[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002243

Length: 1,054

Sequence [FASTA format sequence]
GGGGCTGGCG GTGGGGAGGC TGGAGCGCAG GGCGGCGGCG CAGTGTGCAG AATGGCGTAC
CCCGGGCATC CTGGCGCCGG CGGCGGCGGC TACTACCCAG GCGGGTATGG AGGGGCTCCC
GGAGGACCTG CGTTTCCCGC ACAAACTCAG GATCCGCTCT ATGGTTATTT TGCTGCTGTA
GCTGGACAGG ATGGGCAGAT AGATGCTGAT GAATTGCAGA GATGCCTGAC CCAGTCAGGC
ATTGCTGGAG GATACAAACC TTTTAACCTG GAGACCTGCC GGCTTATGGT TTCAATGCTG
GATAGAGATA TGTCCGGCAC AATGGGTTTC AATGAATTCA AAGAACTCTG GGCTGTGCTG
AATGGCTGGA GGCAGCACTT TATCAGTTTT GACAGCGACA GGAGTGGGAC AGTGGATCCT
CAAGAACTGC AGAAGGCCCT GACCACAATG GGATTTAGAT TGAGTCCCCA GGCCGTGAAT
TCAATTGCAA AACGATACAG CACCAATGGC AAGATCACCT TTGATGATTA CATCGCCTGC
TGTGTCAAGC TGCGTGCTCT TACAGACAGC TTTCGAAGAC GGGATACTGC TCAGCAAGGT
GTTGTGAATT TCCCATATGA TGATTTCATT CAGTGCGTCA TGAGTGTTTA AATCCAGAGG
AAGCTGAATG AACATAATCA ACATTCCAAC TGGAACTCCT CTTTGCTCTT CGCCTTCAGC
AGTCGTGTGC AGACTTACAC AGCCACTTTT CCTTAACAGT TGTAATGGTT TATTGCTTTA
TGTACATCTC AAATTTTTAG TTTTGATAAT AAATTCTTTG GAATGCTATT AAGATAAGAT
CTGTCCTATT TCACCCTTTA GAACTTCCTT GAGCCATTGT TAATCATGCC TTATTTTCTT
GCTAAGCTTC TTTTATGTAA ATTTAAGTGC GCAAATTGTC TAAGGCACAG TATGTATTTT
TTCATTGTAA GATACTAAAA CCTTTTCATC ACAAAAAAAA AAAAAAAAAA ACCCTCTTTT
ACAAGGGCTT TTACGTGGTT TTGAAAGCTT TTTG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSRIsorcin isoform b [Homo sapiens]. 3523e-97O
Contig/Assembly ProteinSRIsorcin isoform a [Homo sapiens]. 3523e-97O
Contig/Assembly ProteinGCAgrancalcin [Homo sapiens]. 2389e-63
Contig/Assembly ProteinPEF1peflin [Homo sapiens]. 1124e-25
Contig/Assembly ProteinPDCD6programmed cell death protein 6 [Homo sapiens]. 1111e-24O
Contig/Assembly ProteinCAPNS1calpain small subunit 1 [Homo sapiens]. 1032e-22
Contig/Assembly ProteinCAPNS1calpain small subunit 1 [Homo sapiens]. 1032e-22
Contig/Assembly ProteinCAPN3calpain-3 isoform d [Homo sapiens]. 99.45e-21
Contig/Assembly ProteinCAPN3calpain-3 isoform a [Homo sapiens]. 99.45e-21
Contig/Assembly ProteinCAPN3calpain-3 isoform b [Homo sapiens]. 99.45e-21


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSrisorcin isoform 2 [Mus musculus]. 3422e-94O
Contig/Assembly ProteinSrisorcin isoform 1 [Mus musculus]. 3422e-94O
Contig/Assembly ProteinGcagrancalcin [Mus musculus]. 2441e-64
Contig/Assembly ProteinPef1peflin [Mus musculus]. 1154e-26
Contig/Assembly ProteinPdcd6programmed cell death protein 6 [Mus musculus]. 1125e-25O
Contig/Assembly ProteinCapns1calpain small subunit 1 [Mus musculus]. 99.83e-21
Contig/Assembly ProteinCapn3calpain-3 isoform b [Mus musculus]. 996e-21
Contig/Assembly ProteinCapn3calpain-3 isoform c [Mus musculus]. 996e-21
Contig/Assembly ProteinCapn3calpain-3 isoform a [Mus musculus]. 996e-21
Contig/Assembly ProteinCapns2calpain small subunit 2 [Mus musculus]. 98.67e-21


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475220PREDICTED: similar to Sorcin (22 kDa protein) (CP-22) (V19) [Canis familiaris]. 3531e-97O
Contig/Assembly ProteinLOC608208PREDICTED: similar to grancalcin [Canis familiaris]. 2489e-66
Contig/Assembly ProteinLOC609549PREDICTED: similar to Programmed cell death protein 6 (Probable calcium-binding protein ALG-2) (PMP41) (ALG-257) [Canis familiaris]. 1126e-25O
Contig/Assembly ProteinLOC611746PREDICTED: similar to Calpain small subunit 1 (CSS1) (Calcium-dependent protease small subunit 1) (Calcium-dependent protease small subunit) (CDPS) (Calpain regulatory subunit) (Calcium-activated neutral proteinase small subunit) (CANP small subunit)... isoform 1 [Canis familiaris]. 1026e-22
Contig/Assembly ProteinLOC611885PREDICTED: similar to penta-EF hand domain containing 1 [Canis familiaris]. 1003e-21
Contig/Assembly ProteinLOC487518PREDICTED: similar to calpain 3 isoform c isoform 19 [Canis familiaris]. 99.84e-21
Contig/Assembly ProteinLOC487273PREDICTED: similar to calpain small subunit 2 [Canis familiaris]. 99.84e-21
Contig/Assembly ProteinLOC487518PREDICTED: similar to Calpain-3 (Calpain L3) (Calpain p94) (Calcium-activated neutral proteinase 3) (CANP 3) (Muscle-specific calcium-activated neutral protease 3) isoform 17 [Canis familiaris]. 97.42e-20
Contig/Assembly ProteinLOC487518PREDICTED: similar to Calpain-3 (Calpain L3) (Calpain p94) (Calcium-activated neutral proteinase 3) (CANP 3) (Muscle-specific calcium-activated neutral protease 3) isoform 20 [Canis familiaris]. 97.42e-20
Contig/Assembly ProteinLOC487518PREDICTED: similar to Calpain-3 (Calpain L3) (Calpain p94) (Calcium-activated neutral proteinase 3) (CANP 3) (Muscle-specific calcium-activated neutral protease 3) isoform 18 [Canis familiaris]. 97.42e-20


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSRIsorcin [Bos taurus]. 3531e-97O
Contig/Assembly ProteinGCAPREDICTED: grancalcin, EF-hand calcium binding protein [Bos taurus]. 1923e-49
Contig/Assembly ProteinGCAPREDICTED: grancalcin, EF-hand calcium binding protein [Bos taurus]. 1923e-49
Contig/Assembly ProteinPDCD6programmed cell death 6 [Bos taurus]. 1125e-25O
Contig/Assembly ProteinPEF1peflin [Bos taurus]. 1125e-25
Contig/Assembly ProteinCAPNS1calpain small subunit 1 [Bos taurus]. 1059e-23
Contig/Assembly ProteinLOC100300424PREDICTED: calpain small subunit 2-like [Bos taurus]. 98.68e-21
Contig/Assembly ProteinCAPN3calpain-3 [Bos taurus]. 97.42e-20
Contig/Assembly ProteinCAPN2calpain-2 catalytic subunit precursor [Bos taurus]. 93.23e-19
Contig/Assembly ProteinCAPN1calpain-1 catalytic subunit [Bos taurus]. 93.23e-19


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100514123PREDICTED: sorcin-like isoform 2 [Sus scrofa]. 3552e-98O
Contig/Assembly ProteinLOC100514123PREDICTED: sorcin-like isoform 1 [Sus scrofa]. 3552e-98O
Contig/Assembly ProteinLOC100520792PREDICTED: peflin-like isoform 1 [Sus scrofa]. 1101e-24
Contig/Assembly ProteinLOC100520792PREDICTED: peflin-like isoform 2 [Sus scrofa]. 1101e-24O
Contig/Assembly ProteinCAPNS1calpain small subunit 1 [Sus scrofa]. 1018e-22
Contig/Assembly ProteinLOC100518072PREDICTED: calpain small subunit 2-like [Sus scrofa]. 1001e-21
Contig/Assembly ProteinCAPN3calpain-3 [Sus scrofa]. 99.43e-21
Contig/Assembly ProteinCAPN9PREDICTED: calpain-9 isoform 1 [Sus scrofa]. 941e-19
Contig/Assembly ProteinLOC100620798PREDICTED: programmed cell death protein 6-like [Sus scrofa]. 941e-19O
Contig/Assembly ProteinCAPN9PREDICTED: calpain-9 isoform 2 [Sus scrofa]. 941e-19


Assembly Members: 57      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010051E04AMP01_0051_E04.bBW958622 
BFLT10032F01BFLT1_0032_F01.bFS642636 
BFLT10100A02BFLT1_0100_A02.bFS647947 
BKFL10056F08BKFL1_0056_F08.bFS652270 
CBLT10025B02CBLT1_0025_B02.bHX213570 
CLNT10089D12CLNT1_0089_D12.bFS663482 
HTMT10083F10HTMT1_0083_F10.bFS670072 AK392529
HTMT10143F03HTMT1_0143_F03.bHX226093 
HTMT10152B07HTMT1_0152_B07.bHX226685 
ILNT10065F07ILNT1_0065_F07.bHX231933 
ITT010025H07ITT01_0025_H07.bBW978302 
ITT010040A02ITT01_0040_A02.bBW979563 
ITT010067E02ITT01_0067_E02.bBW981968 
ITT010091A07ITT01_0091_A07.bBW984049 
KDN010017D07KDN01_0017_D07.bFS672475 
KDN010019H10KDN01_0019_H10.bFS672658 
KDN010072C11KDN01_0072_C11.bFS676156 
LNG010021G11LNG01_0021_G11.bBP439794 AK231770
LVR010008G07LVR01_0008_G07.bBP446767 
LVRM10033D01LVRM1_0033_D01.bCJ001239 
LVRM10114B11LVRM1_0114_B11.bBP449623 
MLN010015C09MLN01_0015_C09.bCJ008867 
MLN010019C03MLN01_0019_C03.bCJ009049 
MLN010033A09MLN01_0033_A09.bCJ010180 
MLN010041A09MLN01_0041_A09.bCJ010840 
MLN010047H08MLN01_0047_H08.bCJ011313 
MLN010055E05MLN01_0055_E05.bCJ011971 
MLN010071G09MLN01_0071_G09.bCJ013322 
MLN010080D03MLN01_0080_D03.bCJ014002 
OVR010001E04OVR01_0001_E04.bBP143145 
OVRM10118B05OVRM1_0118_B05.bBP146638 
OVRM10122B12OVRM1_0122_B12.bBP147393 
OVRT10026H06OVRT1_0026_H06.bFS688576 
OVRT10046E06OVRT1_0046_E06.bFS690159 
OVRT10094A05OVRT1_0094_A05.bFS694034 
OVRT10100B08OVRT1_0100_B08.bFS694553 
OVRT10124H04OVRT1_0124_H04.b  AK400684
OVRT10130F04OVRT1_0130_F04.bHX237235 
PBL010047F06PBL01_0047_F06.bBW970872 
PBL010061B02PBL01_0061_B02.bBW971657 
PST010014A04PST01_0014_A04.bFS698058 
PST010045H10PST01_0045_H10.bFS700413 
PST010066A08PST01_0066_A08.bFS702020 
PST010094D09PST01_0094_D09.bFS704274 
PTG010024D06PTG01_0024_D06.bFS706511 
PTG010058C03PTG01_0058_C03.bFS709486 
SMG010015C01SMG01_0015_C01.bFS714540 
SPL010031H01SPL01_0031_H01.bCJ016464 
UTR010018G05UTR01_0018_G05.bBP172750 
UTR010022B04UTR01_0022_B04.bBP170035 
UTR010032A05UTR01_0032_A05.bBP169557 
UTR010038F05UTR01_0038_F05.bBP172237 
UTR010043B05UTR01_0043_B05.bBP170100 
UTR010064B03UTR01_0064_B03.bBP463018 
UTR010082E02UTR01_0082_E02.bCJ037571 
UTR010089G02UTR01_0089_G02.bCJ038244 
UTR010104C11UTR01_0104_C11.bCJ039500 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
582A1300.232WSCGA/R
G3940.768CGG/R
787C700.171W-
T3400.829


Alignment:      TOP

20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0124_H04.b :
HTMT1_0152_B07.b :
CBLT1_0025_B02.b :
PTG01_0024_D06.b :
PTG01_0058_C03.b :
ITT01_0067_E02.b :
MLN01_0080_D03.b :
LNG01_0021_G11.b :
OVRT1_0094_A05.b :
OVRT1_0100_B08.b :
AMP01_0051_E04.b : nngggtaanantaagcgactctatgggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_D12.b :
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b :
MLN01_0015_C09.b :
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b :
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b :
UTR01_0038_F05.b :
MLN01_0047_H08.b :
HTMT1_0143_F03.b :
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b :
ITT01_0040_A02.b :
LVR01_0008_G07.b :
PBL01_0061_B02.b :
HTMT1_0083_F10.b :
SMG01_0015_C01.b :
BFLT1_0100_A02.b :
UTR01_0064_B03.b :
BFLT1_0032_F01.b :
OVRT1_0046_E06.b :
MLN01_0041_A09.b :
MLN01_0071_G09.b :
UTR01_0043_B05.b :
SPL01_0031_H01.b :
OVR01_0001_E04.b :
BKFL1_0056_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxx
MLN01_0019_C03.b :
MLN01_0033_A09.b :
MLN01_0055_E05.b :
OVRM1_0118_B05.b :
PST01_0094_D09.b :
PBL01_0047_F06.b :
PST01_0066_A08.b :
KDN01_0017_D07.b :
PST01_0014_A04.b :
KDN01_0072_C11.b :
KDN01_0019_H10.b :
PST01_0045_H10.b :
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0124_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxx
HTMT1_0152_B07.b : ttttcgcgagtagagg
CBLT1_0025_B02.b : tttttggcaagagaxxxxxx
PTG01_0024_D06.b : nnnggattt
PTG01_0058_C03.b :
ITT01_0067_E02.b :
MLN01_0080_D03.b : nnggctaggactatgacagt
LNG01_0021_G11.b : ccattagggtgxxxxxxxxxxxxxx
OVRT1_0094_A05.b : ncctcttttnnnnnncctatagcgn
OVRT1_0100_B08.b : nnnnccttctg
AMP01_0051_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_D12.b : ttttccgtcag
LVRM1_0033_D01.b :
OVRM1_0122_B12.b : n
LVRM1_0114_B11.b :
ILNT1_0065_F07.b :
MLN01_0015_C09.b : nntttggctgtacttgacxx
UTR01_0089_G02.b : nnnttgctaggactatgacxx
UTR01_0022_B04.b : ggggaacxxxxxxxxxxxxx
ITT01_0025_H07.b :
OVRT1_0130_F04.b : nnnaagtcttcnnnnnnnccgttag
UTR01_0018_G05.b : ggggccxxxxxxxxxxxxx
UTR01_0032_A05.b : xxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0026_H06.b : natttttnnnnnnncccgtatag
UTR01_0038_F05.b : gggaacctattagxxxxx
MLN01_0047_H08.b : nnnggataggactatgacx
HTMT1_0143_F03.b : ttt
UTR01_0104_C11.b : nttttgcatggactatgac
UTR01_0082_E02.b : nnnnggctaggactatgacxx
ITT01_0091_A07.b :
ITT01_0040_A02.b :
LVR01_0008_G07.b : gcxxxxxxxxxxxxxxxxxxxxxx
PBL01_0061_B02.b :
HTMT1_0083_F10.b : ttt
SMG01_0015_C01.b : nnnnnn
BFLT1_0100_A02.b : ggatccgttag
UTR01_0064_B03.b : tattaaacagctttgtgxxxxxxxxxxxxx
BFLT1_0032_F01.b : ngactaccgttagc
OVRT1_0046_E06.b : nnnnccgtctg
MLN01_0041_A09.b : ttttggcatagtacttgacx
MLN01_0071_G09.b : nnnggctaggactatgac
UTR01_0043_B05.b : gggggacxxxxxxxxxxxxx
SPL01_0031_H01.b : nnnnggctagtgacttnacxxx
OVR01_0001_E04.b : ggaaaattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0019_C03.b : ttcgggggcttggacttg
MLN01_0033_A09.b : nnnnnggtaggacttg
MLN01_0055_E05.b : nnnggctaggactatna
OVRM1_0118_B05.b :
PST01_0094_D09.b :
PBL01_0047_F06.b :
PST01_0066_A08.b :
KDN01_0017_D07.b :
PST01_0014_A04.b :
KDN01_0072_C11.b :
KDN01_0019_H10.b :
PST01_0045_H10.b :
20110601C-002243 : ................GGGGCTGGCGGTGGGGAGGCTGGAGCGCAGGGCGGCGGCGCAGT
---------+---------+---------+---------+---------+---------+ 44
OVRT1_0124_H04.b : xxxxxxxxxcccttgaGGGGCTGGCGGTGGGGAGGCTGGAGCGCAGGGCGGCCGTACACT
HTMT1_0152_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagggCGGCGGCGCAGT
CBLT1_0025_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcagggCGGCGGCGCAGT
PTG01_0024_D06.b : nnnnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
PTG01_0058_C03.b : aaatttggagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
ITT01_0067_E02.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
MLN01_0080_D03.b : ttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
LNG01_0021_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgGT
OVRT1_0094_A05.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
OVRT1_0100_B08.b : cgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
AMP01_0051_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggcggcgcagT
CLNT1_0089_D12.b : cgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0033_D01.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_B12.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0065_F07.b : nnngggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
MLN01_0015_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0022_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0025_H07.b : nnnnttagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0130_F04.b : cgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0018_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0032_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0026_H06.b : cgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0047_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0143_F03.b : tanggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0104_C11.b : agtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0091_A07.b : nnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_A02.b : nttaatgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0061_B02.b : nnggatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0083_F10.b : tccgacggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
