :
TES01_0059_C07.b :
TES01_0052_C04.b :
TES01_0095_E07.b :
TES01_0040_B02.b :
TES01_0068_H11.b :
TES01_0024_H03.b :
TES01_0056_A06.b : t
TES01_0007_G04.b :
TES01_0010_C06.b :
TCH01_0085_B04.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0030_F07.b : nnnggtagtgacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0016_G09.b :
OVRT1_0048_E08.b : nnnnccgtctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0018_H11.b :
TES01_0005_C03.b :
TES01_0013_G09.b :
TES01_0038_D12.b :
TES01_0081_H12.b :
TES01_0064_C10.b :
TES01_0076_E11.b :
TES01_0107_D10.b : ntt
TES01_0096_H02.b :
TES01_0063_C01.b :
TES01_0088_G06.b :
TES01_0109_G09.b :
TES01_0081_E05.b :
TES01_0048_H06.b :
TES01_0100_B05.b :
TES01_0001_F11.b :
TES01_0040_G02.b :
TES01_0056_F09.b :
TES01_0059_D03.b :
TES01_0017_H12.b :
TES01_0032_F11.b :
TES01_0031_G12.b :
TES01_0027_C02.b :
TES01_0099_H12.b :
TES01_0015_G10.b :
TES01_0041_E03.b :
TES01_0050_C09.b :
TES01_0014_C07.b :
TES01_0016_B04.b :
TES01_0014_C02.b :
TES01_0015_G03.b :
TES01_0095_E12.b :
TES01_0063_E10.b :
TES01_0063_F09.b : ttactgcgttgcactgn
TES01_0072_C04.b :
TES01_0095_F08.b :
TES01_0037_D02.b :
TES01_0087_F09.b :
TES01_0110_A05.b :
TES01_0090_G09.b :
TES01_0028_C05.b :
TES01_0077_C05.b :
TES01_0046_B10.b :
TES01_0050_F02.b :
TES01_0091_B04.b :
TES01_0083_H05.b : tttttactgcgttgctctgg
TES01_0039_E05.b :
TES01_0042_H06.b :
TES01_0026_B08.b :
TES01_0029_C04.b :
TES01_0112_E06.b :
TES01_0021_H03.b :
TES01_0045_H11.b :
TES01_0055_D10.b :
TES01_0017_D01.b :
OVR01_0034_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0106_G01.b :
TES01_0021_E03.b :
TES01_0034_C07.b :
TES01_0009_E11.b :
TES01_0097_B06.b : n
TES01_0036_H12.b :
TES01_0042_A01.b :
TES01_0016_E01.b :
TES01_0009_F01.b :
TES01_0093_A07.b :
TES01_0077_B04.b :
TES01_0063_D06.b :
TES01_0100_D04.b :
TES01_0077_C04.b :
TES01_0069_F03.b :
TES01_0096_A04.b :
TES01_0094_B11.b :
TES01_0095_B04.b :
TES01_0112_C02.b :
TES01_0082_B09.b :
TES01_0048_A05.b :
TES01_0063_C05.b :
TES01_0110_B01.b :
TES01_0107_B05.b :
TES01_0084_B06.b :
TES01_0044_E09.b :
TES01_0080_F09.b : nngggt
TES01_0108_A06.b :
TES01_0099_D10.b :
TES01_0102_B03.b :
TES01_0096_A11.b :
TES01_0051_B11.b :
TES01_0005_G09.b :
TES01_0004_D06.b :
TES01_0003_G05.b :
TES01_0067_E04.b :
TES01_0027_E02.b :
TES01_0016_D01.b :
TES01_0015_C12.b :
TES01_0112_A01.b :
TES01_0055_B04.b : tttttcctcgcttggctatg
TES01_0047_H12.b :
TES01_0015_C05.b :
TES01_0016_G04.b :
TES01_0038_G01.b :
TES01_0010_E12.b :
TES01_0002_H05.b :
TES01_0073_B05.b :
OVRM1_0224_G09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0028_E06.b :
TES01_0082_B10.b :
TES01_0074_H01.b :
OVR01_0102_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0103_H03.b :
LVR01_0030_F08.b : tttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0087_E08.b :
TES01_0100_D03.b :
TES01_0087_F08.b :
TES01_0105_F02.b :
TES01_0105_H01.b :
TES01_0112_F02.b :
SMG01_0019_G11.b : ngggttttnnaanggatacagcagcxxxxxxxxxxxxxx
TES01_0095_A06.b :
TES01_0102_H12.b :
TES01_0093_D05.b :
LVR01_0039_H11.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0018_E09.b : nnggggtataaannnggatacagcagcxxxxxxxxxxxxxxxx
UTR01_0033_A04.b : cttttggggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_F05.b : cacttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_D11.b : gcattttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0023_F03.b :
TES01_0065_F09.b :
TES01_0059_B12.b :
TES01_0110_A11.b :
TES01_0051_A06.b :
TES01_0085_A10.b :
OVRT1_0034_E04.b : nggggcgtttgctgtacgatgttxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_E09.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0030_F05.b :
TES01_0065_B04.b :
LVR01_0097_C11.b : ttaaaagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0051_F08.b :
TES01_0009_G07.b :
TES01_0098_E09.b :
TES01_0046_F12.b :
ADR01_0007_C04.b : nnnttataacaxxxxxxxxxxxxxxxx
TES01_0045_D01.b :
TES01_0044_D12.b :
TES01_0035_F10.b :
TES01_0016_F01.b :
TES01_0039_E02.b :
TCH01_0029_C01.b : ntttggtagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0083_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0026_F05.b :
LVR01_0015_E02.b : ctttttggatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0030_F02.b :
TES01_0008_A09.b :
TES01_0104_A09.b :
TES01_0104_F07.b : n
TES01_0074_E02.b :
TES01_0035_F07.b :
TES01_0105_F06.b :
TES01_0095_H05.b :
TES01_0094_D08.b :
TES01_0100_B09.b :
TES01_0088_G01.b :
TES01_0086_F10.b :
TES01_0082_D01.b :
TES01_0036_C05.b :
TES01_0111_F03.b :
TES01_0049_G07.b :
TES01_0028_D09.b :
TES01_0014_H08.b :
TES01_0094_B04.b :
TES01_0051_B02.b :
TES01_0022_B11.b :
TES01_0068_F06.b :
TES01_0029_A06.b :
TES01_0104_C11.b :
TES01_0007_B07.b :
TES01_0019_F11.b :
TES01_0002_C05.b :
TES01_0056_B07.b :
TES01_0057_D10.b :
TES01_0008_C01.b :
TES01_0073_A07.b :
TES01_0093_A05.b :
TES01_0066_C10.b :
TES01_0047_G11.b :
TES01_0072_A01.b :
TES01_0058_B05.b :
TES01_0044_B10.b :
TES01_0060_B12.b :
TES01_0044_G05.b :
TES01_0039_F06.b :
TES01_0017_D03.b :
TES01_0018_H04.b :
TES01_0032_A11.b :
TES01_0011_B01.b :
TES01_0017_E10.b :
TES01_0024_F10.b :
TES01_0096_C11.b :
TES01_0040_E07.b :
TES01_0020_C03.b :
TES01_0018_B08.b :
TES01_0036_E11.b :
TES01_0081_F10.b :
TES01_0040_A04.b :
TES01_0032_H06.b :
TES01_0013_G07.b :
TES01_0005_F11.b :
TES01_0098_C01.b :
TES01_0006_H10.b :
TES01_0092_C12.b :
TES01_0020_H09.b :
TES01_0045_H06.b :
TES01_0099_A08.b :
TES01_0053_H08.b :
TES01_0080_C01.b :
TES01_0051_E02.b :
TES01_0013_C12.b :
TES01_0082_B08.b :
LVR01_0028_B08.b : tatgxxxxxxxxxxxxxxxxxxx
LVR01_0090_A01.b : gaggctctggtgxxxxxxxxxxxxxx
TES01_0071_H12.b :
TES01_0027_D03.b :
TES01_0072_E07.b :
TES01_0075_B08.b :
TES01_0023_B12.b :
20110601C-001686 : CAACTTCCCTGGGCGGGACTGGCCTTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
---------+---------+---------+---------+---------+---------+ 126
TES01_0078_H03.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
CLNT1_0067_B12.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
OVRM1_0015_G07.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
SMG01_0047_D04.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
OVR01_0004_H02.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
OVR01_0030_H02.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
ADR01_0092_F05.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0036_E04.b : C*ACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0043_B12.b : C*ACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0062_B10.b : C*ACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0101_B02.b : C*ACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TCH01_0071_A12.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
CLNT1_0055_E12.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0036_H08.b : C*ACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0009_E05.b : C*ACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
OVR01_0070_D12.b : CAACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0111_D02.b : TCACTTCCCTGGGCGGGACAGAACTCAGA*ACTTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0024_C12.b : gCACTTCCCTGGGCGGGACAGAACTC*GA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0042_C04.b : tCACTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0043_F06.b : tcACTTCC*TGGGCGGGAC**GAACTAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0002_H04.b : gcACTTCC*TGGGCGGGAC*GAACTCAGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TCH01_0045_G09.b : xxxCTTCCCTGGGCGGGACAGAACTCACA*CCCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0053_C12.b : tggACTTCCTGGGCGGGAC**GAACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0018_A01.b : gncACTTCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TCH01_0069_B06.b : xxxCTTCCCTGGGCGGGACAGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0019_F10.b : CTGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0041_B08.b : CTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0021_B12.b : CGTTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0062_G07.b : ttccgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0062_H04.b : tttttcctgcGTTGGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0063_C10.b : ttcgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0076_C04.b : tttcctgcTGTGGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0026_B11.b : TGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0085_E10.b : ccTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0052_G02.b : tctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0037_E05.b : TGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0081_C06.b : gcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0105_D07.b : ncctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0070_H12.b : nctattgtgcGTTGGCTATGGA*GACCGGNCTGCA*CATGCGGGCGGCGGGGC
TES01_0085_G02.b : ttttcctgcTGTGGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0087_H02.b : nntttcctgcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0030_F03.b : tttctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0108_G02.b : tttactgcTGTGGCTCTGGA*GACTGGTCTGCTACATGCGGGCGGCGGGGC
TES01_0096_C04.b : tttctcacGTTGGCTCTGGA*GACTGGTCTG*AACATGCGGGCGGCGGGGC
TES01_0108_C06.b : tcTGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0112_F06.b : ttttcctgcTGTGGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0022_H04.b : ctGTTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0083_F09.b : ntttactgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0111_F11.b : ttcctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0064_C05.b : ntcgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0019_F09.b : TGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0075_A10.b : ttcctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0087_G08.b : ncctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0088_E01.b : nnttcctgcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0096_A12.b : tttttcctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0067_H07.b : ncctgcTGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0082_E01.b : ttttactacGTTGGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0108_D01.b : ttttcctagcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0106_F12.b : ttactgcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0085_E01.b : nntttactgcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0037_C03.b : ttttcctgcTGTGGCTCTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0022_G03.b : tcctgcgTTGGCTATGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0033_B08.b : TGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0111_B08.b : ttttcacTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0022_C10.b : gctGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0092_B04.b : tttttttcgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0079_C02.b : nnnccgcTGTGGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0035_D12.b : tttcctgcTGTGGCTCTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0088_F06.b : nttcctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0019_D10.b : GTTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0047_G08.b : GTGGCTCTGGCA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0017_F05.b : cgcTGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0059_E07.b : nnnnncctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0035_H02.b : cgcgTTGGCTCTGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0067_D03.b : ttttcctgcTGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0108_A10.b : tttcctgcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0027_C03.b : ttccgcTGTGGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0067_B10.b : tttttcctgcgTTGGCTCTGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0045_H04.b : gcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0018_A08.b : ccTGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0007_B11.b : ccTGTGGCTCTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0005_A12.b : nttcctgcTGTGGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0058_F03.b : ncctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0050_E11.b : tttttcctgcGTTGGCTCTANA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0022_B10.b : gctGTTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0051_G06.b : ntttcgcGTTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0019_G01.b : nccgcTGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_A04.b : nnnncctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0051_H11.b : ntttctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0083_E09.b : ttttcctgcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0057_E02.b : nnnncctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0047_C01.b : gcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0047_C02.b : cTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0009_E08.b : ncctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0044_A05.b : ttcgcGTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0008_F03.b : gcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0065_D10.b : ttttcctgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0050_G04.b : nncccggcTGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0042_A03.b : cgcTGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0077_F01.b : GTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0073_F01.b : ttactgcgGTGGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0064_F11.b : ttttcctgcGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0003_E10.b : TTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0075_D08.b : nctgcgTTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0090_C11.b : tttagctgcTGTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0063_D12.b : ttacccTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0028_G08.b : tGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0109_E12.b : ntcgcgGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0106_G07.b : ttcctactTTGGCTCTGGA*GACCGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0027_E09.b : GTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0077_E11.b : ttttgcTGTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0109_H06.b : ttcctgcgTTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0081_F04.b : nctgcGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0022_G10.b : cgctgTTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0056_D12.b : ttttcctgcGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0100_B02.b : nttttgctgcGTGGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0026_G12.b : tGTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0095_F04.b : tttttcctactGTGGCTCTGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0063_H02.b : ttttcctgcGTGGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0091_B09.b : nnnnctggcGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0080_C05.b : nnnnaactacGTTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0106_C06.b : nttttcctactgTGGCTCTGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0097_E02.b : ttttacggcGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0100_H02.b : tttttactgcGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0084_E09.b : ttcccgcTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0046_C11.b : tTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0031_H06.b : cTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0056_E08.b : tttccgcTGTGGCTATANAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0101_G12.b : tttttctgcTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0023_G09.b : ccgcgTTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0082_C02.b : tttttcctacGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0102_D05.b : ttccgcTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0091_C09.b : nnnnggtggcggTGGCTCTGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0045_G06.b : TTGGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0045_G05.b : tTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0027_B03.b : cgTTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0047_D01.b : cacGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0020_A07.b : gTGGCTATGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0056_E05.b : nttttctgcGTGGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0040_C05.b : tttttcccgcGTTGGCTCTGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0019_G09.b : gcgtTGGCTCTGGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0044_H05.b : gcagTTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0051_A03.b : tttttcgcgTTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0004_A10.b : nctgcgGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0054_F01.b : tttcctgacGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0009_F08.b : ntcgcgGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0098_D02.b : nntttcctgcGTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0045_D03.b : ctTTGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0056_H11.b : ttttcctgacGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0012_G03.b : nccgcgtTGGCTCTGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0024_E06.b : nccacgTTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0004_A08.b : nttcgcgTTGGCTCTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0011_G02.b : ncccgcGTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0058_E01.b : nnncctgcgGTGGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0005_G05.b : ttttcgcgTTGGCTCTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0059_C08.b : tttttcctgcTGTTGCTCTGGAGACTGGTCCGCA*CATGCGGGCGGCGGGGC
TES01_0065_E07.b : ttttcctgctGTGGCTCTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0044_B11.b : cgctgTTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0110_E07.b : tttttcacTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0057_G11.b : tttccgcTGTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0024_H12.b : GTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0020_G09.b : tccgcGTTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0083_E07.b : ttttcctgaGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0010_G10.b : ntccgcTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0005_C07.b : ttcgcGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0003_H11.b : ttttcctgcTGTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0018_H02.b : nncgcGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0020_A11.b : tcgcGTTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0043_A12.b : GTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0087_A05.b : nnnnaactgcGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0008_F06.b : TGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0047_G10.b : nntttgcGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0010_H05.b : ncccgcGTTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0012_F03.b : ntcactgtgGCTCTGGGGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0036_B06.b : nttcctgcTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0001_H07.b : ttttcctgcTGTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0012_H07.b : ntttctacTGTGGCTTCGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0103_G01.b : nttttcctgcTGTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0045_A01.b : nttgcGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0008_E02.b : ncgcTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0023_E05.b : ctactTTGGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0042_E10.b : ttctgcTGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_E12.b : ntttcctgcTGTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0012_G07.b : nctgcTGTGGCTCTGGAGACTGGTCTGCA**CTGCGGGCGGCGGGGC
TES01_0010_A09.b : ntctgcGTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0028_C06.b : ttTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0026_A11.b : ttTGGCTCTGGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0025_E10.b : tGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0040_D11.b : cgacgcTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0025_E08.b : tGTGGCTCTGGAGACTGGTCTG**ACATGCGGGCGGCGGGGC
TES01_0094_D09.b : ttttttgtgagcTGGCTATGNA*AACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0040_F03.b : gctTTGGCTCTGGAGACCGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0040_B07.b : ttccgctGTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0071_G06.b : ttttccgcGTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0028_E08.b : tgTGGCTCTGGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0058_E10.b : gTTGGCTCTGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0090_H02.b : ttaatcgctgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0079_E11.b : tttttcctgcggTGGCTANGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0108_G09.b : tgtgcgTTGGCTCTGGGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0095_F02.b : tttttcctgcgTTGGCTCTGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0103_G07.b : ntttttggcGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0075_E10.b : ncctactTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0003_F10.b : ctgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0057_F04.b : nncctgctgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0096_E10.b : ttttcctggctgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_B08.b : ntacagctGTGGCTCTGGAGACTGGCCAGCA*CATGCGAGCGGCGGGGC
TES01_0024_G05.b : cgcttTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0027_B09.b : tTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0097_G05.b : nntttcctgcGTGGCTATGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0021_E11.b : cttTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0047_D12.b : tacgtTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0087_G11.b : tttcctgcgctGGCTCTGGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0096_G12.b : ttttactcgcggTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0108_B08.b : nttagctGTGGCTCTGAGAACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0029_E04.b : ctgctgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0098_F07.b : ntttctgcGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0099_F02.b : ttttcctgcGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0023_B08.b : ttccgctGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0003_F09.b : cgctgTGGCTCTGGA*TACCTGATCTGCACATGCGGGCGGCGGGGC
TES01_0101_D01.b : nntttactgcGTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0058_G02.b : ncctgacgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0026_G06.b : cactgTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0019_B07.b : TGGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0003_G12.b : nttcgctgTGGCTCTGGTGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0019_C07.b : GTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0027_G09.b : gctgTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0041_E06.b : cgcgGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0051_F04.b : ntttgacgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0035_E03.b : cccgcgtTGGCTCTGGTGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0022_H09.b : tcgcggTGGCTATGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0103_B04.b : ntttcctgcGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0006_F06.b : nccacgtTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0002_E09.b : ntcgcgtTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0005_A10.b : ttcctcactgTGGCTATGGCGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0021_E05.b : nnncctgctgTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0007_B10.b : nccgctgtTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0055_E06.b : tttttcctgctGTGGCTCTGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0023_D09.b : tccgcgGTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0042_D03.b : ctgTGGCTCTAGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0041_A05.b : ccgctgtgGCTCTGGGTCGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0024_A11.b : ctgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0007_H05.b : tttttgctgcGTGGCTATGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0018_F09.b : cgcgTTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0042_F02.b : TTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0020_B01.b : tttccgcgGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
PST01_0032_B05.b : GTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0028_G09.b : nctgcggTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0045_E01.b : tTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0035_B12.b : tggcggTGGCTCTGGAAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0017_E06.b : ctgTGGCTATGGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0028_A07.b : gcgtTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0038_E05.b : ntccgcgTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0012_H05.b : nttcacgtTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0005_B12.b : tttttgacgtTGGCTATGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0049_B01.b : nnttaactgcGTGGCTATGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0010_F01.b : nnncctacGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_G10.b : ntcacctgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_D11.b : nctgcgtTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0008_C07.b : cgctTTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0011_G11.b : nttcctactgTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0006_E09.b : ttcctgctgTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0016_D10.b : ntaccgctGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0049_H01.b : ttaaactgcgTGGCTATGGAAGCCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0001_C04.b : tttttttggctGTGGCTATGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0039_D11.b : tttttctgcgTGGCTCTGAGGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0013_F04.b : nnntttcacGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0009_D08.b : tttttcgcGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0013_D05.b : nnnnattgcgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_H04.b : nccggcgGTGGCTATGGAGACCGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0011_A02.b : tttttttcgcGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0043_H10.b : nnncctacgGTGGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0023_C01.b : nccgcgTTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0014_B04.b : nnnngctacGTGGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0012_D05.b : tttncctgcGTGGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0015_B04.b : nnncctactgTGGCTCTGTCGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0016_G02.b : ntttcgcgTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0011_G01.b : ttttncctgcgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0049_G05.b : tttggactacGTGGCTCTGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0002_H10.b : tttttgctgctgTGGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_D04.b : nnncctgctgTGGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0006_B04.b : ttttcctgctgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0016_B12.b : nnccttacgTGGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0046_F10.b : GGCTCTGGTGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0105_F10.b : nttcggctgtGGCTCTGGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0082_C06.b : tgctgtggctatgGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0071_A12.b : ttttaatgctgtGGCTCTGGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0107_G09.b : ttttgcctgcgttGCTATGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0062_B12.b : ttttgctgcgttgcactgGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
OVR01_0086_D04.b : xxxxxxxxxxxxxxxxxxxxGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0006_B09.b : tttctggctgttGCTATGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0089_G12.b : tttttcctgctgttGCTCTGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0045_F10.b : GGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0038_E01.b : GGCTCTGGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
OVRT1_0017_D11.b : xxxxxxxxxxxxxxxxxxxxGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0110_A01.b : tttcctgctgttGCTATGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0014_D12.b : tatcgcgttGCTCTGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGAC
