[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001759

Length: 1,353

Sequence [FASTA format sequence]
AGGCTGGTCC GGTCCGGAAA TCGCACGACT GTTGGCCTAT GGGGCTCTAT CGGCAGCTTC
CGACCGCGGG ATGTCTCACA GGAAGTTCTC CGCTCCCAGG CACGGGTCCC TGGGCTTCCT
GCCTCGGAAG CGTAGCAGCC GGCACCGCGG GAAGGTGAAG AGTTTCCCCA AGGATGACTC
TTCCAAGCCC GTGCACCTCA CCGCCTTCCT TGGCTACAAG GCTGGCATGA CCCACATTGT
GAGGGAGGTC GATAGGCCTG GGTCCAAGGT GAACAAGAAG GAAGTTGTGG AGGCTGTGAC
TATTGTGGAG ACGCCACCCA TGGTGATTGT GGGCATCGTG GGCTATGTGG AAACCCCTCG
GGGCCTCCGG ACCTTTAAGA CCATCTTCGC GGAGCACATC AGCGATGAGT GCAAGAGGCG
CTTCTATAAG AACTGGCATA AATCTAAGAA GAAGGCCTTC ACCAAATACT GCAAGAAGTG
GCAGGATGAA GATGGCAAGA AGCAGTTGGA GAGGGACTTC AGTAGCATGA AGAAGTACTG
CCAGGTCATC CGGGTCATTG CCCACACCCA GATGCGCCTG CTTCCTCTCC GCCAGAAGAA
GGCCCACCTC ATGGAGATCC AGGTGAACGG AGGCACAGTG GCTGAAAAAC TGGACTGGGC
CCGGGAGAGG CTAGAGCAGC AGGTCCCTGT GAACCAGGTG TTTGGGCAGG ATGAGATGAT
TGATGTCATT GGCGTGACCA AGGGCAAGGG CTACAAAGGG GTCACCAGCC GTTGGCATAC
CAAGAAGCTG CCCCGGAAGA CCCACCGGGG GCTCCGCAAG GTTGCCTGTA TTGGCGCGTG
GCATCCTGCG CGTGTGGCCT TCTCCGTGGC CCGGGCTGGG CAGAAAGGCT ACCATCACCG
CACAGAGATC AACAAGAAGA TCTACAAGAT CGGCCAGGGC TACCTCATCA AGGACGGCAA
GCTGATCAAG AACAACGCCT CCACGGATTA CGATCTCTCC GACCAGAGCA TCAATCCTCT
GGGAGGCTTT GTCCACTATG GTGAGGTGAC CAATGACTTT GTCATGCTCA AAGGCTGCGT
CGTGGGGACC AAGAAGCGAG TGCTCACCCT TCGCAAGTCC TTGCTGGTAC AGACCAAACG
ACGGGCCCTG GAGAAGATCG ATCTCAAGTT TATTGACACC ACCTCCAAGT TTGGCCATGG
CCGCTTCCAG ACTGTGGAGG AGAAGAAGGC CTTCATGGGA CCACTTAAGA AGGACCGAAT
TGCAAAGGAA GAAGGGGCCT AATGACAGAG ATTGTAAGGC TGGTAGAGTC TCAATAAAGT
TATTTTCCAG TGAAAAAAAA AAAAAAAAAA AAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPL360S ribosomal protein L3 isoform a [Homo sapiens]. 7840.0O
Contig/Assembly ProteinRPL360S ribosomal protein L3 isoform b [Homo sapiens]. 6610.0O
Contig/Assembly ProteinRPL3L60S ribosomal protein L3-like [Homo sapiens]. 6380.0O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRpl360S ribosomal protein L3 [Mus musculus]. 7790.0O
Contig/Assembly ProteinGm12816PREDICTED: 60S ribosomal protein L3-like [Mus musculus]. 7420.0O
Contig/Assembly ProteinLOC674810PREDICTED: 60S ribosomal protein L3-like [Mus musculus]. 7280.0O
Contig/Assembly ProteinRpl3lribosomal protein L3-like isoform 1 [Mus musculus]. 6400.0O
Contig/Assembly ProteinRpl3lribosomal protein L3-like isoform 2 [Mus musculus]. 3502e-96O
Contig/Assembly ProteinGm12816PREDICTED: 60S ribosomal protein L3-like, partial [Mus musculus]. 3319e-91O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474504PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 2 [Canis familiaris]. 7850.0O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 1 [Canis familiaris]. 7840.0O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 8 [Canis familiaris]. 7490.0O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 6 [Canis familiaris]. 6720.0O
Contig/Assembly ProteinLOC475009PREDICTED: similar to ribosomal protein L3 isoform 5 [Canis familiaris]. 6640.0O
Contig/Assembly ProteinLOC474504PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 8 [Canis familiaris]. 619e-177O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 9 [Canis familiaris]. 615e-176O
Contig/Assembly ProteinLOC490065PREDICTED: similar to 60S ribosomal protein L3-like [Canis familiaris]. 535e-152
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 7 [Canis familiaris]. 534e-152O
Contig/Assembly ProteinLOC474504PREDICTED: similar to ribosomal protein L3 isoform 7 [Canis familiaris]. 478e-135O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPL360S ribosomal protein L3 [Bos taurus]. 7850.0O
Contig/Assembly ProteinRPL3L60S ribosomal protein L3-like [Bos taurus]. 6440.0O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC396768PREDICTED: 60S ribosomal protein L3 [Sus scrofa]. 7890.0O
Contig/Assembly ProteinLOC100622679PREDICTED: 60S ribosomal protein L3-like, partial [Sus scrofa]. 1662e-41O


Assembly Members: 419      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010005F01ADR01_0005_F01.bDB781978 
ADR010009H07ADR01_0009_H07.bDB782359 
ADR010014B09ADR01_0014_B09.bDB782749 
ADR010022B07ADR01_0022_B07.bDB783402 
ADR010031C01ADR01_0031_C01.bDB784218 
ADR010033B11ADR01_0033_B11.bDB784402 
ADR010034A06ADR01_0034_A06.bDB784476 
ADR010038E06ADR01_0038_E06.bDB784876 
ADR010040G04ADR01_0040_G04.bDB785078 
ADR010050B02ADR01_0050_B02.bDB785922 
ADR010053A07ADR01_0053_A07.bDB786181 
ADR010058C03ADR01_0058_C03.bDB786646 
ADR010060C09ADR01_0060_C09.bDB786838 
ADR010063B02ADR01_0063_B02.bDB787086 
ADR010066E03ADR01_0066_E03.bDB787374 
ADR010069C05ADR01_0069_C05.bDB787616 
ADR010072H10ADR01_0072_H10.bDB787938 
ADR010080H09ADR01_0080_H09.bDB788668 
ADR010083C12ADR01_0083_C12.bDB788871 
ADR010087B04ADR01_0087_B04.bDB789197 
ADR010097G09ADR01_0097_G09.bDB790157 
ADR010098B07ADR01_0098_B07.bDB790188 
ADR010102H09ADR01_0102_H09.bDB790612 
BFLT10107E10BFLT1_0107_E10.bHX202329 
BKFL10116A02BKFL1_0116_A02.bFS656636 
BMWN10084A06BMWN1_0084_A06.bHX210724 
CBLT10010A09CBLT1_0010_A09.bHX212476 
CBLT10046H11CBLT1_0046_H11.bHX214947 
CBLT10055H01CBLT1_0055_H01.bHX215570 
CBLT10061F03CBLT1_0061_F03.bHX215999 
CLNT10004G01CLNT1_0004_G01.bFS657378 
CLNT10009C05CLNT1_0009_C05.bFS657747 
CLNT10010H02CLNT1_0010_H02.bFS657879 
CLNT10013F04CLNT1_0013_F04.bFS658112 
CLNT10017G09CLNT1_0017_G09.bFS658439 
CLNT10045A02CLNT1_0045_A02.bFS660574 
CLNT10110B11CLNT1_0110_B11.bHX219906 
CLNT10113C12CLNT1_0113_C12.bHX220146 
CLNT10125A10CLNT1_0125_A10.bHX221050 
CLNT10138C08CLNT1_0138_C08.bHX222049 
HTMT10048B01HTMT1_0048_B01.bFS667558 
HTMT10074F07HTMT1_0074_F07.bFS669490 AK392446
ILNT10046A10ILNT1_0046_A10.bHX230313 
ILNT10047G08ILNT1_0047_G08.bHX230454 
ILNT10091B12ILNT1_0091_B12.bHX234005 
ITT010003H03ITT01_0003_H03.bBW976300 
ITT010004G02ITT01_0004_G02.bBW976381 
ITT010008E05ITT01_0008_E05.bBW976726 
ITT010009A02ITT01_0009_A02.bBW976767 
ITT010009F01ITT01_0009_F01.bBW976824 
ITT010013D05ITT01_0013_D05.bBW977176 
ITT010016G11ITT01_0016_G11.bBW977478 
ITT010020G12ITT01_0020_G12.bBW977839 
ITT010021B07ITT01_0021_B07.bBW977865 
ITT010021D08ITT01_0021_D08.bBW977890 
ITT010022E01ITT01_0022_E01.bBW977989 
ITT010023F11ITT01_0023_F11.bBW978102 
ITT010024C09ITT01_0024_C09.bBW978156 
ITT010032B11ITT01_0032_B11.bBW978859 
ITT010032F07ITT01_0032_F07.bBW978900 
ITT010036C05ITT01_0036_C05.bBW979228 
ITT010041E09ITT01_0041_E09.bBW979705 
ITT010044G10ITT01_0044_G10.bBW979999 
ITT010055B08ITT01_0055_B08.bBW980863 
ITT010056H07ITT01_0056_H07.bBW981016 
ITT010062H12ITT01_0062_H12.bBW981560 
ITT010071A05ITT01_0071_A05.bBW982286 
ITT010086C01ITT01_0086_C01.bBW983611 
ITT010095A05ITT01_0095_A05.bBW984403 
ITT010099G03ITT01_0099_G03.bBW984835 
ITT010100E12ITT01_0100_E12.bBW984915 
LNG010002A12LNG01_0002_A12.bBP433900 
LNG010013C05LNG01_0013_C05.bBP435284 
LNG010020C03LNG01_0020_C03.bBP435132 
LNG010045A06LNG01_0045_A06.bBP433446 
LNG010045H05LNG01_0045_H05.bBP440325 
LNG010059F02LNG01_0059_F02.bBP438077 
LNG010072D03LNG01_0072_D03.bBP436157 
LNG010106A11LNG01_0106_A11.bBP433894 
LVR010033F02LVR01_0033_F02.bBP445525 
LVR010100A04LVR01_0100_A04.bBP441246 
LVRM10063A04LVRM1_0063_A04.bBP137622 
MLN010048E09MLN01_0048_E09.bCJ011370 
MLN010066G09MLN01_0066_G09.bCJ012887 
MLN010071F05MLN01_0071_F05.bCJ013309 
MLN010081D04MLN01_0081_D04.bCJ014088 
MLN010081G10MLN01_0081_G10.bCJ014123 
MLN010090D07MLN01_0090_D07.bCJ014844 
MLN010090G11MLN01_0090_G11.bCJ014879 
MLN010103C03MLN01_0103_C03.bCJ015960 
OVR010006F10OVR01_0006_F10.bBP143823 
OVR010007H10OVR01_0007_H10.bBP144739 
OVR010011F07OVR01_0011_F07.bBP143718 
OVR010013A05OVR01_0013_A05.bBP141408 
OVR010015G10OVR01_0015_G10.b  
OVR010019D03OVR01_0019_D03.bBP142674 
OVR010029F01OVR01_0029_F01.bBP143496 
OVR010029F12OVR01_0029_F12.bBP143918 
OVR010030E04OVR01_0030_E04.bBP143167 
OVR010031C08OVR01_0031_C08.bBP142420 
OVR010033D11OVR01_0033_D11.bBP142977 
OVR010037F08OVR01_0037_F08.bBP143772 
OVR010040H11OVR01_0040_H11.bBP144797 
OVR010048C09OVR01_0048_C09.bBP142471 
OVR010050E08OVR01_0050_E08.bBW964074 
OVR010050F07OVR01_0050_F07.bBW964084 
OVR010057G03OVR01_0057_G03.bBW964725 
OVR010058C03OVR01_0058_C03.bBW964771 
OVR010065A08OVR01_0065_A08.bBW965374 
OVR010065A12OVR01_0065_A12.bBW965378 
OVR010066H10OVR01_0066_H10.bBW965541 
OVR010067E10OVR01_0067_E10.bBW965596 
OVR010076A01OVR01_0076_A01.bBW966340 
OVR010085C10OVR01_0085_C10.bBW966992 
OVR010087C01OVR01_0087_C01.bBW967149 
OVR010087H02OVR01_0087_H02.bBW967195 
OVR010089A11OVR01_0089_A11.bBW967279 
OVR010093H03OVR01_0093_H03.bBW967646 
OVR010094H01OVR01_0094_H01.bBW967711 
OVR010099D12OVR01_0099_D12.bBW968072 
OVR010100D09OVR01_0100_D09.bBW968148 
OVRM10028F03OVRM1_0028_F03.bBP151356 
OVRM10060E12OVRM1_0060_E12.bBP151076 
OVRM10077D11OVRM1_0077_D11.bBP149760 
OVRM10084B12OVRM1_0084_B12.bBP147360 
OVRM10121D03OVRM1_0121_D03.bBP148946 
OVRM10133H07OVRM1_0133_H07.bBP154435 
OVRM10137H01OVRM1_0137_H01.bBP153768 
OVRM10148H07OVRM1_0148_H07.bBP461833 
OVRM10152A03OVRM1_0152_A03.bBP454820 
OVRM10153B04OVRM1_0153_B04.bBP455817 
OVRM10165G06OVRM1_0165_G06.bBP460840 
OVRM10212A10OVRM1_0212_A10.bBP455383 
OVRM10218F02OVRM1_0218_F02.bBP459557 
OVRT10011D10OVRT1_0011_D10.bFS687286 
OVRT10035B11OVRT1_0035_B11.bFS689226 
OVRT10049E04OVRT1_0049_E04.bFS690413 
OVRT10056A09OVRT1_0056_A09.bFS690942 
OVRT10056B10OVRT1_0056_B10.bFS690955 
OVRT10057F04OVRT1_0057_F04.bFS691072 
OVRT10067F09OVRT1_0067_F09.bFS691911 
OVRT10071H11OVRT1_0071_H11.bFS692239 
OVRT10095C04OVRT1_0095_C04.bFS694138 
OVRT10096C07OVRT1_0096_C07.bFS694225 
OVRT10114B10OVRT1_0114_B10.bHX235924 
OVRT10129A01OVRT1_0129_A01.bHX237103 
OVRT10131F06OVRT1_0131_F06.bHX237318 
OVRT10136H03OVRT1_0136_H03.bHX237741 
PBL010001C04PBL01_0001_C04.bBW968561 
PBL010011A03PBL01_0011_A03.bBW969163 
PBL010013G08PBL01_0013_G08.bBW969360 
PBL010021C06PBL01_0021_C06.bBW969773 
PBL010022A03PBL01_0022_A03.bBP462315 
PBL010022H11PBL01_0022_H11.bBW969887 
PBL010024F05PBL01_0024_F05.bBP156074 
PBL010030F11PBL01_0030_F11.bBW970055 
PBL010038B04PBL01_0038_B04.b  
PBL010040D08PBL01_0040_D08.bBW970430 
PBL010051D11PBL01_0051_D11.bBW971106 
PBL010053C01PBL01_0053_C01.bBW971183 
PBL010062D03PBL01_0062_D03.bBW971764 
PBL010065G08PBL01_0065_G08.bBW972039 
PBL010076B03PBL01_0076_B03.bBW972887 
PBL010080A12PBL01_0080_A12.bBW973244 
PBL010081B12PBL01_0081_B12.bBW973346 
PBL010083D09PBL01_0083_D09.bBW973548 
PBL010084B10PBL01_0084_B10.bBW973610 
PBL010085D10PBL01_0085_D10.bBW973721 
PBL010088F07PBL01_0088_F07.bBW974008 
PCT010004G03PCT01_0004_G03.bFS694887 
PCT010013F07PCT01_0013_F07.bFS695529 
PCT010026H01PCT01_0026_H01.bFS696405 
PCT010027E12PCT01_0027_E12.bFS696452 
PCT010034B02PCT01_0034_B02.bFS696856 
PST010009F02PST01_0009_F02.bFS697713 
PST010013G04PST01_0013_G04.bFS698036 
PST010013G05PST01_0013_G05.bFS698037 
PST010031A11PST01_0031_A11.bFS699313 
PST010037F02PST01_0037_F02.bFS699746 
PST010057F03PST01_0057_F03.bFS701353 
PST010070B03PST01_0070_B03.bFS702338 
PST010091B04PST01_0091_B04.bFS704019 
PST010094B02PST01_0094_B02.bFS704247 
PTG010003D07PTG01_0003_D07.bFS704941 
PTG010019D05PTG01_0019_D05.bFS706083 
PTG010036B09PTG01_0036_B09.bFS707552 
PTG010044D02PTG01_0044_D02.bFS708288 
PTG010077G03PTG01_0077_G03.bFS710961 
PTG010080E03PTG01_0080_E03.bFS711201 
PTG010081D07PTG01_0081_D07.bFS711280 
SKNB10003E07SKNB1_0003_E07.bDB800240 
SKNB10008C05SKNB1_0008_C05.b  
SKNB10009E06SKNB1_0009_E06.bDB800562 
SKNB10014B12SKNB1_0014_B12.b  
SKNB10029H03SKNB1_0029_H03.bDB801604 
SKNB10030A09SKNB1_0030_A09.b  
SKNB10032G05SKNB1_0032_G05.bDB801750 
SKNB10034C09SKNB1_0034_C09.bDB801827 
SKNB10035H07SKNB1_0035_H07.bDB801935 
SKNB10037E06SKNB1_0037_E06.bDB802019 
SKNB10038B11SKNB1_0038_B11.b  AK397249
SKNB10040D10SKNB1_0040_D10.bDB802212 
SKNB10047C10SKNB1_0047_C10.bFS713419 
SKNB10052H09SKNB1_0052_H09.bDB803083 
SKNB10061A05SKNB1_0061_A05.bDB803646 
SKNB10063A03SKNB1_0063_A03.bDB803796 
SKNB10063F02SKNB1_0063_F02.bDB803833 
SKNB10069D09SKNB1_0069_D09.bDB804187 
SKNB10071G12SKNB1_0071_G12.bDB804352 
SKNB10075H04SKNB1_0075_H04.bDB804609 
SKNB10079A08SKNB1_0079_A08.b  
SKNB10081B08SKNB1_0081_B08.bDB804902 
SKNB10083F06SKNB1_0083_F06.bDB805050 
SKNB10083G03SKNB1_0083_G03.bDB805057 
SKNB10086F02SKNB1_0086_F02.bDB805270 
SKNB10087D04SKNB1_0087_D04.bDB805328 
SKNB10091G02SKNB1_0091_G02.bFS713463 
SKNB10094C01SKNB1_0094_C01.b  
SMG010002A11SMG01_0002_A11.bFS713572 
SMG010002D03SMG01_0002_D03.bFS713599 
SMG010013A01SMG01_0013_A01.bFS714336 
SMG010021A02SMG01_0021_A02.bFS715052 
SMG010028B09SMG01_0028_B09.bFS715712 
SMG010043B06SMG01_0043_B06.bFS717000 
SMG010046H07SMG01_0046_H07.bFS717327 
SMG010062E03SMG01_0062_E03.bFS718630 
SMG010064E05SMG01_0064_E05.bFS718799 
SMG010070G05SMG01_0070_G05.bFS719346 
SMG010079F06SMG01_0079_F06.bFS720118 AK397586
SMG010089H12SMG01_0089_H12.bFS721003 
SMG010094A09SMG01_0094_A09.bFS721351 
SMG010096B06SMG01_0096_B06.bFS721519 
SMG010096E03SMG01_0096_E03.bFS721548 
SMG010097B10SMG01_0097_B10.bFS721610 
SMG010097D04SMG01_0097_D04.bFS721623 
SMG010099D07SMG01_0099_D07.bFS721779 
SPL010013G05SPL01_0013_G05.bBP158832 
SPL010016E03SPL01_0016_E03.bBP158087 
SPL010019A06SPL01_0019_A06.bBP156818 
SPL010026D09SPL01_0026_D09.bBP157920 
SPL010027F04SPL01_0027_F04.bBP158477 
SPL010028A04SPL01_0028_A04.bBP156772 
SPL010028C09SPL01_0028_C09.bBP157575 
SPL010039F02SPL01_0039_F02.bBP158420 
SPL010044B06SPL01_0044_B06.bCJ016947 
SPL010050G04SPL01_0050_G04.bCJ017542 
SPL010054E10SPL01_0054_E10.bCJ017888 
SPL010065H12SPL01_0065_H12.bCJ018919 
SPL010073A06SPL01_0073_A06.bCJ019549 
SPL010079B07SPL01_0079_B07.bCJ020107 
SPL010081E05SPL01_0081_E05.bCJ020322 
SPL010085E07SPL01_0085_E07.bCJ020685 
SPL010088B09SPL01_0088_B09.bCJ020923 
SPL010090B12SPL01_0090_B12.bCJ021099 
SPL010091B11SPL01_0091_B11.bCJ021190 
SPL010097A10SPL01_0097_A10.bCJ021717 
SPL010099D10SPL01_0099_D10.b  
SPL010103E07SPL01_0103_E07.bCJ022269 
SPL010104E09SPL01_0104_E09.bCJ022358 
SPLT10016G07SPLT1_0016_G07.bHX240459 
SPLT10023H03SPLT1_0023_H03.bHX241019 
SPLT10069C10SPLT1_0069_C10.bHX244555 
SPLT10080F05SPLT1_0080_F05.bHX245450 
SPLT10087C06SPLT1_0087_C06.bHX245965 
TCH010002A08TCH01_0002_A08.bCJ022562 
TCH010006C03TCH01_0006_C03.bCJ022873 
TCH010011D07TCH01_0011_D07.bCJ023265 
TCH010019F05TCH01_0019_F05.bCJ023854 
TCH010025B01TCH01_0025_B01.bCJ024258 
TCH010029F08TCH01_0029_F08.bCJ024606 
TCH010032D09TCH01_0032_D09.bCJ024813 
TCH010036H02TCH01_0036_H02.bCJ025144 
TCH010053H02TCH01_0053_H02.bBW975872 
TCH010054A02TCH01_0054_A02.bBW975879 
TCH010059E04TCH01_0059_E04.bCJ026642 
TCH010069G08TCH01_0069_G08.bCJ027404 
TCH010075F05TCH01_0075_F05.bCJ027854 
TCH010081D01TCH01_0081_D01.bCJ028290 
TCH010083F04TCH01_0083_F04.bCJ028470 
TCH010090C04TCH01_0090_C04.bCJ028981 
TCH010099F11TCH01_0099_F11.bCJ029700 
TCH010101G07TCH01_0101_G07.bCJ029855 
TES010001B07TES01_0001_B07.b  
TES010002F06TES01_0002_F06.bCJ030131 
TES010003G09TES01_0003_G09.bCJ030209 
TES010007F08TES01_0007_F08.bCJ030477 
TES010008G02TES01_0008_G02.bCJ030546 
TES010009B11TES01_0009_B11.bCJ030582 
TES010009E04TES01_0009_E04.bCJ030604 
TES010010E10TES01_0010_E10.bCJ030679 
TES010014C10TES01_0014_C10.bCJ030932 
TES010019C03TES01_0019_C03.bCJ031270 
TES010022F05TES01_0022_F05.bCJ031489 
TES010023B04TES01_0023_B04.bCJ031524 
TES010024C11TES01_0024_C11.bCJ031606 
TES010026D04TES01_0026_D04.bCJ031726 
TES010028A05TES01_0028_A05.bCJ031824 
TES010037D08TES01_0037_D08.bCJ032441 
TES010038D10TES01_0038_D10.b  
TES010042F10TES01_0042_F10.bCJ032733 
TES010044D02TES01_0044_D02.bCJ032836 
TES010044H02TES01_0044_H02.bCJ032863 
TES010050A05TES01_0050_A05.bCJ033163 
TES010050D10TES01_0050_D10.bCJ033195 
TES010053C09TES01_0053_C09.b  
TES010058A10TES01_0058_A10.bCJ033683 
TES010059B10TES01_0059_B10.bCJ033758 
TES010060H10TES01_0060_H10.bCJ033879 
TES010061A11TES01_0061_A11.bCJ033888 
TES010063H10TES01_0063_H10.b  
TES010064H11TES01_0064_H11.bCJ034156 
TES010065A11TES01_0065_A11.bCJ034164 
TES010066H05TES01_0066_H05.b  
TES010067E07TES01_0067_E07.bCJ034322 
TES010069F06TES01_0069_F06.b  
TES010069G09TES01_0069_G09.bCJ034479 
TES010071A01TES01_0071_A01.bCJ034560 
TES010071G09TES01_0071_G09.bCJ034612 
TES010072A11TES01_0072_A11.b  
TES010074G02TES01_0074_G02.bCJ034777 
TES010076H04TES01_0076_H04.bCJ034928 
TES010078D08TES01_0078_D08.bCJ035013 
TES010079B03TES01_0079_B03.bCJ035061 
TES010079D12TES01_0079_D12.bCJ035087 
TES010079G04TES01_0079_G04.bCJ035110 
TES010083H06TES01_0083_H06.bCJ035391 
TES010085G04TES01_0085_G04.bCJ035516 
TES010085H10TES01_0085_H10.bCJ035525 
TES010086F11TES01_0086_F11.bCJ035580 
TES010088A09TES01_0088_A09.bCJ035672 
TES010092H03TES01_0092_H03.bCJ035995 
TES010097A10TES01_0097_A10.bCJ036306 
TES010097B07TES01_0097_B07.bCJ036314 
TES010103F06TES01_0103_F06.bCJ036792 
TES010104B09TES01_0104_B09.bCJ036836 
TES010107B11TES01_0107_B11.b  
TES010108D06TES01_0108_D06.bCJ037127 
TES010112D03TES01_0112_D03.bCJ037392 
TES010112F12TES01_0112_F12.bCJ037417 
THY010001E02THY01_0001_E02.bBP164432 
THY010002G12THY01_0002_G12.bBP167988 
THY010006C03THY01_0006_C03.bBP162044 
THY010008A08THY01_0008_A08.bBP160078 
THY010016B11THY01_0016_B11.bBP161636 
THY010033H08THY01_0033_H08.bBP168873 
THY010034A05THY01_0034_A05.bBP159799 
THY010035E11THY01_0035_E11.bBP165396 
THY010037C08THY01_0037_C08.bBP162584 
THY010037H06THY01_0037_H06.bBP168662 
THY010041B10THY01_0041_B10.bBP161547 
THY010043H10THY01_0043_H10.bBP169097 
THY010051E01THY01_0051_E01.bBP164365 
THY010054G05THY01_0054_G05.bBP167296 
THY010057A10THY01_0057_A10.bBP160317 
THY010057H06THY01_0057_H06.bBP168682 
THY010059F02THY01_0059_F02.bBP165730 
THY010059H06THY01_0059_H06.bBP168684 
THY010063H12THY01_0063_H12.bBP169332 AK239105
THY010066G09THY01_0066_G09.bBP167727 
THY010067D01THY01_0067_D01.bBP163134 
THY010071B07THY01_0071_B07.bBP161260 
THY010082F10THY01_0082_F10.bBP166574 
THY010084C04THY01_0084_C04.bBP162207 
THY010090B06THY01_0090_B06.bBP161164 
THY010094H07THY01_0094_H07.bBP168816 
THY010095G02THY01_0095_G02.bBP167003 
THY010095H03THY01_0095_H03.bBP168385 
THY010104B05THY01_0104_B05.bBP161072 
THY010104F10THY01_0104_F10.bBP166592 
THY010105G04THY01_0105_G04.bBP167229 
THY010106D04THY01_0106_D04.bBP163472 
THY010107F08THY01_0107_F08.bBP166390 
THY010108E06THY01_0108_E06.bBP164938 
THY010109H07THY01_0109_H07.bBP168828 
THY010110A04THY01_0110_A04.bBP159753 
THY010110B10THY01_0110_B10.bBP161604 
THY010110H09THY01_0110_H09.bBP169044 AK399382
THY010110H11THY01_0110_H11.bBP169262 
THY010112E10THY01_0112_E10.b  
THY010116H06THY01_0116_H06.bBP168726 AK239619
THY010117C10THY01_0117_C10.bBP162856 
THY010118E04THY01_0118_E04.bBP164738 
THY010118E09THY01_0118_E09.bBP165247 
THY010118H10THY01_0118_H10.bBP169158 
THY010122A07THY01_0122_A07.bBP160063 
THY010122D06THY01_0122_D06.bBP163693 
THY010123B05THY01_0123_B05.bBP161089 
THY010126C11THY01_0126_C11.bBP162971 
THY010126D05THY01_0126_D05.bBP163593 
THY010207B05THY01_0207_B05.bBP462514 
UTR010004C02UTR01_0004_C02.bBP170468 
UTR010009F01UTR01_0009_F01.bBP172031 
UTR010010A09UTR01_0010_A09.bBP169715 
UTR010016G08UTR01_0016_G08.bBP172886 
UTR010017D09UTR01_0017_D09.bBP171337 
UTR010018E03UTR01_0018_E03.bBP171600 
UTR010019G08UTR01_0019_G08.bBP172889 
UTR010029C12UTR01_0029_C12.bBP170938 
UTR010037D04UTR01_0037_D04.bBP171132 
UTR010037F01UTR01_0037_F01.bBP172055 
UTR010038E04UTR01_0038_E04.bBP171664 
UTR010040C12UTR01_0040_C12.bBP170949 
UTR010054H03UTR01_0054_H03.bBP464743 
UTR010056B02UTR01_0056_B02.bBP462988 
UTR010075F12UTR01_0075_F12.bBP464394 
UTR010076B11UTR01_0076_B11.bBP463223 
UTR010081F04UTR01_0081_F04.bCJ037494 
UTR010082H02UTR01_0082_H02.bCJ037606 
UTR010084A04UTR01_0084_A04.bCJ037710 
UTR010085B12UTR01_0085_B12.bCJ037822 
UTR010087D01UTR01_0087_D01.bCJ038022 
UTR010087F04UTR01_0087_F04.bCJ038048 
UTR010090A01UTR01_0090_A01.bCJ038267 
UTR010092E03UTR01_0092_E03.bCJ038494 
UTR010094C08UTR01_0094_C08.bCJ038660 
UTR010098C11UTR01_0098_C11.bCJ038943 
UTR010103G04UTR01_0103_G04.bCJ039446 
UTR010106A07UTR01_0106_A07.bCJ039658 
UTR010107C05UTR01_0107_C05.bCJ039771 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
313A3200.081WSACA/T
G350140.919ACG/T
346C29110.102WSTAC/Y
T35400.898TAT/Y
1129A500.625WSGTA/V
G300.375GTG/V


Alignment:      TOP

20110601C-001759 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
THY01_0110_H09.b :
THY01_0107_F08.b :
THY01_0109_H07.b :
THY01_0122_A07.b :
THY01_0112_E10.b :
TES01_0069_G09.b :
OVR01_0007_H10.b : aggggggccctattcxx
TES01_0044_H02.b :
THY01_0116_H06.b :
THY01_0008_A08.b :
THY01_0033_H08.b :
TES01_0022_F05.b :
TES01_0003_G09.b :
PST01_0037_F02.b :
TES01_0079_G04.b :
TES01_0019_C03.b :
THY01_0122_D06.b :
THY01_0110_H11.b :
PST01_0091_B04.b :
SKNB1_0038_B11.b :
TCH01_0053_H02.b :
THY01_0110_A04.b :
OVR01_0057_G03.b :
OVR01_0037_F08.b :
OVR01_0029_F12.b :
TES01_0042_F10.b :
ADR01_0066_E03.b :
THY01_0108_E06.b :
TES01_0108_D06.b :
THY01_0082_F10.b :
MLN01_0090_D07.b :
SMG01_0094_A09.b :
THY01_0051_E01.b :
THY01_0066_G09.b :
OVR01_0040_H11.b :
THY01_0059_F02.b :
TCH01_0036_H02.b :
THY01_0104_F10.b :
THY01_0106_D04.b :
TES01_0085_H10.b :
SMG01_0070_G05.b :
SMG01_0079_F06.b :
THY01_0035_E11.b :
CLNT1_0017_G09.b :
SPL01_0039_F02.b :
THY01_0094_H07.b :
SKNB1_0052_H09.b :
ITT01_0009_A02.b :
TES01_0063_H10.b :
PTG01_0036_B09.b :
SPLT1_0016_G07.b :
OVRM1_0060_E12.b : nnnnnnn
SPL01_0016_E03.b :
PBL01_0001_C04.b :
TES01_0038_D10.b :
UTR01_0019_G08.b :
TES01_0050_A05.b :
UTR01_0087_F04.b :
UTR01_0087_D01.b :
OVR01_0015_G10.b :
OVR01_0050_E08.b :
PBL01_0011_A03.b :
TCH01_0032_D09.b :
SPL01_0091_B11.b :
PBL01_0022_H11.b :
SKNB1_0032_G05.b :
TES01_0014_C10.b :
ITT01_0021_D08.b :
OVR01_0085_C10.b :
OVR01_0030_E04.b :
OVRT1_0011_D10.b :
SPL01_0104_E09.b :
PBL01_0081_B12.b :
SKNB1_0061_A05.b :
TES01_0074_G02.b :
OVRM1_0153_B04.b :
OVR01_0067_E10.b :
SPL01_0028_C09.b :
SPLT1_0023_H03.b :
TES01_0079_D12.b :
ITT01_0013_D05.b :
BMWN1_0084_A06.b :
TES01_0058_A10.b :
TES01_0050_D10.b :
UTR01_0094_C08.b :
SPL01_0079_B07.b :
ILNT1_0047_G08.b :
CBLT1_0010_A09.b :
CBLT1_0055_H01.b :
SPLT1_0087_C06.b :
THY01_0037_C08.b :
CBLT1_0061_F03.b :
CBLT1_0046_H11.b :
ILNT1_0091_B12.b :
PBL01_0084_B10.b :
TCH01_0090_C04.b :
TCH01_0002_A08.b :
ILNT1_0046_A10.b :
SMG01_0043_B06.b :
THY01_0118_H10.b :
THY01_0104_B05.b :
THY01_0105_G04.b :
THY01_0117_C10.b :
THY01_0067_D01.b : aaaaacaagaaaggaaggtggccggg
TES01_0053_C09.b :
OVR01_0076_A01.b :
OVRM1_0165_G06.b :
OVRM1_0148_H07.b :
OVRM1_0133_H07.b :
PBL01_0038_B04.b :
TES01_0092_H03.b :
OVR01_0100_D09.b :
TES01_0071_G09.b :
SMG01_0064_E05.b :
OVRM1_0218_F02.b :
OVRM1_0121_D03.b :
LVRM1_0063_A04.b :
OVR01_0066_H10.b :
OVRM1_0084_B12.b :
SMG01_0089_H12.b :
OVRM1_0212_A10.b :
SMG01_0046_H07.b :
SPL01_0088_B09.b :
PBL01_0030_F11.b :
THY01_0006_C03.b :
OVR01_0065_A12.b :
SMG01_0002_A11.b :
SMG01_0099_D07.b :
OVR01_0065_A08.b :
ADR01_0022_B07.b :
THY01_0041_B10.b :
UTR01_0029_C12.b :
THY01_0043_H10.b :
SPL01_0026_D09.b :
SPL01_0028_A04.b :
SPL01_0027_F04.b :
UTR01_0009_F01.b :
UTR01_0040_C12.b :
PTG01_0081_D07.b :
SMG01_0097_B10.b :
OVR01_0006_F10.b :
THY01_0001_E02.b :
SMG01_0021_A02.b :
THY01_0002_G12.b :
PTG01_0077_G03.b :
ADR01_0005_F01.b :
OVRT1_0131_F06.b :
PCT01_0034_B02.b :
UTR01_0017_D09.b :
BKFL1_0116_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxx
OVR01_0029_F01.b :
PTG01_0080_E03.b :
OVRT1_0136_H03.b :
SMG01_0013_A01.b :
UTR01_0037_D04.b :
PCT01_0004_G03.b :
ADR01_0040_G04.b :
OVRT1_0129_A01.b :
UTR01_0075_F12.b :
SMG01_0002_D03.b :
MLN01_0090_G11.b :
SMG01_0028_B09.b :
SKNB1_0040_D10.b :
THY01_0063_H12.b : caxxxxxxxxxxxxxxxxxx
UTR01_0106_A07.b :
ITT01_0003_H03.b :
ITT01_0086_C01.b :
ADR01_0038_E06.b :
SPL01_0065_H12.b :
UTR01_0098_C11.b :
OVRT1_0096_C07.b :
SKNB1_0079_A08.b :
CLNT1_0113_C12.b :
CLNT1_0110_B11.b :
PTG01_0044_D02.b :
ADR01_0083_C12.b :
PST01_0070_B03.b :
OVR01_0058_C03.b :
LNG01_0013_C05.b :
OVRT1_0067_F09.b :
THY01_0059_H06.b :
UTR01_0092_E03.b :
SPL01_0054_E10.b :
THY01_0034_A05.b :
OVRT1_0114_B10.b :
SMG01_0062_E03.b :
OVR01_0087_H02.b :
SKNB1_0083_G03.b :
CLNT1_0009_C05.b :
TES01_0001_B07.b :
OVR01_0087_C01.b :
TES01_0097_B07.b :
LNG01_0045_H05.b :
LNG01_0020_C03.b :
ITT01_0071_A05.b :
CLNT1_0138_C08.b :
TCH01_0054_A02.b :
OVR01_0013_A05.b :
UTR01_0076_B11.b :
OVRT1_0071_H11.b :
ITT01_0095_A05.b :
LNG01_0002_A12.b :
SPL01_0090_B12.b :
LVR01_0033_F02.b :
PBL01_0021_C06.b :
OVRT1_0049_E04.b :
OVRT1_0056_B10.b :
SPL01_0073_A06.b :
LNG01_0072_D03.b :
OVRT1_0057_F04.b :
UTR01_0085_B12.b :
LNG01_0106_A11.b :
ITT01_0041_E09.b :
PST01_0094_B02.b :
PBL01_0065_G08.b :
ITT01_0032_B11.b :
THY01_0037_H06.b :
OVR01_0089_A11.b :
UTR01_0103_G04.b :
ADR01_0063_B02.b :
PTG01_0019_D05.b :
CLNT1_0045_A02.b :
ITT01_0036_C05.b :
SPL01_0081_E05.b :
ITT01_0009_F01.b :
PBL01_0076_B03.b :
LNG01_0045_A06.b :
PBL01_0088_F07.b :
ADR01_0034_A06.b :
PBL01_0083_D09.b :
THY01_0071_B07.b :
PBL01_0051_D11.b :
ITT01_0100_E12.b :
ITT01_0021_B07.b :
ADR01_0050_B02.b :
ITT01_0016_G11.b :
ITT01_0055_B08.b :
SPL01_0103_E07.b :
TCH01_0069_G08.b :
PBL01_0085_D10.b :
ADR01_0080_H09.b :
OVR01_0011_F07.b :
ADR01_0102_H09.b :
THY01_0084_C04.b :
SPL01_0044_B06.b :
THY01_0054_G05.b :
OVRT1_0095_C04.b :
TCH01_0029_F08.b :
PTG01_0003_D07.b :
SPL01_0097_A10.b :
OVRT1_0056_A09.b :
THY01_0095_H03.b :
LVR01_0100_A04.b :
THY01_0095_G02.b :
CLNT1_0004_G01.b :
ITT01_0056_H07.b :
OVRT1_0035_B11.b :
MLN01_0081_D04.b :
ITT01_0023_F11.b :
OVR01_0019_D03.b :
MLN01_0048_E09.b :
TCH01_0059_E04.b :
MLN01_0081_G10.b :
TCH01_0019_F05.b :
TCH01_0006_C03.b :
ADR01_0060_C09.b :
UTR01_0107_C05.b :
SPL01_0019_A06.b :
THY01_0057_A10.b :
OVR01_0093_H03.b :
ADR01_0097_G09.b :
CLNT1_0010_H02.b :
ITT01_0062_H12.b :
OVR01_0050_F07.b :
TCH01_0075_F05.b :
OVR01_0094_H01.b :
THY01_0090_B06.b :
ITT01_0044_G10.b :
ITT01_0020_G12.b :
LNG01_0059_F02.b :
THY01_0057_H06.b :
UTR01_0056_B02.b :
TES01_0069_F06.b :
OVR01_0033_D11.b :
UTR01_0016_G08.b :
SKNB1_0014_B12.b :
SPL01_0099_D10.b :
TES01_0009_B11.b :
SKNB1_0047_C10.b :
ADR01_0053_A07.b :
ADR01_0009_H07.b :
TCH01_0081_D01.b :
TCH01_0011_D07.b :
THY01_0118_E04.b :
THY01_0126_C11.b :
TES01_0037_D08.b :
TES01_0083_H06.b :
THY01_0207_B05.b :
UTR01_0082_H02.b :
TES01_0028_A05.b :
ADR01_0087_B04.b :
MLN01_0071_F05.b :
UTR01_0090_A01.b :
ADR01_0072_H10.b :
TES01_0061_A11.b :
SKNB1_0091_G02.b :
TES01_0112_F12.b :
HTMT1_0048_B01.b :
TES01_0065_A11.b :
TES01_0009_E04.b :
UTR01_0084_A04.b :
PBL01_0040_D08.b :
THY01_0123_B05.b :
TES01_0066_H05.b :
OVRM1_0028_F03.b :
TES01_0024_C11.b :
ADR01_0033_B11.b :
THY01_0016_B11.b :
SKNB1_0003_E07.b :
TCH01_0101_G07.b :
ITT01_0024_C09.b :
SKNB1_0071_G12.b :
THY01_0126_D05.b :
OVRM1_0137_H01.b :
TES01_0026_D04.b :
OVRM1_0077_D11.b :
TES01_0072_A11.b :
PCT01_0013_F07.b :
TES01_0002_F06.b :
PST01_0057_F03.b :
MLN01_0066_G09.b :
OVR01_0031_C08.b :
MLN01_0103_C03.b :
ITT01_0032_F07.b :
PBL01_0022_A03.b :
PBL01_0062_D03.b :
CLNT1_0125_A10.b : ttattaattctcccccnttaccacttcacctttttcctccccctatcg
ITT01_0004_G02.b :
PBL01_0080_A12.b :
ADR01_0098_B07.b :
TCH01_0099_F11.b :
BFLT1_0107_E10.b :
ITT01_0008_E05.b :
ITT01_0022_E01.b :
ADR01_0058_C03.b :
ADR01_0031_C01.b :
TCH01_0025_B01.b :
SPL01_0050_G04.b :
TES01_0044_D02.b :
SKNB1_0029_H03.b :
TES01_0097_A10.b :
TES01_0010_E10.b :
CLNT1_0013_F04.b :
ITT01_0099_G03.b :
PST01_0031_A11.b :
TES01_0078_D08.b :
TES01_0107_B11.b :
TES01_0103_F06.b :
TES01_0059_B10.b :
TES01_0071_A01.b :
PCT01_0027_E12.b :
PCT01_0026_H01.b :
SKNB1_0063_F02.b :
SKNB1_0063_A03.b :
SKNB1_0035_H07.b :
SKNB1_0069_D09.b :
SKNB1_0037_E06.b :
TES01_0008_G02.b :
SKNB1_0034_C09.b :
TES01_0112_D03.b :
TES01_0007_F08.b :
TES01_0076_H04.b :
TES01_0086_F11.b :
TES01_0079_B03.b :
SKNB1_0094_C01.b :
SKNB1_0081_B08.b :
TES01_0067_E07.b :
SKNB1_0009_E06.b :
TES01_0104_B09.b :
PST01_0013_G05.b :
TES01_0064_H11.b :
SKNB1_0087_D04.b :
TES01_0060_H10.b :
PST01_0013_G04.b :
SKNB1_0075_H04.b :
TES01_0023_B04.b :
PST01_0009_F02.b :
TES01_0085_G04.b :
SKNB1_0008_C05.b :
SKNB1_0030_A09.b :
TES01_0088_A09.b :
SKNB1_0083_F06.b :
OVRM1_0152_A03.b :
THY01_0110_B10.b :
PBL01_0053_C01.b :
ADR01_0069_C05.b :
OVR01_0099_D12.b :
ADR01_0014_B09.b :
SPL01_0085_E07.b :
SMG01_0096_E03.b :
PBL01_0024_F05.b :
HTMT1_0074_F07.b :
THY01_0118_E09.b :
SPL01_0013_G05.b :
UTR01_0038_E04.b :
OVR01_0048_C09.b :
UTR01_0018_E03.b :
PBL01_0013_G08.b :
TCH01_0083_F04.b :
SMG01_0097_D04.b :
UTR01_0054_H03.b :
UTR01_0081_F04.b :
UTR01_0004_C02.b :
SKNB1_0086_F02.b :
SMG01_0096_B06.b :
UTR01_0010_A09.b :
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
THY01_0110_H09.b : ttg
THY01_0107_F08.b : gttg
THY01_0109_H07.b : gttg
THY01_0122_A07.b : agtg
THY01_0112_E10.b : g
TES01_0069_G09.b :
OVR01_0007_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0044_H02.b :
THY01_0116_H06.b :
THY01_0008_A08.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0033_H08.b : ggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0022_F05.b :
TES01_0003_G09.b :
PST01_0037_F02.b :
TES01_0079_G04.b :
TES01_0019_C03.b :
THY01_0122_D06.b :
THY01_0110_H11.b :
PST01_0091_B04.b :
SKNB1_0038_B11.b :
TCH01_0053_H02.b : nnttggcttggactatnacxxxxxxxxxxxxx
THY01_0110_A04.b : gttgcxxxx
OVR01_0057_G03.b : ntttgctaggactatnacxxxxxxxxxxx
OVR01_0037_F08.b : gggctttagggtgxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_F12.b : ccgggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0042_F10.b :
ADR01_0066_E03.b : nnnnaatttttnnna
THY01_0108_E06.b : gt
TES01_0108_D06.b :
THY01_0082_F10.b : ggcttatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0090_D07.b : nnngctaggactataacxxxxxxxxxxx
SMG01_0094_A09.b : nngggctttttaatnngagta
THY01_0051_E01.b : attttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_G09.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_H11.b : ctcgggcttttacgtgxxxxxxxxxxxxxxxxxxxxxx
THY01_0059_F02.b : gtgggtggacxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0036_H02.b : nttccgtaggacttgacxxxxxxxxxxx
THY01_0104_F10.b :
THY01_0106_D04.b : gttg
TES01_0085_H10.b :
SMG01_0070_G05.b : nncggaatannnnn
SMG01_0079_F06.b : taaatngga
THY01_0035_E11.b : gggtgcacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0017_G09.b : ncgttctgcgtacgagt
SPL01_0039_F02.b : ggggcattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0094_H07.b : ggtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0052_H09.b :
ITT01_0009_A02.b : nnnaagag
TES01_0063_H10.b :
PTG01_0036_B09.b : nnggccataannnngg
SPLT1_0016_G07.b : nnnnggcgag
OVRM1_0060_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccgatgca
SPL01_0016_E03.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0001_C04.b : ggtttcnnaagga
TES01_0038_D10.b :
UTR01_0019_G08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0050_A05.b :
UTR01_0087_F04.b : nnnnggcttggactatgacxxxxxxxx
UTR01_0087_D01.b : nnnnggcatggactatnacxxxxxxxxxxxxx
OVR01_0015_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0050_E08.b : nnnttgctaggactatgacxxxxxxx
PBL01_0011_A03.b : nnnngggg
TCH01_0032_D09.b : nggtagtgacttgacxxxxxxxx
SPL01_0091_B11.b : nnnggctagtgacttgacxxxxxxxxxxx
PBL01_0022_H11.b : agat
SKNB1_0032_G05.b :
TES01_0014_C10.b :
ITT01_0021_D08.b : nn
OVR01_0085_C10.b : nnnggctaggacttagacxxxxxxx
OVR01_0030_E04.b : gggacatttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_D10.b : nnnnnccgtcagctgcgxxxxx
SPL01_0104_E09.b : nntttgctaggactatnacxxxxxxxxxxxx
PBL01_0081_B12.b : aaag
SKNB1_0061_A05.b :
TES01_0074_G02.b :
OVRM1_0153_B04.b : agttgtcxx
OVR01_0067_E10.b : nttgctagtgatatgacxxxxxxxxxxxx
SPL01_0028_C09.b : cataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0023_H03.b : nntttgac
TES01_0079_D12.b :
ITT01_0013_D05.b : nnggct
BMWN1_0084_A06.b : nnnaaagac
TES01_0058_A10.b :
TES01_0050_D10.b :
UTR01_0094_C08.b : nnnnggctaggactatnacxxxxxxxxxxx
SPL01_0079_B07.b : nnnggctaggacttanacxxxxxx
ILNT1_0047_G08.b : nnnaagggac
CBLT1_0010_A09.b : ttttacgacg
CBLT1_0055_H01.b : nttttggcag
SPLT1_0087_C06.b : nnnnccgcgagtagaggccgtx
THY01_0037_C08.b : tgggtggxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_F03.b : nnnnnnnnnnnnnnnnnnn
CBLT1_0046_H11.b : tttttgcga
ILNT1_0091_B12.b : nnnnncgaag
PBL01_0084_B10.b : nnnggtg
TCH01_0090_C04.b : nnnggctaggactatgacagtttgtac
TCH01_0002_A08.b : nnngctaggacatgacagtttgtacxx
ILNT1_0046_A10.b : nnnnaacgacg
SMG01_0043_B06.b : ntttcgggctaaaannng
THY01_0118_H10.b : ttc
THY01_0104_B05.b : g
THY01_0105_G04.b : a
THY01_0117_C10.b : gttg
THY01_0067_D01.b : gcggggcggtgccccactattggtgtatttatttgcatggactaagacxxxxxxxxxxxx
TES01_0053_C09.b :
OVR01_0076_A01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0165_G06.b : nagttgtcx
OVRM1_0148_H07.b : nagttgtcx
OVRM1_0133_H07.b : agttgtcx
PBL01_0038_B04.b : n
TES01_0092_H03.b :
OVR01_0100_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0071_G09.b :
SMG01_0064_E05.b : nnnnccgcttnnntaa
OVRM1_0218_F02.b : nagttgtcx
OVRM1_0121_D03.b : nagttgtcxx
LVRM1_0063_A04.b : xxxxxxxxx
OVR01_0066_H10.b : nnnggcttggactatnacxxxxxxxxxxx
OVRM1_0084_B12.b : agttgtcx
SMG01_0089_H12.b : nccgctaaaataatt
OVRM1_0212_A10.b : nagttgtcx
SMG01_0046_H07.b : nnngggttttantata
SPL01_0088_B09.b : ngggttggactatgacxxxxxxxxxxxx
PBL01_0030_F11.b : nnnttag
THY01_0006_C03.b :
OVR01_0065_A12.b : nggtgtcccnnggcttggactatnacagtttgtac
SMG01_0002_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0099_D07.b : ncgtagtnnnnnggg
OVR01_0065_A08.b : nnnnggcttgtgacttgacxxxxxxxxxxx
ADR01_0022_B07.b :
THY01_0041_B10.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0029_C12.b : tgggtgcacxxxxxxxxxxxxxxxxxxxxx
THY01_0043_H10.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0028_A04.b : gatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0027_F04.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0009_F01.b : catttcgcggcxxxxxxxxxxxxxxxxxxxxx
UTR01_0040_C12.b : ttttgatggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0081_D07.b : cgaaaaannnnngg
SMG01_0097_B10.b : nnnnnnnnnnnnnnnn
OVR01_0006_F10.b : gggccccatttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0001_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0021_A02.b : nnccggcattnnnnng
THY01_0002_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0077_G03.b : tttg
ADR01_0005_F01.b : nnnaa
OVRT1_0131_F06.b : nncctgtacccnngnnnccgttagcgnacgxxx
PCT01_0034_B02.b :
UTR01_0017_D09.b : cttttggtggcxxxxxxxxxxxxxxxxxxxxx
BKFL1_0116_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_F01.b : gaaggctttatgggxxxxxxxxxxxxxxxxxxxxxx
PTG01_0080_E03.b : acgttcaannnngg
OVRT1_0136_H03.b : nnnccgattaccnnnnnnnccgttagcgttacgag
SMG01_0013_A01.b : gggttttnnnnn
UTR01_0037_D04.b : ggggaacxxxxxxxxxxxxxxxxxxxxxx
PCT01_0004_G03.b :
ADR01_0040_G04.b : nn
OVRT1_0129_A01.b : nnnaagaataannnnnnnccgttagcgttacgat
UTR01_0075_F12.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0002_D03.b : nnnnnnnnnnnnnnnn
MLN01_0090_G11.b : nggctaggactatgacagtttgtac
SMG01_0028_B09.b : nngggtgattcatant
SKNB1_0040_D10.b :
THY01_0063_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0106_A07.b : nncccgcttgtgacttgacagtttgtac
ITT01_0003_H03.b : nng
ITT01_0086_C01.b : nnng
ADR01_0038_E06.b : nnna
SPL01_0065_H12.b : ntttgagctaggactatnacxxxxxxxxxx
UTR01_0098_C11.b : nttttggctaggactatgacxxxxxxxxxx
OVRT1_0096_C07.b : nccgcttnnnnnnnnnacgttcagcgtacgagt
SKNB1_0079_A08.b :
CLNT1_0113_C12.b : nnnnccgtcagcngtacgagt
CLNT1_0110_B11.b : nnnccacttcggcgacgag
PTG01_0044_D02.b : ggggttatnnnngg
ADR01_0083_C12.b : aaaatt
PST01_0070_B03.b :
OVR01_0058_C03.b : nnnccgctaggactatnacxxxxxxxxxx
LNG01_0013_C05.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0067_F09.b : nggccttttnnnnnnccctttagcggacgagt
THY01_0059_H06.b : tgggggcacxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_E03.b : nnnnggctaggactatnacxxxxxxxxxxx
SPL01_0054_E10.b : nnnnggctaggactatnacxxxxxxxxxx
THY01_0034_A05.b : gggtggacctatxxxxxxxxxxxxxxxxx
OVRT1_0114_B10.b : nnnnccgtcagcgnacgxxx
SMG01_0062_E03.b : nnnccgccattatnnng
OVR01_0087_H02.b : nnnnggcatggactatgacxxxxxxxxxx
SKNB1_0083_G03.b :
CLNT1_0009_C05.b : accgttctgcgtcngxxxx
TES01_0001_B07.b :
OVR01_0087_C01.b : nnnggctaggactatgacxxxxxxxxxx
TES01_0097_B07.b :
LNG01_0045_H05.b : ttttcttcattggcatagtgxxxxxxxxxxxxxxxxxxxxxx
LNG01_0020_C03.b : gcatttggntgactatanngacxxxxxxxxxxx
ITT01_0071_A05.b : nntg
CLNT1_0138_C08.b : nnnnccttagctgtacgat
TCH01_0054_A02.b : nnntttgcttggactatgacxxxxxxxxxxx
OVR01_0013_A05.b : tgggggtggacxxxxxxxxxxxxxxxxxxxxxx
UTR01_0076_B11.b : ttttatggtggacxxxxxxxxxxxxxxxxxxxx
OVRT1_0071_H11.b : nnttttccgttagcgcacgxxx
ITT01_0095_A05.b : ntta
LNG01_0002_A12.b : atgggctttxxxxxxxxxxxxxxxxxxxxxx
SPL01_0090_B12.b : nntttgctagtgacttnacxxxxxxxxxx
LVR01_0033_F02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0021_C06.b :
OVRT1_0049_E04.b : nnngggttnnnnnnnnnnccgttagcgttcngxxx
OVRT1_0056_B10.b : nnngggtcttnnnnnnnnggttcagcgtacgxxx
SPL01_0073_A06.b : nnnnggctaggactatgacxxxxxxxxxx
LNG01_0072_D03.b : nnnnnggctggacttgacagtttg
OVRT1_0057_F04.b : ggcgtttnnnnnnnnccgttagcgnacgxxx
UTR01_0085_B12.b : nnnttagctaggactatnacxxxxxxxxxxx
LNG01_0106_A11.b : nnnnggctggacttgacagtttgtcx
ITT01_0041_E09.b : nnng
PST01_0094_B02.b :
PBL01_0065_G08.b : nnn
ITT01_0032_B11.b : nnngg
THY01_0037_H06.b : gggggacctatxxxxxxxxxxxxxxxxxx
OVR01_0089_A11.b : nnggcttggactataacxxxxxxxxxxx
UTR01_0103_G04.b : nnnggcttgtgacttgacagtttgtcac
ADR01_0063_B02.b : nnnnnnnnnnnnn
PTG01_0019_D05.b : nngggttttnnnnn
CLNT1_0045_A02.b : tggatccgttagcgnacgxxx
ITT01_0036_C05.b : nnngg
SPL01_0081_E05.b : nnnaagctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0009_F01.b : nnng
PBL01_0076_B03.b : nn
LNG01_0045_A06.b : agggctttctttagctacagtgaxxxxxxxxxxxxxx
PBL01_0088_F07.b : nnn
ADR01_0034_A06.b : nnnnttttttnaaaag
PBL01_0083_D09.b : nnn
THY01_0071_B07.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0051_D11.b : nnngg
ITT01_0100_E12.b : nnng
ITT01_0021_B07.b : nnn
ADR01_0050_B02.b : tttcna
ITT01_0016_G11.b : nnng
ITT01_0055_B08.b : nnn
SPL01_0103_E07.b : nnnnggctaggactatgacxxxxxxxxxx
TCH01_0069_G08.b : nnggttaggacttanacxxxxx
PBL01_0085_D10.b : nngg
ADR01_0080_H09.b : taaaann
OVR01_0011_F07.b : gaaactatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0102_H09.b : tacaang
THY01_0084_C04.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0044_B06.b : nnttagcttggactatnacagtttgtac
THY01_0054_G05.b : atxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_C04.b : nttgtttnnnnnnnnccgtttgcgnacgxxx
TCH01_0029_F08.b : nnnnggttaggactatgacxxxxxxxxxx
PTG01_0003_D07.b : tattatnng
SPL01_0097_A10.b : nnntttgcatgtgacttgacxxxxxxxxxx
OVRT1_0056_A09.b : nnntggttnnnnnnnnnncctttagcggacgagtg
THY01_0095_H03.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_A04.b : gactgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0095_G02.b : gggctttagggtgxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0004_G01.b : ggaatccgttagctgacgxxx
ITT01_0056_H07.b : nnnnng
OVRT1_0035_B11.b : nttgtttttnnnnnnccgttagcgnacgxxx
MLN01_0081_D04.b : nnggctaggactataacxxxxxxxxxx
ITT01_0023_F11.b : nnngg
OVR01_0019_D03.b : tggggggaacttattagxxxxxxxxxxxxxx
MLN01_0048_E09.b : nnnngggtaggacttgacxxxxxxxxxx
TCH01_0059_E04.b : nnnggctaggactatnacxxxxxxxxxx
MLN01_0081_G10.b : nnggctaggactatgacxxxxxxxxxx
TCH01_0019_F05.b : nnnntttgtggacttgacagtttgtcx
TCH01_0006_C03.b : nnnggctaggactatgacagtttgtcx
ADR01_0060_C09.b : nnnnna
UTR01_0107_C05.b : nnnnggctaggacttagacagtttgtac
SPL01_0019_A06.b : ttggggtgxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0057_A10.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0093_H03.b : nnnnggctagtgacttgacxxxxxxxxxx
ADR01_0097_G09.b : nnnggttaannnnn
CLNT1_0010_H02.b : ctccgtttgctgacgxxx
ITT01_0062_H12.b : nnaaa
OVR01_0050_F07.b : nnnggctaggactatnacxxxxxxxxxx
TCH01_0075_F05.b : nnnaagctaggactatgacxxxxxxx
OVR01_0094_H01.b : nnnnnggcttgtgacttnacagtttgtac
THY01_0090_B06.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0044_G10.b : nnna
ITT01_0020_G12.b : nnaa
LNG01_0059_F02.b : nccgctttnttcgagcatggacttgacagtttgtac
THY01_0057_H06.b : ttttgggtggxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0056_B02.b : gcttttagggtgxxxxxxxxxxxxxxxxxxxxxx
TES01_0069_F06.b :
OVR01_0033_D11.b : aaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0016_G08.b : gggggcacxxxxxxxxxxxxxxxxxxxxx
SKNB1_0014_B12.b :
SPL01_0099_D10.b : nnnnggctaggactatnacxxxxxxxxxx
TES01_0009_B11.b :
SKNB1_0047_C10.b :
ADR01_0053_A07.b : nnnnaacggggnaaa
ADR01_0009_H07.b : nnnn
TCH01_0081_D01.b : ggttagctaggactatnacxxxxxxxxxxx
TCH01_0011_D07.b : nnngggtaggacttgacxxxxxxxxx
THY01_0118_E04.b : gtg
THY01_0126_C11.b :
TES01_0037_D08.b :
TES01_0083_H06.b :
THY01_0207_B05.b : tttttggtggxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_H02.b : nnnggcttnnnnnttgcttggtacttgacxxxxxxxxxx
TES01_0028_A05.b :
ADR01_0087_B04.b : nnn
MLN01_0071_F05.b : gtaggacttgacagtttgt
UTR01_0090_A01.b : nnntttgctagtgacttnacxxxxxxxx
ADR01_0072_H10.b : nnggcgctnnnna
TES01_0061_A11.b :
SKNB1_0091_G02.b :
TES01_0112_F12.b :
HTMT1_0048_B01.b : ttttgcg
TES01_0065_A11.b :
TES01_0009_E04.b :
UTR01_0084_A04.b : nnngggttttnnnnnggcccggactaagacxxxxxxx
PBL01_0040_D08.b :
THY01_0123_B05.b :
TES01_0066_H05.b :
OVRM1_0028_F03.b : atxxxxxxxxxxxxxxxxxxxxx
TES01_0024_C11.b :
ADR01_0033_B11.b : nnccg
THY01_0016_B11.b : cgcaxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0003_E07.b :
TCH01_0101_G07.b : ntgtgttgtgattagac
ITT01_0024_C09.b : n
SKNB1_0071_G12.b :
THY01_0126_D05.b :
OVRM1_0137_H01.b : cagttg
TES01_0026_D04.b :
OVRM1_0077_D11.b : aagtt
TES01_0072_A11.b :
PCT01_0013_F07.b :
TES01_0002_F06.b :
PST01_0057_F03.b :
MLN01_0066_G09.b : ggtagtgctatgacxxxxxx
OVR01_0031_C08.b : gggcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0103_C03.b : nnnnnagtaggactatnacxxxxxx
ITT01_0032_F07.b :
PBL01_0022_A03.b : n
PBL01_0062_D03.b :
CLNT1_0125_A10.b : cnncnncttncccnnntnnnctnnntnnnnnnnnnnngggctttngggnnnccaatcgcg
ITT01_0004_G02.b : n
PBL01_0080_A12.b :
ADR01_0098_B07.b : gaa
TCH01_0099_F11.b : nnggctaggacttaaacxxxxxx
BFLT1_0107_E10.b : nnnccccctcagcgtagg
ITT01_0008_E05.b : n
ITT01_0022_E01.b : n
ADR01_0058_C03.b : n
ADR01_0031_C01.b : ngggattnnn
TCH01_0025_B01.b : nnnnggctaggactatgacagttt
SPL01_0050_G04.b : ncggattnnnnnggcatggactatnacxxxxxx
TES01_0044_D02.b :
SKNB1_0029_H03.b :
TES01_0097_A10.b :
TES01_0010_E10.b :
CLNT1_0013_F04.b : ggggccgtcagcg
ITT01_0099_G03.b :
PST01_0031_A11.b :
TES01_0078_D08.b :
TES01_0107_B11.b :
TES01_0103_F06.b :
TES01_0059_B10.b :
TES01_0071_A01.b :
PCT01_0027_E12.b :
PCT01_0026_H01.b :
SKNB1_0063_F02.b :
SKNB1_0063_A03.b :
SKNB1_0035_H07.b :
SKNB1_0069_D09.b :
SKNB1_0037_E06.b :
TES01_0008_G02.b :
SKNB1_0034_C09.b :
TES01_0112_D03.b :
TES01_0007_F08.b :
TES01_0076_H04.b :
TES01_0086_F11.b :
TES01_0079_B03.b :
SKNB1_0094_C01.b :
SKNB1_0081_B08.b :
TES01_0067_E07.b :
SKNB1_0009_E06.b :
TES01_0104_B09.b :
PST01_0013_G05.b :
TES01_0064_H11.b :
SKNB1_0087_D04.b :
TES01_0060_H10.b :
PST01_0013_G04.b :
SKNB1_0075_H04.b :
TES01_0023_B04.b :
PST01_0009_F02.b :
TES01_0085_G04.b :
SKNB1_0008_C05.b :
SKNB1_0030_A09.b :
TES01_0088_A09.b :
SKNB1_0083_F06.b :
OVRM1_0152_A03.b :
THY01_0110_B10.b :
PBL01_0053_C01.b :
ADR01_0069_C05.b :
OVR01_0099_D12.b :
ADR01_0014_B09.b :
SPL01_0085_E07.b :
SMG01_0096_E03.b :
PBL01_0024_F05.b :
HTMT1_0074_F07.b :
THY01_0118_E09.b :
SPL01_0013_G05.b :
UTR01_0038_E04.b :
OVR01_0048_C09.b :
UTR01_0018_E03.b :
PBL01_0013_G08.b :
TCH01_0083_F04.b :
SMG01_0097_D04.b :
UTR01_0054_H03.b :
UTR01_0081_F04.b :
UTR01_0004_C02.b :
SKNB1_0086_F02.b :
SMG01_0096_B06.b :
UTR01_0010_A09.b :
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : ......AGGCTGGTCCGGTCCGGAAATCGCACGACT*GTTGGCCTATGGGGCTCTATCGG
---------+---------+---------+---------+---------+---------+ 53
THY01_0110_H09.b : tcaaacAGGCTGGTCCGGTCCGGAATCCTCA*CACT*GT**GGCTATGG**CTCTATCGG
THY01_0107_F08.b : caaaaacaGCTGGTCCGGTCCGGAATCCTCAGCACT*GTTGGCCTATGG**CTCTATCGG
THY01_0109_H07.b : caaaaacaGCTGGTCCGGTCCGGAATCCTCAGCACT*GTTGGCCTA*GG**CTCTATCGG
THY01_0122_A07.b : acaaaacaGCTGGTACGGTCCGGAATCCTCAGCACT*GTTGGCCTATGG**CTCTATCGG
THY01_0112_E10.b : ttgcaaaaacagcggacggtCGGAATTCTCAACACT*GTTGGGCTATGG**CTCTATCGG
TES01_0069_G09.b : gctgtggctactggATATCGCACGCCTAGACAGCCCG*AC**CTCTATCGG
OVR01_0007_H10.b : xxxxxxxxxxxxxxxxxxxxxxtATATCGCACGCCTAGACCAGCCCGAC**CTCTATCGG
TES01_0044_H02.b : ccgcgttggctctggatTCGCACGCCTAGACAGCCCG*AC**CTCTATCGG
THY01_0116_H06.b : cgtgacaaagcggcggccggtcggaatccCAGCACT*GTTGGC*TATGG**CTCTATCGG
THY01_0008_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcttGTTGGCCTACTGCTCTCTATCGG
THY01_0033_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGGCCTACTGG*CTCTATCGG
TES01_0022_F05.b : cgcgtTGGCTATGG**CTCTATCGG
TES01_0003_G09.b : cgctgTGGCTATGG**CTCTATCGG
PST01_0037_F02.b : tTGGCTCTGG**CTCTATCGG
TES01_0079_G04.b : nnnaactacgTGGCTATGGCTCTATCGG
TES01_0019_C03.b : cttTGGCTATGGCTCTATCGG
THY01_0122_D06.b : gtgtcaaaacagcggtccggtcggaatcctcagcacgtggcCTATGG**CTCTATGGG
THY01_0110_H11.b : gtgacaaacagtggtcggtcggaatccagcacgtggCTATGG**CTCTATCGG
PST01_0091_B04.b : ttttactgcggtGGCTATGGCTCTATCGG
SKNB1_0038_B11.b : nnttttcctgacggtGGCTACGGCTCTATCGG
TCH01_0053_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTG*GCTCTATCGG
THY01_0110_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGG**CTCTATCGG
OVR01_0057_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGG**CTCTATCGG
OVR01_0037_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtgtttTACTGGCTCTATCGG
OVR01_0029_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtttTACTGGCTCTATCGG
TES01_0042_F10.b : tttttcctgcagttgCTATGGCTCCTACGG
ADR01_0066_E03.b : gagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGG**CTCTATCGG
THY01_0108_E06.b : gtcaaaacagctggtccggtcggaattcctcagcacgttggcctacTGG**CTCTATCGG
TES01_0108_D06.b : caacgttggcACTGGCTCTATCGG
THY01_0082_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG**CTCTATCGG
MLN01_0090_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTGGCTCTATCGG
SMG01_0094_A09.b : aagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG**CTCTATCGG
THY01_0051_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggtGGCTCTCTATCGG
THY01_0066_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTATCGG
OVR01_0040_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTATCGG
THY01_0059_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTATCGG
TCH01_0036_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTATCGG
THY01_0104_F10.b : gttgtcaaaacaggcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTATCGG
THY01_0106_D04.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTATCGG
TES01_0085_H10.b : nccgctgttgctaTGGCTCTATCGG
SMG01_0070_G05.b : ggataaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTATCGG
