[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002115

Length: 2,341

Sequence [FASTA format sequence]
CTATGCAAAT TGCAGCGATT GCGGAAATAA ACAAGCGGGT AGTGAGAGGA GAGAGGGACT
GCGAACCGAT TGCAACTTCG GCAAAGTCTC GTAGAATCCA AAGCACACAA GGCAAAACCA
GAGAGAATCT GAGAACCAGC CAGCCCGGGT TGGATCGCTT TCAAAAGAGG AGAGACAGTG
AGAGAGGCAG AGAGCGCGCA TTGCAATTGC AGAAGCCTCC TGATTTGGAG AAAAAAAAAA
AAAAATCTCC AAGAAGCCTG CAATTGGCCA ACAGCTTAAA AAAAAATCTC TTCCGGGTTT
TCAACGGTTC CAAGTTTATT AAGATATCTT TTTAATGCAA AAAAAAAAAA AAAGGGGGAC
AACAAATGAA GCAATTCGTC TGAACATTTT AAAGTTTCTC ACGTACTCTT TTTACATTGC
AATGGATGAA TTTCATCCTT TCATCGAAGC ACTTCTGCCC CACGTCCGAG CCTTCGCCTA
CACATGGTTC AACCTGCAGG CCCGAAAACG AAAATACTTC AAGAAACATG AAAAGCGTAT
GTCAAAAGAA GAAGAGAGAG CCGTGAAGGA TGAGTTGCTA AGTGAAAAAC CAGAGGTCAA
GCAGAAGTGG GCGTCCCGAC TTCTGGCCAA GTTGCGGAAA GACATCCGAC CCGAGTACCG
AGAGGATTTT GTTCTTACAG TTACAGGGAA AAAGCCGCCA TGTTGTGTTC TTTCCAACCC
AGACCAGAAA GGCAAGATGC GAAGAATTGA CTGCCTCCGC CAGGCAGACA AAGTCTGGAG
GTTGGACCTG GTTATGGTGA TTTTATTTAA AGGTATTCCG CTCGAAAGTA CTGATGGCGA
GCGCCTTGTA AAGTCCCCGC AGTGCTCTAA CCCAGGGCTC TGTGTCCAGC CCCATCACAT
AGGGGTTTCT GTTAAGGAAC TCGATTTATA TTTGGCATAC TTTGTGCATG CAGCAGATTC
AAGTCAATCT GAAAGTCCCA GCCAGCCAAG TGACGCTGAC ATTAAGGACC AGCCAGAAAA
TGGACATTTG GGCTTCCAGG ACAGTTTTGT CACATCAGGT GTTTTTAGTG TGACTGAGCT
AGTAAGAGTG TCACAGACAC CAATAGCTGC AGGAACTGGC CCCAATTTTT CTCTCTCAGA
TTTAGAAAGT TCTTCATACT ACAGCATGAG TCCGGGAGCA ATGAGGAGGT CTTTACCCAG
CACATCCTCT ACCAGCTCCA CAAAGCGCCT CAAGTCTGTG GAGGATGAAA TGGACAGTCC
TGGTGAAGAG CCATTTTACA CGGGCCAGGG CCGCTCCCCG GGGAGCGGAA GTCAGTCCAG
CGGGTGGCAC GAAGTGGAGC CAGGAATGCC ATCTCCAACC ACACTGAAGA AGTCGGAGAA
GTCTGGTTTC AGCAGCCCCT CCCCTTCGCA GACCTCCTCC CTGGGAACGG CATTCACACA
GCATCACCGA CCTGTCATTA CAGGACCCAG AGCAAGCCCA CACGCGACAC CATCGACTCT
TCATTTTCCG ACATCACCCA TCATCCAGCA GCCTGGGCCT TATTTCTCCC ACCCGGCCAT
CCGCTATCAC CCTCAGGAGA CGCTGAAAGA GTTTGTCCAA CTTGTCTGCC CTGATGCTGG
TCAGCAGGCT GGACAGGTGG GGTTCCTCAA TCCCAATGGG AGTAGCCAAG GCAAAGTGCA
CAACCCATTC CTTCCCACCC CAATGTTGCC ACCGCCGCCG CCACCACCGA TGGCCAGGCC
TGTGCCTCTG CCGGTGCCAG ACACAAAGCC TCCGACCACG TCAACAGAAG GAGGTGCAGC
CTCCCCCACC TCACCAATCC TGGTACCTGG GATAAAAGTC GCAGCGTCCC ACCATCCACC
AGACAGACCA CCTGACCCCT TCTCAACTCT GTAACATGGA CGCATCCTCA ACCCAGCGCG
GTTACAACTT CACTGTCACT GGAAGGGGAG AATCAAATCA ACTTGTACAT GGAAACAGCG
AGCATTATGG TCCAACAGCA AAGGCCATAA CCTTTTGGGA TTTTTTTTTT TTAATACTTT
AGGGACTGTT GTAATTTTCT CATATGGTGC TGGAAATGGT TGAGCTTTGT AACATTTGAA
GTGTTTCCGT GGTAGCGTGA GCATTAGGCG ATGCGGCTGG AGGAGGTCTA CCCTTGCTCA
CTGACTTCCG CTGTAACACA CTTCCCTTAC AGAGCCTGGC TGTTTCACAG TATTTCATGA
ATTTACCCAC ACAGGTGTGA GCCTCCTTGA GCAGTCAGGG GGCCCATGGA GAACTAAATC
TTTTGTAGTA GCTGAGATCT GNCATATATA ACTTACGGGA CAGTCAAAGG GCAATGTTTT
T


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFIAnuclear factor 1 A-type isoform 2 [Homo sapiens]. 7410.0O
Contig/Assembly ProteinNFIAnuclear factor 1 A-type isoform 3 [Homo sapiens]. 6900.0O
Contig/Assembly ProteinNFIAnuclear factor 1 A-type isoform 1 [Homo sapiens]. 6890.0O
Contig/Assembly ProteinNFIAnuclear factor 1 A-type isoform 4 [Homo sapiens]. 6890.0O
Contig/Assembly ProteinNFIXnuclear factor 1 X-type [Homo sapiens]. 468e-131O
Contig/Assembly ProteinNFICnuclear factor 1 C-type isoform 2 [Homo sapiens]. 429e-120O
Contig/Assembly ProteinNFICnuclear factor 1 C-type isoform 1 [Homo sapiens]. 420e-117O