SMG01_0015_C01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0100_A02.b : ctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0064_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0032_F01.b : gnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0046_E06.b : cgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0041_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_G09.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0031_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0019_C03.b : acagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_A09.b : acagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0055_E05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_B05.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0094_D09.b : nnnnncctgctgtggctctg
PBL01_0047_F06.b : nnagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0066_A08.b : nnncctggcgtggctct
KDN01_0017_D07.b : tttttttcctactgtggctct
PST01_0014_A04.b : nnnccacctgcggtggctc
KDN01_0072_C11.b : nnnncctgctgtggctct
KDN01_0019_H10.b : ncctttannnnnnggctacgttgtgctc
PST01_0045_H10.b : nnnncctgctgttgctct
20110601C-002243 : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
---------+---------+---------+---------+---------+---------+ 104
OVRT1_0124_H04.b : GTGCACAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
HTMT1_0152_B07.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
CBLT1_0025_B02.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
PTG01_0024_D06.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
PTG01_0058_C03.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
ITT01_0067_E02.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
MLN01_0080_D03.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
LNG01_0021_G11.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
OVRT1_0094_A05.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
OVRT1_0100_B08.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
AMP01_0051_E04.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGCCGGCGGCGGCTACTACCCAGGCGG
CLNT1_0089_D12.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
LVRM1_0033_D01.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
OVRM1_0122_B12.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
LVRM1_0114_B11.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
ILNT1_0065_F07.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
MLN01_0015_C09.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0089_G02.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0022_B04.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
ITT01_0025_H07.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
OVRT1_0130_F04.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0018_G05.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0032_A05.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
OVRT1_0026_H06.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0038_F05.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
MLN01_0047_H08.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACCACCCAGGCGG
HTMT1_0143_F03.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0104_C11.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0082_E02.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
ITT01_0091_A07.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
ITT01_0040_A02.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
LVR01_0008_G07.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
PBL01_0061_B02.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
HTMT1_0083_F10.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
SMG01_0015_C01.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
BFLT1_0100_A02.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0064_B03.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
BFLT1_0032_F01.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
OVRT1_0046_E06.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
MLN01_0041_A09.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
MLN01_0071_G09.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
UTR01_0043_B05.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
SPL01_0031_H01.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
OVR01_0001_E04.b : GTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
BKFL1_0056_F08.b : xTGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
MLN01_0019_C03.b : xxGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
MLN01_0033_A09.b : xxGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
MLN01_0055_E05.b : xxGCAGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
OVRM1_0118_B05.b : xxxxxGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
PST01_0094_D09.b : ggtgcGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
PBL01_0047_F06.b : xxxxxGAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
PST01_0066_A08.b : gggtgcAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
KDN01_0017_D07.b : gggtgcAATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
PST01_0014_A04.b : gggtgcgATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACC*CTCAGGCGG
KDN01_0072_C11.b : gggtgcgATGGCGTACCCCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
KDN01_0019_H10.b : tggggcaaagGCGTAC*CCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
PST01_0045_H10.b : gggtgcgatgGCGTAC*CCGGGCATCCTGGCGCCGGCGGCGGCGGCTACTACCCAGGCGG
20110601C-002243 : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
---------+---------+---------+---------+---------+---------+ 164
OVRT1_0124_H04.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
HTMT1_0152_B07.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
CBLT1_0025_B02.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
PTG01_0024_D06.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
PTG01_0058_C03.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
ITT01_0067_E02.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
MLN01_0080_D03.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
LNG01_0021_G11.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
OVRT1_0094_A05.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
OVRT1_0100_B08.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
AMP01_0051_E04.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
CLNT1_0089_D12.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
LVRM1_0033_D01.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
OVRM1_0122_B12.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
LVRM1_0114_B11.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
ILNT1_0065_F07.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
MLN01_0015_C09.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0089_G02.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0022_B04.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
ITT01_0025_H07.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
OVRT1_0130_F04.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0018_G05.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0032_A05.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
OVRT1_0026_H06.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0038_F05.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
MLN01_0047_H08.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
HTMT1_0143_F03.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0104_C11.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0082_E02.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
ITT01_0091_A07.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
ITT01_0040_A02.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
LVR01_0008_G07.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
PBL01_0061_B02.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
HTMT1_0083_F10.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
SMG01_0015_C01.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
BFLT1_0100_A02.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0064_B03.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
BFLT1_0032_F01.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
OVRT1_0046_E06.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
MLN01_0041_A09.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
MLN01_0071_G09.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
UTR01_0043_B05.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
SPL01_0031_H01.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
OVR01_0001_E04.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
BKFL1_0056_F08.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
MLN01_0019_C03.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCCCAAACTCAGGATCCGCTCTATGG
MLN01_0033_A09.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
MLN01_0055_E05.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
OVRM1_0118_B05.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
PST01_0094_D09.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
PBL01_0047_F06.b : GTATGG**GGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
PST01_0066_A08.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
KDN01_0017_D07.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
PST01_0014_A04.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
KDN01_0072_C11.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
KDN01_0019_H10.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
PST01_0045_H10.b : GTATGGAGGGGCTCCCGGAGGACCTGCGTTTCCCGCACAAACTCAGGATCCGCTCTATGG
20110601C-002243 : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
---------+---------+---------+---------+---------+---------+ 224
OVRT1_0124_H04.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCACATAGATGCTGATGAATTGCACAGATG
HTMT1_0152_B07.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
CBLT1_0025_B02.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
PTG01_0024_D06.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
PTG01_0058_C03.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
ITT01_0067_E02.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
MLN01_0080_D03.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
LNG01_0021_G11.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
OVRT1_0094_A05.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
OVRT1_0100_B08.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
AMP01_0051_E04.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCGGATAGATGCTGATGAATTGCAGAGATG
CLNT1_0089_D12.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
LVRM1_0033_D01.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
OVRM1_0122_B12.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
LVRM1_0114_B11.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
ILNT1_0065_F07.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
MLN01_0015_C09.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0089_G02.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0022_B04.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
ITT01_0025_H07.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
OVRT1_0130_F04.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0018_G05.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0032_A05.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
OVRT1_0026_H06.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0038_F05.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
MLN01_0047_H08.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
HTMT1_0143_F03.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0104_C11.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0082_E02.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
ITT01_0091_A07.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
ITT01_0040_A02.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
LVR01_0008_G07.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
PBL01_0061_B02.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
HTMT1_0083_F10.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
SMG01_0015_C01.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
BFLT1_0100_A02.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0064_B03.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
BFLT1_0032_F01.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
OVRT1_0046_E06.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
MLN01_0041_A09.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
MLN01_0071_G09.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
UTR01_0043_B05.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
SPL01_0031_H01.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
OVR01_0001_E04.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
BKFL1_0056_F08.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
MLN01_0019_C03.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
MLN01_0033_A09.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
MLN01_0055_E05.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
OVRM1_0118_B05.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
PST01_0094_D09.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
PBL01_0047_F06.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
PST01_0066_A08.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
KDN01_0017_D07.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
PST01_0014_A04.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