SMG01_0079_F06.b : taaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTATCGG
THY01_0035_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTATCGG
CLNT1_0017_G09.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcttTGGCTCTATCGG
SPL01_0039_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGGGCTCTATCGG
THY01_0094_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTCTCTATCGG
SKNB1_0052_H09.b : nnngggggggnnnnnnnacacgcgttggctatgGGGCTCTATCGG
ITT01_0009_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTATCGG
TES01_0063_H10.b : tacgctttggctctggGGCTCT*TCGG
PTG01_0036_B09.b : agtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
SPLT1_0016_G07.b : tagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCTCTATCGG
OVRM1_0060_E12.b : aaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
SPL01_0016_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTATCGG
PBL01_0001_C04.b : tatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
TES01_0038_D10.b : ccaaactttgccatGGCTCTA*CGG
UTR01_0019_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTATCGG
TES01_0050_A05.b : nntttctatggctctGGCTCT*TCGG
UTR01_0087_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTATCGG
UTR01_0087_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
OVR01_0015_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncGGCTCTATCGG
OVR01_0050_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTATCGG
PBL01_0011_A03.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTATCGG
TCH01_0032_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCTCTATCGG
SPL01_0091_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
PBL01_0022_H11.b : gaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
SKNB1_0032_G05.b : nngggatnnnnnnttcctacgttggctaGGCTCTATCGG
TES01_0014_C10.b : taactgcgttggctcGGCTCT*TCGG
ITT01_0021_D08.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTATCGG
OVR01_0085_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTATCGG
OVR01_0030_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
OVRT1_0011_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
SPL01_0104_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
PBL01_0081_B12.b : atgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTATCGG
SKNB1_0061_A05.b : nnnnncctcactgttggcaGGCTCTATCGG
TES01_0074_G02.b : catttaattataaatttgtggcgttggctcgGCTCTATCGG
OVRM1_0153_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
OVR01_0067_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggaaACTCTATCGG
SPL01_0028_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
SPLT1_0023_H03.b : ggaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
TES01_0079_D12.b : tttttcctacggttgctatGGCTCTACGG
ITT01_0013_D05.b : acacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttACTCTATCGG
BMWN1_0084_A06.b : ggtagacgccntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
TES01_0058_A10.b : tttctgctgtggctcTGGCTATCGG
TES01_0050_D10.b : tttttcctgcgttgctaTGGCTATCGG
UTR01_0094_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
SPL01_0079_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
ILNT1_0047_G08.b : ggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGC
CBLT1_0010_A09.b : gtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
CBLT1_0055_H01.b : gtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCTCTATCGG
SPLT1_0087_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
THY01_0037_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
CBLT1_0061_F03.b : nnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCTCTATCGG
CBLT1_0046_H11.b : cggtacacgcagtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
ILNT1_0091_B12.b : tagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
PBL01_0084_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttTCTCTATCGG
TCH01_0090_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaACTCTATCGG
TCH01_0002_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTATCGG
ILNT1_0046_A10.b : gtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTATCGG
SMG01_0043_B06.b : gacgtaacagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0118_H10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0104_B05.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0105_G04.b : gtgtcaaaacagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTC*ATCGG
THY01_0117_C10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0067_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TES01_0053_C09.b : ttctatttgacagcgttggcttgGCTCTTCGG
OVR01_0076_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRM1_0165_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRM1_0148_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRM1_0133_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PBL01_0038_B04.b : gctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TES01_0092_H03.b : ttttncctgcggtggctatgGCTCTTCGG
OVR01_0100_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxCTCTATCGG
TES01_0071_G09.b : tttttcctgctgttgctatggGCTCTTCGG
SMG01_0064_E05.b : tgagtaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRM1_0218_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRM1_0121_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LVRM1_0063_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0066_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRM1_0084_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0089_H12.b : ggctaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRM1_0212_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0046_H07.b : ggataaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0088_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PBL01_0030_F11.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0006_C03.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0065_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0002_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxCTCTATCGG
SMG01_0099_D07.b : acgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0065_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0022_B07.b : aaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0041_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0029_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0043_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0026_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0028_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0027_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0009_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0040_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PTG01_0081_D07.b : agtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0097_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCTCTATCGG
OVR01_0006_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0001_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0021_A02.b : gagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0002_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PTG01_0077_G03.b : gataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0005_F01.b : tactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0131_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PCT01_0034_B02.b : nnnngggatttnnnnnnnnactgcgttgtgcangGCTCTTCGG
UTR01_0017_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
BKFL1_0116_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0029_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PTG01_0080_E03.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0136_H03.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0013_A01.b : ggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0037_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PCT01_0004_G03.b : nnngggggattaatnnnnncctgcgttggccacgtGCTCTTCGG
ADR01_0040_G04.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0129_A01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0075_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0002_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
MLN01_0090_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0028_B09.b : agagtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SKNB1_0040_D10.b : nnnnnccaactgtggctatgGCTCTTCGG
THY01_0063_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0106_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0003_H03.b : gatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0086_C01.b : gatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0038_E06.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0065_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0098_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0096_C07.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SKNB1_0079_A08.b : nngggtannnnnnncctacgtttgctcggGGCTCTTCG
CLNT1_0113_C12.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
CLNT1_0110_B11.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PTG01_0044_D02.b : agtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0083_C12.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PST01_0070_B03.b : nnaactgctgtggctatgGCTCTTCGG
OVR01_0058_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LNG01_0013_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0067_F09.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0059_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0092_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0054_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0114_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SMG01_0062_E03.b : gctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0087_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SKNB1_0083_G03.b : nnnnnggggannnnnnnnnccagcgtttgcctcgGCTCTTCGG
CLNT1_0009_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TES01_0001_B07.b : tttcctactgtggctatgGCTCTTCGG
OVR01_0087_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TES01_0097_B07.b : nngggctttnnnnntcccacgttgctatGCTCTACGG
LNG01_0045_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LNG01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0071_A05.b : atgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
CLNT1_0138_C08.b : gttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TCH01_0054_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0013_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0076_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0071_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0095_A05.b : tgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LNG01_0002_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0090_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LVR01_0033_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PBL01_0021_C06.b : tgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0049_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0056_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0073_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LNG01_0072_D03.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0085_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LNG01_0106_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0041_E09.b : ggtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PST01_0094_B02.b : nnnnggctgctgttgctatgGCTCTTCGG
PBL01_0065_G08.b : ggatgaacagctggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0032_B11.b : agtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0037_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0089_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0103_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0063_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PTG01_0019_D05.b : ggcgtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
CLNT1_0045_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0036_C05.b : atgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0081_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0009_F01.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PBL01_0076_B03.b : ggtgacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LNG01_0045_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PBL01_0088_F07.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0034_A06.b : agtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PBL01_0083_D09.b : ggataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0071_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PBL01_0051_D11.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0100_E12.b : gtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0021_B07.b : ggtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0050_B02.b : agatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0016_G11.b : gctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0055_B08.b : ggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0103_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TCH01_0069_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PBL01_0085_D10.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0080_H09.b : ggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0011_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0102_H09.b : gatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0084_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0044_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0054_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0095_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TCH01_0029_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
PTG01_0003_D07.b : gagtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0097_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0095_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LVR01_0100_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0095_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
CLNT1_0004_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0056_H07.b : gagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVRT1_0035_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
MLN01_0081_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0023_F11.b : agxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0019_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
MLN01_0048_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TCH01_0059_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
MLN01_0081_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TCH01_0019_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TCH01_0006_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0060_C09.b : atgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0107_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
SPL01_0019_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0057_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0093_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ADR01_0097_G09.b : ggatcaacagctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
CLNT1_0010_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0062_H12.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0050_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TCH01_0075_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
OVR01_0094_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0090_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0044_G10.b : agatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
ITT01_0020_G12.b : agatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
LNG01_0059_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
THY01_0057_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
UTR01_0056_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTATCGG
TES01_0069_F06.b : tcgcgttggctctggTCTATCGG
OVR01_0033_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTATCGG
UTR01_0016_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTATCGG
SKNB1_0014_B12.b : nnntttccttacggtggctctggCTCTTCNG
SPL01_0099_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTATCGG
TES01_0009_B11.b : nnttcgcggtggctatggTCTATCGG
SKNB1_0047_C10.b : nggggattannnnnccaccgtgtgctcggaTCTATCGG
ADR01_0053_A07.b : actaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGATCGG
ADR01_0009_H07.b : naatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTATCGG
TCH01_0081_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggTCTATCGG
TCH01_0011_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTATCGG
THY01_0118_E04.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGATCGG
THY01_0126_C11.b : ttgtcaaaacagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCGG
TES01_0037_D08.b : tgtggctacggaCTATCGG
TES01_0083_H06.b : tttaactgacgttgctctgGGATCGG
THY01_0207_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCGG
UTR01_0082_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCGG
TES01_0028_A05.b : cgcggtggctatggtggCTATCGG
ADR01_0087_B04.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCGG
MLN01_0071_F05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCGG
UTR01_0090_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCGG
ADR01_0072_H10.b : tggctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCGG
TES01_0061_A11.b : tgcctgcggtggctatGATCGG
SKNB1_0091_G02.b : nttgagttggctctggaactTATCGG
TES01_0112_F12.b : ntttctgctgttgctatGATCGG
HTMT1_0048_B01.b : aggaacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATCGG
TES01_0065_A11.b : nttaacgttggcactggatTATCGG
TES01_0009_E04.b : nnnncctacgtggctatGATCGG
UTR01_0084_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATCGG
PBL01_0040_D08.b : nggtgcaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATCGG
THY01_0123_B05.b : gttgcaaaaacagcggtacggtcggaatcctcagcacgttggctatggATCGG
TES01_0066_H05.b : aactgcgttggctatanATCGG
OVRM1_0028_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgttggcctactggATCGG
TES01_0024_C11.b : cgtggctctggctcATCGG
ADR01_0033_B11.b : ctaaaaaggctaacagctggacggtccgxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGG
THY01_0016_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGG
SKNB1_0003_E07.b : nnnnnggccacggtggccATCGG
TCH01_0101_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCGG
ITT01_0024_C09.b : nnnggtgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGG
SKNB1_0071_G12.b : nnnnaatggcgttggctatggATCGG
THY01_0126_D05.b : gttgtcaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
OVRM1_0137_H01.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
TES01_0026_D04.b : TCGG
OVRM1_0077_D11.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
TES01_0072_A11.b : tttcctgcggtggctctggctctTCNG
PCT01_0013_F07.b : nnnggacaatannnnnncctgcgggtgcacgtgctctTCGG
TES01_0002_F06.b : ttccgctgtggctctggctcTTCG
PST01_0057_F03.b : nnncctgcggtggctatggctctTCGG
MLN01_0066_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
OVR01_0031_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
MLN01_0103_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
ITT01_0032_F07.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
PBL01_0022_A03.b : nnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
PBL01_0062_D03.b : nnggatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
CLNT1_0125_A10.b : tacgnaggttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
ITT01_0004_G02.b : nnggtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
PBL01_0080_A12.b : aaaagatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
ADR01_0098_B07.b : aaanggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
TCH01_0099_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
BFLT1_0107_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
ITT01_0008_E05.b : nnggtgatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
ITT01_0022_E01.b : nnttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
ADR01_0058_C03.b : nnaacgtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
ADR01_0031_C01.b : nnaactaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
TCH01_0025_B01.b : gtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGG
SPL01_0050_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCGG
TES01_0044_D02.b : gtggctcctaCGG
SKNB1_0029_H03.b : nnngggatnnnnnnncctacgttggctnggctctTCG
TES01_0097_A10.b : tttttcctacgttggcacggggtaCGG
TES01_0010_E10.b : nctacggtggctatggctctATC
CLNT1_0013_F04.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGG
ITT01_0099_G03.b : ngtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGG
PST01_0031_A11.b : naaactgcggtggctatggctctTCG
TES01_0078_D08.b : tttttcctacgtggctatggatGG
TES01_0107_B11.b : tttttactacattgtgcttggatGG
TES01_0103_F06.b : nnncctacgttggctctggctctaCG
TES01_0059_B10.b : nntttcctgcgtttgctatggatGG
TES01_0071_A01.b : nttttaccgctgttgctatggatGG
PCT01_0027_E12.b : nnncgcacatannnnnncctgcggtggctcggctcttGG
PCT01_0026_H01.b : nnnggtgaaaatnnnnnnncctgaggtgtgcacgtgatGG
SKNB1_0063_F02.b : nngggggtnnnnnnnttcacgttggctctggatGG
SKNB1_0063_A03.b : ngggcgnnnnnnnncctgacgttggctagctctatGG
SKNB1_0035_H07.b : nnntttatggcgttggcatggtatGG
SKNB1_0069_D09.b : nncccgttnnnnnnnnccagcggtggcatggctctatGG
SKNB1_0037_E06.b : nngggttnnnnnnnccatacttgtgctctctatGG
TES01_0008_G02.b : cggcgtggctatggatGG
SKNB1_0034_C09.b : nnccggtannnnnnncctcacgttggctacggtatGG
TES01_0112_D03.b : tttncctgcggtggctattG
TES01_0007_F08.b : tggctaggtatG
TES01_0076_H04.b : ntttccactgtggctatggctcttcn
TES01_0086_F11.b : naactgctgtggctatggctcttca
TES01_0079_B03.b : nnaactgcgttgctctggctcttcn
SKNB1_0094_C01.b : nnnnttcgctgtggctctggctctatg
SKNB1_0081_B08.b : nnnnnnnnnnnnnnnnnnnnncccgcgttggctagctctatg
TES01_0067_E07.b : nncctgctgtggctctggctctacn
SKNB1_0009_E06.b : nnngggattnnnnnnncctacgttggctcggctcttcn
TES01_0104_B09.b : nttttcctactgttgctatggctcttcn
PST01_0013_G05.b : tttttttcctacgttggctatggatc
TES01_0064_H11.b : ttttcctgcgtggctcggctcctatc
SKNB1_0087_D04.b : nnngggaaaannnnnnccaacgtggctaggctcttcn
TES01_0060_H10.b : nnnnncctgctgtggctatggctcttcn
PST01_0013_G04.b : nnnncctgcggtggctgggctcttc
SKNB1_0075_H04.b : nnnnccttnnnnnnnncctacgttggctcggctctatg
TES01_0023_B04.b : ttttttctactgtggctatggctcttc
PST01_0009_F02.b : tttttttcctgcgttggctatggtt
TES01_0085_G04.b : nnncctactgtggcctggctcttc
SKNB1_0008_C05.b : naaaccctcgcgctggctctggctcttc
SKNB1_0030_A09.b : ntttttgctgacgtttgctatggctcttc
TES01_0088_A09.b : ttttcctgcggttgctatggctcttc
SKNB1_0083_F06.b : nnnnnnnnnngggannnnnnncccacgttggctcat
OVRM1_0152_A03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0110_B10.b : gtgtcaaacaggctggtcggtcggaatcctcagcactgtggctactggctcta
PBL01_0053_C01.b : naagatgaacaxxx
ADR01_0069_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
OVR01_0099_D12.b : attggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0014_B09.b :
SPL01_0085_E07.b : nnnggctaggactataacxxx
SMG01_0096_E03.b :
PBL01_0024_F05.b :
HTMT1_0074_F07.b :
THY01_0118_E09.b :
SPL01_0013_G05.b :
UTR01_0038_E04.b :
OVR01_0048_C09.b :
UTR01_0018_E03.b :
PBL01_0013_G08.b :
TCH01_0083_F04.b :
SMG01_0097_D04.b :
UTR01_0054_H03.b :
UTR01_0081_F04.b :
UTR01_0004_C02.b :
SKNB1_0086_F02.b :
SMG01_0096_B06.b :
UTR01_0010_A09.b :
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
---------+---------+---------+---------+---------+---------+ 111
THY01_0110_H09.b : CAGCTTCCGACCGCGGGATGTTCAA**GGAAGTTCTCCGCTCCCAG**CACGGG*TCC*T
THY01_0107_F08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0109_H07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGT*CTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0122_A07.b : CAGCTTCCGACCGCGGGATGT*TCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0112_E10.b : CAGCTTCCGAACGGGGGATGTTTTACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TTCCT
TES01_0069_G09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0007_H10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0044_H02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0116_H06.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0008_A08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0033_H08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0022_F05.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0003_G09.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PST01_0037_F02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0079_G04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0019_C03.b : CAC**TTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0122_D06.b : G*GCTTCCGACCGCGGGATGT*TCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0110_H11.b : C*GCTTCGAC***GGGGATGTTCAA**GGAAGTTCTCCGCTC*CAG*GCAC**G*GTCCT
PST01_0091_B04.b : CAGCTTCC*ACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0038_B11.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCCCCTTTAA*GCACGGG*TCCCT
TCH01_0053_H02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0110_A04.b : CAGCTTCCGACCGCGGGATGT*TCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0057_G03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0037_F08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0029_F12.b : CAGCTTCCGACCGCGGGATGTCTCTCAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0042_F10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0066_E03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0108_E06.b : CAGCN*CCGACCGCGGGATGT*TCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0108_D06.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0082_F10.b : CAGCTTCCGACCGCGGGACGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
MLN01_0090_D07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0094_A09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0051_E01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0066_G09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0040_H11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCTGCTCCCAG*GCACGGG*TCCCT
THY01_0059_F02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0036_H02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0104_F10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0106_D04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0085_H10.b : *AGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0070_G05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCCCCCAG*GCACGGG*TCCCT
SMG01_0079_F06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0035_E11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0017_G09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0039_F02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0094_H07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0052_H09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0009_A02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0063_H10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PTG01_0036_B09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPLT1_0016_G07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0060_E12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0016_E03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0001_C04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0038_D10.b : AAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0019_G08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0050_A05.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0087_F04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0087_D01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0015_G10.b : CAGCTTCCGACCGCGGGAAGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCC
OVR01_0050_E08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0011_A03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0032_D09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0091_B11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0022_H11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0032_G05.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAT*GCACGGG*TCCCT
TES01_0014_C10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0021_D08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0085_C10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0030_E04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0011_D10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0104_E09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0081_B12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0061_A05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCTT*G*GCACGGG*TCCCT
TES01_0074_G02.b : CA*CTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGC*CCCTT*GCACGGG*TCCCT
OVRM1_0153_B04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0067_E10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0028_C09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPLT1_0023_H03.b : CCGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0079_D12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0013_D05.b : CCGTTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
BMWN1_0084_A06.b : CCGTTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0058_A10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0050_D10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0094_C08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0079_B07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ILNT1_0047_G08.b : CATCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CBLT1_0010_A09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CBLT1_0055_H01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPLT1_0087_C06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0037_C08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CBLT1_0061_F03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CBLT1_0046_H11.b : CCGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ILNT1_0091_B12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0084_B10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0090_C04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0002_A08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ILNT1_0046_A10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0043_B06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0118_H10.b : CAGCTTCCGACCGCGGGATGT*TCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0104_B05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0105_G04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0117_C10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0067_D01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0053_C09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAT*TCACGGG*TCCCT
OVR01_0076_A01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0165_G06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0148_H07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0133_H07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0038_B04.b : CAGCTTCCGACCGCGGGATGTCTCGCAGGAAGTTCTCCGCTCCCAGAGCACGGG*TCCCT
TES01_0092_H03.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0100_D09.b : CAGCTTCCGACCGCGGGACGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0071_G09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0064_E05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0218_F02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0121_D03.b : CAGCTTCCGACCGCGGAATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LVRM1_0063_A04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0066_H10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0084_B12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0089_H12.b : CAGCTTCCGACCGCGGGATGTCTCACGGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0212_A10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0046_H07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0088_B09.b : CAGCTCCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0030_F11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0006_C03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0065_A12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0002_A11.b : CAGCTTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0099_D07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0065_A08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0022_B07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0041_B10.b : CAGCTTCCGACCGCGGGATGTCTCTCAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0029_C12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0043_H10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0026_D09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0028_A04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0027_F04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0009_F01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0040_C12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PTG01_0081_D07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0097_B10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0006_F10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0001_E02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCGCGGG*TCCCT
SMG01_0021_A02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0002_G12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PTG01_0077_G03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0005_F01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0131_F06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PCT01_0034_B02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0017_D09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
BKFL1_0116_A02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0029_F01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PTG01_0080_E03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0136_H03.b : CAGCTTCCGACCGCGGGAT********GGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0013_A01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0037_D04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PCT01_0004_G03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0040_G04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0129_A01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0075_F12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0002_D03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
MLN01_0090_G11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0028_B09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0040_D10.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0063_H12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0106_A07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0003_H03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0086_C01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0038_E06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0065_H12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0098_C11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0096_C07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0079_A08.b : GAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0113_C12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0110_B11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PTG01_0044_D02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0083_C12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PST01_0070_B03.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCTCAG*GCACGGG*TCCCT
OVR01_0058_C03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LNG01_0013_C05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0067_F09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0059_H06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0092_E03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0054_E10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0034_A05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0114_B10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SMG01_0062_E03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0087_H02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0083_G03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0009_C05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0001_B07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0087_C01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0097_B07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LNG01_0045_H05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LNG01_0020_C03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0071_A05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0138_C08.b : CAGCTTCCGACCGCGGGACGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0054_A02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0013_A05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0076_B11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0071_H11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0095_A05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LNG01_0002_A12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0090_B12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LVR01_0033_F02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0021_C06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0049_E04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0056_B10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0073_A06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LNG01_0072_D03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0057_F04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0085_B12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LNG01_0106_A11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0041_E09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PST01_0094_B02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0065_G08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0032_B11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0037_H06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0089_A11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0103_G04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0063_B02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PTG01_0019_D05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0045_A02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0036_C05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0081_E05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0009_F01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0076_B03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LNG01_0045_A06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0088_F07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0034_A06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0083_D09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0071_B07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0051_D11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0100_E12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0021_B07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0050_B02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0016_G11.b : CAGCTTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0055_B08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0103_E07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0069_G08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0085_D10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0080_H09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0011_F07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0102_H09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0084_C04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0044_B06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0054_G05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0095_C04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0029_F08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PTG01_0003_D07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0097_A10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0056_A09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0095_H03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LVR01_0100_A04.b : CAGCTTCCAACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0095_G02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0004_G01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0056_H07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRT1_0035_B11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
MLN01_0081_D04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0023_F11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0019_D03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
MLN01_0048_E09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0059_E04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
MLN01_0081_G10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0019_F05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0006_C03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0060_C09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0107_C05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0019_A06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0057_A10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0093_H03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0097_G09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0010_H02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0062_H12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0050_F07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0075_F05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0094_H01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0090_B06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0044_G10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0020_G12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
LNG01_0059_F02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0057_H06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0056_B02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0069_F06.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0033_D11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0016_G08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0014_B12.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCCCTAC*AG*GCACGGG*TCCCT
SPL01_0099_D10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0009_B11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0047_C10.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0053_A07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0009_H07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0081_D01.b : CAGTTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0011_D07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0118_E04.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0126_C11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0037_D08.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCTG*GCACGGG*TCCCT
TES01_0083_H06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0207_B05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0082_H02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0028_A05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0087_B04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
MLN01_0071_F05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0090_A01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0072_H10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0061_A11.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0091_G02.b : *AGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0112_F12.b : CAGCTTCC*ACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
HTMT1_0048_B01.b : CCGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0065_A11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0009_E04.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
UTR01_0084_A04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0040_D08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0123_B05.b : CAGCTTCCGACCG*GGGATGT*TCACAGGAAGT*CTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0066_H05.b : CAGCTTCC*ACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0028_F03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0024_C11.b : CA*CTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG**CACGGG*TCCCT
ADR01_0033_B11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0016_B11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0003_E07.b : CAGCTT*CGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0101_G07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0024_C09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0071_G12.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0126_D05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0137_H01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0026_D04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAC*CCTTTGG*TCCCT
OVRM1_0077_D11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0072_A11.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PCT01_0013_F07.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0002_F06.b : GCGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PST01_0057_F03.b : C*GCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
MLN01_0066_G09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVR01_0031_C08.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
MLN01_0103_C03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0032_F07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0022_A03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0062_D03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCAGCTCCCAG*GCACGGG*TCCCT
CLNT1_0125_A10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0004_G02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PBL01_0080_A12.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0098_B07.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGA*TCCCT
TCH01_0099_F11.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
BFLT1_0107_E10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0008_E05.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0022_E01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0058_C03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ADR01_0031_C01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TCH01_0025_B01.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SPL01_0050_G04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0044_D02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0029_H03.b : GAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0097_A10.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0010_E10.b : NGCACTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
CLNT1_0013_F04.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