Contig/Assembly ProteinNFIBnuclear factor 1 B-type isoform 1 [Homo sapiens]. 414e-115O
Contig/Assembly ProteinNFIBnuclear factor 1 B-type isoform 3 [Homo sapiens]. 409e-114O
Contig/Assembly ProteinNFIBnuclear factor 1 B-type isoform 2 [Homo sapiens]. 408e-113O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNfianuclear factor 1 A-type isoform 1 [Mus musculus]. 6870.0O
Contig/Assembly ProteinNfianuclear factor 1 A-type isoform 2 [Mus musculus]. 6860.0O
Contig/Assembly ProteinNfianuclear factor 1 A-type isoform 3 [Mus musculus]. 619e-177O
Contig/Assembly ProteinNfixnuclear factor 1 X-type isoform 3 [Mus musculus]. 478e-135O
Contig/Assembly ProteinNfixnuclear factor 1 X-type isoform 1 [Mus musculus]. 468e-131O
Contig/Assembly ProteinNfixnuclear factor 1 X-type isoform 2 [Mus musculus]. 432e-121O
Contig/Assembly ProteinNficnuclear factor 1 C-type isoform b [Mus musculus]. 418e-116O
Contig/Assembly ProteinNficnuclear factor 1 C-type isoform a [Mus musculus]. 417e-116O
Contig/Assembly ProteinNfibnuclear factor 1 B-type isoform 2 [Mus musculus]. 412e-115O
Contig/Assembly ProteinNfibnuclear factor 1 B-type isoform 1 [Mus musculus]. 412e-115O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479552PREDICTED: similar to Nuclear factor 1 A-type (Nuclear factor 1/A) (NF1-A) (NFI-A) (NF-I/A) (CCAAT-box binding transcription factor) (CTF) (TGGCA-binding protein) [Canis familiaris]. 6880.0O
Contig/Assembly ProteinLOC484920PREDICTED: similar to Nuclear factor 1 X-type (Nuclear factor 1/X) (NF1-X) (NFI-X) (NF-I/X) (CCAAT-box binding transcription factor) (CTF) (TGGCA-binding protein) isoform 1 [Canis familiaris]. 476e-134O
Contig/Assembly ProteinLOC484920PREDICTED: similar to nuclear factor I/X (CCAAT-binding transcription factor) isoform 7 [Canis familiaris]. 468e-131O
Contig/Assembly ProteinLOC484920PREDICTED: similar to nuclear factor I/X (CCAAT-binding transcription factor) isoform 6 [Canis familiaris]. 467e-131O
Contig/Assembly ProteinLOC484920PREDICTED: similar to nuclear factor I/X (CCAAT-binding transcription factor) isoform 8 [Canis familiaris]. 466e-131O
Contig/Assembly ProteinLOC484920PREDICTED: similar to nuclear factor I/X (CCAAT-binding transcription factor) isoform 3 [Canis familiaris]. 457e-128O
Contig/Assembly ProteinLOC484920PREDICTED: similar to nuclear factor I/X (CCAAT-binding transcription factor) isoform 2 [Canis familiaris]. 449e-126O
Contig/Assembly ProteinLOC484920PREDICTED: similar to nuclear factor I/X isoform 5 [Canis familiaris]. 430e-120O
Contig/Assembly ProteinLOC484920PREDICTED: similar to nuclear factor I/X isoform 4 [Canis familiaris]. 430e-120O
Contig/Assembly ProteinLOC485061PREDICTED: similar to Nuclear factor 1 C-type (Nuclear factor 1/C) (NF1-C) (NFI-C) (NF-I/C) (CCAAT-box binding transcription factor) (CTF) (TGGCA-binding protein) [Canis familiaris]. 421e-117O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFIAnuclear factor 1 A-type [Bos taurus]. 607e-173O
Contig/Assembly ProteinNFIXPREDICTED: nuclear factor I/X-like [Bos taurus]. 479e-135O
Contig/Assembly ProteinNFIXPREDICTED: nuclear factor I/X-like isoform 2 [Bos taurus]. 468e-131O
Contig/Assembly ProteinNFICnuclear factor 1 C-type [Bos taurus]. 417e-116O
Contig/Assembly ProteinNFIBnuclear factor 1 B-type [Bos taurus]. 409e-114O