TES01_0030_A02.b : ttttcctgctgttGCTCTGGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0055_C10.b : ntttcctgctgttGCTCTGGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0038_H02.b : GGCTATGGTGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0051_H05.b : tttttcctgcgtTGGCTATGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0031_B06.b : cgcggtggctcCAGAACTCAGAACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0055_B03.b : ttgtncctgcgtttGCTCTGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0112_C05.b : ttttttcgctgTGGCTCTGGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0030_G01.b : tttcccgctgttGCTCTGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
SMG01_0052_G07.b : xxxxxxxxxxxxxxxxxxxxGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
ITT01_0071_A02.b : xxxxxxxxxxxxxxxxxxxxGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
LVR01_0002_B06.b : xxxxxxxxxxxxxxxxxxxxGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
SMG01_0060_D05.b : xxxxxxxxxxxxxxxxxxxxGAACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
ITT01_0031_H03.b : xxxxxxxxxxxxxxxxxxxxCAGAACTCAGAACCTGTCTGCAACATGCGGGCGGCGGGGC
CLNT1_0100_C05.b : xxxxxxxxxxxxxxxxxtgaAGAACTCAGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0074_A07.b : cactgtGGCTACTGGGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0076_F01.b : ttttcctgctgttGCTCTGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0078_H01.b : ttacgacgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0101_H03.b : ntttcctgcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0063_E11.b : tccgctgttGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0093_D01.b : tttttcctcgctgttGCTCTGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0070_H07.b : nnttctacgttGCTCTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0038_F06.b : tttttcctgctgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0069_G01.b : nnncccgcgcttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0108_B06.b : attcgctttGGCTACTGGGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0094_A02.b : tttttcctgctgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0059_D01.b : nnnnncctgctgttGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0101_G05.b : ntttcctgcgttGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0080_G06.b : gattttnnttttcctgcgtttGCTCTGNA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0092_D02.b : ttttaactgctgttGCTCTGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0097_F03.b : ntttcctacgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0079_E04.b : nttttgctgctgttGCTCTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0097_C12.b : tttttttccagttGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0112_H06.b : ntttttggcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0103_H04.b : nnnnncctgctgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0048_E03.b : GCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0062_G12.b : ttttgctgcgttgctatgGAACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0073_B06.b : nttccagctgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0064_H12.b : tttttgctgcggttGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0107_F01.b : tttttcctgctgttGCTCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
SPL01_0022_B06.b : xxxxxxxxxxxxxxxxxxxxxGAACTCAGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0070_C08.b : tttttcctgctgttGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0079_A09.b : tttccactgcgttGCTCTGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0106_B02.b : ttttttcctgctgttGCTATGGA*AACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0064_C09.b : tttttactgcgttGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0071_C02.b : ttttgccggctgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0107_G01.b : ntttttcctgctgttGCTCTGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0035_H03.b : tttcctgctgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0080_E04.b : ntttgttcgcgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0084_C09.b : ttactgcggttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0054_G10.b : aacggcgctGCTCTGGA*GACACGTACGCT*CATGCGGGCGGCGGGGC
TES01_0107_C11.b : ntttcctaacgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0058_B02.b : nncccgctgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0063_B07.b : ttttcccgacgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0086_H08.b : nnnttactgcgtttGCTATGGAGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0074_F12.b : ttttcctgctgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0041_H05.b : ctgttGGCTCTGG*AACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0102_A05.b : nnnctgcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0034_F10.b : nctgcgttGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0086_E02.b : nnnnncctgctgttGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0106_C11.b : tttactgctgttGCTCTGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0082_C03.b : ttttcctgcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0059_F06.b : nnnnncctgctgttGCTCTGGA*GACTGGTCTGCA*CATGCGGACGGCGGGGC
TES01_0032_E05.b : tttctgcgtggctctgGAACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0089_E11.b : tttttcctagcgttGCTATGNAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0080_E05.b : nttttgctgcgttGCTATGGA*GACTGGTCTGCGACATGCGGGCGGCGGGGC
TES01_0060_H08.b : nnnnncctgcggtggctatgGAACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0098_D09.b : ttttcgcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0024_G11.b : gcgttGGCTACTGGGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0055_E02.b : tttggcctgctgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0055_E03.b : nttgnccttgcgttGCTATGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0099_E03.b : ntttcctgcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0082_C10.b : ttcctgctgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0098_A01.b : nttttactgcgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0107_F12.b : ttttcctagcgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0030_A04.b : tttccggctgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0099_C07.b : ttttcctgcgttGCTCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0051_A01.b : ttttactgctgttGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0106_B08.b : ttttactgctgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0033_C04.b : tttttccgcgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0026_G07.b : cgctgttGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0099_A12.b : tttttgctgcgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0049_C01.b : nnncctacgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0058_C09.b : ccactgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0083_C09.b : tttttgctgcgttggctctgGAACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0112_A09.b : tttcctgctgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0025_H06.b : tttcctgctgttgctatggacGAACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0084_D05.b : tttttcctgctgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0044_B12.b : tgtGGCTCTAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0104_E05.b : nnnnaactgcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0104_B07.b : tttttcctgcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0090_H04.b : tttatcctagcgtttGCTACGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0013_H09.b : nnntttctgctgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0016_G08.b : nnnnncctgctgttGCTATGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0026_E03.b : ttttcctgcgttGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0050_F03.b : ttttnnctgctgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0042_C10.b : tttttcctgcgttGCTCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0055_A07.b : tttttcctgctgttGCTATGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0054_G09.b : tttttcctgctgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0055_A09.b : tttttcctgctgttGCTCTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0015_E09.b : nnnnncctgctgttGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0022_C01.b : nncccgctgttGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0042_H10.b : tttttcctgctgttGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
ITT01_0081_E03.b : xxxxxxxxxxxxxxxxxxxxxGAACTCAGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0042_H12.b : tttttcctgctgttGCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0010_H08.b : tttttcctgctgttGCTATGGGGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0025_E02.b : gttggcTACTGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0097_D01.b : ttttataactgtGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0063_D02.b : ttttcctgcgttGCTATGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0084_D07.b : tttactgcagttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0064_E02.b : ntttcctgcgttgctaTGGGGCG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0070_D12.b : ttttcctgcgtggcacggagACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0075_G01.b : nttatcgctgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
OVR01_0043_F06.b : xxxxxxxxxxxcgttttactggACTCAGA*ACCTGGTCTGCAACATGCGGGCGCCTGGGC
TES01_0099_H09.b : nttttgctgcgttgctatggACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0032_G05.b : gctgttggcCTATGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0080_E12.b : tttttcctgctgttGCTATGGAGACTGGTTTGCA*CATGCGGGCGGCGGGGC
TES01_0063_D07.b : ttgcgctgtggctatggGACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0109_C02.b : cctgctgttgctatgtctggagACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0075_B12.b : tttcctgctgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0080_C02.b : nncctgcagttGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0094_E12.b : ttttactcgcgtggctctggagACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0062_C12.b : ttttcctgcgttgctcggagACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0040_D08.b : tttttcctgcgtggctctggACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0077_G03.b : cgcgttGCTCTGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0076_C12.b : tttcctgctgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0082_A05.b : ttccgctgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0066_E02.b : ttcctgctgttgctctggACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0079_D06.b : gggctttnnntttcctacgtttGCTCTGNAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0068_A12.b : ntctgcggtggctatgGGGGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0058_A04.b : nttcctgctgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0107_E08.b : ntttctactgttGCTCTGGATACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0069_A09.b : ttttcctgcgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0095_C10.b : ttttttcgcggtggctatggagACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0066_G09.b : ttactgctgttGCTCTGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0032_H01.b : nttcgcgttggctctgTCTGGAG*ACCTGGTCTGCAACATGCGGGCAGCGGGGC
TES01_0112_F05.b : ttttctgctgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0088_E07.b : nnttagcgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0005_C11.b : tttcctgctgttgctatatACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0061_C07.b : tttgcagttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0091_A09.b : ctggggttgttgacctactggaGAACTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0058_A02.b : nnnncctgctgttGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0098_C05.b : nntttcctgcgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0067_B04.b : tttttcctgctgtggctcTGGGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0065_F08.b : tttttcctgctgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0023_A01.b : tccgctgtggctctggagACTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0008_F05.b : GCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0029_G02.b : ttttactgctgttgctcTGGGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0040_B01.b : tcccgctgtggctctgGAACTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0029_H07.b : ttttttcctgctgttGCTATGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0052_F08.b : ttttccttgcgttGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0035_H11.b : tttcccgctgttGCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0104_H12.b : nttttactgctgttGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0097_E10.b : nttttcctacgttGCTATGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0009_E03.b : ttttcctgcgttGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0009_F04.b : nnncctgcgtGGCTCTGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0104_D08.b : nttttttggcgttGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0012_H08.b : ttttcctgctgttGCTATGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0055_A06.b : ttttttcctgctgttGCTCTGGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_E10.b : nncctgctgtGGCTCTGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0042_C11.b : ttttcctgctgttGCTCTGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0015_F10.b : tttttcctgctgttGCTCTGGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0009_B04.b : nttttttcgctgttGCTATGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0097_G06.b : nntttcccgcggtgctctggagACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0001_G12.b : tttttcctcggtgtggctCTGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0034_D05.b : ccgcagtggctctggagACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0099_G02.b : ttttctgcgtggctcgagACTCAGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0070_H04.b : ttttcctgcgtggctctggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0094_E10.b : nttactgctttggctctggagACTCCA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0108_C07.b : tggctgtggctctggCTGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0093_D07.b : ttttttgtcgctgttgctgggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0027_H08.b : tgtggctctggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0101_A12.b : ntttactgctgtggctctgGGGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0096_A05.b : tttcctcgcgtggctctggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0091_B03.b : nttttcctgctgtggctcTGGGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0097_G12.b : nttttactgcgttgctatgggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0112_H03.b : ttttatcgctgtggctcggagACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0093_E06.b : tttttccttctgttgctatggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0059_C07.b : tttttcctgcgttggctacgACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0052_C04.b : nnnggctcactttggctctggagACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0095_E07.b : ttttcctcacgtggctctggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0040_B02.b : nccgctgtggctctggacgACTCGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0068_H11.b : ttctgcgttggctatACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0024_H03.b : ttcgctgttgctatgttctgggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0056_A06.b : tttcctgcgttgctcggggatggACTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0007_G04.b : ntcgctgtgctaTGGGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0010_C06.b : ttttgctgttgctcTGGGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TCH01_0085_B04.b : xxxxxxxxxxxxxxxxxxxxxxxCTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TCH01_0030_F07.b : xxxxxxxxxxxxxxxxxxxxxxxCTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0016_G09.b : nnnnncctcgcgtggctctggACTCAGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
OVRT1_0048_E08.b : xxxxxxxxxxxxxxxxxxxxxxxCTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0018_H11.b : cgcgttgcCTCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0005_C03.b : tttttcgcggtggctcTGGGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0013_G09.b : nnnnttcgctgttGCTCTGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0038_D12.b : tttcctgctgttgctctgACTCAGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0081_H12.b : TCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0064_C10.b : nttctccttcgctTATGCAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0076_E11.b : ttttcgctgttgCTCGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0107_D10.b : agcatgctggctctgttactgggtACTCGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0096_H02.b : tttctggctgtggctatggaTCAGA*GCCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0063_C01.b : ttttcctgcgttgctatggccaCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0088_G06.b : ntttctgctgtggctACTGG*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0109_G09.b : natcgcgttggctctggATGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0081_E05.b : ggctgtggctatggCTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0048_H06.b : CTGGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0100_B05.b : nttttctgcgtggctcggagACTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0001_F11.b : nttcgcgttggctatggaTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0040_G02.b : cgctgttggctCTGGAGACCTGATCTGCAACATGCGGGCGGCGGGGC
TES01_0056_F09.b : tttcctgctgtggctctggACTCGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0059_D03.b : ttttncctgcgttggctctggaTCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0017_H12.b : cactgttggctaCTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0032_F11.b : ncccgctgtggctctGGGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0031_G12.b : ttttcctgacgttgctACTGG*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0027_C02.b : ttttcctgctgttgctctGGGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0099_H12.b : tttttgctgctgttgctACTGG*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0015_G10.b : nnttatcactgtggctctgGGGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0041_E03.b : ggctttggctctggACTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0050_C09.b : nnnttcctgctgttgctctggCTGGGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0014_C07.b : nttttcgctgtggctctgGGGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0016_B04.b : nnnttcactgtggctctggACTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0014_C02.b : ntttcccgctgtggctctggCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0015_G03.b : nnnncccgctgttgctctggCTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0095_E12.b : ttactgctgtggctatgggTCAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0063_E10.b : cactgtggctaCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0063_F09.b : cgagtccccttgtggcctactggtaCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0072_C04.b : tttcctgctgttgctctGGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0095_F08.b : ttttaatcactgtggctctGGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0037_D02.b : cgcgttggctctgaTCGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0087_F09.b : cactgtggctctggTGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0110_A05.b : nttggcgttggctACTGGGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0090_G09.b : tttttactgctgtggctctggaTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0028_C05.b : tttggctctggGGAT*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0077_C05.b : cgcgtggctctggaTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0046_B10.b : TGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0050_F02.b : nncctgcgttggctatggaTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0091_B04.b : ttttncctgcgtggctctggaTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0083_H05.b : tcatcacccttgtggcctactggtaCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0039_E05.b : ttttgctgcgttgctcggctGGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0042_H06.b : gctgtggctCTGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0026_B08.b : ccactgtggctctGGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0029_C04.b : ctgcgttggctctggaTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0112_E06.b : nnncctactgtggctctggCTCG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0021_H03.b : ttcctgctgtggctctggaTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0045_H11.b : tgtggctctggagacTCAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0055_D10.b : nttcctgcggtggctTGGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0017_D01.b : cgttggctCTGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
OVR01_0034_H06.b : xxxxxxxxxxxxxxxxctggactggCAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0106_G01.b : ntttgcctgcgttggctnggGGCA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0021_E03.b : tttcctgctgtggctctggaTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0034_C07.b : tttttcctgcggttggcatggTCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0009_E11.b : ttttcgcgttggcCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0097_B06.b : nggggtttnnnnnttccgcgttgcaCTGGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0036_H12.b : ttttaccgctgtggCTGGAGACTGGTCTGCA**ATGCGGGCGGCGGGGC
TES01_0042_A01.b : tttctgctgtggctACTGGGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0016_E01.b : nncctcgcgttggctACTGGGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0009_F01.b : nnncctgcgttgctctgTGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0093_A07.b : actacggtggctctggatacTCAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0077_B04.b : cgctgtggctaCTG*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0063_D06.b : tttctgagttgctctgaTCAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0100_D04.b : ntttccggcgtggctctggcGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0077_C04.b : taactgcgtggctctggggacCGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0069_F03.b : tttttcctgcgtggctatggcgagTCAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0096_A04.b : tttcctggcgtggctctgggacTCG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0094_B11.b : ttatcgcggtggctctggacCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0095_B04.b : ntttttcctgcgtttgctacGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0112_C02.b : ttttcccgctgtggctatGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0082_B09.b : ttctgctgtggctctggaTCGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0048_A05.b : GGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0063_C05.b : tttactgcgtggctctggacCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0110_B01.b : ttttcctcacttggctatGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0107_B05.b : tttttcctgctgtggctatGAG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0084_B06.b : ttttgctgcggtggctatGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0044_E09.b : tgcggtggctatgagcGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0080_F09.b : ttttnttttcctgcggttgctctggaTCGAACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0108_A06.b : tcctgctgtggctctggacTCG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0099_D10.b : tttttcccgctgttgctatgGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0102_B03.b : ttttcgcgttgctCTGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0096_A11.b : ttttcctcgcgtggctctggaTCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0051_B11.b : naatcgcgttggctctGAG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0005_G09.b : ncccgcggtggctctggtGGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0004_D06.b : ttttcgctgtggctatgaGGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0003_G05.b : ttttggcgttggctatggcgggcgCGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0067_E04.b : tttcctgcgtggctatggacTCG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0027_E02.b : nccgctgttgctctggacTCG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0016_D01.b : nnccctacgtggctctggaTCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0015_C12.b : tccgctgttgctctTGGAGACTGGTCTGCA**ATGCGGGCGGCGGGGC
TES01_0112_A01.b : tttttcctgctgtggctatggaTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0055_B04.b : gatgagtcgccttattgacctactggAGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0047_H12.b : nnncctgctgtggctcGGAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0015_C05.b : nnnttcgcgtggctctggaTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0016_G04.b : nncctgctgtggctctggaTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0038_G01.b : nnncctgcgttgctatggaTCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0010_E12.b : nnncctgcgtggctaTGGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0002_H05.b : tttttcctgctgtggctaGGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0073_B05.b : nttcgcgtggctatGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
OVRM1_0224_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0028_E06.b : tgtggctctggtatggagGG*AACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0082_B10.b : nctgctgttgctatgctCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0074_H01.b : ttcctgcgtggctctggggagatcGG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
OVR01_0102_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGGGGGGC
TES01_0103_H03.b : nttttgctgctgttgctatggatgaGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
LVR01_0030_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0087_E08.b : nttcacgttgctatggatCG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0100_D03.b : nntttccggcgttgctatggctGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0087_F08.b : nttttcctgcggtggctctGAGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0105_F02.b : ttttttcctgctgtggctatGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0105_H01.b : nnttttactgctgttgctatGA*GACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0112_F02.b : ttttttcgctgtggctctGAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
SMG01_0019_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0095_A06.b : ttttttcccgcgttggctacggGG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0102_H12.b : ttncctgctgtggctacGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0093_D05.b : tttttactcgctgtggctatGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
LVR01_0039_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
SMG01_0018_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
UTR01_0033_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
LVR01_0088_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
LVR01_0097_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0023_F03.b : gctgtggctatGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0065_F09.b : tttttcctgcgtttgctatgGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0059_B12.b : nnnnngctgctgttgctctgGG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0110_A11.b : nctgcgttggctctggagactCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0051_A06.b : ntagctgctgtggctctggactCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0085_A10.b : tttcctgcgtggctctggaactCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
OVRT1_0034_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
LVR01_0016_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0030_F05.b : ttctgcggtggctatggagactCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0065_B04.b : tttttcctgctgttgctctgggactCG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
LVR01_0097_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0051_F08.b : nttctactgtggctctggtAG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0009_G07.b : ttcctgcgttggctactCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0098_E09.b : tttcccacggttgctctggctGA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0046_F12.b : ttttcctgcgttgctctggaactCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
ADR01_0007_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0045_D01.b : acgttggctctggtCG*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0044_D12.b : cacgttggcTCGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0035_F10.b : ttttcctgctgtggctatgGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0016_F01.b : ntttctgcgtggctctggaactCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0039_E02.b : tttcctgctgttgctctggactCG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TCH01_0029_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0083_C06.b : nnnnnnnnnnnncctacgtttgctcgtGA*GACTGGNCTGC*ACATGCGGGCGGCGGGGC
TES01_0026_F05.b : tttttcctgctgttgctTGGGACTGGTCTGCA*CATGCGGGCGGCGGGGC