ITT01_0099_G03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PST01_0031_A11.b : GCGCTTCC*ACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCTT*CGA*GGG*TCCCT
TES01_0078_D08.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0107_B11.b : CATCTTCCGACCGCGGGATGTCTCACAGGAAATTCTCCGCTCCCAC*GCACGGGCTCCCT
TES01_0103_F06.b : GAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0059_B10.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0071_A01.b : CAGCTTCCGAC*GCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PCT01_0027_E12.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PCT01_0026_H01.b : CAGCTTCCGACCGCGGGA*GTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0063_F02.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0063_A03.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0035_H07.b : CAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0069_D09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0037_E06.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0008_G02.b : CAGCTTCC*ACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0034_C09.b : CAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAT*TTA*GGG*TCCCT
TES01_0112_D03.b : GCGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0007_F08.b : GCGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0076_H04.b : GCGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0086_F11.b : GAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0079_B03.b : GCGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0094_C01.b : GAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCCG**CACGGG*TCCCT
SKNB1_0081_B08.b : GAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0067_E07.b : GAGCTTCCGAC*GCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0009_E06.b : GCGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0104_B09.b : GAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PST01_0013_G05.b : GCGCTTCCGAC*GCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAC*GCACGGG*TCCCT
TES01_0064_H11.b : gAGCTTC*GACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0087_D04.b : gAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0060_H10.b : gAGCTTC*GACCGCGGGATGTCTCACAGGGAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PST01_0013_G04.b : nGCGCTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGC*CCCCG*GCACGGG*TCCCT
SKNB1_0075_H04.b : gAGCTTCCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0023_B04.b : nGCGCTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
PST01_0009_F02.b : cGCGCTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
TES01_0085_G04.b : ngAGCTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCATGAG*TCCCT
SKNB1_0008_C05.b : ngAGCTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCCCTTC*AG*GCACGGG*TCCCT
SKNB1_0030_A09.b : ngAGCTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCCCATC*AG*GCACGGG*TCCCT
TES01_0088_A09.b : ngAGCTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
SKNB1_0083_F06.b : ggAGCTTCGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
OVRM1_0152_A03.b : xxxxxxxxGACCGCGGGATGTCTCACAGGAAGTTCTCCGCTCCCAG*GCACGGG*TCCCT
THY01_0110_B10.b : tggagcttcgaccgGGGATGTTCAA**GGAAGTTCTCCGCTCCCAG*GCACGGT*T*CCT
PBL01_0053_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCCCAG*GCACGGG*TCCCT
ADR01_0069_C05.b : xxxxxxxxxxxxxxxxxxxxxxtcggcagcttccgaccgcgggaTG*GCACGGG*TCCCT
OVR01_0099_D12.b : xxxxxxxxxxxxxxxctctctatcggcagcttccgaccgcgggatG*GCACGGG*TCCCT
ADR01_0014_B09.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
SPL01_0085_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
SMG01_0096_E03.b : nggcgaaaatnnnnggactatagc
PBL01_0024_F05.b :
HTMT1_0074_F07.b : tt
THY01_0118_E09.b :
SPL01_0013_G05.b :
UTR01_0038_E04.b :
OVR01_0048_C09.b :
UTR01_0018_E03.b :
PBL01_0013_G08.b :
TCH01_0083_F04.b :
SMG01_0097_D04.b :
UTR01_0054_H03.b :
UTR01_0081_F04.b :
UTR01_0004_C02.b :
SKNB1_0086_F02.b :
SMG01_0096_B06.b :
UTR01_0010_A09.b :
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
---------+---------+---------+---------+---------+---------+ 170
THY01_0110_H09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0107_F08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0109_H07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0122_A07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0112_E10.b : GGGGTTCCTGCCTCGGAAGCGTAACAGCCGGCACCGCGGGAAG*GTGAAAAATTTCCCCA
TES01_0069_G09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0007_H10.b : GGGCTTCTTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0044_H02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0116_H06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0008_A08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0033_H08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0022_F05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0003_G09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PST01_0037_F02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0079_G04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0019_C03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0122_D06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0110_H11.b : GGGCTTC*TGCCTCGGAAGCGTA*CAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCC*A
PST01_0091_B04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0038_B11.b : GGGCTTCCTGCCTCGGAAGCGTACCTACCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0053_H02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAGGAGTTTCCCCA
THY01_0110_A04.b : GGGCTTTCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0057_G03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0037_F08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0029_F12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0042_F10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0066_E03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0108_E06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0108_D06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0082_F10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
MLN01_0090_D07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGTAG*GTGAAGAGTTTCCCCA
SMG01_0094_A09.b : GGGCTTCCTGCTTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0051_E01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0066_G09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0040_H11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0059_F02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0036_H02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0104_F10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0106_D04.b : GGGCTTCCTGCCTCGGGAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0085_H10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0070_G05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0079_F06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0035_E11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0017_G09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0039_F02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0094_H07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0052_H09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGGAG*GTGAAGAGTTTCCCCA
ITT01_0009_A02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0063_H10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PTG01_0036_B09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGGAGAGTTTCCCCA
SPLT1_0016_G07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0060_E12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0016_E03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0001_C04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0038_D10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0019_G08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0050_A05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0087_F04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0087_D01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0015_G10.b : GGGCTTCCCGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAGAGTGAAGAGTTTCCCCA
OVR01_0050_E08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0011_A03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0032_D09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0091_B11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0022_H11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0032_G05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0014_C10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0021_D08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0085_C10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0030_E04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0011_D10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0104_E09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0081_B12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0061_A05.b : GGGCTTCCTGCCTCGGAAGCGTAGCATCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0074_G02.b : GGGCCTCCTGCCTCGGAAGCGTACCATCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0153_B04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0067_E10.b : GGGCTTCCTGCCTCGGTAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0028_C09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPLT1_0023_H03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0079_D12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAGGAGTTTCCCCA
ITT01_0013_D05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
BMWN1_0084_A06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0058_A10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0050_D10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0094_C08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0079_B07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ILNT1_0047_G08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CBLT1_0010_A09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CBLT1_0055_H01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPLT1_0087_C06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0037_C08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CBLT1_0061_F03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CBLT1_0046_H11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ILNT1_0091_B12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0084_B10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0090_C04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0002_A08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ILNT1_0046_A10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0043_B06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0118_H10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0104_B05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0105_G04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0117_C10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0067_D01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0053_C09.b : GGGCTTCCTGCCTCGGAAGCGTAGCACCCTGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0076_A01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0165_G06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0148_H07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0133_H07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0038_B04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0092_H03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0100_D09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0071_G09.b : GGGCTTCCTGCCTCCGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0064_E05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0218_F02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0121_D03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LVRM1_0063_A04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0066_H10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0084_B12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0089_H12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0212_A10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0046_H07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0088_B09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0030_F11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0006_C03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0065_A12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0002_A11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0099_D07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0065_A08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0022_B07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0041_B10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAAAGTTTCCCCA
UTR01_0029_C12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0043_H10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0026_D09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0028_A04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0027_F04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0009_F01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0040_C12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PTG01_0081_D07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGGGTTTCCCCA
SMG01_0097_B10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGGAGAGTTTCCCCA
OVR01_0006_F10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0001_E02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0021_A02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0002_G12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PTG01_0077_G03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0005_F01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0131_F06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PCT01_0034_B02.b : GGGCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0017_D09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAACCGGCACCGCGGGAAG*GTGAAAAGTTTCCCCA
BKFL1_0116_A02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0029_F01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PTG01_0080_E03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0136_H03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0013_A01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0037_D04.b : GGGCTTCCCGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PCT01_0004_G03.b : GGGCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0040_G04.b : GGGCTTCCTGCCTCGGAAGCGTAACAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0129_A01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0075_F12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0002_D03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
MLN01_0090_G11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0028_B09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0040_D10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0063_H12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAAAGTTTCCCCA
UTR01_0106_A07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0003_H03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0086_C01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0038_E06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0065_H12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0098_C11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAGGAGTTTCCCCA
OVRT1_0096_C07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0079_A08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0113_C12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0110_B11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PTG01_0044_D02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0083_C12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PST01_0070_B03.b : GGGCTTCCTGCCTCGGAAGCGTATCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0058_C03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LNG01_0013_C05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0067_F09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0059_H06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0092_E03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0054_E10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0034_A05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0114_B10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0062_E03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0087_H02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0083_G03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0009_C05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0001_B07.b : GGGCTTCCTGCCTCGGAAGCGTATCATCCGGCACCACGGGAAG*GTGAAGAGTTTCACCA
OVR01_0087_C01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0097_B07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LNG01_0045_H05.b : GGGCTTCCTGCCTCGGAAGCGTAGCATCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LNG01_0020_C03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0071_A05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0138_C08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0054_A02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0013_A05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0076_B11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0071_H11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0095_A05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LNG01_0002_A12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0090_B12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LVR01_0033_F02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0021_C06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0049_E04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0056_B10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0073_A06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LNG01_0072_D03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0057_F04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0085_B12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LNG01_0106_A11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0041_E09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PST01_0094_B02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0065_G08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0032_B11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0037_H06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0089_A11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0103_G04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0063_B02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PTG01_0019_D05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0045_A02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0036_C05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0081_E05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0009_F01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0076_B03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LNG01_0045_A06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0088_F07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0034_A06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0083_D09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0071_B07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0051_D11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0100_E12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0021_B07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0050_B02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0016_G11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0055_B08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0103_E07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0069_G08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0085_D10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0080_H09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0011_F07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0102_H09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0084_C04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0044_B06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0054_G05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0095_C04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0029_F08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PTG01_0003_D07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0097_A10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0056_A09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0095_H03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LVR01_0100_A04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0095_G02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0004_G01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0056_H07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRT1_0035_B11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
MLN01_0081_D04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0023_F11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0019_D03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
MLN01_0048_E09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0059_E04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
MLN01_0081_G10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0019_F05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0006_C03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0060_C09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0107_C05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0019_A06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0057_A10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0093_H03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0097_G09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0010_H02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0062_H12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0050_F07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0075_F05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0094_H01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0090_B06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0044_G10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0020_G12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
LNG01_0059_F02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0057_H06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0056_B02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0069_F06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0033_D11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0016_G08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0014_B12.b : GGGCTTCCTGCCTCGGAAGCCTATCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0099_D10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGTACCGCGGGAAG*GTGAAGAGATTCCCCG
TES01_0009_B11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0047_C10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0053_A07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0009_H07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0081_D01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0011_D07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0118_E04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0126_C11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0037_D08.b : GGGCTTCCTGCCTCGGAAGCGTACCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0083_H06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0207_B05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0082_H02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0028_A05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0087_B04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGCTTCCCCA
MLN01_0071_F05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0090_A01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0072_H10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0061_A11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0091_G02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0112_F12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
HTMT1_0048_B01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0065_A11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0009_E04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
UTR01_0084_A04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0040_D08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0123_B05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0066_H05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0028_F03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0024_C11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0033_B11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0016_B11.b : GGGCCTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0003_E07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0101_G07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0024_C09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0071_G12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0126_D05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0137_H01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0026_D04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0077_D11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0072_A11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PCT01_0013_F07.b : GGGCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0002_F06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PST01_0057_F03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
MLN01_0066_G09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0031_C08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
MLN01_0103_C03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0032_F07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0022_A03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0062_D03.b : GGGCTTCCTGCCTCGGGAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0125_A10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0004_G02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0080_A12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0098_B07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0099_F11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
BFLT1_0107_E10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0008_E05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0022_E01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0058_C03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGC*GGAAG*GTGAAGAGTTTCCCCA
ADR01_0031_C01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TCH01_0025_B01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0050_G04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAATAGTTTCCCCT
TES01_0044_D02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0029_H03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0097_A10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0010_E10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
CLNT1_0013_F04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ITT01_0099_G03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PST01_0031_A11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCTGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0078_D08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0107_B11.b : GGGCTTCCTGCCTCTGAATCATAGCAACCGGCACCGCGGGAAG*GTGAACAGTTTCCCCT
TES01_0103_F06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0059_B10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0071_A01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PCT01_0027_E12.b : GGGCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PCT01_0026_H01.b : GGGCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0063_F02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0063_A03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0035_H07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0069_D09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0037_E06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0008_G02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0034_C09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0112_D03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0007_F08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0076_H04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0086_F11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0079_B03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0094_C01.b : GGGCTTCCTGCCTCCGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCC
SKNB1_0081_B08.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0067_E07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0009_E06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0104_B09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PST01_0013_G05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0064_H11.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0087_D04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0060_H10.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PST01_0013_G04.b : GGGCTTCCTGCCTCGGAAGCGTAGCATCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0075_H04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0023_B04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PST01_0009_F02.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0085_G04.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0008_C05.b : GGGCTTCCTGCCTCGGAAGCCTATTAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0030_A09.b : GGGCTTCCTGCCTCGGAAGCGTCTTAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
TES01_0088_A09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SKNB1_0083_F06.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVRM1_0152_A03.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
THY01_0110_B10.b : GGGCTTTCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
PBL01_0053_C01.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0069_C05.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
OVR01_0099_D12.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
ADR01_0014_B09.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SPL01_0085_E07.b : GGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGGGAAG*GTGAAGAGTTTCCCCA
SMG01_0096_E03.b : agcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggG*GTGAAGAGTTTCCCCA
PBL01_0024_F05.b : gctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCA
HTMT1_0074_F07.b : tttggatagtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA
THY01_0118_E09.b : agttgtcaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0013_G05.b : ttttgggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_E04.b : gxxxxxxxxxx
OVR01_0048_C09.b : aggatxxxxxxxxxxx
UTR01_0018_E03.b : tggaga
PBL01_0013_G08.b :
TCH01_0083_F04.b :
SMG01_0097_D04.b :
UTR01_0054_H03.b :
UTR01_0081_F04.b :
UTR01_0004_C02.b :
SKNB1_0086_F02.b :
SMG01_0096_B06.b :
UTR01_0010_A09.b :
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
---------+---------+---------+---------+---------+---------+ 225
THY01_0110_H09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0107_F08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0109_H07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0122_A07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0112_E10.b : AG*GATTA*ATTTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*GTGG
TES01_0069_G09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0007_H10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0044_H02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0116_H06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0008_A08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0033_H08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0022_F05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0003_G09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0037_F02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0079_G04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0019_C03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0122_D06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0110_H11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0091_B04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0038_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0053_H02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0110_A04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*GTGG
OVR01_0057_G03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0037_F08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0029_F12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0042_F10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0066_E03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACGAGG*GTGG
THY01_0108_E06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0108_D06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0082_F10.b : AG*GATGAACTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
MLN01_0090_D07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0094_A09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0051_E01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0066_G09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0040_H11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0059_F02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0036_H02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0104_F10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0106_D04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0085_H10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0070_G05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0079_F06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0035_E11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0017_G09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0039_F02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0094_H07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0052_H09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0009_A02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0063_H10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PTG01_0036_B09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPLT1_0016_G07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0060_E12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0016_E03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0001_C04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0038_D10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0019_G08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCACACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0050_A05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0087_F04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0087_D01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0015_G10.b : AGAGATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTCGGCTACAAGG*GTGG
OVR01_0050_E08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0011_A03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0032_D09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0091_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0022_H11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0032_G05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0014_C10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0021_D08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0085_C10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0030_E04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0011_D10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0104_E09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0081_B12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0061_A05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0074_G02.b : AG*GATGA*CTCTTCCTAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0153_B04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0067_E10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0028_C09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPLT1_0023_H03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0079_D12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0013_D05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
BMWN1_0084_A06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0058_A10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0050_D10.b : AG*GATGA*CCCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0094_C08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0079_B07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ILNT1_0047_G08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CBLT1_0010_A09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CBLT1_0055_H01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPLT1_0087_C06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0037_C08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CBLT1_0061_F03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CBLT1_0046_H11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ILNT1_0091_B12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0084_B10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0090_C04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0002_A08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ILNT1_0046_A10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0043_B06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0118_H10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0104_B05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0105_G04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0117_C10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0067_D01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0053_C09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0076_A01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0165_G06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0148_H07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0133_H07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0038_B04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0092_H03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0100_D09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0071_G09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0064_E05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0218_F02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0121_D03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LVRM1_0063_A04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0066_H10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0084_B12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0089_H12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0212_A10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0046_H07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0088_B09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0030_F11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0006_C03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0065_A12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0002_A11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0099_D07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0065_A08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0022_B07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0041_B10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTCCCTTGGCTACAAGG*CTGG
UTR01_0029_C12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTATAAGG*CTGG
THY01_0043_H10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0026_D09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0028_A04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0027_F04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0009_F01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0040_C12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PTG01_0081_D07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0097_B10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0006_F10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0001_E02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0021_A02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0002_G12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PTG01_0077_G03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0005_F01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0131_F06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PCT01_0034_B02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0017_D09.b : AG*GATGA*CTCTTCCTAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACTAGG*CTGG
BKFL1_0116_A02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0029_F01.b : AG*GATAA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PTG01_0080_E03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0136_H03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0013_A01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0037_D04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PCT01_0004_G03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0040_G04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0129_A01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0075_F12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0002_D03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
MLN01_0090_G11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0028_B09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0040_D10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0063_H12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0106_A07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0003_H03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0086_C01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0038_E06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0065_H12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0098_C11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0096_C07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0079_A08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACCAGG*CTGG
CLNT1_0113_C12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0110_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PTG01_0044_D02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0083_C12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0070_B03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0058_C03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LNG01_0013_C05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0067_F09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0059_H06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0092_E03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0054_E10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0034_A05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0114_B10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0062_E03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0087_H02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0083_G03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0009_C05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0001_B07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0087_C01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0097_B07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LNG01_0045_H05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LNG01_0020_C03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0071_A05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0138_C08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0054_A02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0013_A05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0076_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0071_H11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0095_A05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LNG01_0002_A12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0090_B12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LVR01_0033_F02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0021_C06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0049_E04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0056_B10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0073_A06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LNG01_0072_D03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0057_F04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0085_B12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LNG01_0106_A11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0041_E09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0094_B02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0065_G08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*GTGG
ITT01_0032_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0037_H06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0089_A11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0103_G04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0063_B02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACGAGG*GTGG
PTG01_0019_D05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0045_A02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0036_C05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0081_E05.b : AG*GATGA*CTCCTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0009_F01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0076_B03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LNG01_0045_A06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0088_F07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0034_A06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0083_D09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0071_B07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0051_D11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0100_E12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0021_B07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0050_B02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0016_G11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0055_B08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0103_E07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0069_G08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0085_D10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0080_H09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0011_F07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0102_H09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0084_C04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0044_B06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0054_G05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0095_C04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0029_F08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PTG01_0003_D07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0097_A10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0056_A09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0095_H03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LVR01_0100_A04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0095_G02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0004_G01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0056_H07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRT1_0035_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