Contig/Assembly ProteinLOC100337236PREDICTED: Nuclear factor 1 C-type-like [Bos taurus]. 3304e-90O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFIAPREDICTED: nuclear factor 1 A-type [Sus scrofa]. 6900.0O
Contig/Assembly ProteinNFIXPREDICTED: nuclear factor 1 X-type isoform 1 [Sus scrofa]. 478e-135O
Contig/Assembly ProteinNFIXPREDICTED: nuclear factor 1 X-type isoform 2 [Sus scrofa]. 468e-132O
Contig/Assembly ProteinNFIXPREDICTED: nuclear factor 1 X-type [Sus scrofa]. 466e-131O
Contig/Assembly ProteinLOC100623748PREDICTED: nuclear factor 1 X-type-like [Sus scrofa]. 388e-108O
Contig/Assembly ProteinLOC100620447PREDICTED: nuclear factor 1 B-type-like [Sus scrofa]. 3372e-92O
Contig/Assembly ProteinLOC100623769PREDICTED: hypothetical protein LOC100623769 [Sus scrofa]. 3327e-91O
Contig/Assembly ProteinLOC100621802PREDICTED: nuclear factor 1 A-type-like [Sus scrofa]. 2672e-71O
Contig/Assembly ProteinLOC100155995PREDICTED: nuclear factor 1 B-type isoform 1 [Sus scrofa]. 91.72e-18O


Assembly Members: 7      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010066B11ADR01_0066_B11.bDB787351 
KDN010052A09KDN01_0052_A09.bFS674577 
LVRM10185D07LVRM1_0185_D07.bCJ005863 
OVRM10040C07OVRM1_0040_C07.bBP457015 AK235003
OVRM10206D07OVRM1_0206_D07.bBP458024 
SPL010077H12SPL01_0077_H12.bCJ020001 
TCH010024E04TCH01_0024_E04.bCJ024210 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
1543C200.500WSTAC/Y
T200.500TAT/Y


Alignment:      TOP

20110601C-002115 : ..........................................................CT
---------+---------+---------+---------+---------+---------+ 2
OVRM1_0040_C07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : ATGCAAATTGCAGCGATTGCGGAAATAAACAAGCGGGTAGTGAGAGGAGAGAGGGACTGC
---------+---------+---------+---------+---------+---------+ 62
OVRM1_0040_C07.b : ATGCAAATTGCAGCGATTGCGGAAATAAACAAGCGGGTAGTGAGAGGAGAGAGGGACTGC
LVRM1_0185_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : GAACCGATTGCAACTTCGGCAAAGTCTCGTAGAATCCAAAGCACACAAGGCAAAACCAGA
---------+---------+---------+---------+---------+---------+ 122
OVRM1_0040_C07.b : GAACCGATTGCAACTTCGGCAAAGTCTCGTAGAATCCAAAGCACACAAGGCAAAACCAGA
LVRM1_0185_D07.b : xxxxxxxxxxxxxCTTCGGCAAAGTCTCGTAGAATCCAAAGCACACAAGGCAAAACCAGA
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : GAGAATCTGAGAACCAGCCAGCCCGGGTTGGATCGCTTTCAAAAGAGGAGAGACAGTGAG
---------+---------+---------+---------+---------+---------+ 182
OVRM1_0040_C07.b : GAGAATCTGAGAACCAGCCAGCCCGGGTTGGATCGCTTTCAAAAGAGGAGAGACAGTGAG
LVRM1_0185_D07.b : GAGAATCTGAGAACCAGCCAGCCCGGGTTGGATCGCTTTCAAAAGAGGAGAGACAGTGAG
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : AGAGGCAGAGAGCGCGCATTGCAATTGCAGAAGCCTCCTGATTTGGAGAAAAAAAAAAAA
---------+---------+---------+---------+---------+---------+ 242
OVRM1_0040_C07.b : AGAGGCAGAGAGCGCGCATTGCAATTGCAGAAGCCTCCTGATTTGGAGAAAAAAAAAAAA
LVRM1_0185_D07.b : AGAGGCAGAGAGCGCGCATTGCAATTGCAGAAGCCTCCTGATTTGGAGAAAAAAAAAAAA
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : AAA*TCTCCAAGAAGCCTGCAATTGGCCAACAGCTTAAAAAAAAATCTCTTCCGGGTTTT
---------+---------+---------+---------+---------+---------+ 301
OVRM1_0040_C07.b : AAA*TCTCCAAGAAGCCTGCAATTGGCCAACAGCTTAAAAAAAAATCTCTTCCGGGTTTT
LVRM1_0185_D07.b : AAAATCTCCAAGAAGCCTGCAATTGGCCAACAGCTTAAAAAAAAATCTCTTCCGGGTTTT
OVRM1_0206_D07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : CAACGGTTCCAAGTTTATTAAGATATCTTTTTAATGCAAAAAAAAAAAAAAAGGGGGACA