KDN01_0072_C11.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
KDN01_0019_H10.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
PST01_0045_H10.b : TTATTTTGCTGCTGTAGCTGGACAGGATGGGCAGATAGATGCTGATGAATTGCAGAGATG
20110601C-002243 : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
---------+---------+---------+---------+---------+---------+ 284
OVRT1_0124_H04.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGATACCTGCCGGCT
HTMT1_0152_B07.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
CBLT1_0025_B02.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
PTG01_0024_D06.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
PTG01_0058_C03.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
ITT01_0067_E02.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
MLN01_0080_D03.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
LNG01_0021_G11.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
OVRT1_0094_A05.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
OVRT1_0100_B08.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
AMP01_0051_E04.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
CLNT1_0089_D12.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
LVRM1_0033_D01.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
OVRM1_0122_B12.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
LVRM1_0114_B11.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
ILNT1_0065_F07.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
MLN01_0015_C09.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
UTR01_0089_G02.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
UTR01_0022_B04.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
ITT01_0025_H07.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
OVRT1_0130_F04.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
UTR01_0018_G05.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
UTR01_0032_A05.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
OVRT1_0026_H06.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
UTR01_0038_F05.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGACT
MLN01_0047_H08.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
HTMT1_0143_F03.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
UTR01_0104_C11.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
UTR01_0082_E02.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
ITT01_0091_A07.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
ITT01_0040_A02.b : CCCGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
LVR01_0008_G07.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCAGCT
PBL01_0061_B02.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
HTMT1_0083_F10.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
SMG01_0015_C01.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
BFLT1_0100_A02.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
UTR01_0064_B03.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
BFLT1_0032_F01.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
OVRT1_0046_E06.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
MLN01_0041_A09.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
MLN01_0071_G09.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCTGGCT
UTR01_0043_B05.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
SPL01_0031_H01.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
OVR01_0001_E04.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
BKFL1_0056_F08.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
MLN01_0019_C03.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
MLN01_0033_A09.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
MLN01_0055_E05.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
OVRM1_0118_B05.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
PST01_0094_D09.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
PBL01_0047_F06.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
PST01_0066_A08.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
KDN01_0017_D07.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
PST01_0014_A04.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
KDN01_0072_C11.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
KDN01_0019_H10.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
PST01_0045_H10.b : CCTGACCCAGTCAGGCATTGCTGGAGGATACAAACCTTTTAACCTGGAGACCTGCCGGCT
20110601C-002243 : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
---------+---------+---------+---------+---------+---------+ 344
OVRT1_0124_H04.b : TATGGTTTCAGTGCTGGATACAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
HTMT1_0152_B07.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
CBLT1_0025_B02.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
PTG01_0024_D06.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
PTG01_0058_C03.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
ITT01_0067_E02.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
MLN01_0080_D03.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
LNG01_0021_G11.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
OVRT1_0094_A05.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
OVRT1_0100_B08.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
AMP01_0051_E04.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
CLNT1_0089_D12.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
LVRM1_0033_D01.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
OVRM1_0122_B12.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
LVRM1_0114_B11.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
ILNT1_0065_F07.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
MLN01_0015_C09.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0089_G02.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0022_B04.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
ITT01_0025_H07.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
OVRT1_0130_F04.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0018_G05.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0032_A05.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
OVRT1_0026_H06.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0038_F05.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
MLN01_0047_H08.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTACAATGAATTCAAAGA
HTMT1_0143_F03.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0104_C11.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0082_E02.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
ITT01_0091_A07.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
ITT01_0040_A02.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
LVR01_0008_G07.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
PBL01_0061_B02.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
HTMT1_0083_F10.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
SMG01_0015_C01.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
BFLT1_0100_A02.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0064_B03.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
BFLT1_0032_F01.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
OVRT1_0046_E06.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
MLN01_0041_A09.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
MLN01_0071_G09.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
UTR01_0043_B05.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
SPL01_0031_H01.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
OVR01_0001_E04.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
BKFL1_0056_F08.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
MLN01_0019_C03.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
MLN01_0033_A09.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
MLN01_0055_E05.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
OVRM1_0118_B05.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
PST01_0094_D09.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
PBL01_0047_F06.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
PST01_0066_A08.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
KDN01_0017_D07.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
PST01_0014_A04.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
KDN01_0072_C11.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
KDN01_0019_H10.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
PST01_0045_H10.b : TATGGTTTCAATGCTGGATAGAGATATGTCCGGCACAATGGGTTTCAATGAATTCAAAGA
20110601C-002243 : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
---------+---------+---------+---------+---------+---------+ 404
OVRT1_0124_H04.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCGGTTTTGACAGCGACAGGAG
HTMT1_0152_B07.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
CBLT1_0025_B02.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
PTG01_0024_D06.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
PTG01_0058_C03.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
ITT01_0067_E02.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
MLN01_0080_D03.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
LNG01_0021_G11.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
OVRT1_0094_A05.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
OVRT1_0100_B08.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
AMP01_0051_E04.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
CLNT1_0089_D12.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
LVRM1_0033_D01.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGAAG
OVRM1_0122_B12.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
LVRM1_0114_B11.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
ILNT1_0065_F07.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
MLN01_0015_C09.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0089_G02.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0022_B04.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
ITT01_0025_H07.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
OVRT1_0130_F04.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0018_G05.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0032_A05.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
OVRT1_0026_H06.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0038_F05.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
MLN01_0047_H08.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
HTMT1_0143_F03.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0104_C11.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0082_E02.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
ITT01_0091_A07.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
ITT01_0040_A02.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
LVR01_0008_G07.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
PBL01_0061_B02.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
HTMT1_0083_F10.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
SMG01_0015_C01.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
BFLT1_0100_A02.b : ACTCTGGGCTGTGCTGAATGGCAGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0064_B03.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
BFLT1_0032_F01.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
OVRT1_0046_E06.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
MLN01_0041_A09.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
MLN01_0071_G09.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
UTR01_0043_B05.b : ACCCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
SPL01_0031_H01.b : ACTCTGGGCTGTGCTGGATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
OVR01_0001_E04.b : ACTCTGGTCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
BKFL1_0056_F08.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
MLN01_0019_C03.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
MLN01_0033_A09.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
MLN01_0055_E05.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
OVRM1_0118_B05.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
PST01_0094_D09.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
PBL01_0047_F06.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
PST01_0066_A08.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
KDN01_0017_D07.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
PST01_0014_A04.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
KDN01_0072_C11.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
KDN01_0019_H10.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
PST01_0045_H10.b : ACTCTGGGCTGTGCTGAATGGCTGGAGGCAGCACTTTATCAGTTTTGACAGCGACAGGAG
20110601C-002243 : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
---------+---------+---------+---------+---------+---------+ 464
OVRT1_0124_H04.b : TGGGACAGTGGATCCTCAAGAACTGCATAAGGCCCTGACCACTATGGGATTTAGATTGAG
HTMT1_0152_B07.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
CBLT1_0025_B02.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
PTG01_0024_D06.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
PTG01_0058_C03.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
ITT01_0067_E02.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
MLN01_0080_D03.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
LNG01_0021_G11.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
OVRT1_0094_A05.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
OVRT1_0100_B08.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
AMP01_0051_E04.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
CLNT1_0089_D12.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
LVRM1_0033_D01.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
OVRM1_0122_B12.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