MLN01_0081_D04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0023_F11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0019_D03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
MLN01_0048_E09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0059_E04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
MLN01_0081_G10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0019_F05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0006_C03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0060_C09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0107_C05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0019_A06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0057_A10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0093_H03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0097_G09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0010_H02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0062_H12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0050_F07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0075_F05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0094_H01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0090_B06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0044_G10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTGCAAGG*CTGG
ITT01_0020_G12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
LNG01_0059_F02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0057_H06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0056_B02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0069_F06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0033_D11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0016_G08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0014_B12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACTG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0099_D10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0009_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0047_C10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0053_A07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0009_H07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0081_D01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0011_D07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0118_E04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0126_C11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACTTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0037_D08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0083_H06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0207_B05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0082_H02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0028_A05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0087_B04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
MLN01_0071_F05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0090_A01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0072_H10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0061_A11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0091_G02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACCAGG*CTGG
TES01_0112_F12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
HTMT1_0048_B01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0065_A11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0009_E04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
UTR01_0084_A04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0040_D08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0123_B05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0066_H05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0028_F03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0024_C11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0033_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGGGCTGG
THY01_0016_B11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0003_E07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0101_G07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0024_C09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0071_G12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0126_D05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0137_H01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0026_D04.b : AG*GATGA*CTCTTCCAAGCCCG*CGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0077_D11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACNAGG*CTGG
TES01_0072_A11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PCT01_0013_F07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0002_F06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0057_F03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
MLN01_0066_G09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0031_C08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
MLN01_0103_C03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0032_F07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0022_A03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*TCTTCCTTGGCTACAAGG*CTGG
PBL01_0062_D03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0125_A10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0004_G02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0080_A12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0098_B07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0099_F11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
BFLT1_0107_E10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0008_E05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0022_E01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0058_C03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0031_C01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TCH01_0025_B01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0050_G04.b : AG*GATGA*CTCTTCCTAGCCCGATGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0044_D02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0029_H03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0097_A10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0010_E10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
CLNT1_0013_F04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ITT01_0099_G03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0031_A11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0078_D08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0107_B11.b : TG*GATGA*CTCTTCCTAGCCCT*TGCACCTCACCG*CCTTCCTTGGCTACGACG*GTGG
TES01_0103_F06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0059_B10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0071_A01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PCT01_0027_E12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PCT01_0026_H01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0063_F02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0063_A03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0035_H07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0069_D09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0037_E06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0008_G02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0034_C09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0112_D03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0007_F08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0076_H04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0086_F11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0079_B03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0094_C01.b : AG*GATGA*CTCTTCCCAGCCCG*TGCACCTCCCCGCCCTTCCTTGGCTACCAGG*CTGG
SKNB1_0081_B08.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACCAGG*CTGG
TES01_0067_E07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0009_E06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0104_B09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0013_G05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0064_H11.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0087_D04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0060_H10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0013_G04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0075_H04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0023_B04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PST01_0009_F02.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0085_G04.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0008_C05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0030_A09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
TES01_0088_A09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SKNB1_0083_F06.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVRM1_0152_A03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0110_B10.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*GTGG
PBL01_0053_C01.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
ADR01_0069_C05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
OVR01_0099_D12.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGA
ADR01_0014_B09.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0085_E07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SMG01_0096_E03.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
PBL01_0024_F05.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
HTMT1_0074_F07.b : AG*GATGA*CTCTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
THY01_0118_E09.b : xG*GATGA*C*CTTCCAAGCCCG*TGCACCTCACCG*CCTTCCTTGGCTACAAGG*CTGG
SPL01_0013_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCTACAAGG*CTGG
UTR01_0038_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0048_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0018_E03.b : acctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0013_G08.b : nnna
TCH01_0083_F04.b : nnnggctaggactatgacxxxxxxxx
SMG01_0097_D04.b :
UTR01_0054_H03.b : gctxxxxx
UTR01_0081_F04.b :
UTR01_0004_C02.b :
SKNB1_0086_F02.b :
SMG01_0096_B06.b :
UTR01_0010_A09.b :
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
---------+---------+---------+---------+---------+---------+ 284
THY01_0110_H09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0107_F08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0109_H07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0122_A07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0112_E10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0069_G09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0007_H10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0044_H02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0116_H06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0008_A08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0033_H08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0022_F05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0003_G09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAGG
PST01_0037_F02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0079_G04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0019_C03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0122_D06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0110_H11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PST01_0091_B04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0038_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0053_H02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0110_A04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTTCAAGGTGAACAAGAAGGAAG
OVR01_0057_G03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0037_F08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0029_F12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0042_F10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0066_E03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0108_E06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0108_D06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0082_F10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
MLN01_0090_D07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0094_A09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0051_E01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0066_G09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0040_H11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0059_F02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0036_H02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0104_F10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0106_D04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0085_H10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0070_G05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0079_F06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0035_E11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0017_G09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0039_F02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0094_H07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAGG
SKNB1_0052_H09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0009_A02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0063_H10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PTG01_0036_B09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPLT1_0016_G07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0060_E12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0016_E03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0001_C04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0038_D10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0019_G08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0050_A05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0087_F04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0087_D01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0015_G10.b : CATCGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0050_E08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0011_A03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0032_D09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0091_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0022_H11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0032_G05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0014_C10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0021_D08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0085_C10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0030_E04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0011_D10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0104_E09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0081_B12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0061_A05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0074_G02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0153_B04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0067_E10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCCAGGTGAACAAGAAGGAAG
SPL01_0028_C09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPLT1_0023_H03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0079_D12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGGAGGAAG
ITT01_0013_D05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
BMWN1_0084_A06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0058_A10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0050_D10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0094_C08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0079_B07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ILNT1_0047_G08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CBLT1_0010_A09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CBLT1_0055_H01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPLT1_0087_C06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0037_C08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CBLT1_0061_F03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CBLT1_0046_H11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ILNT1_0091_B12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0084_B10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0090_C04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0002_A08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ILNT1_0046_A10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0043_B06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCNAGGTGAACA*GAAGGAAA
THY01_0118_H10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0104_B05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0105_G04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0117_C10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0067_D01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0053_C09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCTAGGTGAACAAGAAGGAAG
OVR01_0076_A01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0165_G06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0148_H07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0133_H07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0038_B04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0092_H03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0100_D09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0071_G09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0064_E05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0218_F02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0121_D03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LVRM1_0063_A04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0066_H10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0084_B12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0089_H12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0212_A10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0046_H07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0088_B09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0030_F11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0006_C03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0065_A12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0002_A11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0099_D07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0065_A08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0022_B07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0041_B10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAATAAGGAAG
UTR01_0029_C12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0043_H10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0026_D09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0028_A04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0027_F04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGGACAAGAAGGAAG
UTR01_0009_F01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0040_C12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PTG01_0081_D07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0097_B10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0006_F10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0001_E02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0021_A02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0002_G12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PTG01_0077_G03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0005_F01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0131_F06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PCT01_0034_B02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0017_D09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
BKFL1_0116_A02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0029_F01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGGAGGAAG
PTG01_0080_E03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0136_H03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0013_A01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0037_D04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PCT01_0004_G03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0040_G04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0129_A01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0075_F12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0002_D03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
MLN01_0090_G11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0028_B09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0040_D10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0063_H12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAAAAGGAAG
UTR01_0106_A07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0003_H03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0086_C01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0038_E06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0065_H12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0098_C11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0096_C07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0079_A08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0113_C12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0110_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PTG01_0044_D02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0083_C12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PST01_0070_B03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0058_C03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LNG01_0013_C05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0067_F09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0059_H06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0092_E03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0054_E10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0034_A05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0114_B10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0062_E03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0087_H02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0083_G03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0009_C05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0001_B07.b : CAT*GACCCACATTGTGAGGGAAGTCGATAGGCCTGGGTCCAATGTGAACAAGAACGAAG
OVR01_0087_C01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0097_B07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LNG01_0045_H05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LNG01_0020_C03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0071_A05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0138_C08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0054_A02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0013_A05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0076_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0071_H11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0095_A05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LNG01_0002_A12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0090_B12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LVR01_0033_F02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0021_C06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0049_E04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0056_B10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0073_A06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LNG01_0072_D03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0057_F04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0085_B12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LNG01_0106_A11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0041_E09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PST01_0094_B02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0065_G08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0032_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0037_H06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0089_A11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0103_G04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0063_B02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PTG01_0019_D05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0045_A02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0036_C05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0081_E05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0009_F01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0076_B03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LNG01_0045_A06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0088_F07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0034_A06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0083_D09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0071_B07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0051_D11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0100_E12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0021_B07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0050_B02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0016_G11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0055_B08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0103_E07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0069_G08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0085_D10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0080_H09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0011_F07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0102_H09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0084_C04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0044_B06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0054_G05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0095_C04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0029_F08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PTG01_0003_D07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0097_A10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0056_A09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0095_H03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LVR01_0100_A04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0095_G02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0004_G01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0056_H07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRT1_0035_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
MLN01_0081_D04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0023_F11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0019_D03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
MLN01_0048_E09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0059_E04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
MLN01_0081_G10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0019_F05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0006_C03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0060_C09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0107_C05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0019_A06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0057_A10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0093_H03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0097_G09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0010_H02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0062_H12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0050_F07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0075_F05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0094_H01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0090_B06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0044_G10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0020_G12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
LNG01_0059_F02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0057_H06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0056_B02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0069_F06.b : CAT*GACTCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0033_D11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0016_G08.b : CAC*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0014_B12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0099_D10.b : CAT*GAACCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAA
TES01_0009_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0047_C10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0053_A07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0009_H07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0081_D01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0011_D07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0118_E04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0126_C11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0037_D08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0083_H06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0207_B05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0082_H02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0028_A05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0087_B04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
MLN01_0071_F05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0090_A01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0072_H10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0061_A11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0091_G02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0112_F12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
HTMT1_0048_B01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0065_A11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0009_E04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0084_A04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0040_D08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0123_B05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0066_H05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0028_F03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0024_C11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAACAAGGAAG
ADR01_0033_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0016_B11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0003_E07.b : CAT*GACCCACGTTGTGAGGGAGGCCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0101_G07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0024_C09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0071_G12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0126_D05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0137_H01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0026_D04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0077_D11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0072_A11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PCT01_0013_F07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0002_F06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PST01_0057_F03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
MLN01_0066_G09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0031_C08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
MLN01_0103_C03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0032_F07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0022_A03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0062_D03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0125_A10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0004_G02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0080_A12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0098_B07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0099_F11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
BFLT1_0107_E10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0008_E05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0022_E01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0058_C03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0031_C01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TCH01_0025_B01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0050_G04.b : CAT*GACCCACATTGTGAGGGAGGTCTATAGGCCTGGGTCCAAGGTGAACTAGAAGGAAG
TES01_0044_D02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0029_H03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0097_A10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0010_E10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
CLNT1_0013_F04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ITT01_0099_G03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PST01_0031_A11.b : CAT*GACCCACATTGTGAGGGAGGTCGAGGGGCCTGAGTCCAAGGTGAACAAGAAGGAAG
TES01_0078_D08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0107_B11.b : CAT*GACCCACATTGTGAGGGAGGTCTATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAA
TES01_0103_F06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0059_B10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0071_A01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PCT01_0027_E12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PCT01_0026_H01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0063_F02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0063_A03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0035_H07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0069_D09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0037_E06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0008_G02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0034_C09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0112_D03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0007_F08.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0076_H04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0086_F11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0079_B03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0094_C01.b : CAT*GACCCCCATTGTGAGGGAGGTCGATAGGCCTGGGTCCCAGGTGAACAAGAAGGAAG
SKNB1_0081_B08.b : CAT*GACCCACATTGTGAGGGAGGTCCATAGGCCTGGGTCCCAGGTGAACAAGAAGGAAG
TES01_0067_E07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0009_E06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0104_B09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PST01_0013_G05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0064_H11.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0087_D04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0060_H10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PST01_0013_G04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0075_H04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0023_B04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PST01_0009_F02.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0085_G04.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0008_C05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0030_A09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
TES01_0088_A09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SKNB1_0083_F06.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVRM1_0152_A03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0110_B10.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0053_C01.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0069_C05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0099_D12.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
ADR01_0014_B09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0085_E07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SMG01_0096_E03.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0024_F05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
HTMT1_0074_F07.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
THY01_0118_E09.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
SPL01_0013_G05.b : CAT*GACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0038_E04.b : xxxxxxxxxxgATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
OVR01_0048_C09.b : xxxxxxxxxxxxTTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
UTR01_0018_E03.b : xxxxxxxxxxxxxxGTGAGGGAGGTCGATAGGCCTGGGTCCAAGGTGAACAAGAAGGAAG
PBL01_0013_G08.b : atgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAG
TCH01_0083_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAG
SMG01_0097_D04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0054_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0081_F04.b :
UTR01_0004_C02.b :
SKNB1_0086_F02.b :
SMG01_0096_B06.b :
UTR01_0010_A09.b :
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
---------+---------+---------+---------+---------+---------+ 344
THY01_0110_H09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0107_F08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0109_H07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0122_A07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0112_E10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0069_G09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0007_H10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0044_H02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0116_H06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0008_A08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0033_H08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0022_F05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0003_G09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0037_F02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0079_G04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0019_C03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0122_D06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0110_H11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0091_B04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0038_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0053_H02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0110_A04.b : TTGTGGAGGCTGTGAATATTGTGGAGACGCCACCCATGGTGATTGTGGGCATTGTGGGCT
OVR01_0057_G03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0037_F08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0029_F12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0042_F10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0066_E03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0108_E06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0108_D06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0082_F10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
MLN01_0090_D07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0094_A09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0051_E01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTAGGCT
THY01_0066_G09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0040_H11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0059_F02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0036_H02.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
THY01_0104_F10.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0106_D04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0085_H10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0070_G05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0079_F06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0035_E11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0017_G09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0039_F02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0094_H07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0052_H09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0009_A02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0063_H10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PTG01_0036_B09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPLT1_0016_G07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0060_E12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
SPL01_0016_E03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0001_C04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0038_D10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0019_G08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0050_A05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0087_F04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0087_D01.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
OVR01_0015_G10.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
OVR01_0050_E08.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
PBL01_0011_A03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0032_D09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0091_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0022_H11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0032_G05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0014_C10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGTATCGTGGGCT
ITT01_0021_D08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0085_C10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0030_E04.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
OVRT1_0011_D10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0104_E09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0081_B12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0061_A05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0074_G02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0153_B04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
OVR01_0067_E10.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCCTGGGCT
SPL01_0028_C09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPLT1_0023_H03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0079_D12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0013_D05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
BMWN1_0084_A06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
TES01_0058_A10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0050_D10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0094_C08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0079_B07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ILNT1_0047_G08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CBLT1_0010_A09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CBLT1_0055_H01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPLT1_0087_C06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0037_C08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CBLT1_0061_F03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CBLT1_0046_H11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ILNT1_0091_B12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0084_B10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0090_C04.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
TCH01_0002_A08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ILNT1_0046_A10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0043_B06.b : GTGTGGAGGCTGTGACTATTGTGGAGACGCCAC*CATGGTGATTGTGGGCATCGTGGGCT
THY01_0118_H10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0104_B05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0105_G04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0117_C10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0067_D01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0053_C09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0076_A01.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
OVRM1_0165_G06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
OVRM1_0148_H07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
OVRM1_0133_H07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
PBL01_0038_B04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0092_H03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0100_D09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCCTCGTGGGCT
TES01_0071_G09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0064_E05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0218_F02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
OVRM1_0121_D03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
LVRM1_0063_A04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
OVR01_0066_H10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0084_B12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
SMG01_0089_H12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0212_A10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
SMG01_0046_H07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0088_B09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0030_F11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0006_C03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGACATCGTGGGCT
OVR01_0065_A12.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGAGCT
SMG01_0002_A11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0099_D07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0065_A08.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
ADR01_0022_B07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0041_B10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0029_C12.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
THY01_0043_H10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0026_D09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0028_A04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0027_F04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0009_F01.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