LVR01_0015_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0030_F02.b : tttcctgctgttgctatggacCGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0008_A09.b : cactttggctctggagacTCGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0104_A09.b : nttatactgctgtggcttcgGGAGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0104_F07.b : ttttcccgctgttgctctggtatggagGG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0074_E02.b : cgttggctctggcaA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0035_F07.b : ttccctgtggctctggctcG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0105_F06.b : tttttcctgcgttgctatggcggggtcAGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0095_H05.b : nnttcgtggctgttgctatG*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0094_D08.b : tttttcctgcggtggcactatAGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0100_B09.b : ncggctgttgctctggatcatA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0088_G01.b : nnnncctggcgtggctatGAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0086_F10.b : nnnaactactttggctactA*GACTGGTCTGCA*CATGCGGACGGCGGGGC
TES01_0082_D01.b : ttttactgcgtttgctctggggaccG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0036_C05.b : gctttggctatcG*AACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0111_F03.b : ttttcctgctgtggctatggcgcA*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0049_G07.b : nncctactgttgctctggagactcAGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0028_D09.b : ggctcTGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0014_H08.b : ttttnttcgctgttgctacgGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0094_B04.b : tttttcctgctgtggctatgnA*ACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0051_B02.b : tttttcctgctgtggctatgGAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0022_B11.b : ttggcA*GACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0068_F06.b : ncctgctgttgcactggaactcG*ACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0029_A06.b : ccgcgttggctctggtCGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0104_C11.b : tttttcctgctgtggctcggagactCGAACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0007_B07.b : ntcgcgtggctctggatcG*ACCTGGTCCGCAACATGCGGGCGGCGGGGC
TES01_0019_F11.b : cgcgttggctaCGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0002_C05.b : tttcctgctgtggctatggagactCGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0056_B07.b : tttcctgcgttggctctAGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0057_D10.b : ttcctacggtggctctgggggcgCGAACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0008_C01.b : nnccagcgttgctctggatCGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0073_A07.b : ntcccactttggctctGGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0093_A05.b : tgttcctggctgttgctctggactcGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0066_C10.b : nacagctgttggctAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0047_G11.b : caggggcaatggaccaGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0072_A01.b : ttttactgcgttgctctGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0058_B05.b : ncctactttggctcGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0044_B10.b : gcgctggctctggatcGAACTGGTCTGTA*CATGCGGGCGGCGGGGC
TES01_0060_B12.b : tttttcctgctgttgctcGAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0044_G05.b : gctgtggctctggagactcGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0039_F06.b : ttttcctgcgttgctatggcggnAACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0017_D03.b : ncctgcgttgctatggatcGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0018_H04.b : ntcgcgttggctatGGACTGGTCTGCA**CTGCGGGCGGCGGGGC
TES01_0032_A11.b : ttttcctgctgttgctatggGACCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0011_B01.b : ttttncctgcgtggctaAGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0017_E10.b : ttttccgcgtggctccgaactcGACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0024_F10.b : cgatgttggctcgAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0096_C11.b : tttttcctgcgttggctactgGACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0040_E07.b : ttcctgcgttgctctggctctACCTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0020_C03.b : ttggctctggCCCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0018_B08.b : tcgcgttggctactGACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0036_E11.b : ttttcctgctgttgctatgaAACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0081_F10.b : ACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0040_A04.b : tttcctgcggtggctcgtACTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0032_H06.b : tttttcctgctgttgctatCCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0013_G07.b : nntttacgcgtggctctggggggatagaACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0005_F11.b : tttcgctgtggctatatACTGGTCTGCAACATGCGGGCGGCGGGGC
TES01_0098_C01.b : nttttcctacgttgctatggCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0006_H10.b : ttttccgcggtggctctgggatctggCTGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0092_C12.b : ttttttactgtggctctgGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0020_H09.b : ctgtggctatggGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0045_H06.b : ctggagatcagacccGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0099_A08.b : tttttcctgcgttgctatgGGTCTGCA*CATGCGGGCGGCGGGGC
TES01_0053_H08.b : gtacattattaactagcgttggcctcgtgagacctGTCTGCACATGCGGGCGGCGGGGC
TES01_0080_C01.b : nttcccgagttggctctggctgnCTGCA*CATGCGGGCGGCGGGGC
TES01_0051_E02.b : naactgctgtggctatgggggctgnCTGCA*CATGCGGGCGGCGGGGC
TES01_0013_C12.b : nnncctactgtggctatgggctgnCTGCA*CATGCGGGCGGCGGGGC
TES01_0082_B08.b : ttcctgcggtggctctggtggtTGCA*CATGCGGGCGGCGGGGC
LVR01_0028_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0071_H12.b : nctggtgtgctgttgctactggcg
TES01_0027_D03.b : tttggctctggatcgagtcggcggccta
TES01_0072_E07.b : ncccgcggtggctct
TES01_0075_B08.b : tttccggctgttg
TES01_0023_B12.b : nctgcg
20110601C-001686 : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
---------+---------+---------+---------+---------+---------+ 184
TES01_0078_H03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
CLNT1_0067_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVRM1_0015_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
SMG01_0047_D04.b : AGTTACTGA*GGGTCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVR01_0004_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVR01_0030_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
ADR01_0092_F05.b : AGTTACTGA*GGGTCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0036_E04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0043_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0062_B10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0101_B02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TCH01_0071_A12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
CLNT1_0055_E12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0036_H08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVR01_0070_D12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0111_D02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0024_C12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0043_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0002_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TCH01_0045_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0053_C12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0018_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TCH01_0069_B06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0019_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0041_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0021_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0062_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0062_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_C10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0076_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0026_B11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0085_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0052_G02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0037_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0081_C06.b : AGTTACTGA*GGGCCTGTCTCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0105_D07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0070_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0085_G02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0087_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0030_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_G02.b : GGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0096_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_C06.b : AGTTACTGA*GGGCCTGC*TC*TAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0022_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0083_F09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0111_F11.b : AGTTACTGA*GGGCCTCC*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGC
TES01_0064_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0019_F09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0075_A10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0087_G08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0088_E01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0096_A12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0067_H07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGGAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_E01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0106_F12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0085_E01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0037_C03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCTAGCACCGGGGT
TES01_0022_G03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0033_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0111_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0022_C10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0092_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0079_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0035_D12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0088_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0019_D10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0047_G08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0017_F05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0059_E07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0035_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0067_D03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_A10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_C03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0067_B10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0018_A08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0007_B11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_A12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0050_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0022_B10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_G06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0019_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_A04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_H11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0083_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0057_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0047_C01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0047_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_E08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0044_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0008_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0065_D10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0050_G04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_A03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0077_F01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0073_F01.b : AGTTACTGA*GGGCCTGC*TCTCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0064_F11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0003_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0075_D08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0090_C11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_D12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0028_G08.b : AGTTACTGA*GGGCCTGTCTCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0109_E12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0106_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGT**AAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0077_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0109_H06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0081_F04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0022_G10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0056_D12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0100_B02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0026_G12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0095_F04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0091_B09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0080_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0106_C06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0097_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0100_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0084_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0046_C11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0031_H06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0056_E08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0101_G12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0023_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0102_D05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0091_C09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_G06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_B03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0047_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0020_A07.b : AGTTACTGA*GGGCC**T*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0056_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0019_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0044_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_A03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0004_A10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0054_F01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_F08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0098_D02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_D03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0056_H11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0012_G03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0024_E06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0004_A08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0011_G02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_E01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0059_C08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0065_E07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0044_B11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0110_E07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0057_G11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0024_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0020_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0083_E07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0010_G10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0003_H11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0018_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0020_A11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0043_A12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0087_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0008_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0047_G10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0010_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0012_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0036_B06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0001_H07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0012_H07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0103_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACTGGGGT
TES01_0045_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0008_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0023_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_E12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0012_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0010_A09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0028_C06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0026_A11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0025_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_D11.b : AGTTACTGA*GGGCCTGC*CCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGTG
TES01_0025_E08.b : AGTTACTGA*GGGCCTGTCTCCTAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGC
TES01_0094_D09.b : AGTTACTGA*GGGCCCGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGT**AAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_B07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0071_G06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0028_E08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_E10.b : AGTTACTGA*GGGCCTGT*TCCCATACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0090_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0079_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_G09.b : AGTTACTGA*GGGCCTGC*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0095_F02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0103_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0075_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0003_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0057_F04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0096_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_B08.b : AGTTACTGA*AGGCCTGT*TCCCATACTTGGAAGTCGGTGCGGATGGCCAGCACCGGGCG
TES01_0024_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_B09.b : AGTTACTGA*GGGCCTGC*TCCCAGACGTGGAAGTCGGAGCGGATGGCCAGCACCGGGGT
TES01_0097_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0021_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0047_D12.b : AATTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0087_G11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0096_G12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0029_E04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0098_F07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGATGCGGATGGCCAGCACCGGGGT
TES01_0099_F02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0023_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0003_F09.b : AGTTACTGA*GGGCCTGT*TCCCAGACTTGGAAGTCGGTGCGGATGGCCAGCACCTGGGT
TES01_0101_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_G02.b : AGTTACTGA*GGGCCTGT*CCCCTGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0026_G06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0019_B07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0003_G12.b : AGTTACCGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0019_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0041_E06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_F04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGC
TES01_0035_E03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0022_H09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0103_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0006_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0002_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_A10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0021_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0007_B10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_E06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0023_D09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_D03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0041_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0024_A11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0007_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0018_F09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_F02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0020_B01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
PST01_0032_B05.b : AGTTACTGA*GGGCCTG**CCCCTGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0028_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_E01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0035_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0017_E06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0028_A07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0038_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0012_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0049_B01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0010_F01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_G10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_D11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0008_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0011_G11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0006_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_D10.b : GGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0049_H01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0001_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0039_D11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0013_F04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_D08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0013_D05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGT**AAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0011_A02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0043_H10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0023_C01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0012_D05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0015_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_G02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0011_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0049_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0002_H10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_D04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0006_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0046_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0105_F10.b : AGTTACTGA*GGGCCCCC*TTC*AGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_C06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0071_A12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0107_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0062_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVR01_0086_D04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0006_B09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0089_G12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0038_E01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVRT1_0017_D11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0110_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCATCGGGGT
TES01_0014_D12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0030_A02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_C10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0038_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0031_B06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_B03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0030_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
SMG01_0052_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
ITT01_0071_A02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0002_B06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
SMG01_0060_D05.b : AGTTACTGA*GGGTCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
ITT01_0031_H03.b : AGTTACTGA*GGGTCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
CLNT1_0100_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0074_A07.b : AGTTACTGA*GGGCCTGC*CCTTTAACGTGGAAGTCGGAGCGGATGGCCAGCACCGGGGT
TES01_0076_F01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0078_H01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0101_H03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0093_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0070_H07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0038_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0069_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_B06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0094_A02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0059_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0101_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0080_G06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0092_D02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0097_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0079_E04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0097_C12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_H06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0103_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0048_E03.b : AGTTACTGA*GGGCCTGTCTCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0062_G12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0073_B06.b : AGTTACTGA*GGGCCTGC*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0064_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0107_F01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
SPL01_0022_B06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0070_C08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0079_A09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0106_B02.b : AGTTACTGA*GGGCCTGC*TCT*AGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0064_C09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0071_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0107_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0035_H03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0080_E04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0084_C09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0054_G10.b : AGTTACTGA*GGGCCTGT*CCCTATACATGTAAGTCGGTGCGGATGGTCACCACCGGGGT
TES01_0107_C11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_B02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_B07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0086_H08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0074_F12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0041_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0102_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0034_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACTTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0086_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0106_C11.b : AGTTACTGA*GGGCCTGC*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_C03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAGGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0059_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0032_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0089_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0080_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0060_H08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0098_D09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0024_G11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_E02.b : AGTTACTGA*GGGCCTGC*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_E03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0099_E03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_C10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0098_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0107_F12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0030_A04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0099_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0106_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0033_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0026_G07.b : AGTTACTGA*GGGCCTGC*TCT*AGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0099_A12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0049_C01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_C09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0083_C09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_A09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0025_H06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0084_D05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0044_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0104_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0104_B07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0090_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0013_H09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_G08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0026_E03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0050_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_C10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_A07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0054_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_A09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0015_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0022_C01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_H10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