---------+---------+---------+---------+---------+---------+ 361
OVRM1_0040_C07.b : CAACGGTTCCAAGTTTATTAAGATATCTTTTTAATGCAAAAAAAAAAAAAAAGGGGGACA
LVRM1_0185_D07.b : CAACGGTTCCAAGTCTATTAAGATATCTTTTTAATGCAAAAAAAAAAAAAAAGGGGGACA
OVRM1_0206_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxtCTTTTTAATGC*AAAAAAAAAAAAAAGGGGGACA
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : ACAAATGAAGCAATTCGTCTGAACATTTTAAAGTTTCTCACGTACTCTTTTTACATTGCA
---------+---------+---------+---------+---------+---------+ 421
OVRM1_0040_C07.b : ACAAATGAAGCAATTCGTCTGAACATTTTAAAGTTTCTCACGTACTCTTTTTACATTGCA
LVRM1_0185_D07.b : ACAAATGAAGCAATTCGTCTGAACATTTTAAAGTTTCTCACGTACTCTTTTTACATTGCA
OVRM1_0206_D07.b : ACAAATGAAGCAATTCGTCTGAACATTTTAAAGTTTCTCACGTACTCTTTTTACATTGCA
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : ATGGATGAATTTCATCCTTTCATCGAAGCACTTCTGCCCCACGTCCGAGCCTTCGCCTAC
---------+---------+---------+---------+---------+---------+ 481
OVRM1_0040_C07.b : ATGGATGAATTTCATCCTTTCATCGAAGCACTTCTGCCCCACGTCCGAGCCTTCGCCTAC
LVRM1_0185_D07.b : ATGGATGAATTTCATCCTTTCATCGAAGCACTTCTGCCCCACGTCCGAGCCTTCGCCTAC
OVRM1_0206_D07.b : ATGGATGAATTTCATCCTTTCATCGAAGCACTTCTGCCCCACGTCCGAGCCTTCGCCTAC
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : ACATGGTTCAACCTGCAGGCCCGAAAACGAAAATACTTCAAGAAACATGAAAAGCGTATG
---------+---------+---------+---------+---------+---------+ 541
OVRM1_0040_C07.b : ACATGGTTCAACCTGCAGGCCCGAAAACGAAAATACTTCAAGAAACATGAAAAGCGTATG
LVRM1_0185_D07.b : ACATGGTTCAACCTGCAGGCCCGAAAACGAAAATACTTCAAGAAACATGAAAAGCGTATG
OVRM1_0206_D07.b : ACATGGTTCAACCTGCAGGCCCGAAAACGAAAATACTTCAAGAAACATGAAAAGCGTATG
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : TCAAAAGAAGAAGAGAGAGCCGTGAAGGATGAGTTGCTAAGTGAAAAACCAGAGGTCAAG
---------+---------+---------+---------+---------+---------+ 601
OVRM1_0040_C07.b : TCAAAAGAAGAAGAGAGAGCCGTGAAGGATGAGTTGCTAAGTGAAAAACCAGAGGTCAAG
LVRM1_0185_D07.b : TCAAAAGAAGAAGAGAGAGCCGTGAAGGATGAGTTGCTAAGTGAAAAACCAGAGGTCAAG
OVRM1_0206_D07.b : TCAAAAGAAGAAGAGAGAGCCGTGAAGGATGAGTTGCTAAGTGAAAAACCAGAGGTCAAG
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : CAGAAGTGGGCGTCCCGACTTCTGGCCAAGTTGCGGAAAGACATCCGACCCGAGTACCGA
---------+---------+---------+---------+---------+---------+ 661
OVRM1_0040_C07.b : CAGAAGTGGGCGTCCCGACTTCTGGCCAAGTTGCGGAAAGACATCCGACCCGAGTACCGA
LVRM1_0185_D07.b : CAGAAGTGGGCGTCCCGACTTCTGGCCAAGTTGCGGAAAGACATCCGACCCGAGTACCGA
OVRM1_0206_D07.b : CAGAAGTGGGCGTCCCGACTTCTGGCCAAGTTGCGGAAAGACATCCGACCCGAGTACCGA
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : GAGGATTTTGTTCTTACAGTTACAGGGAAAAAGCCGCCATGTTGTGTTCTTTCCAACCCA
---------+---------+---------+---------+---------+---------+ 721
OVRM1_0040_C07.b : GAGGATTTTGGTTCTACAGTTACAGGGAAAAAGCCGCCATGTTGTGTTCTTTCCAACCCA
LVRM1_0185_D07.b : GAGGATTTTGTTCTTACAGTTACAGGGAAAAAGCCGCCATGTTGTGTTCTTTCCAACCCA
OVRM1_0206_D07.b : GAGGATTTTGTTCTTACAGTTACAGGGAAAAAGCCGCCATGTTGTGTTCTTTCCAACCCA
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : GACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAGACAAAGTCTGGAGG
---------+---------+---------+---------+---------+---------+ 781
OVRM1_0040_C07.b : GACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAtac
LVRM1_0185_D07.b : GACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAGACAAAGTCTGGAGG
OVRM1_0206_D07.b : GACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAGACAAAGTCTGGAGG
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : TTGGACCTGGTTATGGTGATTTTATTTAAAGGTATTCCGCTCGAAAGTACTGATGGCGAG
---------+---------+---------+---------+---------+---------+ 841
OVRM1_0040_C07.b :
LVRM1_0185_D07.b : TTGGACCTGGTTATGGTGANTTTATTTAAgg
OVRM1_0206_D07.b : TTGGACCTGGTTATGGTGATTTTATTTAAAGGTATTCCGCTCGAAAGTACTGATGGCGAG
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : CGCCTTGTAAAGTCCCCGCAGTGCTCTAACCCAGGGCTCTGTGTCCAGCCCCATCACATA
---------+---------+---------+---------+---------+---------+ 901
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b : CGCCTTGTAAAGTCCCCGCAGTGCTCTAACCCAGGGCTCTGTGTCCAGCCCCATCACATA
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : GGGGTTTCTGTTAAGGAACTCGATTTATATTTGGCATACTTTGTGCATGCAGCAGATTCA
---------+---------+---------+---------+---------+---------+ 961
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b : GGGGTTTCTGTTAAGGAACTCGATTTATATTTGGCATACTTTGTGCATGCAGCAGATTCA
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : AGTCAATCTGAAAGTCCCAGCCAGCCAAGTGACGCTGACATTAAGGACCAGCCAGAAAAT
---------+---------+---------+---------+---------+---------+ 1021
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b : AGTCAATCTGAAAGTCCCAGCCAGCCAAGTGACGCTGACATTAAGGACCAGCCAGAAAAT
KDN01_0052_A09.b : cccttatagctgacTTAAGGACCAGCCAGAAAAT
SPL01_0077_H12.b : ntgggct
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : GGACATTTGGGCTTCCAGGACAGTTTTGTCACATCAGGTGTTTTTAGTGTGACTGAGCTA
---------+---------+---------+---------+---------+---------+ 1081
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b : GGACATTTGGGCTTCCAGGACAGTTTTGTCACATCAGGTGTTTTTAGTGTGACTGAGCTA
KDN01_0052_A09.b : GGACATTTGGGCTTCCAGGACAGTTTTGTCACATCAGGTGTTTTTAGTGTGACTGAGCTA
SPL01_0077_H12.b : tggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0066_B11.b :
TCH01_0024_E04.b :
20110601C-002115 : GTAAGAGTGTCACAGACACCAATAGCTGCAGGAACTGGCCCCAATTTTTCTCTCTCAGAT
---------+---------+---------+---------+---------+---------+ 1141
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b : GTAAGAGTGTCc
KDN01_0052_A09.b : GTAAGAGTGTCACAGACACCAATAGCTGCAGGAACTGGCCCCAATTTTTCTCTCTCAGAT
SPL01_0077_H12.b : xxxxxxxxxxxxCAGACACCAATAGCTGCAGGAACTGGCCCCAATTTTTCTCTCTCAGAT
ADR01_0066_B11.b : nnnnnnggatacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0024_E04.b :
20110601C-002115 : TTAGAAAGTTCTTCATACTACAGCATGAGTCCGGGAGCAATGAGGAGGTCTTTACCCAGC
---------+---------+---------+---------+---------+---------+ 1201
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : TTAGAAAGTTCTTCATACTACAGCATGAGTCCGGGAGCAATGAGGAGGTCTTTACCCAGC
SPL01_0077_H12.b : TTAGAAAGTTCTTCATACTACAGCATGAGTCCGGGAGCAATGAGGAGGTCTTTACCCAGC
ADR01_0066_B11.b : xxxxxxxxxxxxTCATACTACAGCATGAGTCCGGGAGCAATGAGGAGGTCTTTACCCAGC
TCH01_0024_E04.b :
20110601C-002115 : ACATCCTCTACCAGCTCCACAAAGCGCCTCAAGTCTGTGGAGGATGAAATGGACAGTCCT
---------+---------+---------+---------+---------+---------+ 1261
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : ACATCCTCTACCAGCTCCACAAAGCGCCTCAAGTCTGTGGAGGATGAAATGGACAGTCCT
SPL01_0077_H12.b : ACATCCTCTACCAGCTCCACAAAGCGCCTCAAGTCTGTGGAGGATGAAATGGACAGTCCT
ADR01_0066_B11.b : ACATCCTCTACCAGCTCCACAAAGCGCCTCAAGTCTGTGGAGGATGAAATGGACAGTCCT
TCH01_0024_E04.b :
20110601C-002115 : GGTGAAGAGCCATTTTACACGGGCCAGGGCCGCTCCCCGGGGAGCGGAAGTCAGTCCAGC
---------+---------+---------+---------+---------+---------+ 1321