UTR01_0040_C12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PTG01_0081_D07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0097_B10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0006_F10.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
THY01_0001_E02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0021_A02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0002_G12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PTG01_0077_G03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0005_F01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0131_F06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PCT01_0034_B02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
UTR01_0017_D09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
BKFL1_0116_A02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0029_F01.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
PTG01_0080_E03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0136_H03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0013_A01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0037_D04.b : TTGTGGAGGCTGTGACCATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
PCT01_0004_G03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
ADR01_0040_G04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0129_A01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0075_F12.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
SMG01_0002_D03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
MLN01_0090_G11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0028_B09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0040_D10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0063_H12.b : TTGTGGAGGCTGTGACTATTGTGGAAACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0106_A07.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
ITT01_0003_H03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0086_C01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0038_E06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0065_H12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0098_C11.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
OVRT1_0096_C07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0079_A08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0113_C12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0110_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PTG01_0044_D02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0083_C12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0070_B03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0058_C03.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
LNG01_0013_C05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0067_F09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0059_H06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0092_E03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0054_E10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0034_A05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0114_B10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0062_E03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0087_H02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0083_G03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0009_C05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0001_B07.b : TTGTGGAGGCTGTGACTATTGTGGAGATGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0087_C01.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
TES01_0097_B07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
LNG01_0045_H05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
LNG01_0020_C03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0071_A05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0138_C08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0054_A02.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
OVR01_0013_A05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0076_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0071_H11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0095_A05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
LNG01_0002_A12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0090_B12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
LVR01_0033_F02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0021_C06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0049_E04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0056_B10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0073_A06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
LNG01_0072_D03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0057_F04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0085_B12.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
LNG01_0106_A11.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
ITT01_0041_E09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0094_B02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0065_G08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0032_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0037_H06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0089_A11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0103_G04.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
ADR01_0063_B02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PTG01_0019_D05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0045_A02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0036_C05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0081_E05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0009_F01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0076_B03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
LNG01_0045_A06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0088_F07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0034_A06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0083_D09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0071_B07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0051_D11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0100_E12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0021_B07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0050_B02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0016_G11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0055_B08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0103_E07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0069_G08.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
PBL01_0085_D10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0080_H09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0011_F07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0102_H09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0084_C04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0044_B06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0054_G05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0095_C04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0029_F08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PTG01_0003_D07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0097_A10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0056_A09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0095_H03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
LVR01_0100_A04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0095_G02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0004_G01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0056_H07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRT1_0035_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
MLN01_0081_D04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0023_F11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0019_D03.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
MLN01_0048_E09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0059_E04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
MLN01_0081_G10.b : TTGTGGAGGCTGTGACGATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0019_F05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0006_C03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0060_C09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0107_C05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0019_A06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0057_A10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0093_H03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCATCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0097_G09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0010_H02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0062_H12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0050_F07.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
TCH01_0075_F05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0094_H01.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
THY01_0090_B06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0044_G10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0020_G12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
LNG01_0059_F02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0057_H06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0056_B02.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
TES01_0069_F06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0033_D11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0016_G08.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
SKNB1_0014_B12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0099_D10.b : TTGTGGAGGCTGTGACTATTGAGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0009_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0047_C10.b : TTGTGGAGGCTGTGACTATTGTGGAGGCGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0053_A07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0009_H07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0081_D01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0011_D07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0118_E04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0126_C11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0037_D08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0083_H06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0207_B05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0082_H02.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
TES01_0028_A05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0087_B04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
MLN01_0071_F05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0090_A01.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
ADR01_0072_H10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0061_A11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0091_G02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0112_F12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
HTMT1_0048_B01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0065_A11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0009_E04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0084_A04.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
PBL01_0040_D08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0123_B05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0066_H05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0028_F03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
TES01_0024_C11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0033_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0016_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0003_E07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0101_G07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0024_C09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0071_G12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0126_D05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0137_H01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
TES01_0026_D04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0077_D11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
TES01_0072_A11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PCT01_0013_F07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
TES01_0002_F06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0057_F03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
MLN01_0066_G09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0031_C08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
MLN01_0103_C03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0032_F07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0022_A03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0062_D03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0125_A10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0004_G02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0080_A12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0098_B07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0099_F11.b : TTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCGTGGGCATCGTGGGCT
BFLT1_0107_E10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0008_E05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0022_E01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0058_C03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0031_C01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0025_B01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0050_G04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0044_D02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0029_H03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0097_A10.b : TTGTGGAGGCTGTGGCTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0010_E10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
CLNT1_0013_F04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ITT01_0099_G03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0031_A11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0078_D08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0107_B11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0103_F06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0059_B10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGTTTGTGGGCATCGTGGGCT
TES01_0071_A01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PCT01_0027_E12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
PCT01_0026_H01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
SKNB1_0063_F02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0063_A03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0035_H07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0069_D09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0037_E06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0008_G02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0034_C09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0112_D03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0007_F08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0076_H04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0086_F11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0079_B03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0094_C01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0081_B08.b : TTGTGGAGGCTGTGACTATTGTGGAAACCCCCCCCCTGGTGATTGTGGGCATCGTGGGCT
TES01_0067_E07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0009_E06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0104_B09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0013_G05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0064_H11.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0087_D04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0060_H10.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0013_G04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0075_H04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0023_B04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PST01_0009_F02.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0085_G04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0008_C05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0030_A09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TES01_0088_A09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SKNB1_0083_F06.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVRM1_0152_A03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCGTGGGCATCGTGGGCT
THY01_0110_B10.b : TTGTGGAGGGTGTGAATATTGTGGAGAACCCACCCATGGTGATTGTGGGCATTGTGGGCT
PBL01_0053_C01.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0069_C05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0099_D12.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
ADR01_0014_B09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0085_E07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0096_E03.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0024_F05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
HTMT1_0074_F07.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
THY01_0118_E09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SPL01_0013_G05.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0038_E04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
OVR01_0048_C09.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0018_E03.b : TTGTGGGGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
PBL01_0013_G08.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
TCH01_0083_F04.b : TTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
SMG01_0097_D04.b : nnnnnnnnnnnnnnnnnnnTGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0054_H03.b : xxxxxxxxxxxxxxxxctacGTGGAGACGCCACCCATGGTGATTGTGGGCATCGTGGGCT
UTR01_0081_F04.b : n
UTR01_0004_C02.b :
SKNB1_0086_F02.b :
SMG01_0096_B06.b :
UTR01_0010_A09.b :
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
---------+---------+---------+---------+---------+---------+ 403
THY01_0110_H09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0107_F08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0109_H07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0122_A07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0112_E10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0069_G09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0007_H10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0044_H02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0116_H06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0008_A08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0033_H08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0022_F05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0003_G09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0037_F02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0079_G04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0019_C03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0122_D06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0110_H11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0091_B04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0038_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0053_H02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0110_A04.b : ATGTGGAAACCCCTCCGGGCCTCCG*GACCTTTAAGAACATCTTCGCGGAGCACATCAGC
OVR01_0057_G03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0037_F08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0029_F12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0042_F10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0066_E03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0108_E06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0108_D06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0082_F10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
MLN01_0090_D07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0094_A09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0051_E01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0066_G09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0040_H11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0059_F02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0036_H02.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0104_F10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0106_D04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0085_H10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0070_G05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0079_F06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0035_E11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0017_G09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0039_F02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0094_H07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0052_H09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0009_A02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0063_H10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PTG01_0036_B09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPLT1_0016_G07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0060_E12.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0016_E03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0001_C04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0038_D10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0019_G08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0050_A05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0087_F04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0087_D01.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0015_G10.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0050_E08.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0011_A03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0032_D09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0091_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0022_H11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0032_G05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0014_C10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0021_D08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0085_C10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0030_E04.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0011_D10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0104_E09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0081_B12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0061_A05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0074_G02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCCTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0153_B04.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0067_E10.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGAACATCTTCCCGGAACACATCAGC
SPL01_0028_C09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPLT1_0023_H03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0079_D12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0013_D05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
BMWN1_0084_A06.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0058_A10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0050_D10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0094_C08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0079_B07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ILNT1_0047_G08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CBLT1_0010_A09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CBLT1_0055_H01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPLT1_0087_C06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0037_C08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CBLT1_0061_F03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CBLT1_0046_H11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ILNT1_0091_B12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0084_B10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0090_C04.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0002_A08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ILNT1_0046_A10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0043_B06.b : ATGTGGAAAACCCTCGGGGGCTTCGGGACTTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0118_H10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0104_B05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0105_G04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0117_C10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0067_D01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCATC
TES01_0053_C09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0076_A01.b : ACGTGGAAACCCCTCGGGGCCTCCA*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0165_G06.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0148_H07.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0133_H07.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0038_B04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTATGGACCATCTTCGCGGATCACATCTTC
TES01_0092_H03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0100_D09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCTCGGAGCCCATCAGC
TES01_0071_G09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0064_E05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0218_F02.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0121_D03.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LVRM1_0063_A04.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0066_H10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0084_B12.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0089_H12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0212_A10.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0046_H07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0088_B09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0030_F11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0006_C03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0065_A12.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCGCATCAGC
SMG01_0002_A11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGGCCATCTTCGCGGAGCACATCAGC
SMG01_0099_D07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0065_A08.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0022_B07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0041_B10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAAC
UTR01_0029_C12.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0043_H10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0026_D09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0028_A04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0027_F04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0009_F01.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0040_C12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PTG01_0081_D07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0097_B10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0006_F10.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0001_E02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0021_A02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0002_G12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PTG01_0077_G03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0005_F01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0131_F06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PCT01_0034_B02.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0017_D09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCATC
BKFL1_0116_A02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0029_F01.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PTG01_0080_E03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0136_H03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0013_A01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0037_D04.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PCT01_0004_G03.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0040_G04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0129_A01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0075_F12.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0002_D03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
MLN01_0090_G11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0028_B09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0040_D10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0063_H12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAAACCATCTTCGCGGAGCACATCAGC
UTR01_0106_A07.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0003_H03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0086_C01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0038_E06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0065_H12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0098_C11.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0096_C07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0079_A08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0113_C12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0110_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PTG01_0044_D02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0083_C12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0070_B03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0058_C03.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LNG01_0013_C05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0067_F09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0059_H06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0092_E03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0054_E10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0034_A05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTCCGCGGAGCACATCAGC
OVRT1_0114_B10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0062_E03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0087_H02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0083_G03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0009_C05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0001_B07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAATACCATCTTCGCGGAGCACATCACC
OVR01_0087_C01.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0097_B07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LNG01_0045_H05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCGTCTTCCCGGAGCACATCAGC
LNG01_0020_C03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0071_A05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0138_C08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0054_A02.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0013_A05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0076_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0071_H11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0095_A05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LNG01_0002_A12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0090_B12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LVR01_0033_F02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0021_C06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0049_E04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0056_B10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0073_A06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LNG01_0072_D03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0057_F04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0085_B12.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LNG01_0106_A11.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0041_E09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0094_B02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTCCGCGGAGCACATCAGC
PBL01_0065_G08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0032_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0037_H06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0089_A11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0103_G04.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0063_B02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PTG01_0019_D05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0045_A02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0036_C05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0081_E05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0009_F01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0076_B03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LNG01_0045_A06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0088_F07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0034_A06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0083_D09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0071_B07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0051_D11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0100_E12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0021_B07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0050_B02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0016_G11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0055_B08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0103_E07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0069_G08.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0085_D10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0080_H09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0011_F07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0102_H09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0084_C04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0044_B06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0054_G05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0095_C04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0029_F08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PTG01_0003_D07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0097_A10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0056_A09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0095_H03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
LVR01_0100_A04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0095_G02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0004_G01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0056_H07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRT1_0035_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
MLN01_0081_D04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0023_F11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0019_D03.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
MLN01_0048_E09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0059_E04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
MLN01_0081_G10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0019_F05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0006_C03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0060_C09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0107_C05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0019_A06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0057_A10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0093_H03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0097_G09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0010_H02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0062_H12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0050_F07.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0075_F05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0094_H01.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0090_B06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0044_G10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0020_G12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCATATCAGC
LNG01_0059_F02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0057_H06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0056_B02.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0069_F06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0033_D11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0016_G08.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0014_B12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0099_D10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCACGGAGCACGTCAGC
TES01_0009_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0047_C10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0053_A07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0009_H07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0081_D01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0011_D07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0118_E04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0126_C11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0037_D08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0083_H06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0207_B05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0082_H02.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0028_A05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0087_B04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
MLN01_0071_F05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0090_A01.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0072_H10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0061_A11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0091_G02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0112_F12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
HTMT1_0048_B01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0065_A11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0009_E04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0084_A04.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0040_D08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0123_B05.b : ATGTGGAAACCCCACGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0066_H05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0028_F03.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0024_C11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0033_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0016_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0003_E07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0101_G07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0024_C09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0071_G12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0126_D05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0137_H01.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0026_D04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0077_D11.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0072_A11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PCT01_0013_F07.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0002_F06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0057_F03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
MLN01_0066_G09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0031_C08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
MLN01_0103_C03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0032_F07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0022_A03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0062_D03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCACCTTCGCGGAGCACATCAGC
CLNT1_0125_A10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0004_G02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0080_A12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0098_B07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0099_F11.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
BFLT1_0107_E10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0008_E05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0022_E01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0058_C03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0031_C01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0025_B01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0050_G04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0044_D02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0029_H03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0097_A10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0010_E10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
CLNT1_0013_F04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ITT01_0099_G03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0031_A11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0078_D08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0107_B11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCTCC
TES01_0103_F06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0059_B10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0071_A01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PCT01_0027_E12.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACACCAGC
PCT01_0026_H01.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0063_F02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0063_A03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0035_H07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0069_D09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0037_E06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0008_G02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0034_C09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCAACTTCGCGGAGCACATCAGC
TES01_0112_D03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0007_F08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0076_H04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0086_F11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0079_B03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0094_C01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0081_B08.b : ATGTGGAAACCCCTCCGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0067_E07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0009_E06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0104_B09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0013_G05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0064_H11.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0087_D04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0060_H10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0013_G04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0075_H04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0023_B04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PST01_0009_F02.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0085_G04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0008_C05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SKNB1_0030_A09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TES01_0088_A09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCACCTTCGCGGAGCACATCAGC
SKNB1_0083_F06.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVRM1_0152_A03.b : ACGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0110_B10.b : ATGTGGAAACCCCTCGGGGCCTCCG*GANCTTTAAGACCATCTTCGCGGAGCACATTAGC
PBL01_0053_C01.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0069_C05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0099_D12.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
ADR01_0014_B09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0085_E07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0096_E03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0024_F05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
HTMT1_0074_F07.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
THY01_0118_E09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SPL01_0013_G05.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0038_E04.b : ATGTGGAAACTCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
OVR01_0048_C09.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0018_E03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
PBL01_0013_G08.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
TCH01_0083_F04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
SMG01_0097_D04.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCATCTTCGCGGAGCACATCAGC
UTR01_0054_H03.b : ATGTGGAAACCCCTCGGGGCCTCCG*GACCTTTAAGACCACCTTCGCGGAGCACATCAGC
UTR01_0081_F04.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0004_C02.b : ggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0086_F02.b : nnnttgta
SMG01_0096_B06.b : nngggctactnnnnnngggtaaagcagcggnaxxxxxxxxx
UTR01_0010_A09.b : tttgggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0037_F01.b :
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
---------+---------+---------+---------+---------+---------+ 463
THY01_0110_H09.b : GATGATTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0107_F08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCGTAAATCTAAGAAGAAGGCCTTCACC
THY01_0109_H07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0122_A07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0112_E10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0069_G09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0007_H10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0044_H02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATGAATCTAAGAAGAAGGCCTTCACC
THY01_0116_H06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0008_A08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0033_H08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0022_F05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0003_G09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0037_F02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0079_G04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0019_C03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0122_D06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0110_H11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0091_B04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0038_B11.b : GATGAGTGCAAGAGGCGCTTCTATAATAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0053_H02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0110_A04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATTAATCTAAGAAGAAGGCCTTCACC