ITT01_0081_E03.b : AGTTACTGA*GGGTCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0010_H08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0025_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0097_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_D02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGAGT
TES01_0084_D07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0064_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0070_D12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0075_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVR01_0043_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0099_H09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0032_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0080_E12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_D07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0109_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0075_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0080_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0094_E12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0062_C12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_D08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0077_G03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0076_C12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0066_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0079_D06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0068_A12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_A04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0107_E08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0069_A09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0095_C10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0066_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0032_H01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_F05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0088_E07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_C11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0061_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0091_A09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_A02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0098_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0067_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0065_F08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0023_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0008_F05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0029_G02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_B01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0029_H07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0052_F08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0035_H11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0104_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0097_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_E03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCGCCGGGGT
TES01_0009_F04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0104_D08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0012_H08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_A06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_C11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0015_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0097_G06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0001_G12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0034_D05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0099_G02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0070_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0094_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGCCGG
TES01_0093_D07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_H08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0101_A12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0096_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0091_B03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0097_G12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_H03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0093_E06.b : AGTTACTGA*GGGCCTGT*TCTCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0059_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0052_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0095_E07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCTGATGGCCAGCACCGGGGT
TES01_0040_B02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0068_H11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0024_H03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0056_A06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0007_G04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0010_C06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TCH01_0085_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TCH01_0030_F07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVRT1_0048_E08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0018_H11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_C03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0013_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0038_D12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0081_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0064_C10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0076_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0107_D10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0096_H02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_C01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0088_G06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0109_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0081_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0048_H06.b : AGTTACTGA*GGGCCTGTCTCTTAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0100_B05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0001_F11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_G02.b : AGTTACTGA*GGGCCTGT*CCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0056_F09.b : AGTTACTGA*GGGCCTGT*CCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0059_D03.b : AGTTGCTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0017_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0032_F11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0031_G12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0099_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0015_G10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0041_E03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0050_C09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0015_G03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0095_E12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_F09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0072_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0095_F08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0037_D02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0087_F09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCCGGGT
TES01_0110_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0090_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0028_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0077_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0046_B10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0050_F02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCCGGGT
TES01_0091_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0083_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0039_E05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_H06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0026_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0029_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_E06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0021_H03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_H11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_D10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0017_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVR01_0034_H06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0106_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0021_E03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0034_C07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0097_B06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0036_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0042_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_E01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_F01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0093_A07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0077_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_D06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0100_D04.b : AGTTACCGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0077_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0069_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0096_A04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0094_B11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0095_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_C02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_B09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0048_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0063_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0110_B01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0107_B05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0084_B06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0044_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0080_F09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0108_A06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCCGGGT
TES01_0099_D10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0102_B03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0096_A11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_B11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0004_D06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0003_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0067_E04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_D01.b : AGTTACTGA*GGCCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCCGTGT
TES01_0015_C12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0055_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0047_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0015_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_G04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0038_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0010_E12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0002_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0073_B05.b : AGTTACTGA*GGGCCTGT*CCCCTGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVRM1_0224_G09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0028_E06.b : AGTTACTGCCGGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_B10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0074_H01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVR01_0102_F09.b : AGTTACTGA*GGGCCTGT*TCCCAAACTTGGAAGACGGTGCGGATGGCCACCACCGGGGT
TES01_0103_H03.b : AGTTACTGA*GCGTTTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCTTGGT
LVR01_0030_F08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0087_E08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0100_D03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGCCGGTGCGGATGGCCAGCACCGGGGT
TES01_0087_F08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0105_F02.b : AGTTACTGA*GGGCCTGT*TCCCTGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0105_H01.b : AGTTACTGA*GGGCCTGT*TCCT*GACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0112_F02.b : AGTTACTGA*GGGCCTGC*TCTTAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGC
SMG01_0019_G11.b : AGTTACTGA*GGGTCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0095_A06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0102_H12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0093_D05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0039_H11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
SMG01_0018_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
UTR01_0033_A04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0088_F05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0097_D11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0023_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0065_F09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0059_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0110_A11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_A06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0085_A10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
OVRT1_0034_E04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0016_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0030_F05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0065_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0097_C11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_F08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0009_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0098_E09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGAG
TES01_0046_F12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
ADR01_0007_C04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0044_D12.b : AGTCACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0035_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0016_F01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0039_E02.b : AGTTACTGA*GGGCCTGC*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TCH01_0029_C01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0083_C06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0026_F05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0015_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0030_F02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0008_A09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCAGTGCGGATGGCCAGCACCGGGGT
TES01_0104_A09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0104_F07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0074_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGC
TES01_0035_F07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0105_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCTAGCACCGGGGT
TES01_0095_H05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0094_D08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0100_B09.b : AGTTATTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0088_G01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0086_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_D01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0036_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0111_F03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0049_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0028_D09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0014_H08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0094_B04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0051_B02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0022_B11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0068_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0029_A06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0104_C11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0007_B07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0019_F11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0002_C05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0056_B07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0057_D10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0008_C01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0073_A07.b : AGTTACTGA*GGGCCTGT*TCCCTTACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0093_A05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0066_C10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0047_G11.b : AGTTACTGG*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0072_A01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0058_B05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGC
TES01_0044_B10.b : AGTTACTGA*TGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGTGT
TES01_0060_B12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0044_G05.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0039_F06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0017_D03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0018_H04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0032_A11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0011_B01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0017_E10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0024_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGC
TES01_0096_C11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_E07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0020_C03.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0018_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0036_E11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0081_F10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0040_A04.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0032_H06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0013_G07.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0005_F11.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0098_C01.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0006_H10.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0092_C12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0020_H09.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0045_H06.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0099_A08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0053_H08.b : AGTTACTGA*GGGCCTGC*CCCCATACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0080_C01.b : AGTTACTGA*GGGCCTGT*TCCCACACTTGGAAGTCGGTACGGATGGCCAGCACCGGGGT
TES01_0051_E02.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0013_C12.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0082_B08.b : AGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0028_B08.b : xGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
LVR01_0090_A01.b : xGTTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0071_H12.b : gagTACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0027_D03.b : ctggACTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0072_E07.b : gagttaTGA*GGGCCTGT*TCCCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0075_B08.b : ctctggactgaGGCCTGT*T*CCAGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
TES01_0023_B12.b : ttggctatggaGGCCTGT*TCC*AGACGTGGAAGTCGGTGCGGATGGCCAGCACCGGGGT
20110601C-001686 : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
---------+---------+---------+---------+---------+---------+ 240
TES01_0078_H03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
CLNT1_0067_B12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVRM1_0015_G07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
SMG01_0047_D04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVR01_0004_H02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVR01_0030_H02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
ADR01_0092_F05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0036_E04.b : *GGAGCGCCGAAAACCGCTG*GAGAATGAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0043_B12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0062_B10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0101_B02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TCH01_0071_A12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
CLNT1_0055_E12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0036_H08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_E05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVR01_0070_D12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0111_D02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0024_C12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_C04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0043_F06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0002_H04.b : *GGAGCGCCGAAAACCGCCC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TCH01_0045_G09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0053_C12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0018_A01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TCH01_0069_B06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0019_F10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0041_B08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0021_B12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0062_G07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0062_H04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_C10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0076_C04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0026_B11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0085_E10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0052_G02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0037_E05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0081_C06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0105_D07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0070_H12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0085_G02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0087_H02.b : *GGAGCGCCGAAAACCGCTG*GAGGATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0030_F03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0108_G02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_C04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0108_C06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_F06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0022_H04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0083_F09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0111_F11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0064_C05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0019_F09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCGCTA**GTAACAGCCTCCACTGACG
TES01_0075_A10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0087_G08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0088_E01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_A12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0067_H07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_E01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0108_D01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0106_F12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0085_E01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0037_C03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0022_G03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0033_B08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0111_B08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0022_C10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0092_B04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0079_C02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0035_D12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0088_F06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0019_D10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0047_G08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0017_F05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0059_E07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0035_H02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0067_D03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0108_A10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_C03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0067_B10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0045_H04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0018_A08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0007_B11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_A12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0058_F03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0050_E11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0022_B10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_G06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0019_G01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_A04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAACCTCCACTGACG
TES01_0051_H11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0083_E09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0057_E02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0047_C01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0047_C02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_E08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0044_A05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0008_F03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0065_D10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0050_G04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_A03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0077_F01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0073_F01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0064_F11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0003_E10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0075_D08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0090_C11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_D12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0028_G08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0109_E12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0106_G07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_E09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0077_E11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0109_H06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0081_F04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0022_G10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0056_D12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0100_B02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0026_G12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_F04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_H02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCGCTA**GTAACAGCCTCCACTGACG