LVRM1_0114_B11.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
ILNT1_0065_F07.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
MLN01_0015_C09.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0089_G02.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0022_B04.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
ITT01_0025_H07.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
OVRT1_0130_F04.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0018_G05.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0032_A05.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
OVRT1_0026_H06.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0038_F05.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
MLN01_0047_H08.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
HTMT1_0143_F03.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0104_C11.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0082_E02.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
ITT01_0091_A07.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
ITT01_0040_A02.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
LVR01_0008_G07.b : TGGGACAGTGGATCCTCAAGAACTGCACAAGGCCCTGACCACAATGGGATTTACATTGAG
PBL01_0061_B02.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
HTMT1_0083_F10.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
SMG01_0015_C01.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
BFLT1_0100_A02.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0064_B03.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
BFLT1_0032_F01.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
OVRT1_0046_E06.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
MLN01_0041_A09.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
MLN01_0071_G09.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
UTR01_0043_B05.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
SPL01_0031_H01.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
OVR01_0001_E04.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
BKFL1_0056_F08.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
MLN01_0019_C03.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
MLN01_0033_A09.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
MLN01_0055_E05.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
OVRM1_0118_B05.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
PST01_0094_D09.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
PBL01_0047_F06.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
PST01_0066_A08.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
KDN01_0017_D07.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
PST01_0014_A04.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
KDN01_0072_C11.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
KDN01_0019_H10.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
PST01_0045_H10.b : TGGGACAGTGGATCCTCAAGAACTGCAGAAGGCCCTGACCACAATGGGATTTAGATTGAG
20110601C-002243 : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
---------+---------+---------+---------+---------+---------+ 524
OVRT1_0124_H04.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCATGATCACCTTTGA
HTMT1_0152_B07.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
CBLT1_0025_B02.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
PTG01_0024_D06.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
PTG01_0058_C03.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
ITT01_0067_E02.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
MLN01_0080_D03.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
LNG01_0021_G11.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
OVRT1_0094_A05.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
OVRT1_0100_B08.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
AMP01_0051_E04.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
CLNT1_0089_D12.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
LVRM1_0033_D01.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
OVRM1_0122_B12.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
LVRM1_0114_B11.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
ILNT1_0065_F07.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
MLN01_0015_C09.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0089_G02.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0022_B04.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
ITT01_0025_H07.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
OVRT1_0130_F04.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0018_G05.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0032_A05.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
OVRT1_0026_H06.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0038_F05.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
MLN01_0047_H08.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
HTMT1_0143_F03.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0104_C11.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0082_E02.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
ITT01_0091_A07.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
ITT01_0040_A02.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
LVR01_0008_G07.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
PBL01_0061_B02.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
HTMT1_0083_F10.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
SMG01_0015_C01.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
BFLT1_0100_A02.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0064_B03.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
BFLT1_0032_F01.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
OVRT1_0046_E06.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
MLN01_0041_A09.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
MLN01_0071_G09.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
UTR01_0043_B05.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
SPL01_0031_H01.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
OVR01_0001_E04.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
BKFL1_0056_F08.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCTATGGCAAGATCACCTTTGA
MLN01_0019_C03.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
MLN01_0033_A09.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
MLN01_0055_E05.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
OVRM1_0118_B05.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
PST01_0094_D09.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
PBL01_0047_F06.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
PST01_0066_A08.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
KDN01_0017_D07.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
PST01_0014_A04.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
KDN01_0072_C11.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
KDN01_0019_H10.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
PST01_0045_H10.b : TCCCCAGGCCGTGAATTCAATTGCAAAACGATACAGCACCAATGGCAAGATCACCTTTGA
20110601C-002243 : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
---------+---------+---------+---------+---------+---------+ 584
OVRT1_0124_H04.b : TGATTACATCGCCTGCTGTGTCACGCTGCGTGCTCTTACTGACAGCTTTCGAAGACGGGA
HTMT1_0152_B07.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
CBLT1_0025_B02.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
PTG01_0024_D06.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
PTG01_0058_C03.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
ITT01_0067_E02.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
MLN01_0080_D03.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
LNG01_0021_G11.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
OVRT1_0094_A05.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
OVRT1_0100_B08.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
AMP01_0051_E04.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
CLNT1_0089_D12.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
LVRM1_0033_D01.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
OVRM1_0122_B12.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
LVRM1_0114_B11.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
ILNT1_0065_F07.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
MLN01_0015_C09.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
UTR01_0089_G02.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
UTR01_0022_B04.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
ITT01_0025_H07.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
OVRT1_0130_F04.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
UTR01_0018_G05.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
UTR01_0032_A05.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
OVRT1_0026_H06.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
UTR01_0038_F05.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
MLN01_0047_H08.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
HTMT1_0143_F03.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
UTR01_0104_C11.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGGAGACGAGA
UTR01_0082_E02.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
ITT01_0091_A07.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
ITT01_0040_A02.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
LVR01_0008_G07.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
PBL01_0061_B02.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
HTMT1_0083_F10.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
SMG01_0015_C01.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
BFLT1_0100_A02.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
UTR01_0064_B03.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
BFLT1_0032_F01.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
OVRT1_0046_E06.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
MLN01_0041_A09.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
MLN01_0071_G09.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
UTR01_0043_B05.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
SPL01_0031_H01.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
OVR01_0001_E04.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
BKFL1_0056_F08.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
MLN01_0019_C03.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
MLN01_0033_A09.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
MLN01_0055_E05.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
OVRM1_0118_B05.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
PST01_0094_D09.b : TGCTTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
PBL01_0047_F06.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
PST01_0066_A08.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
KDN01_0017_D07.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
PST01_0014_A04.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
KDN01_0072_C11.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
KDN01_0019_H10.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGAGA
PST01_0045_H10.b : TGATTACATCGCCTGCTGTGTCAAGCTGCGTGCTCTTACAGACAGCTTTCGAAGACGGGA
20110601C-002243 : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
---------+---------+---------+---------+---------+---------+ 644
OVRT1_0124_H04.b : TACTGCTCAGCATGGTGTTGTGAATTTCCCATATGATGATTTCATTCCGTGCGTCATGAG
HTMT1_0152_B07.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
CBLT1_0025_B02.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
PTG01_0024_D06.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
PTG01_0058_C03.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
ITT01_0067_E02.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAATGCGTCATGAG
MLN01_0080_D03.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
LNG01_0021_G11.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
OVRT1_0094_A05.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
OVRT1_0100_B08.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
AMP01_0051_E04.b : TACTGCTCAGNCAGGTGTTATGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
CLNT1_0089_D12.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
LVRM1_0033_D01.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
OVRM1_0122_B12.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
LVRM1_0114_B11.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
ILNT1_0065_F07.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
MLN01_0015_C09.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0089_G02.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0022_B04.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGCGCGTCATGAG
ITT01_0025_H07.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
OVRT1_0130_F04.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0018_G05.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0032_A05.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
OVRT1_0026_H06.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0038_F05.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
MLN01_0047_H08.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
HTMT1_0143_F03.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0104_C11.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0082_E02.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
ITT01_0091_A07.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
ITT01_0040_A02.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
LVR01_0008_G07.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
PBL01_0061_B02.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
HTMT1_0083_F10.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