OVR01_0057_G03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0037_F08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0029_F12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0042_F10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTGAGAAGAAGGCCTTCACC
ADR01_0066_E03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0108_E06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0108_D06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0082_F10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
MLN01_0090_D07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0094_A09.b : GATGAGTGGCAGAGGCGCTTCTANTAGAACTGGCATAAATCTAAGAAGAAGGCCTTTCAC
THY01_0051_E01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0066_G09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0040_H11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0059_F02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0036_H02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0104_F10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0106_D04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0085_H10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0070_G05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0079_F06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0035_E11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0017_G09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0039_F02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0094_H07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0052_H09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0009_A02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0063_H10.b : GTTGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PTG01_0036_B09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPLT1_0016_G07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0060_E12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0016_E03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0001_C04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0038_D10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0019_G08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0050_A05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0087_F04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0087_D01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0015_G10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0050_E08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0011_A03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0032_D09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0091_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0022_H11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0032_G05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0014_C10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0021_D08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0085_C10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0030_E04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0011_D10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0104_E09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0081_B12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0061_A05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0074_G02.b : GATGAGTGCAAGAGGCGCTTCTATAATAACTGGCATATATCTAATAAGAAGGCCTTCACC
OVRM1_0153_B04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0067_E10.b : GATGAATGCCAGAAGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGGCTTCACC
SPL01_0028_C09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPLT1_0023_H03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0079_D12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0013_D05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
BMWN1_0084_A06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0058_A10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0050_D10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0094_C08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0079_B07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ILNT1_0047_G08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CBLT1_0010_A09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CBLT1_0055_H01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPLT1_0087_C06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0037_C08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CBLT1_0061_F03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CBLT1_0046_H11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ILNT1_0091_B12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0084_B10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0090_C04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0002_A08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ILNT1_0046_A10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0043_B06.b : GATGAGTGgcagagggggcttctattagaactggcataaatcttaaaaaaagggccttcc
THY01_0118_H10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0104_B05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0105_G04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0117_C10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0067_D01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0053_C09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0076_A01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0165_G06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0148_H07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0133_H07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0038_B04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAGATCTTACAAGAAGGCCTTCACC
TES01_0092_H03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0100_D09.b : GATGAGTGCAAGAGGCGCTTCTATAACAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0071_G09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0064_E05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0218_F02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0121_D03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LVRM1_0063_A04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0066_H10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0084_B12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0089_H12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0212_A10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAATTGACATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0046_H07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0088_B09.b : GATGAGTGCGAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0030_F11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0006_C03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0065_A12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0002_A11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0099_D07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0065_A08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0022_B07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0041_B10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0029_C12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0043_H10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0026_D09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0028_A04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAACCTAAGAAGAAGGCCTTCACC
SPL01_0027_F04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0009_F01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0040_C12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PTG01_0081_D07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0097_B10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0006_F10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0001_E02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0021_A02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0002_G12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PTG01_0077_G03.b : GATGAGTGCAAGGGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0005_F01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0131_F06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PCT01_0034_B02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0017_D09.b : GATGAGTGCAAGAGGCGCTTCTATAACAACTGGCATAAATCTCAGAAGAAGGCCTTCACC
BKFL1_0116_A02.b : GATGAGTGCAAGAGGCACTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0029_F01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PTG01_0080_E03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0136_H03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0013_A01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0037_D04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PCT01_0004_G03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0040_G04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0129_A01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0075_F12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0002_D03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
MLN01_0090_G11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0028_B09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0040_D10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0063_H12.b : GATGAGTGCAAAAGGCGCTTCTATAAAAACTGGCATAAATCTAAAAAAAAGGCCTTCACC
UTR01_0106_A07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0003_H03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0086_C01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0038_E06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0065_H12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0098_C11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0096_C07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0079_A08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0113_C12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0110_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PTG01_0044_D02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0083_C12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0070_B03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0058_C03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LNG01_0013_C05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0067_F09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0059_H06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0092_E03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0054_E10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0034_A05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0114_B10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0062_E03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0087_H02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0083_G03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0009_C05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0001_B07.b : TATGAATGCAGCAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCGCC
OVR01_0087_C01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0097_B07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LNG01_0045_H05.b : GATGAGTGCAAGAGGCGCTTCTATAACAACTGGCATAAATCTAAGCAGAAGGCCTTCACC
LNG01_0020_C03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0071_A05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0138_C08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0054_A02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0013_A05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0076_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0071_H11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0095_A05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LNG01_0002_A12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0090_B12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LVR01_0033_F02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0021_C06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0049_E04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0056_B10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0073_A06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LNG01_0072_D03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0057_F04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0085_B12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LNG01_0106_A11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0041_E09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0094_B02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0065_G08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0032_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0037_H06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0089_A11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0103_G04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0063_B02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PTG01_0019_D05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0045_A02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0036_C05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0081_E05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0009_F01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0076_B03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LNG01_0045_A06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0088_F07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0034_A06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0083_D09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0071_B07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0051_D11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0100_E12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0021_B07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0050_B02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0016_G11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0055_B08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0103_E07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0069_G08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0085_D10.b : GATGAGTGCAAGAGGTGCTTCTATAAGAACTGGCATAAATCTGAGAAGAAGGCCTTCACC
ADR01_0080_H09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0011_F07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0102_H09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0084_C04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0044_B06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0054_G05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0095_C04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0029_F08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PTG01_0003_D07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0097_A10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0056_A09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0095_H03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LVR01_0100_A04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0095_G02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0004_G01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0056_H07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRT1_0035_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
MLN01_0081_D04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0023_F11.b : GATGAGTGCAAGGGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0019_D03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
MLN01_0048_E09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0059_E04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
MLN01_0081_G10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0019_F05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0006_C03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0060_C09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0107_C05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0019_A06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0057_A10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0093_H03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0097_G09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0010_H02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0062_H12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0050_F07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0075_F05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0094_H01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0090_B06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0044_G10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0020_G12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
LNG01_0059_F02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0057_H06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0056_B02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0069_F06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0033_D11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0016_G08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0014_B12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0099_D10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0009_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0047_C10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0053_A07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0009_H07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0081_D01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0011_D07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAAGCCTTCACC
THY01_0118_E04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0126_C11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0037_D08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0083_H06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0207_B05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0082_H02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0028_A05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0087_B04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
MLN01_0071_F05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0090_A01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0072_H10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0061_A11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0091_G02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0112_F12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
HTMT1_0048_B01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0065_A11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0009_E04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0084_A04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0040_D08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0123_B05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0066_H05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0028_F03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0024_C11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0033_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0016_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0003_E07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGTCTTCACC
TCH01_0101_G07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0024_C09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0071_G12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0126_D05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0137_H01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0026_D04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0077_D11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0072_A11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PCT01_0013_F07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0002_F06.b : GGTGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0057_F03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
MLN01_0066_G09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0031_C08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
MLN01_0103_C03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0032_F07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0022_A03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0062_D03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0125_A10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0004_G02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0080_A12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0098_B07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0099_F11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
BFLT1_0107_E10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0008_E05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0022_E01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0058_C03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0031_C01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0025_B01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0050_G04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0044_D02.b : GATGAGTGCAAGAGGCGTTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0029_H03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0097_A10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0010_E10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
CLNT1_0013_F04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ITT01_0099_G03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0031_A11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0078_D08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0107_B11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0103_F06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0059_B10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0071_A01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PCT01_0027_E12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PCT01_0026_H01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0063_F02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0063_A03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0035_H07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0069_D09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0037_E06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0008_G02.b : GATGAGTGCAAGAGGCGC*TCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0034_C09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0112_D03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0007_F08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0076_H04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0086_F11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0079_B03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0094_C01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0081_B08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0067_E07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0009_E06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0104_B09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0013_G05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0064_H11.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0087_D04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0060_H10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0013_G04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0075_H04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0023_B04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PST01_0009_F02.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0085_G04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0008_C05.b : GATGAGTGCAAGAGGCGCTTCTATAATAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0030_A09.b : GATGAGTGCAAGAGGCGCTTCTATTATAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TES01_0088_A09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0083_F06.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVRM1_0152_A03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0110_B10.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGGCTTCACC
PBL01_0053_C01.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0069_C05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0099_D12.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
ADR01_0014_B09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0085_E07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0096_E03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0024_F05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
HTMT1_0074_F07.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
THY01_0118_E09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SPL01_0013_G05.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0038_E04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
OVR01_0048_C09.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0018_E03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
PBL01_0013_G08.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
TCH01_0083_F04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SMG01_0097_D04.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0054_H03.b : GATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0081_F04.b : xxxxxxxxxxxxxxxxxxxTCTATAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0004_C02.b : xxxxxxxxxxxxxxxxxxxxxxxTAAGAACTGGCATAAATCTAAGAAGAAGGCCTTCACC
SKNB1_0086_F02.b : nnnnnnnncctgcgtttgctatggttagACTGGCATAAATCTA*GAAGAAGGCCTTCACC
SMG01_0096_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCATAAATCTAAGAAGAAGGCCTTCACC
UTR01_0010_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAAGAAGAAGGCCTTCACC
UTR01_0037_F01.b : tggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0069_C10.b :
SPLT1_0080_F05.b :
20110601C-001759 : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
---------+---------+---------+---------+---------+---------+ 522
THY01_0110_H09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0107_F08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0109_H07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0122_A07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0112_E10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0069_G09.b : AAATACCGCAAGAAGTGGCAAGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0007_H10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0044_H02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0116_H06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0008_A08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0033_H08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0022_F05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0003_G09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0037_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0079_G04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0019_C03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0122_D06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAACAG*TTGGAGAGGGAATTTAN
THY01_0110_H11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0091_B04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0038_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0053_H02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0110_A04.b : AAATACTGGAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0057_G03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGNCAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0037_F08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0029_F12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0042_F10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0066_E03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0108_E06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0108_D06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0082_F10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
MLN01_0090_D07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0094_A09.b : NAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0051_E01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0066_G09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0040_H11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0059_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0036_H02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0104_F10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0106_D04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0085_H10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0070_G05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0079_F06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0035_E11.b : TAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0017_G09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0039_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0094_H07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0052_H09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0009_A02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0063_H10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PTG01_0036_B09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPLT1_0016_G07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0060_E12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0016_E03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0001_C04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0038_D10.b : AAATACTGCAAGAAGTGGCACGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0019_G08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0050_A05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0087_F04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0087_D01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0015_G10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0050_E08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0011_A03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0032_D09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0091_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0022_H11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0032_G05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0014_C10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0021_D08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0085_C10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0030_E04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0011_D10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0104_E09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0081_B12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0061_A05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0074_G02.b : TAATACTGCAAGAAGTGGCATGATGAAGATGGCAAGTAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0153_B04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0067_E10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAA*TTGGAGAGGGACTTCCG
SPL01_0028_C09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPLT1_0023_H03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0079_D12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0013_D05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
BMWN1_0084_A06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0058_A10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0050_D10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0094_C08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0079_B07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ILNT1_0047_G08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CBLT1_0010_A09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CBLT1_0055_H01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPLT1_0087_C06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0037_C08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CBLT1_0061_F03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CBLT1_0046_H11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ILNT1_0091_B12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0084_B10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0090_C04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0002_A08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ILNT1_0046_A10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0043_B06.b : ccaaatactggcaaaaaatggcagggatgaaaattggcaaaaaccccttggaaaagggac
THY01_0118_H10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0104_B05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0105_G04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0117_C10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0067_D01.b : AAATACTGCAAGAAGTGGCATGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0053_C09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0076_A01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0165_G06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0148_H07.b : AAATACTGCAAGGAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0133_H07.b : AAACACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0038_B04.b : AAATACTGCGAGAACTGGCACGATGAAGATGGCTACAAACAG*TTGGACAGGGACTTCAG
TES01_0092_H03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0100_D09.b : AAATACTGCTAGAAGTGGCACGATGAAGATGGCCCGAAGCAGTTTGGAGAGGGACTTCAG
TES01_0071_G09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0064_E05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0218_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0121_D03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LVRM1_0063_A04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0066_H10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0084_B12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0089_H12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0212_A10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0046_H07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0088_B09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0030_F11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0006_C03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0065_A12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0002_A11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGTAGCAG*TTGGAGAGGGACTTCAG
SMG01_0099_D07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0065_A08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0022_B07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0041_B10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0029_C12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0043_H10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0026_D09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0028_A04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0027_F04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0009_F01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0040_C12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PTG01_0081_D07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0097_B10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0006_F10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0001_E02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0021_A02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0002_G12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PTG01_0077_G03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0005_F01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0131_F06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PCT01_0034_B02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0017_D09.b : AAATACTGCAAGAAGTGGCAGGATGAACATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
BKFL1_0116_A02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0029_F01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PTG01_0080_E03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0136_H03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0013_A01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0037_D04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PCT01_0004_G03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0040_G04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0129_A01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0075_F12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0002_D03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
MLN01_0090_G11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0028_B09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0040_D10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0063_H12.b : AAATACTGCAAAAAGTGGCAGGATGAAAATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0106_A07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0003_H03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0086_C01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0038_E06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0065_H12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0098_C11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0096_C07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0079_A08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0113_C12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0110_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PTG01_0044_D02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0083_C12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0070_B03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0058_C03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LNG01_0013_C05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0067_F09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0059_H06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0092_E03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0054_E10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0034_A05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0114_B10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0062_E03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0087_H02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0083_G03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0009_C05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0001_B07.b : AAATACTGCAAGAAGTGGCACGATGAAGATGGCAAGAAGCAG*ATGGACAGGGACTTCAG
OVR01_0087_C01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0097_B07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LNG01_0045_H05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAC*TTGGAGAGGGACTTCAG
LNG01_0020_C03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0071_A05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0138_C08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0054_A02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0013_A05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0076_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0071_H11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0095_A05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LNG01_0002_A12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0090_B12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LVR01_0033_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0021_C06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0049_E04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0056_B10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0073_A06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LNG01_0072_D03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0057_F04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0085_B12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LNG01_0106_A11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0041_E09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0094_B02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0065_G08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0032_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0037_H06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0089_A11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0103_G04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0063_B02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PTG01_0019_D05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0045_A02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0036_C05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0081_E05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0009_F01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0076_B03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LNG01_0045_A06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0088_F07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0034_A06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0083_D09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0071_B07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0051_D11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0100_E12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0021_B07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0050_B02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0016_G11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0055_B08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0103_E07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0069_G08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0085_D10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0080_H09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0011_F07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0102_H09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0084_C04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0044_B06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0054_G05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0095_C04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0029_F08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PTG01_0003_D07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0097_A10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0056_A09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0095_H03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
LVR01_0100_A04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0095_G02.b : GAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0004_G01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0056_H07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRT1_0035_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
MLN01_0081_D04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0023_F11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0019_D03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
MLN01_0048_E09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0059_E04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
MLN01_0081_G10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0019_F05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0006_C03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0060_C09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0107_C05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0019_A06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0057_A10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0093_H03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0097_G09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0010_H02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0062_H12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0050_F07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0075_F05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0094_H01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0090_B06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0044_G10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0020_G12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGTAGCAG*TTGGAGAGGGACTTCAG
LNG01_0059_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0057_H06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0056_B02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0069_F06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0033_D11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0016_G08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0014_B12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0099_D10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0009_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0047_C10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0053_A07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0009_H07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0081_D01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0011_D07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0118_E04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0126_C11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0037_D08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0083_H06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0207_B05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0082_H02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0028_A05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0087_B04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
MLN01_0071_F05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0090_A01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0072_H10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0061_A11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0091_G02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0112_F12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
HTMT1_0048_B01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0065_A11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0009_E04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0084_A04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0040_D08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0123_B05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0066_H05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0028_F03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0024_C11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0033_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0016_B11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0003_E07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0101_G07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0024_C09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0071_G12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0126_D05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0137_H01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0026_D04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0077_D11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0072_A11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PCT01_0013_F07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0002_F06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0057_F03.b : AAATACTGCGAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