TES01_0091_B09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0080_C05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0106_C06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0100_H02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0084_E09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0046_C11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0031_H06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0056_E08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0101_G12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0023_G09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_C02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0102_D05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0091_C09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0045_G06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0045_G05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_B03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0047_D01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0020_A07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0056_E05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_C05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0019_G09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0044_H05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_A03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0004_A10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0054_F01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_F08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0098_D02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0045_D03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0056_H11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0012_G03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0024_E06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0004_A08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0011_G02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0058_E01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_G05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0059_C08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0065_E07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0044_B11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0110_E07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0057_G11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0024_H12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0020_G09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0083_E07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0010_G10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_C07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0003_H11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0018_H02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0020_A11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0043_A12.b : *GGAGCGCCGAAAACCGCTC*GGGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0087_A05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0008_F06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0047_G10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0010_H05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0012_F03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0036_B06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0001_H07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0012_H07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0103_G01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACCGACG
TES01_0045_A01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0008_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0023_E05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_E10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_E12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0012_G07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0010_A09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0028_C06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0026_A11.b : *GGGGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0025_E10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_D11.b : CGGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0025_E08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0094_D09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_F03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_B07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0071_G06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0028_E08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0058_E10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0090_H02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0079_E11.b : *GGGGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0108_G09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_F02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0103_G07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0075_E10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCAGTA**GTAACAGCCTCCACTGACG
TES01_0003_F10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0057_F04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_E10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_B08.b : TGGAGCGCCTAATACCTCTGCGAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACA
TES01_0024_G05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_B09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_G05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0021_E11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0047_D12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0087_G11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_G12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0108_B08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0029_E04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0098_F07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_F02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0023_B08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0003_F09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0101_D01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0058_G02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0026_G06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACT
TES01_0019_B07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0003_G12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0019_C07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_G09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0041_E06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_F04.b : *AGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0035_E03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACCA**GTAACAGCCTCCACTGACG
TES01_0022_H09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0103_B04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0006_F06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0002_E09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_A10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0021_E05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0007_B10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_E06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0023_D09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_D03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0041_A05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0024_A11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0007_H05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0018_F09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_F02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0020_B01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
PST01_0032_B05.b : *GCATCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0028_G09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA*****ACAGCCTCCACTGACG
TES01_0045_E01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0035_B12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0017_E06.b : *GGGGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0028_A07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0038_E05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0012_H05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_B12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0049_B01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0010_F01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_G10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_D11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0008_C07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0011_G11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0006_E09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_D10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0049_H01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0001_C04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0039_D11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0013_F04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_D08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0013_D05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_H04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0011_A02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0043_H10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0023_C01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_B04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0012_D05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0015_B04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_G02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0011_G01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0049_G05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0002_H10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_D04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0006_B04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_B12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0046_F10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0105_F10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_C06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0071_A12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0107_G09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0062_B12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVR01_0086_D04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0006_B09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0089_G12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0045_F10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0038_E01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVRT1_0017_D11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0110_A01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_D12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0030_A02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGTCG
TES01_0055_C10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0038_H02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_H05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0031_B06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_B03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_C05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0030_G01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
SMG01_0052_G07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
ITT01_0071_A02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0002_B06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
SMG01_0060_D05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
ITT01_0031_H03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
CLNT1_0100_C05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0074_A07.b : *GCTTCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0076_F01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0078_H01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0101_H03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_E11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCGCTA**GTAACAGCCTCCACTGACG
TES01_0093_D01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0070_H07.b : *GGAGCGCCTAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0038_F06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0069_G01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTAGGGTAACAGCCTCCACTGACG
TES01_0108_B06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0094_A02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0059_D01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0101_G05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0080_G06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0092_D02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_F03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0079_E04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_C12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_H06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0103_H04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0048_E03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0062_G12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0073_B06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0064_H12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0107_F01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
SPL01_0022_B06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0070_C08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0079_A09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0106_B02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0064_C09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0071_C02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0107_G01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0035_H03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0080_E04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0084_C09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0054_G10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAATGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0107_C11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0058_B02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_B07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0086_H08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGATGGCACTA**GTAACAGCCTCCACTGACG
TES01_0074_F12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0041_H05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0102_A05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0034_F10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0086_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0106_C11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_C03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0059_F06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0032_E05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0089_E11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0080_E05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0060_H08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0098_D09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0024_G11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_E03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_E03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_C10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0098_A01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0107_F12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0030_A04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_C07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_A01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0106_B08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0033_C04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0026_G07.b : *GTAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_A12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0049_C01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0058_C09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0083_C09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_A09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0025_H06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0084_D05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0044_B12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0104_E05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0104_B07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0090_H04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0013_H09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_G08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0026_E03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0050_F03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCGCTA**GTAACAGCCTCCACTGACG
TES01_0042_C10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_A07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0054_G09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_A09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0015_E09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0022_C01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_H10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
ITT01_0081_E03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_H12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0010_H08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0025_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_D01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_D02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0084_D07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0064_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0070_D12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0075_G01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVR01_0043_F06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_H09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0032_G05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0080_E12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_D07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0109_C02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0075_B12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0080_C02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0094_E12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0062_C12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_D08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0077_G03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGTCTCCACTGACG
TES01_0076_C12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_A05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0066_E02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0079_D06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0068_A12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAACCTCCACTGACG
TES01_0058_A04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTAGGGTAACAGCCTCCACTGACG
TES01_0107_E08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAATGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0069_A09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_C10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0066_G09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0032_H01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_F05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0088_E07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_C11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0061_C07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0091_A09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0058_A02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0098_C05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0067_B04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0065_F08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0023_A01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0008_F05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0029_G02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_B01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0029_H07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0052_F08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0035_H11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0104_H12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_E10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_E03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_F04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0104_D08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0012_H08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_A06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_E10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_C11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0015_F10.b : *GGAGCGCTGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_B04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_G06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0001_G12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0034_D05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_G02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0070_H04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0094_E10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0108_C07.b : TGGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0093_D07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_H08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0101_A12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_A05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0091_B03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_G12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_H03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0093_E06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0059_C07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0052_C04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_E07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_B02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0068_H11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0024_H03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0056_A06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0007_G04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0010_C06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TCH01_0085_B04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TCH01_0030_F07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_G09.b : *GGAGCGCCGAAAACCGCCG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVRT1_0048_E08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0018_H11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_C03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0013_G09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0038_D12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0081_H12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0064_C10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0076_E11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0107_D10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_H02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_C01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0088_G06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0109_G09.b : *GGAGCGCCGAAAACCGCTC*GAGAACAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0081_E05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0048_H06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0100_B05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0001_F11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_G02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0056_F09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0059_D03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0017_H12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0032_F11.b : *GGAGCGCCGAAAACCGCTC*GAGAGTAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0031_G12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_C02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_H12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0015_G10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0041_E03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0050_C09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_C07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_B04.b : *GGGGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_C02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAACCTCCACTGACG
TES01_0015_G03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_E12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_E10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_F09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGATG
TES01_0072_C04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_F08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0037_D02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0087_F09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0110_A05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0090_G09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACGGCCTCCACTGACG
TES01_0028_C05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0077_C05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0046_B10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0050_F02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0091_B04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0083_H05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0039_E05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAAGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_H06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0026_B08.b : *GGGGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0029_C04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_E06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GAAACAGCCTCCACTGACG
TES01_0021_H03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0045_H11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_D10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0017_D01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVR01_0034_H06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0106_G01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0021_E03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0034_C07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_E11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0097_B06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0036_H12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0042_A01.b : *GGAGCGCCGAAGACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_E01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_F01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0093_A07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0077_B04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_D06.b : *GGAGCGCCGAAAACCGTTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0100_D04.b : *GGAACGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0077_C04.b : TGGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0069_F03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_A04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0094_B11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_B04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_C02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_B09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0048_A05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0063_C05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0110_B01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0107_B05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0084_B06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0044_E09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0080_F09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0108_A06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_D10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0102_B03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_A11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_B11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_G09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0004_D06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0003_G05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0067_E04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_D01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGGCG
TES01_0015_C12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_A01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0055_B04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0047_H12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0015_C05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_G04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0038_G01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0010_E12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0002_H05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0073_B05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVRM1_0224_G09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0028_E06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_B10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0074_H01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVR01_0102_F09.b : *GGAGCGCCAAAAACCGCTG*GAAAATAAGGGGGCACTA**GTAACAGCCTCCACTGACG