SMG01_0015_C01.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
BFLT1_0100_A02.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0064_B03.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
BFLT1_0032_F01.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
OVRT1_0046_E06.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
MLN01_0041_A09.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
MLN01_0071_G09.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
UTR01_0043_B05.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
SPL01_0031_H01.b : TACTGCTCAGCGAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
OVR01_0001_E04.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
BKFL1_0056_F08.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
MLN01_0019_C03.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
MLN01_0033_A09.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
MLN01_0055_E05.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
OVRM1_0118_B05.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
PST01_0094_D09.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
PBL01_0047_F06.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
PST01_0066_A08.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
KDN01_0017_D07.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
PST01_0014_A04.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
KDN01_0072_C11.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
KDN01_0019_H10.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
PST01_0045_H10.b : TACTGCTCAGCAAGGTGTTGTGAATTTCCCATATGATGATTTCATTCAGTGCGTCATGAG
20110601C-002243 : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
---------+---------+---------+---------+---------+---------+ 703
OVRT1_0124_H04.b : TGTTTACATCCAGACGATGCTGAATGAACATAATCATCATTCCAACTGGAACTCCCTCTT
HTMT1_0152_B07.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
CBLT1_0025_B02.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
PTG01_0024_D06.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
PTG01_0058_C03.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
ITT01_0067_E02.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
MLN01_0080_D03.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
LNG01_0021_G11.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
OVRT1_0094_A05.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
OVRT1_0100_B08.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
AMP01_0051_E04.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
CLNT1_0089_D12.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
LVRM1_0033_D01.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
OVRM1_0122_B12.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
LVRM1_0114_B11.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
ILNT1_0065_F07.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
MLN01_0015_C09.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
UTR01_0089_G02.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
UTR01_0022_B04.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
ITT01_0025_H07.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
OVRT1_0130_F04.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
UTR01_0018_G05.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
UTR01_0032_A05.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
OVRT1_0026_H06.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTC
UTR01_0038_F05.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
MLN01_0047_H08.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
HTMT1_0143_F03.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
UTR01_0104_C11.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
UTR01_0082_E02.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
ITT01_0091_A07.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
ITT01_0040_A02.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
LVR01_0008_G07.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
PBL01_0061_B02.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
HTMT1_0083_F10.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
SMG01_0015_C01.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
BFLT1_0100_A02.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
UTR01_0064_B03.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
BFLT1_0032_F01.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
OVRT1_0046_E06.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
MLN01_0041_A09.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
MLN01_0071_G09.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
UTR01_0043_B05.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
SPL01_0031_H01.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
OVR01_0001_E04.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
BKFL1_0056_F08.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
MLN01_0019_C03.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
MLN01_0033_A09.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
MLN01_0055_E05.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
OVRM1_0118_B05.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
PST01_0094_D09.b : TGTTCAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
PBL01_0047_F06.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
PST01_0066_A08.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
KDN01_0017_D07.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
PST01_0014_A04.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
KDN01_0072_C11.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
KDN01_0019_H10.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
PST01_0045_H10.b : TGTTTAAATCCAGAGGAAGCTGAATGAACATAATCAACATTCCAACTGGAACTC*CTCTT
20110601C-002243 : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
---------+---------+---------+---------+---------+---------+ 759
OVRT1_0124_H04.b : TGTTCTTCTCCCTTCAGCAGTTGTGTGCAGATTTTCACCGCCCCTTTTCCTTAAAAG***
HTMT1_0152_B07.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
CBLT1_0025_B02.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
PTG01_0024_D06.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCCTTACAG***
PTG01_0058_C03.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
ITT01_0067_E02.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
MLN01_0080_D03.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
LNG01_0021_G11.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
OVRT1_0094_A05.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
OVRT1_0100_B08.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
AMP01_0051_E04.b : TGCTCTTCGC**TTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCCTAACAG***
CLNT1_0089_D12.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
LVRM1_0033_D01.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGNTT
OVRM1_0122_B12.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
LVRM1_0114_B11.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCCTTACAGTTN
ILNT1_0065_F07.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
MLN01_0015_C09.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
UTR01_0089_G02.b : TGCTCTTCGC*CTTCA*CAGTCGTGTGCAGACTTACACAGCCACTTTTTCTTAACAGTTG
UTR01_0022_B04.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
ITT01_0025_H07.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
OVRT1_0130_F04.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
UTR01_0018_G05.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
UTR01_0032_A05.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
OVRT1_0026_H06.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
UTR01_0038_F05.b : TGCTCTTCGC*CTTCA*CAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
MLN01_0047_H08.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
HTMT1_0143_F03.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
UTR01_0104_C11.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCCTTACAGTTG
UTR01_0082_E02.b : TGCTCTTCGC*CTTCA*CAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
ITT01_0091_A07.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
ITT01_0040_A02.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
LVR01_0008_G07.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
PBL01_0061_B02.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
HTMT1_0083_F10.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
SMG01_0015_C01.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
BFLT1_0100_A02.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
UTR01_0064_B03.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
BFLT1_0032_F01.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
OVRT1_0046_E06.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
MLN01_0041_A09.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
MLN01_0071_G09.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
UTR01_0043_B05.b : TGCTCTTCGC*CTTCA*CAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
SPL01_0031_H01.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
OVR01_0001_E04.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
BKFL1_0056_F08.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTTACAG***
MLN01_0019_C03.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
MLN01_0033_A09.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
MLN01_0055_E05.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
OVRM1_0118_B05.b : TGCTCTTCNG*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTTACAGTTG
PST01_0094_D09.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
PBL01_0047_F06.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
PST01_0066_A08.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
KDN01_0017_D07.b : TGCTCTTCGC*CTTCA*CAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
PST01_0014_A04.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
KDN01_0072_C11.b : TGCTCTTCGC*CTTCA*CAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
KDN01_0019_H10.b : TGCTCTTCGC*CTTCA*CAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAGTTG
PST01_0045_H10.b : TGCTCTTCGC*CTTCAGCAGTCGTGTGCAGACTTACACAGCCACTTTTCCTTAACAG***
20110601C-002243 : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
---------+---------+---------+---------+---------+---------+ 818
OVRT1_0124_H04.b : TTGCAATGGGTTATTGCTTTcatgtacctctccaaattttcatttttgataataatttct
HTMT1_0152_B07.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
CBLT1_0025_B02.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
PTG01_0024_D06.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
PTG01_0058_C03.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
ITT01_0067_E02.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
MLN01_0080_D03.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
LNG01_0021_G11.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
OVRT1_0094_A05.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
OVRT1_0100_B08.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
AMP01_0051_E04.b : TTGTAATGGTTTATTGCCTTATGTACATCTCAAA*TTTTAGTTTTGATAATAAATTC*TT
CLNT1_0089_D12.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
LVRM1_0033_D01.b : GTGTAATGGTTTATTGCTTTATGTACACC
OVRM1_0122_B12.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTtgatataaat
LVRM1_0114_B11.b : GTGTGATGGGTTATTGCCTTATGTACACCTCACATTTTTAGTTTTAATAtaaaatct
ILNT1_0065_F07.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
MLN01_0015_C09.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
UTR01_0089_G02.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTCTTT
UTR01_0022_B04.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
ITT01_0025_H07.b : TTGTAATGGTTTATTGGCTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
OVRT1_0130_F04.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
UTR01_0018_G05.b : TTGTAATGGTTTATTGCTTTATGTACACCTCANATTTTTAGTTTTGATAATAAATTC*TT
UTR01_0032_A05.b : TTGTAATGGTTTATTGCTTTATGTACACCTCANATTTTTAGTTTTGATAATAAATTC*TT
OVRT1_0026_H06.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAAATAATTC*TT
UTR01_0038_F05.b : TTGTAATGGTTTATTGCTTTATGCACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
MLN01_0047_H08.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
HTMT1_0143_F03.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
UTR01_0104_C11.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
UTR01_0082_E02.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
ITT01_0091_A07.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
ITT01_0040_A02.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
LVR01_0008_G07.b : TTGTAATGGTTTATTGCTATATGTACATCTCACATTTTTAGTTTTGATAATAAATTC*TT
PBL01_0061_B02.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
HTMT1_0083_F10.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
SMG01_0015_C01.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
BFLT1_0100_A02.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
UTR01_0064_B03.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
BFLT1_0032_F01.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
OVRT1_0046_E06.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
MLN01_0041_A09.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
MLN01_0071_G09.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
UTR01_0043_B05.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
SPL01_0031_H01.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
OVR01_0001_E04.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
BKFL1_0056_F08.b : NTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTT*GATAATAAATTC*TT
MLN01_0019_C03.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
MLN01_0033_A09.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
MLN01_0055_E05.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