MLN01_0066_G09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0031_C08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
MLN01_0103_C03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0032_F07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0022_A03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0062_D03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0125_A10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0004_G02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0080_A12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0098_B07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0099_F11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
BFLT1_0107_E10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0008_E05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0022_E01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0058_C03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0031_C01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0025_B01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0050_G04.b : TAATACTGCAAGAAATGGCAGGATGAACATGGCAAGAAGCAG*TTGGGGAGGGACTTCAG
TES01_0044_D02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0029_H03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0097_A10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0010_E10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
CLNT1_0013_F04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ITT01_0099_G03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0031_A11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0078_D08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0107_B11.b : AAATACTGCAAGAAGTGGCAAGATGAACATGGCAAGAAGCAG*TTGGAGAGGGACTTCAT
TES01_0103_F06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0059_B10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0071_A01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PCT01_0027_E12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PCT01_0026_H01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0063_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0063_A03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0035_H07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0069_D09.b : AAATACTGCAAGAAGTGGCAGGATGAAGGTGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0037_E06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0008_G02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0034_C09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0112_D03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0007_F08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0076_H04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0086_F11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0079_B03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0094_C01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0081_B08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0067_E07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCGG*TTGGAGAGGGACTTCAG
SKNB1_0009_E06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0104_B09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0013_G05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0064_H11.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0087_D04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0060_H10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0013_G04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0075_H04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0023_B04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PST01_0009_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0085_G04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0008_C05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0030_A09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TES01_0088_A09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0083_F06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVRM1_0152_A03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0110_B10.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGAAG*TTGGAGAGGGACTTCAG
PBL01_0053_C01.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0069_C05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0099_D12.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
ADR01_0014_B09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0085_E07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0096_E03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0024_F05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
HTMT1_0074_F07.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
THY01_0118_E09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPL01_0013_G05.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0038_E04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
OVR01_0048_C09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0018_E03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
PBL01_0013_G08.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
TCH01_0083_F04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0097_D04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0054_H03.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0081_F04.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0004_C02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SKNB1_0086_F02.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SMG01_0096_B06.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0010_A09.b : AAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
UTR01_0037_F01.b : xxxxxxxxxxxxxxxxxxxxxxxTGAAGATGGCAAGAAGCAG*TTGGAGAGGGACTTCAG
SPLT1_0069_C10.b : nnnaacgcgagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0080_F05.b :
20110601C-001759 : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
---------+---------+---------+---------+---------+---------+ 579
THY01_0110_H09.b : TAGC*ATGAAGAAGTACTGCCAGGTTATCCGGGTCA*TTGCCCACACCCAGATTCGCCCT
THY01_0107_F08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0109_H07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0122_A07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCCCATGCC*CCT
THY01_0112_E10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0069_G09.b : TAGC*ATGAAGAAATACTGCCCGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0007_H10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0044_H02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0116_H06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0008_A08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0033_H08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0022_F05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0003_G09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PST01_0037_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0079_G04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0019_C03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0122_D06.b : TAGC*ATGAAAAAATAatggccggtcatcccgggtcttgccaccaccccattgccctgct
THY01_0110_H11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATTCGGGTCA*TTGCCCACAC*CAGATGCG*CCT
PST01_0091_B04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0038_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0053_H02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCAGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0110_A04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0057_G03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0037_F08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0029_F12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0042_F10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0066_E03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0108_E06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0108_D06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0082_F10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
MLN01_0090_D07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0094_A09.b : TAGC*ATGAAGAAGTACTGCCCAGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0051_E01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0066_G09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0040_H11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0059_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0036_H02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0104_F10.b : TACC*ATGAAGAAATACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCCGATGCG*CCT
THY01_0106_D04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0085_H10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0070_G05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0079_F06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0035_E11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0017_G09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0039_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0094_H07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0052_H09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0009_A02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0063_H10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PTG01_0036_B09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPLT1_0016_G07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0060_E12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCCGCCT
SPL01_0016_E03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0001_C04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0038_D10.b : TAGC*ATGAAGAAGTACTGCCAGGTCACCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0019_G08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0050_A05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0087_F04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0087_D01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0015_G10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0050_E08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0011_A03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0032_D09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0091_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0022_H11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0032_G05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0014_C10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0021_D08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0085_C10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0030_E04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0011_D10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0104_E09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0081_B12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0061_A05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0074_G02.b : TATT*CTGATCAATTACTGCCAGGTCTCCCGGGTTA*TTGgccctcatccatatgcgtct
OVRM1_0153_B04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0067_E10.b : TAGC*ATGAAGAAGTACTGGCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0028_C09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPLT1_0023_H03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0079_D12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0013_D05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
BMWN1_0084_A06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0058_A10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0050_D10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0094_C08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0079_B07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ILNT1_0047_G08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CBLT1_0010_A09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CBLT1_0055_H01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPLT1_0087_C06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0037_C08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CBLT1_0061_F03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CBLT1_0046_H11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ILNT1_0091_B12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0084_B10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0090_C04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0002_A08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ILNT1_0046_A10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0043_B06.b : ttccttaccttgaaaaaatttcgggcccgggtctcccgggtttttggccccaccccaaag
THY01_0118_H10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTAA*TTGCCCACACCCAGATGCG*CCT
THY01_0104_B05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0105_G04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0117_C10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0067_D01.b : TAGC*ATGAATAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACTCATATGCG*CCT
TES01_0053_C09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0076_A01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0165_G06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0148_H07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0133_H07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0038_B04.b : TAGC*ATGAACAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACGCAGATGCG*CCT
TES01_0092_H03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0100_D09.b : TTGCTATGAAGAAGTACTGCCAGGTCATCCGGGTCATTTGCCCACACCCAGATGCG*CCT
TES01_0071_G09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0064_E05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0218_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0121_D03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LVRM1_0063_A04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0066_H10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0084_B12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0089_H12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0212_A10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0046_H07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0088_B09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0030_F11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCGCCCT
THY01_0006_C03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0065_A12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0002_A11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0099_D07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0065_A08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0022_B07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0041_B10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0029_C12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0043_H10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0026_D09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0028_A04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0027_F04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0009_F01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0040_C12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PTG01_0081_D07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0097_B10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0006_F10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0001_E02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0021_A02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0002_G12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PTG01_0077_G03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0005_F01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0131_F06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PCT01_0034_B02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0017_D09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
BKFL1_0116_A02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0029_F01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PTG01_0080_E03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0136_H03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0013_A01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0037_D04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PCT01_0004_G03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0040_G04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0129_A01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0075_F12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0002_D03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
MLN01_0090_G11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0028_B09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0040_D10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0063_H12.b : TAGC*ATGAAAAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAAATGCG*CCT
UTR01_0106_A07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0003_H03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0086_C01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0038_E06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0065_H12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0098_C11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0096_C07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0079_A08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0113_C12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0110_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PTG01_0044_D02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0083_C12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PST01_0070_B03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0058_C03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LNG01_0013_C05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0067_F09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0059_H06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0092_E03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0054_E10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0034_A05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0114_B10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0062_E03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0087_H02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0083_G03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0009_C05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0001_B07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0087_C01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0097_B07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LNG01_0045_H05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LNG01_0020_C03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0071_A05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0138_C08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0054_A02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0013_A05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0076_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0071_H11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0095_A05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LNG01_0002_A12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0090_B12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LVR01_0033_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0021_C06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0049_E04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0056_B10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0073_A06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LNG01_0072_D03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0057_F04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0085_B12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LNG01_0106_A11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0041_E09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PST01_0094_B02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*CTGCCCACACCCAGATGCG*CCT
PBL01_0065_G08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0032_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0037_H06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0089_A11.b : TAGC*ATGAAGAAGTACTGCCAAGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0103_G04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0063_B02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PTG01_0019_D05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0045_A02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0036_C05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0081_E05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0009_F01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0076_B03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LNG01_0045_A06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0088_F07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0034_A06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0083_D09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0071_B07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0051_D11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0100_E12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0021_B07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0050_B02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0016_G11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0055_B08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0103_E07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0069_G08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0085_D10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0080_H09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0011_F07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0102_H09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0084_C04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0044_B06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0054_G05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0095_C04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0029_F08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PTG01_0003_D07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0097_A10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0056_A09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0095_H03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LVR01_0100_A04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGTCCACACCCAGATGCG*CCT
THY01_0095_G02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*CTGCCCACACCCAGATGCG*CCT
CLNT1_0004_G01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0056_H07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRT1_0035_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
MLN01_0081_D04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0023_F11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0019_D03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
MLN01_0048_E09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0059_E04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
MLN01_0081_G10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0019_F05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0006_C03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0060_C09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0107_C05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0019_A06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0057_A10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0093_H03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0097_G09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0010_H02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0062_H12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0050_F07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0075_F05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0094_H01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0090_B06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0044_G10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0020_G12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
LNG01_0059_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0057_H06.b : TAGC*ATGAAGAAGTACTGCCAGGTCACCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0056_B02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0069_F06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0033_D11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0016_G08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0014_B12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0099_D10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0009_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0047_C10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0053_A07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0009_H07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0081_D01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0011_D07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0118_E04.b : TACC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0126_C11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0037_D08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0083_H06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0207_B05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0082_H02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0028_A05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0087_B04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
MLN01_0071_F05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0090_A01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0072_H10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0061_A11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0091_G02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0112_F12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
HTMT1_0048_B01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0065_A11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0009_E04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0084_A04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0040_D08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0123_B05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCCCACCCAAATCCC*CCT
TES01_0066_H05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0028_F03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0024_C11.b : TAGC*ATGAACAACTACTGCCAGGTCATCCTGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0033_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0016_B11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0003_E07.b : TAGC*ATGAAGGAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0101_G07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0024_C09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0071_G12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0126_D05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0137_H01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0026_D04.b : TAGC*ATGAAGAAATACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0077_D11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0072_A11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCTGGGTCA*TTGCCCACACCCAGATGCG*CCT
PCT01_0013_F07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0002_F06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PST01_0057_F03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
MLN01_0066_G09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0031_C08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
MLN01_0103_C03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0032_F07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0022_A03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0062_D03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0125_A10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0004_G02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0080_A12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0098_B07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0099_F11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
BFLT1_0107_E10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0008_E05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTCCCCACACCCAGATGCG*CCT
ITT01_0022_E01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0058_C03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0031_C01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0025_B01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0050_G04.b : TAGC*ATGAACAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0044_D02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0029_H03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0097_A10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0010_E10.b : TAGC*ATGAAGAAGTACTGCCAGGCCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
CLNT1_0013_F04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ITT01_0099_G03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PST01_0031_A11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0078_D08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0107_B11.b : TACC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCA*CCT
TES01_0103_F06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0059_B10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0071_A01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PCT01_0027_E12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PCT01_0026_H01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0063_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0063_A03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0035_H07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0069_D09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0037_E06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0008_G02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0034_C09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0112_D03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0007_F08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0076_H04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0086_F11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0079_B03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0094_C01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0081_B08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0067_E07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0009_E06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0104_B09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PST01_0013_G05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0064_H11.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0087_D04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGATCA*TTGCCCACACCCAGATGCG*CCT
TES01_0060_H10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PST01_0013_G04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0075_H04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0023_B04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PST01_0009_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0085_G04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0008_C05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0030_A09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TES01_0088_A09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0083_F06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVRM1_0152_A03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0110_B10.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0053_C01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0069_C05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0099_D12.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
ADR01_0014_B09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0085_E07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0096_E03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0024_F05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
HTMT1_0074_F07.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
THY01_0118_E09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPL01_0013_G05.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0038_E04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
OVR01_0048_C09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0018_E03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
PBL01_0013_G08.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
TCH01_0083_F04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SMG01_0097_D04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0054_H03.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0081_F04.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0004_C02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SKNB1_0086_F02.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGTCCACACCCAGATGCG*CCT
SMG01_0096_B06.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0010_A09.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
UTR01_0037_F01.b : TAGC*ATGAAGAAGTACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPLT1_0069_C10.b : xxxxxxxxxxxxxxxACTGCCAGGTCATCCGGGTCA*TTGCCCACACCCAGATGCG*CCT
SPLT1_0080_F05.b :
20110601C-001759 : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
---------+---------+---------+---------+---------+---------+ 638
THY01_0110_H09.b : GCTTCCTCTCCGCCAGAAG*AAAGGCCACCTtttggga
THY01_0107_F08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCACCCTCATGagatcaggtgaacggagggccggtg
THY01_0109_H07.b : GCTTCCTCTCCGCCANAAG*AAAGGCCACCTCATGagaatcaggttaaaggaggacagtg
THY01_0122_A07.b : GCTTCCTCTCCCCCAAAAA*AAAGCCCCCCTCATGaaattcggtgaaggaggcccgtggt
THY01_0112_E10.b : GCTTCCTCTCCGCCAGAAA*AAAGGCCCCCTCATGaaaatccagttgacggaggccagtg
TES01_0069_G09.b : GCTTCCTCTTCGCCAAAAGAAAGGCCCACCTCTTGGAGATTCTGGTGAACGGAAGCACAT
OVR01_0007_H10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0044_H02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0116_H06.b : GCTTCCTCTCCCCCAAAAA*AAGGCCC*CCTCATGaaatccagttaacgaggccagtggt
THY01_0008_A08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0033_H08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0022_F05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0003_G09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PST01_0037_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0079_G04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0019_C03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0122_D06.b : tctctcccccaaaaaaggcccccctttggaaatcaggtaaaggggggcagggggtaaaaa
THY01_0110_H11.b : GCTTTCTTccgccagaaaaaggccccctattgaaatcagttgaaggaggacagtggtgaa
PST01_0091_B04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0038_B11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0053_H02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0110_A04.b : GCTTCCTCTCCGCCAGAAG*AAAGCCCCCCTCATGGAAATCaggttaacggagggccgtg
OVR01_0057_G03.b : GCTTTCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATC*AGGTGAACGGAAGGCCCG
OVR01_0037_F08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGGGGCACAG
OVR01_0029_F12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0042_F10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0066_E03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0108_E06.b : GCTTCCTCTCCGCCAGAAG*AAAGCCCACCTCATGGAGATCangtgaaaggaagggcagt
TES01_0108_D06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0082_F10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
MLN01_0090_D07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0094_A09.b : GCCTCCTCTCCGCCAGAGG*AAAGCC*ACCTTCTGGAAATCCAGGTGGACGGgaggcaca
THY01_0051_E01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0066_G09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0040_H11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0059_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCTACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0036_H02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0104_F10.b : GCTTCCTCTCCGCCAAAAG*AAGGCCCCCCTCtggagatcangtgaaccgggggaccggg
THY01_0106_D04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATTCANGTGAACGGAGGgccag
TES01_0085_H10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0070_G05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0079_F06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0035_E11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0017_G09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0039_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0094_H07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0052_H09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0009_A02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0063_H10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAAAGGAGGCACAG
PTG01_0036_B09.b : GCTTCCTCTCCGCCAGAAG*A*GGCCCACCTCATGGAGATCC*GGTGAACGGAGGCACAG
SPLT1_0016_G07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCANGTGAACGGAGGCACAG
OVRM1_0060_E12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGAATCAGGTGTACGGAGGCACGN
SPL01_0016_E03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0001_C04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0038_D10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0019_G08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0050_A05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0087_F04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0087_D01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0015_G10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0050_E08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0011_A03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0032_D09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0091_B11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0022_H11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0032_G05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0014_C10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0021_D08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0085_C10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0030_E04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0011_D10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0104_E09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0081_B12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0061_A05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0074_G02.b : gtttcctctccgcccttaataaggcccttctttatggaaatccatgtgaacggaagtaca
OVRM1_0153_B04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
OVR01_0067_E10.b : GCTTCCTCTCCGCCAGAAG*AAAGGCCACCTCATGGAGATCCAGGTGAACGGAAGCACAG
SPL01_0028_C09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPLT1_0023_H03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0079_D12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0013_D05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
BMWN1_0084_A06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0058_A10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0050_D10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0094_C08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0079_B07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ILNT1_0047_G08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CBLT1_0010_A09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CBLT1_0055_H01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPLT1_0087_C06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0037_C08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CBLT1_0061_F03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CBLT1_0046_H11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ILNT1_0091_B12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0084_B10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0090_C04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0002_A08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ILNT1_0046_A10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0043_B06.b : gggccgggtttcctttcccccaaaaaagaggccccccctcggggaaatccccgggaaagg
THY01_0118_H10.b : GCTTCCCTCTCCCCAGAAG*AAGGCCACCCTatggagattaggtgaacggagcacagtgc
THY01_0104_B05.b : GCCTCCTCTCCGCCAGAAG*AAGG*CCACCTCATGGAGATCaggttaacgggaggacagt
THY01_0105_G04.b : GCTTCCTCTTCGCCAGAAG*AAGGGCCACCTCATGGAGATTCAGtgaaaggaggcccagt
THY01_0117_C10.b : GCTTCCTCTCCGCCAGAAG*AAGGGCCCACCTCTGGAGATCCAGGTGAACCGAGGCACAG
THY01_0067_D01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGTAACGGCGCACAG
TES01_0053_C09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCTCAT
OVR01_0076_A01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRM1_0165_G06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
OVRM1_0148_H07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
OVRM1_0133_H07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
PBL01_0038_B04.b : GCTTCCTCTCCGCTCGAAG*AAGGCCCATCTCATGGAGATCCACGTGAACTGAGGCACAG
TES01_0092_H03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGANGCACAG
OVR01_0100_D09.b : GCTTCCTCTCCGCTCGAAT*AATGCCCACCTCATGGAGATCCATGTGAACGGAGGCCACG
TES01_0071_G09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCANGTGAACNGGAGCACAG
SMG01_0064_E05.b : GCTTCCCTCTCGCCAGAAG*AAAGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRM1_0218_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
OVRM1_0121_D03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
LVRM1_0063_A04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
OVR01_0066_H10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRM1_0084_B12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
SMG01_0089_H12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRM1_0212_A10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0046_H07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0088_B09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0030_F11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGANGCACAG
THY01_0006_C03.b : GCTTCCTCCCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0065_A12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0002_A11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACAGAGGCACAG
SMG01_0099_D07.b : GCTTCCTCNTCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0065_A08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0022_B07.b : GCTTCCTCTCCGCCAGAAG*AAAGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0041_B10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCACGTGAACGGACGCACAG
UTR01_0029_C12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0043_H10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0026_D09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0028_A04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0027_F04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0009_F01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0040_C12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PTG01_0081_D07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0097_B10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0006_F10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0001_E02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0021_A02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0002_G12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PTG01_0077_G03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0005_F01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0131_F06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PCT01_0034_B02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
UTR01_0017_D09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
BKFL1_0116_A02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0029_F01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PTG01_0080_E03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0136_H03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0013_A01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0037_D04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PCT01_0004_G03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
ADR01_0040_G04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0129_A01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0075_F12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0002_D03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
MLN01_0090_G11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0028_B09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0040_D10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0063_H12.b : GCTTCCTCTCCGCCAAAAA*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0106_A07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0003_H03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0086_C01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0038_E06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0065_H12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0098_C11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0096_C07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0079_A08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0113_C12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0110_B11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PTG01_0044_D02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0083_C12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PST01_0070_B03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0058_C03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LNG01_0013_C05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0067_F09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0059_H06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0092_E03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0054_E10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0034_A05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0114_B10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0062_E03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0087_H02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0083_G03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0009_C05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0001_B07.b : GCTTCCTCTCCACCAAAAA*AACGCCCACCTCATGGAGATCCATGTGAACGGAGGCACAC