TES01_0103_H03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0030_F08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0087_E08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0100_D03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0087_F08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGACACTA**GTAACAGCCTCCACTGACG
TES01_0105_F02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0105_H01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0112_F02.b : *GTAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
SMG01_0019_G11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_A06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0102_H12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0093_D05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0039_H11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAACCTCCACTGACG
SMG01_0018_E09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
UTR01_0033_A04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0088_F05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0097_D11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0023_F03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0065_F09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0059_B12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0110_A11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_A06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0085_A10.b : *GGAGCGCCGAAAACCGCTC*GAGGATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
OVRT1_0034_E04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0016_E09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGGCG
TES01_0030_F05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0065_B04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0097_C11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_F08.b : *GGAGCGCCGAAAACCGCTC*GGGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0009_G07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0098_E09.b : TGGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0046_F12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
ADR01_0007_C04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0045_D01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0044_D12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0035_F10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0016_F01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0039_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TCH01_0029_C01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0083_C06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0026_F05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0015_E02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0030_F02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0008_A09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0104_A09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0104_F07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0074_E02.b : TGGAGCGCCTAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0035_F07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0105_F06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0095_H05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0094_D08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0100_B09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0088_G01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0086_F10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_D01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0036_C05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0111_F03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0049_G07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0028_D09.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0014_H08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0094_B04.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_B02.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0022_B11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0068_F06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0029_A06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0104_C11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0007_B07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0019_F11.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0002_C05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0056_B07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0057_D10.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0008_C01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0073_A07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0093_A05.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0066_C10.b : *GGAGCGCCCAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0047_G11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0072_A01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0058_B05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0044_B10.b : *GGAGCGCCTAATACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0060_B12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0044_G05.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACCA**GTAACAGCCTCCACTGACG
TES01_0039_F06.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0017_D03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0018_H04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0032_A11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0011_B01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0017_E10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0024_F10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0096_C11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_E07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0020_C03.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0018_B08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0036_E11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0081_F10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0040_A04.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0032_H06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0013_G07.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0005_F11.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0098_C01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0006_H10.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAGCAGCCTCCACTGACG
TES01_0092_C12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0020_H09.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0045_H06.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0099_A08.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0053_H08.b : GGCACCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0080_C01.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0051_E02.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0013_C12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0082_B08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0028_B08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
LVR01_0090_A01.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0071_H12.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0027_D03.b : *GGAGCGCCGAAAACCGCTG*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0072_E07.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0075_B08.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
TES01_0023_B12.b : *GGAGCGCCGAAAACCGCTC*GAGAATAAGGTGGCACTA**GTAACAGCCTCCACTGACG
20110601C-001686 : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
---------+---------+---------+---------+---------+---------+ 300
TES01_0078_H03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
CLNT1_0067_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVRM1_0015_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
SMG01_0047_D04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVR01_0004_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVR01_0030_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
ADR01_0092_F05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0036_E04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0043_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0062_B10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0101_B02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TCH01_0071_A12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
CLNT1_0055_E12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0036_H08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVR01_0070_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0111_D02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0024_C12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0043_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0002_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TCH01_0045_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0053_C12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0018_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TCH01_0069_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0019_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0041_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0021_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0062_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0062_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_C10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0076_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0026_B11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0085_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0052_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0037_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0081_C06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0105_D07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0070_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0085_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0087_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0030_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_C06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGGTGGGGCCCACGTGGTGGTCAGCA
TES01_0112_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0022_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0083_F09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0111_F11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0064_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0019_F09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0075_A10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0087_G08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0088_E01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_A12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0067_H07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_E01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0106_F12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0085_E01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0037_C03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0022_G03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0033_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0111_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0022_C10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0092_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0079_C02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0035_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0088_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0019_D10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0047_G08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0017_F05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0059_E07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0035_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0067_D03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_A10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_C03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0067_B10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0018_A08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0007_B11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_A12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0050_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0022_B10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_G06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0019_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_A04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_H11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0083_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0057_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0047_C01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0047_C02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_E08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0044_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0008_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0065_D10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0050_G04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_A03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0077_F01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0073_F01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0064_F11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0003_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0075_D08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0090_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0028_G08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGCGGTCAGCA
TES01_0109_E12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0106_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0077_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0109_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0081_F04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0022_G10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0056_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCATGATGGGGCCCACGTGGTGGTCAGCA
TES01_0100_B02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0026_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0095_F04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0091_B09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0080_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0106_C06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_E02.b : GGATCGGCCCCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0100_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0084_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0046_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0031_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0056_E08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0101_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0023_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_C02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0102_D05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0091_C09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_G06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_B03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0047_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0020_A07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0056_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0019_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0044_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_A03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0004_A10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0054_F01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_F08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0098_D02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_D03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0056_H11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0012_G03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0024_E06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0004_A08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0011_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_E01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0059_C08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0065_E07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0044_B11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0110_E07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0057_G11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0024_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0020_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0083_E07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0010_G10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0003_H11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0018_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0020_A11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0043_A12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0087_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0008_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0047_G10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0010_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0012_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0036_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0001_H07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0012_H07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0103_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0008_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0023_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_E12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0012_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0010_A09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0028_C06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0026_A11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0025_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCACGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_D11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0025_E08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0094_D09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_B07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0071_G06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0028_E08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0090_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0079_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0095_F02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCGGCA
TES01_0103_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0075_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0003_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0057_F04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_B08.b : GGATCGGCCTCACCATCGCCCGGCGTCTGGCCCATTATGGGGCCCACGTGGTGGTCAGCA
TES01_0024_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_B09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0021_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0047_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCATGATGGGGCCCACGTGGTGGTCAGCA
TES01_0087_G11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0029_E04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0098_F07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_F02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0023_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0003_F09.b : GGATCGGCCTCCCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGCCAGCA
TES01_0101_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0026_G06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0019_B07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0003_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0019_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_G09.b : GGATCGGCCTCGTCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCGGCA
TES01_0041_E06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_F04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0035_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0022_H09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0103_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0006_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0002_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_A10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0021_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0007_B10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_E06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0023_D09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_D03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0041_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0024_A11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0007_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0018_F09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_F02.b : GGGTCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0020_B01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
PST01_0032_B05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCG
TES01_0028_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_E01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0035_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0017_E06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0028_A07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0038_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0012_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0049_B01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0010_F01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_G10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_D11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0008_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0011_G11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0006_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_D10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0049_H01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0001_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0039_D11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0013_F04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_D08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0013_D05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0011_A02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0043_H10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0023_C01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0012_D05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0015_B04.b : GGATCGGCCTCGCCATCGCTCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0011_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0049_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0002_H10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_D04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0006_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0046_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0105_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_C06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0071_A12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0107_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0062_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVR01_0086_D04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0006_B09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0089_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0038_E01.b : GGATCGACCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVRT1_0017_D11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0110_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0030_A02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_C10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0038_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0031_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_B03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0112_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0030_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
SMG01_0052_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
ITT01_0071_A02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0002_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
SMG01_0060_D05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
ITT01_0031_H03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
CLNT1_0100_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0074_A07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0076_F01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0078_H01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0101_H03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0093_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0070_H07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0038_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0069_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0094_A02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0059_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0101_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0080_G06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0092_D02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0079_E04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_C12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0112_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0103_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0048_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0062_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0073_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0064_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0107_F01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
SPL01_0022_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0070_C08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0079_A09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0106_B02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0064_C09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0071_C02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0107_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0035_H03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0080_E04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0084_C09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0054_G10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCATCA
TES01_0107_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_B02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_B07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0086_H08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0074_F12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0041_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0102_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0034_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0086_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0106_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_C03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0059_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0032_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0089_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0080_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0060_H08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0098_D09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0024_G11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_C10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0098_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0107_F12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0030_A04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0106_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0033_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0026_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_A12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0049_C01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_C09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0083_C09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0112_A09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0025_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0084_D05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0044_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0104_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0104_B07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0090_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0013_H09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_G08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0026_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0050_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_C10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_A07.b : GGATCGGCCTCGCCATCGCCCGGCGTCCGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0054_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_A09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0015_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0022_C01.b : GGAACGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_H10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