OVRM1_0118_B05.b : TTGTAATGGGTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGAa
PST01_0094_D09.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
PBL01_0047_F06.b : TTGTAATGGTTTATTGCTTTATGTACATCTCAAATTTTTAGTTTTGATAATAAATTC*TT
PST01_0066_A08.b : TTGTAATGGTTTATTGCTTTATGTACATCTCANATTTTTAGTTTTGATAATAAATTC*TT
KDN01_0017_D07.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
PST01_0014_A04.b : TTGTAATGGTTTATTGCTTTATGTACATCTCANATTTTTAGTTTTGATAATAAATTC*TT
KDN01_0072_C11.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
KDN01_0019_H10.b : TTGTAATGGTTTATTGCTTTATGTACACCTCAAATTTTTAGTTTTGATAATAAATTC*TT
PST01_0045_H10.b : TTGTAATGGTTTATTGCTTTATGTACATCTCANATTTTTAGTTTTGATAATAAATTC*TT
20110601C-002243 : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
---------+---------+---------+---------+---------+---------+ 874
OVRT1_0124_H04.b : ttggaagcatttaacataaaacccgtcctatttccccctttaaacttcttggagccacga
HTMT1_0152_B07.b : TGGAATGCTnttnngannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0025_B02.b : TGGAATGCTATTAAGATAA**GATCTGTCCTAATTCA*CCCTTTAAAACTTCCTT*GAGC
PTG01_0024_D06.b : TGGAATGCTATTNAGATNA**GATCTGTCCTATTTCA*CCCTTTAGAAC*TCCTT*GAGC
PTG01_0058_C03.b : TGGAATGCTATTAAGAAA***GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GA*C
ITT01_0067_E02.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
MLN01_0080_D03.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
LNG01_0021_G11.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
OVRT1_0094_A05.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCT**GAGC
OVRT1_0100_B08.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTC*TT*GAGC
AMP01_0051_E04.b : TGccttgcaaaanaanannnnnnnnnnnnnnnnncctxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_D12.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAAAACTTCCTT*GAGC
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : TGGAATGCTNATAAAAnnnnnnnannnnnnnnnnnnnnnnnnnnnnnaaantaccgcggg
MLN01_0015_C09.b : TGGAATGCTATTaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_G02.b : TGGAATGCTATTAACATAA**GATCTGTTCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
UTR01_0022_B04.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
ITT01_0025_H07.b : TGGAATGCTATTAAAATAA**GATCTGTCCTATTTCA*CCCTTTTAAACTTCCTTTGAGC
OVRT1_0130_F04.b : TGGAATGCTATTAAGA*AA**GATCTGTCCTATTTCA**CCTTTAGAACTTCCT**GAGC
UTR01_0018_G05.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
UTR01_0032_A05.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
OVRT1_0026_H06.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCACCCCTTTGAAACTTCCTT*GAGC
UTR01_0038_F05.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
MLN01_0047_H08.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
HTMT1_0143_F03.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACT*CCTT*GAGC
UTR01_0104_C11.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
UTR01_0082_E02.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTTCTT*GAGC
ITT01_0091_A07.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
ITT01_0040_A02.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
LVR01_0008_G07.b : TGGAATGCTATTAAAGATAACGATCTGTCCTATTTCA*CCCTTTAAAACTTCCTT*GAGC
PBL01_0061_B02.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
HTMT1_0083_F10.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTTC*ACCTTTAGAACTTCCTT*GAGC
SMG01_0015_C01.b : TGGAAATGCTATAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
BFLT1_0100_A02.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GANG
UTR01_0064_B03.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
BFLT1_0032_F01.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCCTTGAGC
OVRT1_0046_E06.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*TTGA
MLN01_0041_A09.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGA*CTTCCTT*GAGC
MLN01_0071_G09.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
UTR01_0043_B05.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
SPL01_0031_H01.b : TGGAATGCTATTAAGAATA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCTTT*GAGC
OVR01_0001_E04.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
BKFL1_0056_F08.b : TGGAATGCTATnnnnnnnnnnnnnnnnnnnnnnnnnaaaxxxxxxxxxxxxxxxxxxxxx
MLN01_0019_C03.b : TGGAATGCTaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_A09.b : TGGAATGCTATTTAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTCCTTT*GAG*
MLN01_0055_E05.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*TGAG
OVRM1_0118_B05.b :
PST01_0094_D09.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
PBL01_0047_F06.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
PST01_0066_A08.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
KDN01_0017_D07.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
PST01_0014_A04.b : TGGAATGCtattaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0072_C11.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
KDN01_0019_H10.b : TGGAATGCTATTAAGATA***GATCTGTCCTATTTCA*CCCTTTAAAACT*CCTT*GAGC
PST01_0045_H10.b : TGGAATGCTATTAAGATAA**GATCTGTCCTATTTCA*CCCTTTAGAACTTCCTT*GAGC
20110601C-002243 : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
---------+---------+---------+---------+---------+---------+ 930
OVRT1_0124_H04.b : tactcaggcttaattttttcgcactttttttttgtaatttacactgccacatagtcttag
HTMT1_0152_B07.b : nnnnnnnnnnnnnnnnnnnnnnttnnnnnnnnntnnnngnnncnnnnnnnnnnnnnnnnn
CBLT1_0025_B02.b : CCTTGGTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAAATTTAGTTG*C
PTG01_0024_D06.b : CCATGT*AATCATGCCCTANTTT*CTTGCTAAGCTTC*TTTaagtaaattaagtgcgcaa
PTG01_0058_C03.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAAT**GC
ITT01_0067_E02.b : CATTGGTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAATTTAAGT***GC
MLN01_0080_D03.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGGTAATTTAAGT**GC
LNG01_0021_G11.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT*G*C
OVRT1_0094_A05.b : CATTGNTNATCATGCCTTATTTTTC*TGCTAGGCTTC*T*TTATGTAAATTTTAGT**GC
OVRT1_0100_B08.b : CATTGT*AATCATGCCTTATTTcttgctagcttcttttagtaaatttaatgcgcaaatgt
AMP01_0051_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_D12.b : CATTGTTAACCATGGCCTTATTT*CTTGGTAACCT*C*TTTTATGTAAATTTAAT***GC
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : ccgcggaattccctttggggaggtttattggtttcggaagggtaaaaaaacctggaggag
MLN01_0015_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_G02.b : CATTGTTAATCATGCCcttatttccttgcctagcttccttttatgtaaattttaaatgcc
UTR01_0022_B04.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCT
ITT01_0025_H07.b : CATTGTTAATCATGCCTTTATTTTCCTGCTAAACNTCTTTTTATGTAAATTTAAGT**GC
OVRT1_0130_F04.b : CATTGT*AATCATGCCTTATTTT**CTGCTAAACTTC*TTTatgtaaattaagtgcgcaa
UTR01_0018_G05.b : CATTGTTAATCATGCCTTATTTTCTTTGCTA*GCTTC*TTTTATGTAAAT
UTR01_0032_A05.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT*G
OVRT1_0026_H06.b : CA*TGTTAATCATGCCTTATTTT*CNTGCTAAGCTTC*TTTTATGTAAATTTAGT***GC
UTR01_0038_F05.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
MLN01_0047_H08.b : CATTGTTAATCATGCCTTATTTT**CTGCTAAGCCTC*TTTTATGTAAATTAAGT***GC
HTMT1_0143_F03.b : CAATGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
UTR01_0104_C11.b : CATTGNTAATCATGCCTTATTTTNNCTGCTA*GCTTC*TTTTATGTAAATTTTAGT*GGC
UTR01_0082_E02.b : CATTGNTAATCATGCCTTATTTTTC*TGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
ITT01_0091_A07.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGNTAATTTAAGT**GC
ITT01_0040_A02.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
LVR01_0008_G07.b : CATTGTTAATCATGCCTTATTTTTCGTGCTAACCTTC*TTTTATGTAAATTTAAATTGGC
PBL01_0061_B02.b : CCATGTTAATCATGCCTTATTTT*CTTGCNTAGCTTC*TTTTATGTNAATTTTAGT**GC
HTMT1_0083_F10.b : CATTGTTAATCATGCCTTATTTTNNCTGCTA*GCTTC*TTTTATGTAAATTTAAGT**GC
SMG01_0015_C01.b : CCATGTTAATCATGCCTTATTTT*CTTGCTAGGCTTC*CTTTNAGTTAATTTTAAGTGCG
BFLT1_0100_A02.b : CATTGT*AATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAAT**GC
UTR01_0064_B03.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAGGT**GC
BFLT1_0032_F01.b : CATTGTTAATCATGCCTTTATTT*CTTGCTAAGCTTCTTTTTATGTAATTTAAAT***GC
OVRT1_0046_E06.b : GCATTGTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
MLN01_0041_A09.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
MLN01_0071_G09.b : CCCATGTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
UTR01_0043_B05.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
SPL01_0031_H01.b : CATTGT*AATCATGGCTTATTTT*CTTGCTTAGCTTC*TTT*ATGTAAATTTAGT***GC
OVR01_0001_E04.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTTAGT**GC
BKFL1_0056_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0019_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_A09.b : CATTGNTNATCATGCCTTATTTTCTTGNNCTAGCTTC*TTT*ATGTAANTTTTAGT**GC
MLN01_0055_E05.b : CCATGTTAATCATGCCTTATTT**CTTGCTAAGCTTC*TTTTATGCAAANTAAAGT**GC
OVRM1_0118_B05.b :
PST01_0094_D09.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT**GC
PBL01_0047_F06.b : CCCATGTAATCATGCCNTATTTTNNCTGCTA*GCTTC*TTTTATGTAANTTNNAGT**GC
PST01_0066_A08.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTN*CTTTATGTAAATTTAAGT**GC
KDN01_0017_D07.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC*TTTTATGTAAATTTAAGT*GCG
PST01_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0072_C11.b : CATTGTTAATCATGCCTTATTTTCTTTGCTA*GCTTC*TTTTATGTAAATTTAAGT**GC
KDN01_0019_H10.b : CCCATGTAATCATGCCNTATTTTTC*TGCTAAGCTTC*TTTTATGTAAATTTAGT***GC
PST01_0045_H10.b : CATTGTTAATCATGCCTTATTTT*CTTGCTAAGCTTC**TTTATGTAAATAAAGT***GC
20110601C-002243 : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGATACTAAAACCTTTTCATC
---------+---------+---------+---------+---------+---------+ 990
OVRT1_0124_H04.b : gtccaatttttttttttctgtaaaacataaaacttttttccccttacgctgttgtctccc
HTMT1_0152_B07.b : ntnnnnnnnnttgnnnnnncnnnnnnnnnntnnnnnnnnnnnnnnnntnnntnnnnnaat
CBLT1_0025_B02.b : GCAAATGGTCTAAGGGACAGTATGTATTTTTTCCTTGGAAGAAACTAAAA*CCTTTTCAT
PTG01_0024_D06.b : atgtctaagcacagtatgtattttttcatgtaagtactaaaacttttcatcccaaaaaaa
PTG01_0058_C03.b : GCAAATTGTCCTAAGCACAGTATGTATTTTTTCAT*GGAAGAAACTAAAACCTTTcatca
ITT01_0067_E02.b : GCAAATTGTCTAAGGC*CAGTATGGATTTTTTCATTGTAAGATACTAAAACCTTTTCATC
MLN01_0080_D03.b : GCAAAATGTCCTAAGCACAGTATGTATTTTTTCATTGTAAGATACTAAAACCTTTTCATC
LNG01_0021_G11.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGATACTAAAAACCTTTTCAT
OVRT1_0094_A05.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTTGTAGATACTAAAACTTTTTCATC
OVRT1_0100_B08.b : ctagggacagtatgtattttttcttgaaaatactaaaccttttcatcccctacagctgtt
AMP01_0051_E04.b : xxxxxxxxatccggccagaataaggctgggatcccccaaaaaaaaccccggggcaacgag
CLNT1_0089_D12.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGAAACATAAAACCTTTTCAT
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : tttggacaacccccaacttaaggccgggaaaaaatgccttttttggaaaaatggggtagc
MLN01_0015_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_G02.b : caaaattgcctaaggcacagtaaggtatttttttcattggaaaaatcctaaaactttttc
UTR01_0022_B04.b :
ITT01_0025_H07.b : GCAAATTGgtctaaggcacagtaagtaattttttccttgaagaatactaaaaccttttca
OVRT1_0130_F04.b : atgtctagggccagtatgtatttttcattgaagaaacaaaactttcctcccatacgcggt
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b : GCAAATTGTCTAAGcaccgtatgtttttttcatgtaagatactaaaccttttcatcacac
UTR01_0038_F05.b : GCAAATTGTCTAAGGCACAGTATGTA
MLN01_0047_H08.b : GCAAATG**TCTAAGCACAGTATGTATTTTTtcattgtagatactaaaacttttcatccc
HTMT1_0143_F03.b : GCAAATTGCCTAAAGCACAGTATGTATTTTTTTCTTGTAAGATACTAAAACCTTTTatcc
UTR01_0104_C11.b : GCAAAT*GTCNTAGGCACAGTATGTATTTTTTCAT*GTAAGATACTAAAccttttcatca
UTR01_0082_E02.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGGA*GATACTAAAACCTTTcatcc
ITT01_0091_A07.b : GCNAATTGTCTAAAGCACAGTATGTATTTTTTTCATGTAAGATACTAAAACTTTTTCATC
ITT01_0040_A02.b : GCAAATTGTCTAAGGCACAGTANTGTATTTTTCATTGTAAGATACTAAAACCTTTTCATC
LVR01_0008_G07.b : CCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGGAAGAAACAAAAACCCTTTtctt
PBL01_0061_B02.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTA*GATACTAAAACTTTTCATCC
HTMT1_0083_F10.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGATACTAAAACCTTTTCATC
SMG01_0015_C01.b : CAATTTGCCTAAAGCCACAGTAGGTATTTTTTCATTGGAAGATACCTAAACCTTTTTCTC
BFLT1_0100_A02.b : GCAAAATGTCTAAGGCACAGTATGTATTTTTTTCATTGTAAAAACTAAAAACTTTTCATC
UTR01_0064_B03.b : GCAAATTGTCTAAAGCACAGTATGTATTTTTTCATTGTAAGATACTAAAACCTTTTCATC
BFLT1_0032_F01.b : GCAAATTGTCTAAAGCACAGTATGTATTTTTTCATGGTAA*AAACTAAAACCTTTTCATC
OVRT1_0046_E06.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGAACTAAAAACTTTTCATCA
MLN01_0041_A09.b : GGCAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGATACTAAAACCTTTTCATC
MLN01_0071_G09.b : GCAAATTGTCTAAAGCACAGTATGTATTTTTTCATTTGTAGATACTAAAACCTTTTCATC
UTR01_0043_B05.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGATACTAAAACCTTTTTCAT
SPL01_0031_H01.b : GCAAATTT**CTAAGCACAGTATGTATTTTTTCATTGTA*GATACTAAAACCCTTTCATC
OVR01_0001_E04.b : GCAAATTGTCTAACGCACAGAATGTATTTTTTCATTGTAAGATACTAAAACCTTTTCCTC
BKFL1_0056_F08.b : xxxxxtagaaatctggccaggaaagtgctggatcccccaaaaaaaaccggggggaccaag
MLN01_0019_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_A09.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGATACTGAAAACTTTTCATC
MLN01_0055_E05.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAGGATACTAAAAACTTTTCATC
OVRM1_0118_B05.b :
PST01_0094_D09.b : GCAAATTGTCTAAAGCACAGTATGTATTTTTTCATTGTAAGATACTAAAACCTTTTCATC
PBL01_0047_F06.b : GNCAATTGTCTA*GGCACAGTATGTATTTTTTCATTGTA*GATACTAAAACCTTTCATCC
PST01_0066_A08.b : GCAAATTGTCTAAGGCACAGTATGTA*TTTTTCATTGTAAGATACTAAAACCCTTTCATC
KDN01_0017_D07.b : NCAATTTGTCTAAG*CACAGTATGTATTTTTTCATGTAA**ATACTAAAACTTTTTCATC
PST01_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0072_C11.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTTCATGTAAGATACTAAAACCTTTTCATC
KDN01_0019_H10.b : GCAAATTGTCTAAGGCACAGGATGTATTTTTTCATTGAAGAATACTAAAACTTTTcatca
PST01_0045_H10.b : GCAAATTGTCTAAGGCACAGTATGTATTTTTTCATTGTAAGATACTAAAACCTTTTCATC