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : GGTGAAGAGCCATTTTACACGGGCCAGGGCCGCTCCCCGGGGAGCGGAAGTCAGTCCAGC
SPL01_0077_H12.b : GGTGAAGAGCCATTTTACACGGGCCAGGGCCGCTCCCCGGGGAGCGGAAGTCAGTCCAGC
ADR01_0066_B11.b : GGTGAAGAGCCATTTTACACGGGCCAGGGCCGCTCCCCGGGGAGCGGAAGTCAGTCCAGC
TCH01_0024_E04.b :
20110601C-002115 : GGGTGGCACGAAGTGGAGCCAGGAATGCCATCTCCAACCACACTGAAGAAGTCGGAGAAG
---------+---------+---------+---------+---------+---------+ 1381
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : GGGTGGCACGAAGTGGAGCCAGGAATGCCATCTCCAACCACACTGAAGAAGTCGGAGAAG
SPL01_0077_H12.b : GGGTGGCACGAAGTGGAGCCAGGAATGCCATCTCCAACCACACTGAAGAAGTCGGAGAAG
ADR01_0066_B11.b : GGGTGGCACGAAGTGGAGCCAGGAATGCCATCTCCAACCACACTGAAGAAGTCGGAGAAG
TCH01_0024_E04.b : nnnggctaggactatnacxxxx
20110601C-002115 : TCTGGTTTCAGCAGCCCCTCCCCTTCGCAGACCTCCTCCCTGGGAACGGCATTCACACAG
---------+---------+---------+---------+---------+---------+ 1441
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : TCTGGTTTCAGCAGCCCCTCCCCTTCGCAGACCTCCTCCCTGGGAACGGCATTCACACAG
SPL01_0077_H12.b : TCTGGTTTCAGCAGCCCCTCCCCTTCGCAGACCTCCTCCCTGGGAACGGCATTCACACAG
ADR01_0066_B11.b : TCTGGTTTCAGCAGCCCCTCCCCTTCGCAGACCTCCTCCCTGGGAACGGCATTCACACAG
TCH01_0024_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctG
20110601C-002115 : CATCACCGACCTGTCATTACAGGACCCAGAGCAAGCCCACACGCGACACCATCGACTCTT
---------+---------+---------+---------+---------+---------+ 1501
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : CATCACCGACCTGTCATTACAGGACCCAGAGCAAGCCCACACGCGACACCATCGACTCTT
SPL01_0077_H12.b : CATCACCGACCTGTCATTACAGGACCCAGAGCAAGCCCACACGCGACACCATCGACTCTT
ADR01_0066_B11.b : CATCACCGACCTGTCATTACAGGACCCAGAGCAAGCCCACACGCGACACCATCGACTCTT
TCH01_0024_E04.b : CATCACCGACCTGTCATTACAGGACCCAGAGCAAGCCCACACGCGACACCATCGACTCTT
20110601C-002115 : CATTTTCCGACATCACCCATCATCCAGCAGCCTGGGCCTTATTTCTCCCACCCGGCCATC
---------+---------+---------+---------+---------+---------+ 1561
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : CATTTTCCGACATCACCCATCATCCAGCAGCCTGGGCCTTATTTCTCCCACCCGGCCATC
SPL01_0077_H12.b : CATTTTCCGACATCACCCATCATCCAGCAGCCTGGGCCTTATTTCTCCCACCCGGCCATC
ADR01_0066_B11.b : CATTTTCCGACATCACCCATCATCCAGCAGCCTGGGCCTTACTTCTCCCACCCGGCCATC
TCH01_0024_E04.b : CATTTTCCGACATCACCCATCATCCAGCAGCCTGGGCCTTACTTCTCCCACCCGGCCATC
20110601C-002115 : CGCTATCACCCTCAGGAGACGCTGAAAGAGTTTGTCCAACTTGTCTGCCCTGATGCTGGT
---------+---------+---------+---------+---------+---------+ 1621
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : CGCTATCACCCTCAGGAGACGCTGAAAGAGTTTGTCCAACTTGTCTGCCCTGATGCTGGT
SPL01_0077_H12.b : CGCTATCACCCTCAGGAGACGCTGAAAGAGTTTGTCCAACTTGTCTGCCCTGATGCTGGT
ADR01_0066_B11.b : CGCTATCACCCTCAGGAGACGCTGAAAGAGTTTGTCCAACTTGTCTGCCCTGATGCTGGT
TCH01_0024_E04.b : CGCTATCACCCTCAGGAGACGCTGAAAGAGTTTGTCCAACTTGTCTGCCCTGATGCTGGT
20110601C-002115 : CAGCAGGCTGGACAGGTGGGGTTCCTCAATCCCAATGGGAGTAGCCAAGGCAAAGTGCAC
---------+---------+---------+---------+---------+---------+ 1681
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : CAGCAGGCTGGACAGGTGGGGTTCCTCAATCCCAATGGGAGTAGCCAAGGCAAAGTGCAC
SPL01_0077_H12.b : CAGCAGGCTGGACAGGTGGGGTTCCTCAATCCCAATGGGAGTAGCCAAGGCAAAGTGCAC
ADR01_0066_B11.b : CAGCAGGCTGGACAGGTGGGGTTCCTCAATCCCAATGGGAGTAGCCAAGGCAAAGTGCAC
TCH01_0024_E04.b : CAGCAGGCTGGACAGGTGGGGTTCCTCAATCCCAATGGGAGTAGCCAAGGCAAAGTGCAC
20110601C-002115 : AACCCATTCCTTCCCACCCCAATGTTGCCACCGCCGCCGCCACCACCGATGGCCAGGCCT