ITT01_0081_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0010_H08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0025_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_D02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0084_D07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0064_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0070_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0075_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVR01_0043_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_H09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0032_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0080_E12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_D07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0109_C02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0075_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0080_C02.b : GGATCGGCCTCGTCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCGGCA
TES01_0094_E12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0062_C12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_D08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0077_G03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0076_C12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0066_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0079_D06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0068_A12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_A04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0107_E08.b : GGATCGGCCTCGCCATCACCCGGCGTCTGGCCCATGATGGGGCCCACGTGGTGGTCAGCA
TES01_0069_A09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0095_C10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0066_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0032_H01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0112_F05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0088_E07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0061_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0091_A09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_A02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0098_C05.b : GGATCGGCCTCGCCATCGCCCAGCGTCTGGCCCGGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0067_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0065_F08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0023_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0008_F05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0029_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_B01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0029_H07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0052_F08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0035_H11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0104_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_F04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0104_D08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0012_H08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_A06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0015_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_G06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0001_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0034_D05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0070_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0094_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0093_D07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_H08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0101_A12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0091_B03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0112_H03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0093_E06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0059_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0052_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0095_E07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_B02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGACGGGGCCCACGTGGTGGTCAGCA
TES01_0068_H11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0024_H03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0056_A06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0007_G04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0010_C06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TCH01_0085_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TCH01_0030_F07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVRT1_0048_E08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGACGGGGCCCACGTGGTGGTCAGCA
TES01_0018_H11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_C03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCG
TES01_0013_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0038_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0081_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0064_C10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0076_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0107_D10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_H02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_C01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0088_G06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0109_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0081_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0048_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0100_B05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0001_F11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_G02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0056_F09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0059_D03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0017_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0032_F11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0031_G12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_C02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0015_G10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0041_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0050_C09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_B04.b : GGATCGGCCCCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_C02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0015_G03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0095_E12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_F09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0072_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0095_F08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0037_D02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0087_F09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0110_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0090_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0028_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0077_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0046_B10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0050_F02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0091_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0083_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0039_E05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0026_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0029_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAACA
TES01_0112_E06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0021_H03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_H11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_D10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0017_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVR01_0034_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0106_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0021_E03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0034_C07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0097_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0036_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0042_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_E01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_F01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0093_A07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCATGATGGGGCCCACGTGGTGGTCAGCA
TES01_0077_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_D06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0100_D04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0077_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0069_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_A04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0094_B11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0095_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0112_C02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_B09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0048_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0063_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0110_B01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0107_B05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0084_B06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0044_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0080_F09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0108_A06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_D10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0102_B03.b : GGATCGGCCTCGCCATCGCCCGGCGCCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_A11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_B11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0004_D06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0003_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0067_E04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0015_C12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0112_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0055_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0047_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0015_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_G04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0038_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0010_E12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0002_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCTACGTGGTGGTCAGCA
TES01_0073_B05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVRM1_0224_G09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0028_E06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_B10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0074_H01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVR01_0102_F09.b : GGATCGGCCTCCCCATCGCCCGGGGTCTGGCCCAGAATGGGGCCCACGTGGTGGTCAGCA
TES01_0103_H03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0030_F08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0087_E08.b : GGATCGGCCTCACCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0100_D03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0087_F08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0105_F02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0105_H01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0112_F02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
SMG01_0019_G11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0095_A06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0102_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0093_D05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0039_H11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
SMG01_0018_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
UTR01_0033_A04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0088_F05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0097_D11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0023_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0065_F09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0059_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0110_A11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_A06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0085_A10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
OVRT1_0034_E04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0016_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0030_F05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0065_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0097_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_F08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0009_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0098_E09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0046_F12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
ADR01_0007_C04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0044_D12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0035_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0016_F01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0039_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTAGTGGTCAGCA
TCH01_0029_C01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0083_C06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0026_F05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0015_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0030_F02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCGCGTGGTGGTCAGCA
TES01_0008_A09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0104_A09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0104_F07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0074_E02.b : GGATCGGCCTCGCCATCGCCCGGTGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0035_F07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0105_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCGCGTGGTGGTCAGCA
TES01_0095_H05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0094_D08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0100_B09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0088_G01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0086_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_D01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0036_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0111_F03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0049_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0028_D09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0014_H08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0094_B04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_B02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0022_B11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0068_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0029_A06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0104_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0007_B07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0019_F11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0002_C05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0056_B07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0057_D10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0008_C01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0073_A07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0093_A05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0066_C10.b : GGATCGGCCTCGCCATCTCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0047_G11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0072_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0058_B05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0044_B10.b : GGATCGGCCTCGCCATCGCCCGGTGTCTGGCCCATGATGGGGCCCACGTGGTGGTCATCA
TES01_0060_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0044_G05.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0039_F06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0017_D03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0018_H04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0032_A11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0011_B01.b : GGATCGGCCTCGCCATCGCCCGGCGCCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0017_E10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0024_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0096_C11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_E07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0020_C03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0018_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0036_E11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0081_F10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0040_A04.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0032_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0013_G07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0005_F11.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0098_C01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0006_H10.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0092_C12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0020_H09.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0045_H06.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0099_A08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0053_H08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0080_C01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0051_E02.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0013_C12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0082_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0028_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
LVR01_0090_A01.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0071_H12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0027_D03.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0072_E07.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0075_B08.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
TES01_0023_B12.b : GGATCGGCCTCGCCATCGCCCGGCGTCTGGCCCAGGATGGGGCCCACGTGGTGGTCAGCA
20110601C-001686 : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
---------+---------+---------+---------+---------+---------+ 360
TES01_0078_H03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
CLNT1_0067_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVRM1_0015_G07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
SMG01_0047_D04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVR01_0004_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVR01_0030_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
ADR01_0092_F05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0036_E04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0043_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGGGGGGCTGAGCG
TES01_0062_B10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0101_B02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TCH01_0071_A12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
CLNT1_0055_E12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0036_H08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVR01_0070_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0111_D02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0024_C12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0043_F06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0002_H04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TCH01_0045_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0053_C12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0018_A01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TCH01_0069_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0019_F10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0041_B08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0021_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0062_G07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0062_H04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_C10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0076_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0026_B11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0085_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0052_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0037_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0081_C06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0105_D07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0070_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0085_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0087_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0030_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0096_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_C06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_F06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0022_H04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0083_F09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0111_F11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0064_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0019_F09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0075_A10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0087_G08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0088_E01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0096_A12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0067_H07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0082_E01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0106_F12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0085_E01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0037_C03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0022_G03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0033_B08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0111_B08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0022_C10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0092_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0079_C02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0035_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0088_F06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0019_D10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0047_G08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0017_F05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0059_E07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0035_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0067_D03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_A10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0027_C03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0067_B10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_H04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0018_A08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0007_B11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0005_A12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0058_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0050_E11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0022_B10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_G06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0019_G01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_A04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_H11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0083_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0057_E02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0047_C01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0047_C02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_E08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0044_A05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0008_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0065_D10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0050_G04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_A03.b : GTCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0077_F01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0073_F01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0064_F11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0003_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0075_D08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0090_C11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0028_G08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0109_E12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0106_G07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0027_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0077_E11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0109_H06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0081_F04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0022_G10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0056_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCACGGGGAGGGGCTGAGCG
TES01_0100_B02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0026_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0095_F04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0091_B09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0080_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0106_C06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_E02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0100_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0084_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0046_C11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0031_H06.b : GCTGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0056_E08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0101_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0023_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0082_C02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0102_D05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0091_C09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_G06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_G05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0027_B03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0047_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0020_A07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0056_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0040_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0019_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0044_H05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_A03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0004_A10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0054_F01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_F08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0098_D02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_D03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0056_H11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0012_G03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0024_E06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0004_A08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0011_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0058_E01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0005_G05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0059_C08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0065_E07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0044_B11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0110_E07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0057_G11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0024_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0020_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0083_E07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0010_G10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0005_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0003_H11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCGACACTGCAGGGGGAGGGGCTGAGCG