20110601C-002243 : ACAAAAAAAAAAAAAAAAAAACCCTCTTTTACAAGGGCTTTTACGTGGTTTTGAAAGCTT
---------+---------+---------+---------+---------+---------+ 1050
OVRT1_0124_H04.b : ttttttaagggttttgacggatcttaaacctttttggcaaatttcttacttgtaataagg
HTMT1_0152_B07.b : tntnatnntttgctttttttttntntttttngtttnnntaaanttttnnnccnttttnnt
CBLT1_0025_B02.b : Cccccttgagaaaacaaaatgaataagagtgagataggatagagatctgtacacagggag
PTG01_0024_D06.b : aaaaaagcccctgtgctcactgcagtccgggcctctagatatcctcgaggggcaagctta
PTG01_0058_C03.b : actacacttgttgcctccctcttttacaggcttttaggggttttgaaactttttggcaaa
ITT01_0067_E02.b : CACTAAAAAAAAAAAAAAAAggcccattgtccccaaxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_D03.b : ACnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0021_G11.b : CACAAAAAAAAAAAAAAAAAAggcccccatgtgcttcaagctggcgggtcccgggcccgc
OVRT1_0094_A05.b : CCCTAAAAAAAAAAAAAAAAAggcacatgtgctcaagcttcaggtccgccccctaaacta
OVRT1_0100_B08.b : gcctccctctttaaagggcttttactgtttggaaactttttggcaaaaattcctacatga
AMP01_0051_E04.b : gtttgaaaaatccaaagggttctgaggcttacggatctccaacgagcccgcagcccaatt
CLNT1_0089_D12.b : CAAACTAACACTGTTGTCCTTCCCCCTTTTAAAAGGGCTTTTACGTGGTTTTGAAAGCTT
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : tatgggtttttgtggacccattttaacttgcaaaaacaattttaccacaacaattggttt
MLN01_0015_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_G02.b : ttcccccaaaacaaaaaaaaaaaagggccccatgtgttccaaacctcaagttcccggccc
UTR01_0022_B04.b :
ITT01_0025_H07.b : tcacactaaaa
OVRT1_0130_F04.b : gtctccctctttacagggctttacttggttgaaagcttttggcaaaaatcttaccgtaaa
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b : acagctgttgtcttccctcttttacagggctttttactggtttgaaaccttttgggcaaa
UTR01_0038_F05.b :
MLN01_0047_H08.b : acttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0143_F03.b : nccttnnaaaaanaaagaaaannaaaaaaaaanaannaaagttccgcggccgccgattcc
UTR01_0104_C11.b : caaannnnnnnnnnannnnnnannnnaagccactgtgctcaagctgcagttccgcccctt
UTR01_0082_E02.b : cactnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0091_A07.b : ACACTAAAAAAAAAAAAAAAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_A02.b : ACaaaaaaaaaaaaaaaaaaaagggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_G07.b : cacacttaccgctgtttgtccttccctctttttaaaagggccttttacgggggtttttaa
PBL01_0061_B02.b : ACTACAGCTGTTGTCTTCCCTCTTTacaggncttttacgtggtttgaagcttttgtgcag
HTMT1_0083_F10.b : ACACAAAAAAAAAAAAAAA
SMG01_0015_C01.b : CCCCTAAAAAAAAAAAAAAAAggcaacctgggcctcaactgcaagtcccggccccccaaa
BFLT1_0100_A02.b : ACAAAAAAAAAAAAAAAAggccacatgtgctccacctgccagtcccggcccctaaacaac
UTR01_0064_B03.b : ACcctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
BFLT1_0032_F01.b : CCCTTAAAAAAAAAAAAAAAggccccttgttctccaactgcaggtcccggcccttaactt
OVRT1_0046_E06.b : ACTACAGCTGTTGTCTTCCCTCTTTacaaggcttttacntgtttttgaagctttttgtgc
MLN01_0041_A09.b : ACAAAAAAAAAAAAAAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_G09.b : ACACTAAAAAAAAAAAAAAAAAAggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_B05.b : CACACTAAAAAAAAAAAAAAAAAAagccacatggtgctccaagctgccaggtcgcggccc
SPL01_0031_H01.b : CACTACAGCTGGTG***TCTTCCCTCTTTTACAAGGCTTTTtacgtggtttgaaaatttt
OVR01_0001_E04.b : CC*ACTACAGCTGGTTGCCTCCCCTCTTTTACAAGGGCTTTTAagggggttttgaaaggg
BKFL1_0056_F08.b : cttttgaaaatccaagggtttgaggcttttggtttttcaaggggtccacgaccgattaat
MLN01_0019_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_A09.b : ACnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0055_E05.b : ACnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0118_B05.b :
PST01_0094_D09.b : ACACTAAAAAAAAAAAAAAAAAggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0047_F06.b : ACTACAGCTGTTGTCTTCCCTCTTacagggctttacgtgtttngaagctttttgcaaata
PST01_0066_A08.b : ACAAAAAAAAAAAAAAAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0017_D07.b : C***ACTACAGCTGTTGTCTTCCCTCTTTTACAAGGGCTTTTACGTGGTTTTGAAgcttt
PST01_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0072_C11.b : ACACTACAGCT**GTTGTCTTCCTTCTTTTACAAGG*CTTTTACGTGGTTTCGAAAGCTT
KDN01_0019_H10.b : actaacgctggtgtcttccttctttaacaagggcttttaatgggtttcaaaagcttttgt
PST01_0045_H10.b : ACaaaaaaaaaaaaaaaaaaaaaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002243 : TTTG........................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b : gggcctcccgtgccacaacaggggattcctttcggattcccttggtgaattaccacgtct
HTMT1_0152_B07.b : ttttttttttttttttnggggggggggggagtttttttgttnggaanggnnncgctggga
CBLT1_0025_B02.b : aagagaagagagtatttccgccgcccccccgactccctcttttggggggagagtgggccc
PTG01_0024_D06.b : cgtacccgctttttgtacaagggtcccatagggagcaattaagctagccggggccccgtt
PTG01_0058_C03.b : aaattctacagggaaaaattggggcccccgggagcaaaaagggtaacctatcaggattcc
ITT01_0067_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxattaggga
MLN01_0080_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0021_G11.b : tctaaaataatcccctcaagggggccccaagcctttaccccttaccccagcttttctttg
OVRT1_0094_A05.b : tctaaaaaaaaactccccacctcccttggactgaaaaaaaatgaatgcttgttgttgtac
OVRT1_0100_B08.b : aaaattggggccccctgggggcaaaagtggtatcctattccggttccctttggaaactaa
AMP01_0051_E04.b : aatcccccgcccgcccctctccaaccgtgtaattttagtttcccccatgaaaccccaagg
CLNT1_0089_D12.b : TTTGggccaaataatccttatcctggaaaatatttggggcccctctgggagccacaaaaa
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : cttttagtttccgttccggggaaggttggggaagggtttttccctttaaaattctccaac
MLN01_0015_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxaaatttaatttttagtgtaatgtgttaactac
UTR01_0089_G02.b : ccttcaaaattatccccctcgaggggccccaagctttatcgcgttaccccagcttttctt
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b : agtgggccctccggagccaaaatggtatcctttcggattccttagggaactaaccggctt
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b : aattcttattatgtaaatattggggccctctgtgagccaaaaaggggaaaccatatcagg
UTR01_0038_F05.b :
MLN01_0047_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0143_F03.b : ctttaggagggttattgcatcacactaataaatctttgtaatttggacaacccactaaag
UTR01_0104_C11.b : taaagtttcttcgagggcccaaacttaagcgtaccagtttcttgtaaaa
UTR01_0082_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0091_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_G07.b : aaccttttttggtgcaaaaatttccttaactcgggtaaaaagttttgggggcccctcccg
PBL01_0061_B02.b : atattctatcatgtaatagtgggccctctgatgcaaaaatggtatcatatcagatcacct
HTMT1_0083_F10.b :
SMG01_0015_C01.b : ttatcccccaggggcccaactaaccgtaccccctttttgaaaaaggggccctataggggg
BFLT1_0100_A02.b : ctaaaaaaaaacctccaaactcccccggaactgaaactaaaggatgccattttgtggtaa
UTR01_0064_B03.b : ggccccttgtgctccaagctccaggtcccgggcccctttaaaattatccccccgggggcc
BFLT1_0032_F01.b : atccaaaaaaaaacctccccacctcccctgaacttgaaacaaaaagaaagcaatggtgtt
OVRT1_0046_E06.b : aaatattctatcagtaaatagttggggccctctggatgcaaaaattggtaatcatattca
MLN01_0041_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_B05.b : gcctctagaagtaatcccctcaagggggccccaagccctaaccccttaccccaggctttt
SPL01_0031_H01.b : ttgggccgaaaattcttatcaggtaaatattgggggccctccgggatgccaaaaatggta
OVR01_0001_E04.b : ttttttgggcaaaaatattctttttcctggaaaataaattggggggcccctcttgggatg
BKFL1_0056_F08.b : atccccccccgccccccccgaggggtaatttttaatctgccccggacccccaaaggtgga
MLN01_0019_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagggaaaagggt
MLN01_0033_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0055_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0118_B05.b :
PST01_0094_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0047_F06.b : tctatctgtaatagtgggccctctgatgcaaaagtgtatcatacggatcacttatgaact
PST01_0066_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0017_D07.b : tgtgcagattattctatcatgtaataattgggccctctggatgcaaaaatggtaatcata
PST01_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0072_C11.b : TTgtgcaaaatatcctatcatgtaaatatttggggccctatggatgcaaaaaagtggtaa
KDN01_0019_H10.b : gccaaaaatcttatcatgtaaatagtggggccttcgggatggccaaaattgggaacccta
PST01_0045_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b : tatgtggaacttgttttttattggggtcttttattcccccttatttggtgtgaattttca
HTMT1_0152_B07.b : agggtttgtttggggggttnntttttttaatattnnttgnggggttggggggggggggtt
CBLT1_0025_B02.b : cccaaagaaaataatttagtagtgtgcgccccccacccaggggacgagaaaaaggctttt
PTG01_0024_D06.b : taaaccccgaccggaaaagccaactgggattttttaaggaacttttccgggggggcaagt
PTG01_0058_C03.b : cttatggaaagtaaccaggcttaaggtgaacccctttagactttgggggacttttaaacc
ITT01_0067_E02.b : tcgattaaaactaggctgggccctctttaaacctctgaacgggaaactgtaccttggaat
MLN01_0080_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0021_G11.b : ttacaaaagggggtccccttaaaagttgaagtttcgaaattttaaaaagaccttaggggg
OVRT1_0094_A05.b : ttgtttatgcactttaagggtccaaaaaacaatgcctccaatttcaaaaaagctttttcc
OVRT1_0100_B08.b : ccaggtttaggcgaacctgttttaaactttgggggactttttaacccccgaaaattgggg
AMP01_0051_E04.b : ttgtaactgatgccggggcccccctgccctgtttaatttccccgaaaagggcaaatt
CLNT1_0089_D12.b : gtgttaaccatatccggattcacccttaggggaaactgaaacaaggctttaaggcttaaa
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : cccggggaaaggcccttcccgaagggggctttttcgtttcggcccctaaacccccccccc
MLN01_0015_C09.b : gcctagctgctgttgaaatttgctaccgatagatttggaatattacccggactgggttca
UTR01_0089_G02.b : gggcacaaagggggtcccccttaaggggg
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b : aagcaaccctttttaactttggggggcctttaaaccccgaaattgggggaaaagtcccat
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b : atccccttagtgaaactgaaacagggcttaaggcgaaccctttttgaaacttttggaggc
UTR01_0038_F05.b :
MLN01_0047_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0143_F03.b : gcgtgaaaaaagcttatttggaatttggggcaattgctttttgaactattaccgccaaaa
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_G07.b : gggatcccaaaaaaaaggtgggtaaaatccaatttttcgggaatttcccccttttagtgg
PBL01_0061_B02.b : tatgaaactgaccgcttnagctgagctgttgatactatgatgactattaaaaccctgaaa
HTMT1_0083_F10.b :
SMG01_0015_C01.b : cgtatatagctaggcccggccgtctttttaacctcggaagggaaaacgcccactggaatt
BFLT1_0100_A02.b : cctggtaatgcaccttaaaaggttccaaaaaggaatgcctccaatttccaaaaaagactt
UTR01_0064_B03.b : ccaacctttaacccataccccccctttttttgggaaaaaagggggccc
BFLT1_0032_F01.b : gttaaatggtttttgcccttaaatggttcaaaaaagcaatacctccaaatttccaaaaaa
OVRT1_0046_E06.b : gattcccttatggaaattgaccccgggcttaggctgaaactgtttgaagactagggaggg
MLN01_0041_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggaaaacgccacctggaattttg
MLN01_0071_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_B05.b : ccttggtaacaaaaggtgggtccccttaaaaaatggaagttcgcaaatttaaaaaaaccc
SPL01_0031_H01.b : atcctt
OVR01_0001_E04.b : gcaaaaaaaagggggaaaatccccatatttagggaattcccccctttatatgggaaaaaa
BKFL1_0056_F08.b : aataatcccgggttccctttctttttattttctggaaaggggaaagtctttcccttaaaa
MLN01_0019_C03.b : taacaacggcaagctggcgctgaaagttgctacgagtgatttgaaatttttcccgagctg
MLN01_0033_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0055_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0118_B05.b :
PST01_0094_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0047_F06.b : gancaagcttagctgaactgttgagactatgtgactatttaaaccttgatatgatggaac
PST01_0066_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0017_D07.b : tcaggatcacctagtggaactgacacaagttaaggctgacgctgtttgatacttcggagg
PST01_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0072_C11.b : tcatattcagattcacctagtggaaactgaccaggcctaaagctgacgctgntttgagac
KDN01_0019_H10.b : ttcggattcccttagggaaactgaaacccggttttaggctaaacctgtttaatactttcg
PST01_0045_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b : cctttcattgtctactatggttcttctaatataaaacgcggggttgtcttgtggtggata
HTMT1_0152_B07.b : ttctctcgggggttgggttccnnnngggggagggggaaaatggaaaaggccaaaagagag
CBLT1_0025_B02.b : tttattgattggtgtgaatcctttttttgcccctatatccgccgaaaaaaaattacccgc
PTG01_0024_D06.b : gcaaacccccccaaattaacccccgggaaaaaaaattttgggaagggttaaacccccccg
PTG01_0058_C03.b : cccgaaggtggagtggaaatgtcccaatccctggcataccgggaacttgttaaaaactaa
ITT01_0067_E02.b : tttggaaagaacttcatctggggggtactattgcaaactccccccgaatttaagccctag
MLN01_0080_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0021_G11.b : cccttgggcgccccgttccctttttttttaaacaaacccctccccggtggggaacgtggt
OVRT1_0094_A05.b : cggattcattgggttgccaaccccaagtatttaaagtgggacccggaacaaccaaaattc
OVRT1_0100_B08.b : ggaaataggcccattccctgggcaccccgggaacttgtaaaaattaaaaccttgagggtt
AMP01_0051_E04.b :
CLNT1_0089_D12.b : acttgttttataaacttttggagggacgttttttaaaaccccctgaaatattgaagtggg
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : aattttcggtgcggggagggtttatcccccaaggggtttatattttttcccaaaattggg
MLN01_0015_C09.b : atgttgggatttaaatccggccaggtttttagccccatctcacattgtagataaatccca
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b : tttctggtacacaggaacctttaatataaacttgggggagccccggcggggtaaatacca
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b : ctttttaaaacccccgaaaattgggaggaaaaatgtcccgatttccctgggacacccggg
UTR01_0038_F05.b :
MLN01_0047_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0143_F03.b : aattaaacacaatttctttcttttttttggtcggggggagtgggaagtttttcgccaaaa
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b : xxxxxxxxxxxxxxxxxxxxxxxggggtggactaatggaaaacctcccgaaatttagccc
ITT01_0040_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxacctcgtggggtggacaatttggcacactcc
LVR01_0008_G07.b : gaaaaaactggaaaaaccacagggcttttttaaaagggggcgaaaaaacccgcttggttt
PBL01_0061_B02.b : tggatgcgatctgccgaatcccttgccctccgtaacttgtaatactaacctaaggaatca
HTMT1_0083_F10.b :
SMG01_0015_C01.b : tttgaaagaaccttatctgggggggccaatgggaaaccccccccagattaaacccccggg
BFLT1_0100_A02.b : ttttccggcttccagtggggtgggccaaccccagggttttattggggggaccccggacca
UTR01_0064_B03.b :
BFLT1_0032_F01.b : gcttttttcccgcattcaatggggggtggccaacccccagttttttaatgttggggcccc
OVRT1_0046_E06.b : cgatttaaaaccccggataattggatgggaaaaacggcccgattccctctggaccacccg
MLN01_0041_A09.b : taaggaactaattctggggggcaaaattggaaacacccccggaatttacgccggggaaaa
MLN01_0071_G09.b : xxxxxxxxxxxxxctgtaaagaacttacttcgtggggggctaaatgggcaacccctacga
UTR01_0043_B05.b : ctaaagggcccctgtgggccccccttctcgtttttttttaaacaaaacccccctcctccc
SPL01_0031_H01.b :
OVR01_0001_E04.b : cttaaacccccaggggcttttttaagggggtgtggaacaccccgtgttttttt
BKFL1_0056_F08.b : gggaacccggggggaaaaataacctggaaggttcccccccctaaaaaaggtccaattggg