---------+---------+---------+---------+---------+---------+ 1741
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : AACCCATTCCTTCCCACCCCAATGTTGCCACCGCCGCCGCCACCACCGATGGCCAGGCCT
SPL01_0077_H12.b : AACCCATTCCTTCCCACCCCAATGTTGCCACCGCCGCCGCCACCACCGATGGCCAGGCCT
ADR01_0066_B11.b : AACCCATTCCTTCCCACCCCAATGTTGCCACCGCCGCCGCCACCACCGATGGCCGGGCCT
TCH01_0024_E04.b : AACCCATTCCTTCCCACCCCAATGTTGCCACCGCCGCCGCCACCACCGATGGCCAGGCCT
20110601C-002115 : GTGCCTCTGCCGGTGCCAGACACAAAGCCTCCGACCACGTCAACAGAAGGAGGTGCAGCC
---------+---------+---------+---------+---------+---------+ 1801
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : GTGCCTCTGCCGGTTGCAGACACAAAGCCTCCGACCACGTCAACAGAAGGAGGTGCAGCC
SPL01_0077_H12.b : GTGCCTCTGCCGGTGCCAGACACAAAGCCTCCGACCACGTCAACAGAAGGAGGTGCAGCC
ADR01_0066_B11.b : GTGCCTCTGCCGGTGCCAGACACAAAGCCTCCGACCACGTCAACAGAAGGAGGTGCAGCC
TCH01_0024_E04.b : GTGCCTCTGCCGGTGCCAGACACAAAGCCTCCGACCACGTCAACAGAAGGAGGTGCAGCC
20110601C-002115 : TCCCCCACCTCACCAATCCTGGTACCTGGGATAAAAGTCGCAGCGTCCCACCATCCACCA
---------+---------+---------+---------+---------+---------+ 1861
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : TCCCCCACCTTCACAATCCTGGTACCTGGGAAAAAAGTCGCAGCGTCCCACCCTCCACCA
SPL01_0077_H12.b : TCCCCCACCTCACCAATCCTGGTACCTGGGATAAAAGTCGCAGCGTCCCACCATCCACCA
ADR01_0066_B11.b : TCCCCCACCTCACCAATCCTGGTACCTGGGATAAAAGTCGCAGCGTCCCACCATCCACCA
TCH01_0024_E04.b : TCCCCCACCTCACCAATCCTGGTACCTGGGATAAAAGTCGCAGCGTCCCACCATCCACCA
20110601C-002115 : GACAGACCACCTGACCCCTTCTCAACTCTGTAACATGGACGCATCCTCAACCCAGCGCGG
---------+---------+---------+---------+---------+---------+ 1921
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : ACAAAACCAC*TGACCCCTTCCTCACTCTGTAACATGAACGCATCCTCAACCCACCGCGG
SPL01_0077_H12.b : GACAGACCACCTGACCCCTTCTCAACTCTGTAACATGGACGCATCCTCAACCCAGCGCGG
ADR01_0066_B11.b : GACAGACCACCTGACCCCTTCTNCACTCTGTAACATGGACGCATCCTCAACCCAGCGCGG
TCH01_0024_E04.b : GACAGACCACCTGACCCCTTCTCAACTCTGTAACATGGACGCATCCTCAACCCAGCGCGG
20110601C-002115 : TTACAACTTCACTGTCACTGGAAGGGGAGAATCAAATCAACTTGTACATGGAAACAGCGA
---------+---------+---------+---------+---------+---------+ 1981
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : TTACAACTTACCTGTTCCTGGAAGGGGgaatccattcagcttgtactggaaaacagggag
SPL01_0077_H12.b : TTACAACTTCACTGTCACTGGAAGGGGAGAATCAAATCAACTTGTACATGAAAACAGCGA
ADR01_0066_B11.b : TTACAACTTCACTGTCACTGGAAGGGGAGAATCAAATCAACTTGTACATGGAAACAGCGA
TCH01_0024_E04.b : TTACAACTTCACTGTCACTGGAAGGGGAGAATCAAATCAACTTGTACATGGAAACAGCGA
20110601C-002115 : GCATTATGGTCCAA*CAGCAAAGGCCATAACCTTTTGGGATTTTTTTTTTTTAATACTTT
---------+---------+---------+---------+---------+---------+ 2040
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : cattatgggccacacacaaaggccataactttttgggattttttttttttaaaactttgg
SPL01_0077_H12.b : GCATTTATGTCCAAACGGCAAAGGCCATAACCCTTTGGGGATTTTTTTTTTTTaatactt
ADR01_0066_B11.b : GCATTATGGTCCCA*CAGCAAAGGCCATAACCTTTTGGGATTTTTTTTTTTTTtaatact
TCH01_0024_E04.b : GCATTATGGTCCAA*CAGCAAAGGCCATAACCTTTTGGGATTTTTTTTTTTTAATACTTT
20110601C-002115 : AGGGACTGTTGTAATTTTCTCATATGGTGCTGGAAATGGTTGAGCTTTGTAACATTTGAA
---------+---------+---------+---------+---------+---------+ 2100
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : ggacggtggaattttctcaaagggggcggggaagggttgggccttgtaacattttaaagg
SPL01_0077_H12.b : taggggactgttggaaattttccccaaatgggggctgggaaagggttgggcctttttaac
ADR01_0066_B11.b : ttagggactggntgtattttctcatatggtgctggggaatggtgggncttggtacatttg