TES01_0018_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0020_A11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0043_A12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0087_A05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0008_F06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0047_G10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0010_H05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0012_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0036_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0001_H07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0012_H07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGCGCG
TES01_0103_G01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_A01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0008_E02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0023_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGGGGGGCTGAGCG
TES01_0042_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_E12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0012_G07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0010_A09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0028_C06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0026_A11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0025_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0040_D11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0025_E08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0094_D09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0040_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0040_B07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0071_G06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0028_E08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0058_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0090_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0079_E11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0095_F02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0103_G07.b : GCCGGAAGCAGGAGAATGTGGGCCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0075_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0003_F10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0057_F04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0096_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_B08.b : GCCGGAAGCAGGAGAATGTGAACCGGACAGTGGCAACACTGCATGGGGAGGGGCTGAGCG
TES01_0024_G05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0027_B09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_G05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0021_E11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0047_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0087_G11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0096_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_B08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCGGAGCG
TES01_0029_E04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0098_F07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0099_F02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0023_B08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0003_F09.b : GCCGGAATCAGGATAATGTGGACCGGACAGTGGCAACTCTGCATGGGGAGGGGCTGAGCG
TES01_0101_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0058_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0026_G06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0019_B07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0003_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0019_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0027_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0041_E06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_F04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0035_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0022_H09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0103_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0006_F06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0002_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0005_A10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0021_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0007_B10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_E06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0023_D09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_D03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0041_A05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0024_A11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0007_H05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0018_F09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_F02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0020_B01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
PST01_0032_B05.b : GGGGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0028_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_E01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0035_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0017_E06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0028_A07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0038_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0012_H05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0005_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0049_B01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0010_F01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_G10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_D11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0008_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0011_G11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0006_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_D10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0049_H01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0001_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0039_D11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0013_F04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_D08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCGGGGGGAGGGGCTGAGCG
TES01_0013_D05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_H04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0011_A02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0043_H10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0023_C01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0012_D05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0015_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0011_G01.b : GCCGGAAGCAGGAGGATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0049_G05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0002_H10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_D04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGGGCG
TES01_0006_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0046_F10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0105_F10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0082_C06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0071_A12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0107_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0062_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVR01_0086_D04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0006_B09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCGGGGGGAGGGGCTGAGCG
TES01_0089_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_F10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0038_E01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVRT1_0017_D11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0110_A01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0030_A02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_C10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0038_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_H05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0031_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_B03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0030_G01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
SMG01_0052_G07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
ITT01_0071_A02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
LVR01_0002_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
SMG01_0060_D05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
ITT01_0031_H03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
CLNT1_0100_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0074_A07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAAGGGGAGGGGCTGAGCG
TES01_0076_F01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0078_H01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0101_H03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_E11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0093_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0070_H07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0038_F06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0069_G01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0094_A02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0059_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0101_G05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0080_G06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0092_D02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0079_E04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_C12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_H06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0103_H04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0048_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0062_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0073_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0064_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0107_F01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
SPL01_0022_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0070_C08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0079_A09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0106_B02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0064_C09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0071_C02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0107_G01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0035_H03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0080_E04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0084_C09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0054_G10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGATCG
TES01_0107_C11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0058_B02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_B07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0086_H08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0074_F12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0041_H05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0102_A05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0034_F10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCGACACTGCAGGGGGAGGGGCTGAGCG
TES01_0086_E02.b : GCCAGGAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0106_C11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCA*GGGGAGGGGCTGAGCG
TES01_0082_C03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0059_F06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0032_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0089_E11.b : GCCGGAAGCAGGAGAATGTGGACCAGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0080_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0060_H08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0098_D09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0024_G11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_E02.b : GCTGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0099_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0082_C10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0098_A01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0107_F12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0030_A04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0099_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_A01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGTAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0106_B08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0033_C04.b : GCCGGAAGCAGGAGAATATGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0026_G07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0099_A12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0049_C01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0058_C09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0083_C09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_A09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0025_H06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0084_D05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0044_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0104_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0104_B07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGAGGGAGGGGCTGAGCG
TES01_0090_H04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0013_H09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_G08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0026_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0050_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_C10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_A07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0054_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_A09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0015_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0022_C01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_H10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
ITT01_0081_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0010_H08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0025_E02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_D02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0084_D07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0064_E02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0070_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0075_G01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVR01_0043_F06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0099_H09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0032_G05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0080_E12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_D07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0109_C02.b : GCCGGAAGCAGGAAAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0075_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0080_C02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0094_E12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0062_C12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0040_D08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0077_G03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0076_C12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0082_A05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0066_E02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAATGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0079_D06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0068_A12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0058_A04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0107_E08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCACGGGGAGGGGCTGAGCG
TES01_0069_A09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0095_C10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0066_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0032_H01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_F05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0088_E07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0005_C11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0061_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0091_A09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0058_A02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0098_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0067_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0065_F08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0023_A01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0008_F05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0029_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0040_B01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0029_H07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0052_F08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0035_H11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0104_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_F04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0104_D08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0012_H08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_A06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_C11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0015_F10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_G06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0001_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0034_D05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0099_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0070_H04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0094_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0093_D07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0027_H08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0101_A12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0096_A05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0091_B03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_H03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0093_E06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0059_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0052_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0095_E07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0040_B02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0068_H11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0024_H03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0056_A06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0007_G04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0010_C06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TCH01_0085_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TCH01_0030_F07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVRT1_0048_E08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0018_H11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0005_C03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0013_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0038_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0081_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAAGGGGAGGGGCTGAGCG
TES01_0064_C10.b : TCCGGAAGCAGGAGGATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0076_E11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0107_D10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0096_H02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_C01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0088_G06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0109_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0081_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0048_H06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0100_B05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0001_F11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0040_G02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0056_F09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0059_D03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0017_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0032_F11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0031_G12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0027_C02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0099_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0015_G10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0041_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0050_C09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0014_C02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0015_G03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0095_E12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_E10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_F09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0072_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0095_F08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0037_D02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0087_F09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0110_A05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0090_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0028_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0077_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0046_B10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0050_F02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0091_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0083_H05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0039_E05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAAGGGGAGGGGCTGAGCG
TES01_0042_H06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0026_B08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0029_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_E06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0021_H03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_H11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_D10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0017_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVR01_0034_H06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0106_G01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTAAGCG
TES01_0021_E03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0034_C07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_E11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0097_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0036_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0042_A01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_E01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_F01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0093_A07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0077_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_D06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0100_D04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0077_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0069_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0096_A04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0094_B11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0095_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_C02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0082_B09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0048_A05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0063_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0110_B01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0107_B05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0084_B06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0044_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0080_F09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0108_A06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0099_D10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0102_B03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0096_A11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_B11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0005_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0004_D06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0003_G05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0067_E04.b : GCCGGAAGCGGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0027_E02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0015_C12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_A01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0055_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0047_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0015_C05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0016_G04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0038_G01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0010_E12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0002_H05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0073_B05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGATCG
OVRM1_0224_G09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0028_E06.b : GCCGGAAGCAGGAGAATATGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0082_B10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0074_H01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVR01_0102_F09.b : GCCGGAAGCAGGAAAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAACG
TES01_0103_H03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
LVR01_0030_F08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0087_E08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0100_D03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0087_F08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0105_F02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0105_H01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0112_F02.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
SMG01_0019_G11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0095_A06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0102_H12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0093_D05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
LVR01_0039_H11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
SMG01_0018_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
UTR01_0033_A04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
LVR01_0088_F05.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
LVR01_0097_D11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0023_F03.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0065_F09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0059_B12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0110_A11.b : GCCGGAAGCATGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_A06.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0085_A10.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
OVRT1_0034_E04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
LVR01_0016_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACATTGCAGGGGGAGGGGCTGAGCG
TES01_0030_F05.b : GCCGGAAGCAGGAGAATGTGGACTGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0065_B04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
LVR01_0097_C11.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0051_F08.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0009_G07.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0098_E09.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0046_F12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
ADR01_0007_C04.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0045_D01.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0044_D12.b : GCCGGAAGCAGGAGAATGTGGACCGGACAGTGGCAACACTGCAGGGGGAGGGGCTGAGCG
TES01_0035_F10.b : GCCGGAAGCAGGAGAATGTGGACCGG