OVR01_0087_C01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0097_B07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAAGTGAACGGAGGCACAG
LNG01_0045_H05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LNG01_0020_C03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0071_A05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0138_C08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0054_A02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0013_A05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0076_B11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0071_H11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0095_A05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LNG01_0002_A12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0090_B12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LVR01_0033_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0021_C06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0049_E04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0056_B10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0073_A06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LNG01_0072_D03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0057_F04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0085_B12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LNG01_0106_A11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0041_E09.b : GCTTCCTCTCCGTCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PST01_0094_B02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0065_G08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0032_B11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0037_H06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0089_A11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0103_G04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0063_B02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PTG01_0019_D05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0045_A02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0036_C05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0081_E05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0009_F01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0076_B03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LNG01_0045_A06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0088_F07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0034_A06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0083_D09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0071_B07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0051_D11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0100_E12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0021_B07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0050_B02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0016_G11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0055_B08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0103_E07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0069_G08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0085_D10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0080_H09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0011_F07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0102_H09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0084_C04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0044_B06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0054_G05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0095_C04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0029_F08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PTG01_0003_D07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0097_A10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0056_A09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0095_H03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LVR01_0100_A04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0095_G02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0004_G01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGACCCAGGTGAACGGAGGCACAG
ITT01_0056_H07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRT1_0035_B11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
MLN01_0081_D04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0023_F11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0019_D03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
MLN01_0048_E09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0059_E04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
MLN01_0081_G10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0019_F05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0006_C03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0060_C09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0107_C05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0019_A06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGGGATCCAGGTGAACGGAGGCACAG
THY01_0057_A10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0093_H03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0097_G09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0010_H02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0062_H12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0050_F07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0075_F05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0094_H01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0090_B06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0044_G10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0020_G12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
LNG01_0059_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0057_H06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0056_B02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0069_F06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0033_D11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0016_G08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0014_B12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0099_D10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0009_B11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0047_C10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0053_A07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0009_H07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0081_D01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0011_D07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0118_E04.b : GCTTTCTCTCCGCCAGAAC*AAAGCC*ACCTTATGGAGATCCAagtaaacgaggcacagt
THY01_0126_C11.b : GCTTCCTCTCCGCCAGAAG*AAGGGCCACCTCATGGAGAATCAGGTGACCGGAGGCACAG
TES01_0037_D08.b : GCTTCCTCTCCGCCAGAAA*AAGGCCCACCTCAAGGAGATCCAGGTGAACGGAGGCCCAT
TES01_0083_H06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0207_B05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0082_H02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0028_A05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0087_B04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
MLN01_0071_F05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0090_A01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0072_H10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0061_A11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0091_G02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGTACAG
TES01_0112_F12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
HTMT1_0048_B01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0065_A11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0009_E04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0084_A04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0040_D08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0123_B05.b : TCTTTCTTCCCCCCAAAAA*Aggcccccctcatgagattcaggtgaaggagggaagtggg
TES01_0066_H05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRM1_0028_F03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
TES01_0024_C11.b : GCTTCCTCTCCGCCAGAAG*AAAGCCCACCTCATGGAGATCCAAGTGAACCGAGGCACAG
ADR01_0033_B11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0016_B11.b : GCTTCCTCTCCGCCAGAAG*GAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0003_E07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0101_G07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0024_C09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0071_G12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0126_D05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCNACTCATGGAGATCCAGTTGAACGaggcccagt
OVRM1_0137_H01.b : GCTTCCTCTCCGCCAGAAG*AA*GCCTACCTCATGGAGATCCAGGTGAACGGAGGCACGG
TES01_0026_D04.b : GCTTCCTCTCCGCCAGAAG*AAAGCCCACCCCATGGAGATCCAGGTGAACGGAGGCACAG
OVRM1_0077_D11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
TES01_0072_A11.b : GCTTCCTCTCCGCCAGAGG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PCT01_0013_F07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
TES01_0002_F06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PST01_0057_F03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
MLN01_0066_G09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0031_C08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
MLN01_0103_C03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0032_F07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0022_A03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0062_D03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0125_A10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0004_G02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0080_A12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0098_B07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0099_F11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
BFLT1_0107_E10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0008_E05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0022_E01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0058_C03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0031_C01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0025_B01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0050_G04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0044_D02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0029_H03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0097_A10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0010_E10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
CLNT1_0013_F04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ITT01_0099_G03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PST01_0031_A11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0078_D08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0107_B11.b : GCTTCCTCTCCGCCATAAG*AAGGCCCACCTCATGGAGATCCACGTGAACGGAGGCACAG
TES01_0103_F06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0059_B10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0071_A01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PCT01_0027_E12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
PCT01_0026_H01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
SKNB1_0063_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0063_A03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0035_H07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0069_D09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0037_E06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0008_G02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0034_C09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0112_D03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0007_F08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0076_H04.b : GCTTCCTCTCCGCCAGAAG*AAGGCC*ACCTCATGGAGATCCAGGTGAACGGANGCACAA
TES01_0086_F11.b : GCTTCCTCTCCGCCAGAAG*AAAGCCCACCTCATGGAGATCCANGTGAACGGANGCACAG
TES01_0079_B03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0094_C01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0081_B08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0067_E07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGTTCCAGGTGAACGGAGGCACAG
SKNB1_0009_E06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0104_B09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PST01_0013_G05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0064_H11.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAAACGAGGCACAG
SKNB1_0087_D04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0060_H10.b : GCTTCCCCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PST01_0013_G04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0075_H04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0023_B04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PST01_0009_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0085_G04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0008_C05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCCCCCCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0030_A09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TES01_0088_A09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0083_F06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVRM1_0152_A03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACGG
THY01_0110_B10.b : GCTTTCTTTCCCCCAAAAA*AAGGCCCCctatgggaaatcagttaaaagggggcaagggg
PBL01_0053_C01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGATGAACGGAGGCACAG
ADR01_0069_C05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0099_D12.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
ADR01_0014_B09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0085_E07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0096_E03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0024_F05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
HTMT1_0074_F07.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
THY01_0118_E09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPL01_0013_G05.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0038_E04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
OVR01_0048_C09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0018_E03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
PBL01_0013_G08.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
TCH01_0083_F04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0097_D04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0054_H03.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0081_F04.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0004_C02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SKNB1_0086_F02.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCACGGAGATCCAGGTGAACGGAGGCACAG
SMG01_0096_B06.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0010_A09.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
UTR01_0037_F01.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPLT1_0069_C10.b : GCTTCCTCTCCGCCAGAAG*AAGGCCCACCTCATGGAGATCCAGGTGAACGGAGGCACAG
SPLT1_0080_F05.b : nnnncgcgagtagacgccnxxxxx
20110601C-001759 : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
---------+---------+---------+---------+---------+---------+ 695
THY01_0110_H09.b :
THY01_0107_F08.b : ggtgaaa
THY01_0109_H07.b : gcttaaaaatgggatgggcccgagaaggtaaaaaaaggtctctt
THY01_0122_A07.b : taaaaatggaagg
THY01_0112_E10.b : gctgaaaaatggatgggccggggaaagttaaacanng
TES01_0069_G09.b : TGGtctgaaaaaattgaacggggccccgtggaaggcttttaccagccaggtccttgtgaa
OVR01_0007_H10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0044_H02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0116_H06.b : gaaaaattgattgggccggaaagggaaaaacctgtcctttaaaccggtttgg
THY01_0008_A08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0033_H08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0022_F05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0003_G09.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PST01_0037_F02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0079_G04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0019_C03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0122_D06.b : gggg
THY01_0110_H11.b : aaatgaatgggccggaaaggtaaaaaagggtt
PST01_0091_B04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0038_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0053_H02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0110_A04.b : gttaaaaaatggatggggccggggaagggaaaaacc
OVR01_0057_G03.b : TGGCTGAAAAAC*GGGACTGGGCCCGGGAaagcttaaaacaaccagttccctggaaacaa
OVR01_0037_F08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0029_F12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0042_F10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0066_E03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0108_E06.b : gggtgaaaaaatg
TES01_0108_D06.b : TGGCTGATAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAAGTCCC*TGTGAACC
THY01_0082_F10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAAG*CTAGAGCAGCAGGTCCC*TGTGAACC
MLN01_0090_D07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0094_A09.b : tgggctgaaaaactggaactgggccgggaaaagctaaaccaacagtccctgggaaaccag
THY01_0051_E01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0066_G09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0040_H11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0059_F02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0036_H02.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0104_F10.b : cttaaaaaatgcatggggccggggaaggttaaaacg
THY01_0106_D04.b : gggttaaaaa
TES01_0085_H10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0070_G05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0079_F06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0035_E11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0017_G09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0039_F02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0094_H07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0052_H09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0009_A02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0063_H10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGAAAAGG*CTAGAGCAACAGGTCCC*TGTGAACC
PTG01_0036_B09.b : TGGCTGA*AAAC*TGGACTGGGCCGGGGAGAGG*CTAGAGCAACAAGTCCC*TGTTGAAC
SPLT1_0016_G07.b : TGGCTG*AAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0060_E12.b : TGGTCGAAAAAC*TGGACTGTGTCCGGGAGAGG*CTAGAGCATCAGGTCCC*TGTGAACC
SPL01_0016_E03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0001_C04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAAAC
TES01_0038_D10.b : TGGCTGAATAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAAGTCCC*TGTGAACC
UTR01_0019_G08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0050_A05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0087_F04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0087_D01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0015_G10.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0050_E08.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0011_A03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGGACC
TCH01_0032_D09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0091_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0022_H11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0032_G05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0014_C10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0021_D08.b : TGGCTGANAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0085_C10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0030_E04.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0011_D10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0104_E09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0081_B12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0061_A05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0074_G02.b : tggttttaataacttggtctggccctggtaaaaagctaaaatctacagtccctgttaaac
OVRM1_0153_B04.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0067_E10.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAAG*CTATAGCAACACGTCCC*TGTGAAAC
SPL01_0028_C09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPLT1_0023_H03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0079_D12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0013_D05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
BMWN1_0084_A06.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0058_A10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0050_D10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0094_C08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0079_B07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ILNT1_0047_G08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CBLT1_0010_A09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CBLT1_0055_H01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPLT1_0087_C06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0037_C08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CBLT1_0061_F03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CBLT1_0046_H11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ILNT1_0091_B12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0084_B10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0090_C04.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0002_A08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ILNT1_0046_A10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0043_B06.b : ggggccccgtgggttaaaaaaatggaatggggcccgggaaaaaattaaaacaaaagggcc
THY01_0118_H10.b : gtgaaaacgggacgggccccggaagggctaactncggttccctataccgt
THY01_0104_B05.b : ggctaaaaactggatgggcccgggagaggttaagag
THY01_0105_G04.b : gggtgtaaa
THY01_0117_C10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGTAGAGG*CTATACCACCAGGTCCC*Tttaaaca
THY01_0067_D01.b : TGttctgaaaaaactagactgggtccgggagaggctaaataagcatgtccctgtcaacca
TES01_0053_C09.b : TGGCTGATAAACTTGGACTGGGCCCGGGAGAGG*CTAAAGCAGCAGGTCCC*TGTGAACC
OVR01_0076_A01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0165_G06.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0148_H07.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0133_H07.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCGGGTCCC*TGTGAACC
PBL01_0038_B04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTATAGCATCAAGTCCC*TGTGAACC
TES01_0092_H03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAAG*CTAGAGCAGCAAGTCCCTTGTGAACC
OVR01_0100_D09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCATCATGTCCC*TGTGAACC
TES01_0071_G09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGNAGAG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0064_E05.b : TGGCTGAAAAAC*TGGACTGGGGCCGGGAGAGG*CTAGAGCAGCAAGTCCC*TGTGAAAC
OVRM1_0218_F02.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0121_D03.b : TGGCCGAAAAAC*TGTACTGTGCCCGGGAGAAG*CTAGAGCAGCATGTCCC*TGTGAACC
LVRM1_0063_A04.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*TTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0066_H10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0084_B12.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0089_H12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0212_A10.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0046_H07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0088_B09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGGGCTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0030_F11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTANAGCAGCAAGTCCC*TGTGAACC
THY01_0006_C03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0065_A12.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0002_A11.b : CGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAACTGGTCCC*TGTGAACC
SMG01_0099_D07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0065_A08.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0022_B07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0041_B10.b : TGGCTGATAAAC*TGGACTGGGCCCGGTAGAGG*CTAGAGCACCTGGTCCC*TGTGAACC
UTR01_0029_C12.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0043_H10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGGGAGG*CTAGAGCAGCAGGCCCC*TGTGAACC
SPL01_0026_D09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0028_A04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0027_F04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0009_F01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0040_C12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PTG01_0081_D07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAAAC
SMG01_0097_B10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0006_F10.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0001_E02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGNAGAGG*CTAGAGCAGCACGTCCC*TGTGAACC
SMG01_0021_A02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0002_G12.b : TGGCTGAAAAAC*TGGACTGCGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PTG01_0077_G03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0005_F01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAAG*CTAGAGCAGCAGGTCCC*TGTGAAAC
OVRT1_0131_F06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PCT01_0034_B02.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0017_D09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
BKFL1_0116_A02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0029_F01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PTG01_0080_E03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0136_H03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0013_A01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0037_D04.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PCT01_0004_G03.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0040_G04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0129_A01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0075_F12.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0002_D03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
MLN01_0090_G11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0028_B09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0040_D10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0063_H12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0106_A07.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0003_H03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCACGTCCC*TGTGAACC
ITT01_0086_C01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0038_E06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0065_H12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGCGAACC
UTR01_0098_C11.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0096_C07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0079_A08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0113_C12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0110_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCACGTCCC*TGTGAACC
PTG01_0044_D02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0083_C12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PST01_0070_B03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGGGCAGCAGGTCCC*TGTGAACC
OVR01_0058_C03.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LNG01_0013_C05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0067_F09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0059_H06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0092_E03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0054_E10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0034_A05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0114_B10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0062_E03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0087_H02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0083_G03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0009_C05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0001_B07.b : TGGCTGACAAAC*TGGACTGGACCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0087_C01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0097_B07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LNG01_0045_H05.b : TGGCTGATAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LNG01_0020_C03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0071_A05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0138_C08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0054_A02.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0013_A05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAGCC
UTR01_0076_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0071_H11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0095_A05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LNG01_0002_A12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0090_B12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LVR01_0033_F02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0021_C06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0049_E04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0056_B10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0073_A06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LNG01_0072_D03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0057_F04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0085_B12.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LNG01_0106_A11.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0041_E09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PST01_0094_B02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGGACC
PBL01_0065_G08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0032_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0037_H06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0089_A11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0103_G04.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0063_B02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PTG01_0019_D05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0045_A02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0036_C05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0081_E05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0009_F01.b : TGGCTGAAAAAC*TGGACTGGGCCCAGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0076_B03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LNG01_0045_A06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0088_F07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGGGCAGCAGGTCCC*TGTGAACC
ADR01_0034_A06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0083_D09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0071_B07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0051_D11.b : TGGCTGANAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0100_E12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0021_B07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0050_B02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0016_G11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0055_B08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0103_E07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0069_G08.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0085_D10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0080_H09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0011_F07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0102_H09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0084_C04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0044_B06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0054_G05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0095_C04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0029_F08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PTG01_0003_D07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0097_A10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0056_A09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0095_H03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LVR01_0100_A04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0095_G02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0004_G01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0056_H07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRT1_0035_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
MLN01_0081_D04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0023_F11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0019_D03.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
MLN01_0048_E09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0059_E04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
MLN01_0081_G10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0019_F05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0006_C03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0060_C09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0107_C05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0019_A06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0057_A10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0093_H03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGGGCAGCAGGTCCC*TGTGAACC
ADR01_0097_G09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0010_H02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0062_H12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0050_F07.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0075_F05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0094_H01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0090_B06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0044_G10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0020_G12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
LNG01_0059_F02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0057_H06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0056_B02.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0069_F06.b : TGGCTGATAAAC*TGGACTGGGCCCGGGAGAAG*CTTAAGCAGCAGGTCCC*TGTGAACC
OVR01_0033_D11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0016_G08.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0014_B12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0099_D10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0009_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0047_C10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0053_A07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0009_H07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0081_D01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0011_D07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0118_E04.b : gcttgaaaacttgactgggccgggaaaggcttagcaggaggttctttgaacaagtg
THY01_0126_C11.b : TGGCTGAAAAAC*TTGACTGGGCCtggaaa
TES01_0037_D08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTATAGCATCAAGTCCC*TGTGAACC
TES01_0083_H06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0207_B05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0082_H02.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0028_A05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0087_B04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
MLN01_0071_F05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0090_A01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0072_H10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0061_A11.b : TGGCTGATAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0091_G02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0112_F12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
HTMT1_0048_B01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0065_A11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0009_E04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0084_A04.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0040_D08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0123_B05.b : gaaaaaagaatgggggcg
TES01_0066_H05.b : TGGCTGATAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0028_F03.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0024_C11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAAG*CTATAACATCATGTCCC*TGTGAACC
ADR01_0033_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0016_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAAGTCCCCTGTGA*CC
SKNB1_0003_E07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0101_G07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0024_C09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0071_G12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0126_D05.b : gggtgaaaaactgtactggccccggaaaggt
OVRM1_0137_H01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAAGTCCC*TGTGGACC
TES01_0026_D04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAAG*CTAGAGCAACAAGGCCC*TGTGGACC
OVRM1_0077_D11.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0072_A11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PCT01_0013_F07.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCANGTCCC*TGTGAACC
TES01_0002_F06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PST01_0057_F03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
MLN01_0066_G09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0031_C08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
MLN01_0103_C03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0032_F07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0022_A03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCGGGTCCC*TGTGAACC
PBL01_0062_D03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0125_A10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0004_G02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0080_A12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0098_B07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0099_F11.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
BFLT1_0107_E10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0008_E05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGCGAACC
ITT01_0022_E01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0058_C03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0031_C01.b : TGGCTGAAAAAC*TGGACTGAGCTCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0025_B01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0050_G04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCACGTCCC*TGTGAACC
TES01_0044_D02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0029_H03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0097_A10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0010_E10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
CLNT1_0013_F04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ITT01_0099_G03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PST01_0031_A11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0078_D08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0107_B11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0103_F06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAAGTCCC*TGTGAACC
TES01_0059_B10.b : TGGCTGAAAAAC*TGGACTGGGCCCCN*AGAAG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0071_A01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PCT01_0027_E12.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCANGTCCC*TGTGAACC
PCT01_0026_H01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0063_F02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0063_A03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0035_H07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0069_D09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0037_E06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0008_G02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0034_C09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0112_D03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0007_F08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCATGTCCC*TGTGAACC
TES01_0076_H04.b : TGGCTGAAAAAC*TGGACTGGCCCGGGGAGAGctaaagcgcaaggccctgtgaaccagtg
TES01_0086_F11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAAC*
TES01_0079_B03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0094_C01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0081_B08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0067_E07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0009_E06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0104_B09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PST01_0013_G05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0064_H11.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0087_D04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0060_H10.b : TGGGTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PST01_0013_G04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0075_H04.b : TGGCTGAAAAAC*AGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0023_B04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PST01_0009_F02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0085_G04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0008_C05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0030_A09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TES01_0088_A09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0083_F06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVRM1_0152_A03.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0110_B10.b : ctgaaaaaggaatgggccggggaagggatat
PBL01_0053_C01.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
ADR01_0069_C05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0099_D12.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAAGTCCC*TGTGAACC
ADR01_0014_B09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0085_E07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0096_E03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0024_F05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
HTMT1_0074_F07.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
THY01_0118_E09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPL01_0013_G05.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0038_E04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
OVR01_0048_C09.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0018_E03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
PBL01_0013_G08.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
TCH01_0083_F04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0097_D04.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0054_H03.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0081_F04.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0004_C02.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SKNB1_0086_F02.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SMG01_0096_B06.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0010_A09.b : TGGCTGAAAAAC*TGGATTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
UTR01_0037_F01.b : TGGCCGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPLT1_0069_C10.b : TGGCTGAAAAAC*TGGACTGGGCCCGGGAGAGG*CTAGAGCAGCAGGTCCC*TGTGAACC
SPLT1_0080_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCAGCAGGTCCC*TGTGAACC
20110601C-001759 : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
---------+---------+---------+---------+---------+---------+ 750
THY01_0110_H09.b :
THY01_0107_F08.b :
THY01_0109_H07.b :
THY01_0122_A07.b :
THY01_0112_E10.b :
TES01_0069_G09.b : acccagttgtttgggcctggaaggaatagaattgatgttcattgggcttgacccaagggc
OVR01_0007_H10.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
TES01_0044_H02.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
THY01_0116_H06.b :
THY01_0008_A08.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
THY01_0033_H08.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
TES01_0022_F05.b : A*AGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAAGGCAA*GGG
TES01_0003_G09.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
PST01_0037_F02.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
TES01_0079_G04.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
TES01_0019_C03.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAATGGCAA*GGG
THY01_0122_D06.b :
THY01_0110_H11.b :
PST01_0091_B04.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
SKNB1_0038_B11.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
TCH01_0053_H02.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGGCA*GGG
THY01_0110_A04.b :
OVR01_0057_G03.b : ggtgtttgggcaggattaaattatttgatgtctttggcgtgaccaagggcaaggggttac
OVR01_0037_F08.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
OVR01_0029_F12.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
TES01_0042_F10.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
ADR01_0066_E03.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
THY01_0108_E06.b :
TES01_0108_D06.b : A*GGTGTTTGGGGCAGGATGAGA*TGATTGATGTCATTGG*CGTGACCCAGGGCAAGGGG
THY01_0082_F10.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
MLN01_0090_D07.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
SMG01_0094_A09.b : tgttgggccagaataaaaaaatgaatgttcttggctggaccagggcaagggttcaaaggg
THY01_0051_E01.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
THY01_0066_G09.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
OVR01_0040_H11.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
THY01_0059_F02.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
TCH01_0036_H02.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTCACCAAGGGCAA*GGG
THY01_0104_F10.b :
THY01_0106_D04.b :
TES01_0085_H10.b : A*GGTGTTTGGG*CAAGATGAGA*TGATTGATGTCTTTGG*CGTGACCAAGGGCAA*GGG
SMG01_0070_G05.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCNANGGGCA*GGG
SMG01_0079_F06.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
THY01_0035_E11.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
CLNT1_0017_G09.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
SPL01_0039_F02.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
THY01_0094_H07.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
SKNB1_0052_H09.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
ITT01_0009_A02.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
TES01_0063_H10.b : A*GGTGTTTGGG*CAGGATGAAA*AGATTGATGTCTTTGG*CCTGGACCAGGGCAA*GGG
PTG01_0036_B09.b : A*AGTGTTTGGG*CANGATGAAA*TGATTGATGTCATTGG*CGTGGACAAAGGCAA*GGG
SPLT1_0016_G07.b : A*AGTGTTTGGG*GCAGATGAGA*TGATTGATGTCATTGC*CGTGACCAAGGGCAA*GGG
OVRM1_0060_E12.b : A*GGTGTTTGGG*CAGGATGAGA*TGATCGGTGTCATTGG*CGTGACCAAGGCCAA*GGC
SPL01_0016_E03.b : A*GGTGTTTGGG*CAGGATGAGA*TGATTGATGTCATTGG*CGTGACCAAGGGCAA*GGG
PBL01_0001_C04.b : A*