TCH01_0024_E04.b : AGGGACTGTTGTAATTTTCTCATATGGTGCTGGAAATGGTTGAGCTTTGTAACATTTGAA
20110601C-002115 : GTGTTTCCGTGGTAGCGTGAGCATTAGGCGATGCGGCTGGAGGAGGTCTACCCTTGCTCA
---------+---------+---------+---------+---------+---------+ 2160
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : gtctctgggaaccgggaacttagcagaacgcggggaaagatccccttgctcaggaattcc
SPL01_0077_H12.b : atttta
ADR01_0066_B11.b : aagtgtttccgtggtagcgtgagcattangcgatgcagctggaggaggtctacccttgct
TCH01_0024_E04.b : GTGTTTCCGTGGTAGCGTGAGCATTAGGCGATGCGGCTGGAGGAGGTCTACCCTTGCTCA
20110601C-002115 : CTGACTTCCGCTGTAACACACTTCCCTTACAGAGCCTGGCTGTTTCACAGTATTTCATGA
---------+---------+---------+---------+---------+---------+ 2220
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : cgtgaaaacttcccttaagaacctgggtgttcctattttcggaattaccccccgggtggg
SPL01_0077_H12.b :
ADR01_0066_B11.b : cactgacttccgctgaacccacctcccttaacgagcctggctgttccacgtattttctga
TCH01_0024_E04.b : CTGACTTCCGCTGTAACACACTTCCCTTACAGAGCCTGGCTGTTTCACAGTATTTCATGA
20110601C-002115 : ATTTACCCACACAGGTGTGAGCCTCCTTGAGCAGTCAGGGGGCCCATGGAGAACTAAATC
---------+---------+---------+---------+---------+---------+ 2280
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : accctcttaaaattgggggcgggagaacatatttttggtagagagatctccatatataat
SPL01_0077_H12.b :
ADR01_0066_B11.b : tttccccacccggggggacctccctgaccatccaggggcccctggaaactaatcttttgg
TCH01_0024_E04.b : ATTTACCCACACAGGTGTGAGCCTCCTTGAGCAGTCAGGGGGCCCATGGAGAACTAAATC
20110601C-002115 : TTTTGTAGTAGCTGAGATCTGNCATATATAACTTACGGGACAGTCAAAGGGCAATGTTTT
---------+---------+---------+---------+---------+---------+ 2340
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b : gcgggaccaaggatgtgtttgtataattgaaa
SPL01_0077_H12.b :
ADR01_0066_B11.b : gggaccgaaatctcgcaaaaaacttacgggccgccaaggggaggttttctgtacatttgg
TCH01_0024_E04.b : TTTTGTAGTAGCTGAGATCTGNCATATATAACTTACGGGACAGTCAAAGGGCAATGTTTT
20110601C-002115 : T...........................................................
---------+---------+---------+---------+---------+---------+ 2341
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b : aacaaaaaggcgntaaccccccctatattttcttaaatggggtggcccccccccccttaa
TCH01_0024_E04.b : Ttctgtacatattggacaaagaaatgcagttaagtccctctctattttttcttttattgg
20110601C-002115 : ............................................................
---------+---------+---------+---------+---------+---------+ 2341
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b : attaaaggggcccgggagaggaacccc
TCH01_0024_E04.b : gnttgggtcagcaatcagcagttaaatatataacatgggccgcagggacgtgaatccact
20110601C-002115 : ............................................................
---------+---------+---------+---------+---------+---------+ 2341
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b : cacgtgcaaaacattccgaaaatgacaactactactacaccattcagttttaaaattttg
20110601C-002115 : ............................................................
---------+---------+---------+---------+---------+---------+ 2341
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b : aatgctgccttacttttaaaaaaaaaaaaaaaaggccaatgggcccacctgcagtccggc
20110601C-002115 : ............................................................
---------+---------+---------+---------+---------+---------+ 2341
OVRM1_0040_C07.b :
LVRM1_0185_D07.b :
OVRM1_0206_D07.b :
KDN01_0052_A09.b :
SPL01_0077_H12.b :
ADR01_0066_B11.b :
TCH01_0024_E04.b : ccc