MLN01_0019_C03.b : ggtctcaggttgggatttaatccgaccaaggtcatagggcccacctcaagtggttgtata
MLN01_0033_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0055_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0118_B05.b :
PST01_0094_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctcatggatcttacc
PBL01_0047_F06.b : tgccggatcctggctctccgtactttgtatactaacctgaaggtcactgccagttaaaca
PST01_0066_A08.b : xxxxxxxxxxxxxcctgcatcaagtggggttgccaactcctcagtattttactgccgaat
KDN01_0017_D07.b : acgtattaaacccctgaatatggagtgcaaacttcccggatctctgggcactccagtaac
PST01_0014_A04.b : xxxxxxxxxxxxxxxccccaaatcggggatacccggaaaaatttgtacaaaggcccaaag
KDN01_0072_C11.b : tacggatgactatttaaaaacccctgaatatggatggccgaacggtcaccattcctctgg
KDN01_0019_H10.b : atggaccttttaaaccccccgaaaattgaggggaaaaattgcccccagtcccttgggacc
PST01_0045_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b : ttacaaataagattggtatcttgctctctcgtagtacttccttgctgctcatttctacgg
HTMT1_0152_B07.b : aaaaagcggggggggttttattcccccccgacccacacccctctggggagcaagaaaaaa
CBLT1_0025_B02.b : cgtcttgttttttttattgtgtgagggagggtgggggttttatcgagagaaaaggaccca
PTG01_0024_D06.b : cccgcgtgaatttcccgggaattttaaaatacacgcgcgggttctttttttttattaaca
PTG01_0058_C03.b : actttagggattcatcggggaggtttaaaacaaaaaacagtgtggggtatacgccttcgg
ITT01_0067_E02.b : gaaaataaaattttaggaaagggtgaaaacccgccatcctgcccgtaaattttccctcgt
MLN01_0080_D03.b : nnnnn
LNG01_0021_G11.b : ggggggaaaaaaaaaa
OVRT1_0094_A05.b : ctttcctccccccaaaaaaccgccccggttggggggggggtttttctcagggggatagtt
OVRT1_0100_B08.b : ccccgggccggtttaaaacccaaaaacaaagtgggtctcccccctcttcgggaagacccc
AMP01_0051_E04.b :
CLNT1_0089_D12.b : aaaattgttccccgaatctccctgtggaaacaccgggaaaaccttttatataatt
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : gacccccaaaaaaattttgcgaagtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0015_C09.b : ccaatggaaggttctgcttaaacccccacccctgacgaacaaaagagatgttttactgtt
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b : aaacaggggggtacccctcttcgggaaaccgcccctgggggaaaaaaaaaccttgggggg
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b : aaccttgttaaaatattaaaacttgaggggggttccccgggcccggtgttaaacccaaaa
UTR01_0038_F05.b :
MLN01_0047_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0143_F03.b : cgccccccgggagagggtttgtattggcctcctatacaaataaaatcttttttgccggcg
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b : taggaataaaaatttaggtaaagggtaaaaccccaagctggccttgaaattcctctgata
ITT01_0040_A02.b : tacggagatcaaacctccaggaaattaaaattttaaggtaaagtggtacacaaccggatg
LVR01_0008_G07.b : ttttttttatatagaaacatttttttttggggggaagagggg
PBL01_0061_B02.b : tcggcccgtagaacacaaacaagtcggtatccgcctccggcagacgctccaatgggaaca
HTMT1_0083_F10.b :
SMG01_0015_C01.b : aaataaaatttttgggaagggggtaccccccccaacccgcgcccaaattttctccgagtt
BFLT1_0100_A02.b : actcaaaataccctccccttcccccaaaaacccgccccgggttggtgggagaaggttctc
UTR01_0064_B03.b :
BFLT1_0032_F01.b : gggaaaaacccaaaattcctttcctttcccccacaaaccccgcccgggttttgggggggg
OVRT1_0046_E06.b : ggaaaccttttaaataataaaaccttgtagggattcccccggcgcgggtaaagaacacaa
MLN01_0041_A09.b : aaattttaggggtagggttaaaaccccaaccctgcgctgaatttttacggagaattaaaa
MLN01_0071_G09.b : atttaaaccctagggaaataaaattttaaggtaagggtgaaccaccccatcgctgcgctg
UTR01_0043_B05.b : ggtggaa
SPL01_0031_H01.b :
OVR01_0001_E04.b :
BKFL1_0056_F08.b : gaacccccnnnnnngttggnnnnnnnggaggagcnntctctactctttttttatcaannn
MLN01_0019_C03.b : aacccaccattggaggttatttttaacccccccccgacaaaaaaaaggatgggttttttt
MLN01_0033_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0055_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0118_B05.b :
PST01_0094_D09.b : ggctgaatcccgggaccgagctcaattattcccttcccttcccctcagaaaccgtgccct
PBL01_0047_F06.b : caacaagtggttatcgctccggcagacgtccattgggacacctaccttggttggggcccc
PST01_0066_A08.b : ccgcgtacgacccaaatatccctccctttccgcacaaaaccgtgcccggcttcggtggaa
KDN01_0017_D07.b : cttgtaacatctaaacctgtcaggggatcacctggcccaggtaaaacccaagaactaagt
PST01_0014_A04.b : gccgaacacctaaggccggttggtggttttccaaggccccccccgagaacctcaaatccc
KDN01_0072_C11.b : cacctcatggaaacctgttacttaactaaaacttgtcagggaattcatccggcgcaggtt
KDN01_0019_H10.b : cccctggaaccttgtaaaatcttaaaccttttacgggaattcccccgggccccgggttaa
PST01_0045_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b : tgtgtgtggtgcctcctacttctctgggccacaaacatatcttgctcgt
HTMT1_0152_B07.b : aggtnnngagagaggggtggacgcagaaaaccctcctcgaagttataaagattttttgtg
CBLT1_0025_B02.b : cgaggagaggggattgtatatgtagttgcactctaataggagaggaagtgat
PTG01_0024_D06.b : cagggatttggcccccccccgtgttataaaccccattggttttgtaaaccccccccccaa
PTG01_0058_C03.b : ggaagaccatcccaggtgggggaaaagctatacgtgtgggggggggggggggcccttacc
ITT01_0067_E02.b : tattttgaaatattccgcgcgtgttttttgtgtttttatataagccccgtgcttgtgcct
MLN01_0080_D03.b :
LNG01_0021_G11.b :
OVRT1_0094_A05.b : ccccatgggaaccaaaaaatgtaaggccaagggccaaaaggggtttggtttttcccccac
OVRT1_0100_B08.b : tccaattggtgttcacacacctatactgtgtg
AMP01_0051_E04.b :
CLNT1_0089_D12.b :
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0015_C09.b : tcctatagtaaaaaaacccatttaaaatttttcgtccttggtcacactttaatgggtccc
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b : gggggccccccccccccccgcgcccaaaaaaaaacagcggggnnnnnnnnnnnnnnnnnn
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b : aaacaagtggggttctcctcccttccggggaaaacccttctacatgggggaaacaaacta
UTR01_0038_F05.b :
MLN01_0047_H08.b : nnnnnnnnnnn
HTMT1_0143_F03.b : aatattgaatgatagttccaagagaagaagaataaagagcgaagatagaatgatattttc
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b : attttaaaattacacgcccggttcttttgtgttttaattaccccggcattggccctccca
ITT01_0040_A02.b : gctgccgcttaaattttctcccggaataatttgtaaaatttaccggggccggggtctctt
LVR01_0008_G07.b :
PBL01_0061_B02.b : acctacccgtggcggggggggccctacccccggcccggggccgaaaaaaaaaagcccggc
HTMT1_0083_F10.b :
SMG01_0015_C01.b : attaaaaaatatacccgcggcgcgtctttttgtgttttaatacccgcggttttccccccc
BFLT1_0100_A02.b : ctccaggggaaaa
UTR01_0064_B03.b :
BFLT1_0032_F01.b : aaaataat
OVRT1_0046_E06.b : aaaccaagttggggttacccgcctctccgggaaaacgctttcaacggtgggagaaa
MLN01_0041_A09.b : aataaa
MLN01_0071_G09.b : gaaattcttcgggggatttaaaaatataccggccgtgtgtttg
UTR01_0043_B05.b :
SPL01_0031_H01.b :
OVR01_0001_E04.b :
BKFL1_0056_F08.b : nt
MLN01_0019_C03.b : tcttgtgtaaaaaaccattcaaattttctctgggtcacaaaatagggcga
MLN01_0033_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0055_E05.b :
OVRM1_0118_B05.b :
PST01_0094_D09.b : ggcttgggtggggaagggtttcctccttaaggggtaacggttccccaatcggggaacccg
PBL01_0047_F06.b : tcccggcccggccaaaaaaaaaaggggccccggccccccnnnnaannnnagagtatgaaa
PST01_0066_A08.b : gggtttccccctaaggggaatgttccacaatgggaacccgaaaatttgaaaggcnaaggc
KDN01_0017_D07.b : ggggtaacctgctctccggtagaccgcttccaagtggaggacaaccttaacggttggctg
PST01_0014_A04.b : cttataaaggggaacccaggaataaaaccggtttcccgaaccctggcctcttcaccgcct
KDN01_0072_C11.b : aggatcaacaaaaaccgagtgcggttcacccggctttcccgggctaaaccgctttccgac
KDN01_0019_H10.b : aacccaaaaacaaggggtggggttaaccgcccttctcgggaaaaaaccccctccccaagt
PST01_0045_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b :
HTMT1_0152_B07.b : ggggggggggcgccccgcnnnnnnaaaaactaaaaaagggtgtgggttg
CBLT1_0025_B02.b :
PTG01_0024_D06.b : aaagttggttttttgaaaactattttt
PTG01_0058_C03.b : cggggacctgggggcccagaaaaaaaaaagagtgtgggggggcttatcgggaacaccttt
ITT01_0067_E02.b : ctctccacttgtgatatatcccaaactttgggattttcttataccccccccccaaaaaaa
MLN01_0080_D03.b :
LNG01_0021_G11.b :
OVRT1_0094_A05.b : aaaaaaaaaaaaagaagaa
OVRT1_0100_B08.b :
AMP01_0051_E04.b :
CLNT1_0089_D12.b :
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0015_C09.b : aaaaaccggggagttttgaaaacccctccccccaagcccgcgagggggggganncccttc
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b : aacacgtttgttgggagagagct
UTR01_0038_F05.b :
MLN01_0047_H08.b :
HTMT1_0143_F03.b : cccaaaaaaatgaaagaaatcagtaatgacaaagaaatcaannannnnnnnttctgagtg
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b : cgtttgataacaccacattggggtttgttaaacccccccccacaaaaagatggttttttt
ITT01_0040_A02.b : tttgggtttt
LVR01_0008_G07.b :
PBL01_0061_B02.b : ccccgccccccccccnnannnnnnnnnnggggggccaaaaggtgttcatcccnnnnnnnn
HTMT1_0083_F10.b :
SMG01_0015_C01.b : ccccctgtgtaaataacc
BFLT1_0100_A02.b :
UTR01_0064_B03.b :
BFLT1_0032_F01.b :
OVRT1_0046_E06.b :
MLN01_0041_A09.b :
MLN01_0071_G09.b :
UTR01_0043_B05.b :
SPL01_0031_H01.b :
OVR01_0001_E04.b :
BKFL1_0056_F08.b :
MLN01_0019_C03.b :
MLN01_0033_A09.b :
MLN01_0055_E05.b :
OVRM1_0118_B05.b :
PST01_0094_D09.b : gaaaaatgttaaaggccccaaggcgcaacataaggccgtttggttttttaagcccccccg
PBL01_0047_F06.b : ttgttaccannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0066_A08.b : gaactaaggcggttggtttttagtcccccgaaactaaatcccttagggcacagaaaaaaa
KDN01_0017_D07.b : gagggggggcttaccccggcccttcgggccaaagaaaaaaaaagagggggggcgggaccc
PST01_0014_A04.b : aaaagtgtcctttcctgagagggtcttacccggatatcttgaggtctccgcgggggaacc
KDN01_0072_C11.b : ttggggaaccaaaaccctataccgg
KDN01_0019_H10.b : gggggaaacaaaaccttaaccccgtgtgggggtgggggggggggccttataccccggggg
PST01_0045_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b :
HTMT1_0152_B07.b :
CBLT1_0025_B02.b :
PTG01_0024_D06.b :
PTG01_0058_C03.b : aagaattaaacgcccccggaggnngngtggggccttgagtgggggctgggggggcc
ITT01_0067_E02.b : gaattgtgtttatattattgacaa
MLN01_0080_D03.b :
LNG01_0021_G11.b :
OVRT1_0094_A05.b :
OVRT1_0100_B08.b :
AMP01_0051_E04.b :
CLNT1_0089_D12.b :
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b : n
MLN01_0015_C09.b : ggcnggttaatagcctcatatcgtaagaannnnnnnnnnnnnnnnnnnnnnnnnnnncac
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b :
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b :
UTR01_0038_F05.b :
MLN01_0047_H08.b :
HTMT1_0143_F03.b : agaacngnnaanagnnnnnatctagtgtgtggtagattgttttgtnnnnnncccnnnnnn
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b : tttataaaaaacacaactatttt
ITT01_0040_A02.b :
LVR01_0008_G07.b :
PBL01_0061_B02.b : t
HTMT1_0083_F10.b :
SMG01_0015_C01.b :
BFLT1_0100_A02.b :
UTR01_0064_B03.b :
BFLT1_0032_F01.b :
OVRT1_0046_E06.b :
MLN01_0041_A09.b :
MLN01_0071_G09.b :
UTR01_0043_B05.b :
SPL01_0031_H01.b :
OVR01_0001_E04.b :
BKFL1_0056_F08.b :
MLN01_0019_C03.b :
MLN01_0033_A09.b :
MLN01_0055_E05.b :
OVRM1_0118_B05.b :
PST01_0094_D09.b : aaaacaaaaagccctcaggg
PBL01_0047_F06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0066_A08.b : gttcctacccgcctttcacacaa
KDN01_0017_D07.b : ccccccacnnnnnnggataaaacanaanaataaatttagagcccctctctcccacacaan
PST01_0014_A04.b : cccccccgctttatttttttc
KDN01_0072_C11.b :
KDN01_0019_H10.b : accttaggggac
PST01_0045_H10.b :
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b :
HTMT1_0152_B07.b :
CBLT1_0025_B02.b :
PTG01_0024_D06.b :
PTG01_0058_C03.b :
ITT01_0067_E02.b :
MLN01_0080_D03.b :
LNG01_0021_G11.b :
OVRT1_0094_A05.b :
OVRT1_0100_B08.b :
AMP01_0051_E04.b :
CLNT1_0089_D12.b :
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b :
MLN01_0015_C09.b : ctccctatatcgccgcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b :
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b :
UTR01_0038_F05.b :
MLN01_0047_H08.b :
HTMT1_0143_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnggangnagnacgannataaatggagaagaagcgac
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b :
ITT01_0040_A02.b :
LVR01_0008_G07.b :
PBL01_0061_B02.b :
HTMT1_0083_F10.b :
SMG01_0015_C01.b :
BFLT1_0100_A02.b :
UTR01_0064_B03.b :
BFLT1_0032_F01.b :
OVRT1_0046_E06.b :
MLN01_0041_A09.b :
MLN01_0071_G09.b :
UTR01_0043_B05.b :
SPL01_0031_H01.b :
OVR01_0001_E04.b :
BKFL1_0056_F08.b :
MLN01_0019_C03.b :
MLN01_0033_A09.b :
MLN01_0055_E05.b :
OVRM1_0118_B05.b :
PST01_0094_D09.b :
PBL01_0047_F06.b :
PST01_0066_A08.b :
KDN01_0017_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0014_A04.b :
KDN01_0072_C11.b :
KDN01_0019_H10.b :
PST01_0045_H10.b :
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b :
HTMT1_0152_B07.b :
CBLT1_0025_B02.b :
PTG01_0024_D06.b :
PTG01_0058_C03.b :
ITT01_0067_E02.b :
MLN01_0080_D03.b :
LNG01_0021_G11.b :
OVRT1_0094_A05.b :
OVRT1_0100_B08.b :
AMP01_0051_E04.b :
CLNT1_0089_D12.b :
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b :
MLN01_0015_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b :
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b :
UTR01_0038_F05.b :
MLN01_0047_H08.b :
HTMT1_0143_F03.b : tgtggcagcagatatttatatt
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b :
ITT01_0040_A02.b :
LVR01_0008_G07.b :
PBL01_0061_B02.b :
HTMT1_0083_F10.b :
SMG01_0015_C01.b :
BFLT1_0100_A02.b :
UTR01_0064_B03.b :
BFLT1_0032_F01.b :
OVRT1_0046_E06.b :
MLN01_0041_A09.b :
MLN01_0071_G09.b :
UTR01_0043_B05.b :
SPL01_0031_H01.b :
OVR01_0001_E04.b :
BKFL1_0056_F08.b :
MLN01_0019_C03.b :
MLN01_0033_A09.b :
MLN01_0055_E05.b :
OVRM1_0118_B05.b :
PST01_0094_D09.b :
PBL01_0047_F06.b :
PST01_0066_A08.b :
KDN01_0017_D07.b :
PST01_0014_A04.b :
KDN01_0072_C11.b :
KDN01_0019_H10.b :
PST01_0045_H10.b :
20110601C-002243 : ............................................................
---------+---------+---------+---------+---------+---------+ 1054
OVRT1_0124_H04.b :
HTMT1_0152_B07.b :
CBLT1_0025_B02.b :
PTG01_0024_D06.b :
PTG01_0058_C03.b :
ITT01_0067_E02.b :
MLN01_0080_D03.b :
LNG01_0021_G11.b :
OVRT1_0094_A05.b :
OVRT1_0100_B08.b :
AMP01_0051_E04.b :
CLNT1_0089_D12.b :
LVRM1_0033_D01.b :
OVRM1_0122_B12.b :
LVRM1_0114_B11.b :
ILNT1_0065_F07.b :
MLN01_0015_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0089_G02.b :
UTR01_0022_B04.b :
ITT01_0025_H07.b :
OVRT1_0130_F04.b :
UTR01_0018_G05.b :
UTR01_0032_A05.b :
OVRT1_0026_H06.b :
UTR01_0038_F05.b :
MLN01_0047_H08.b :
HTMT1_0143_F03.b :
UTR01_0104_C11.b :
UTR01_0082_E02.b :
ITT01_0091_A07.b :
ITT01_0040_A02.b :
LVR01_0008_G07.b :
PBL01_0061_B02.b :
HTMT1_0083_F10.b :
SMG01_0015_C01.b :
BFLT1_0100_A02.b :
UTR01_0064_B03.b :
BFLT1_0032_F01.b :
OVRT1_0046_E06.b :
MLN01_0041_A09.b :
MLN01_0071_G09.b :
UTR01_0043_B05.b :
SPL01_0031_H01.b :
OVR01_0001_E04.b :
BKFL1_0056_F08.b :
MLN01_0019_C03.b :
MLN01_0033_A09.b :
MLN01_0055_E05.b :
OVRM1_0118_B05.b :
PST01_0094_D09.b :
PBL01_0047_F06.b :
PST01_0066_A08.b :
KDN01_0017_D07.b :
PST01_0014_A04.b :
KDN01_0072_C11.b :
KDN01_0019_H10.b :
PST01_0045_H10.b :