[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002265

Length: 2,322

Sequence [FASTA format sequence]
GATTGGAATT CCTGATGCTA CAGGACGCTT GGAAATTCTT CAAATCCATA CCAAGAATAT
GAAGCTGGCA GATGATGTGG ACCTTGAACA GGTAGCCAAT GAAACTCATG GGCATGTTGG
TGCTGACTTA GCAGCCCTGT GCTCAGAGGC TGCTCTGCAA GCCATCCGCA AAAAGATGGA
CCTCATTGAC CTAGAAGACG AAACCATCGA TGCTGAGGTC ATGAACTCCC TGGCAGTTAC
CATGGATGAC TTCCGATGGG CCCTAAGCCA GAGCAACCCA TCAGCACTTC GGGAAACTGT
GGTAGAGGTG CCACAGGTGA CCTGGGAGGA CATTGGGGGC TTGGAGGATG TCAAACGTGA
GCTTCAGGAG CTGGTCCAGT ATCCTGTGGA GCACCCAGAC AAATTCCTCA AGTTTGGCAT
GACACCCTCC AAGGGAGTGC TATTCTATGG ACCTCCTGGC TGTGGGAAAA CCTTGCTGGC
CAAAGCCATT GCTAATGAGT GCCAGGCCAA CTTCATCTCC ATCAAAGGTC CTGAGCTGCT
CACCATGTGG TTTGGGGAAT CAGAGGCCAA TGTTAGGGAA ATCTTTGACA AGGCCCGCCA
AGCTGCCCCC TGTGTACTGT TCTTTGATGA GCTGGATTCA ATTGCCAAGG CCCGTGGTGG
CAACATTGGA GATGGTGGTG GGGCTGCCGA CCGAGTCATC AACCAGATCT TGACAGAAAT
GGATGGCATG TCCACAAAAA AAAATGTGTT TATCATTGGC GCTACCAACC GACCTGACAT
CATTGATCCT GCCATCTTGC GACCTGGCCG CCTTGATCAG CTCATCTACA TCCCACTTCC
TGATGAGAAG TCCCGTGTCG CCATTCTCAA GGCCAACCTG CGCAAGTCCC CCGTTGCCAA
GGATGTGGAT TTGGAGTTCC TGGCTAAGAT GACTAATGGC TTCTCTGGAG CTGACTTGAC
AGAGATTTGC CAACGTGCTT GCAAGCTGGC CATCCGAGAA TCAATCGAGA GTGAGATTAG
GCGAGAACGG GAGAGGCAGA CCAACCCATC GGCCATGGAG GTAGAGGAAG ATGATCCAGT
GCCTGAGATC CGACGGGATC ACTTTGAGGA AGCCATGCGT TTTGCCCGCC GTTCTGTTAG
TGATAATGAC ATCCGGAAGT ATGAGATGTT TGCTCAGACC CTTCAGCAGA GTCGAGGCTT
TGGCAGCTTC AGATTCCCTT CAGGAAACCA AGGTGGAGCT GGACCCAGTC AGGGCAGTGG
CGGTGGCACA GGTGGCAGTG TGTACACGGA AGATAATGAT GATGACCTGT ATGGCTAAGT
GGTGGTAGCC AGCATGCAGT GAGCTGGCCT GGCTGGACTT TGTTCCCTGA GGGTGGGGGC
GCCCGCCCAG GAGGGACCAC GGGTGCGCCC ACGGCCTGTT CCATTCCTCA GTCTGAACAG
TTCAGCTACA GTCAGACTCT GGACAGGGGG TTAACTGTTG GAAAAAAATT CAAAACAAAA
GTGATAAAAT AAAAGCAATT TTCATTTGGG AGGCGGAGAG TGAATTACCA ACAGGGAATT
GGGCCTTGGG CCTATGCCAC TTCTGTTGTA GTTGGGGCAG TGCAGGGGAC CTCTGTGGGT
GCGAAGAAAG GCATTATTGC CACTCCCCAC AGTAAAGCAT CTGCACTTCA CTCAATGCTG
CCCATGCCCT CCCTTCTTCC CCCTACCCAA CTTGGGCAGG AGGATGAAGG GCTCCAGTTG
CTGGGTGTTT ATATAGAGTA GGTTGATTTT TATTTTACAT GCTTTTGAGT TAATGTTGGA
AAACTAATCA CAAGCAGTTT CTAAACCAAA AATGACATGC TGTAAAAGGA CAATAAACGT
TGGGTCAAAA TGGAGCCTGA GTCCTGGCCC CTGTGCCTGC TTCTTTTCCT GGGAAGGGCC
TTGGGCCTCA TTGCCAAGGC ACTCTTCCAC ATGTGAAATC CTGGGAGTAG GATTGCACCA
CCTTCCCCTC CTGATAACAT TGGTATGCTG CTGCCTCGCC CAGTGTTTGC AGTATCATTG
GAGAGGACTG CAGTGGAGGG AGAGCAGTCT TACAGAGTTC CAGTGCGGAG AATGTGGCAT
CCTCCACCTG TGTCTGGTTG GGTGGTGAGA CTAGTCCTGG AGAGCCCCCA TTTTCTGACT
GANGCTGGAT TGGGGTGCCC NTCAAAAATC TTAAGGTTGT AGAAAAGTAA AGTCTCTGTC
TGGAGAGATG GATGTTTCTC TGATGCATCT AAAAGTTCCA TATATTCATG TTTCTGGTAA
GGATCACTTN ACAATTATGT CCACCTTTAT CTTATGTAAT TT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVCPtransitional endoplasmic reticulum ATPase [Homo sapiens]. 7550.0
Contig/Assembly ProteinSPATA5spermatogenesis-associated protein 5 [Homo sapiens]. 3103e-84
Contig/Assembly ProteinNVLnuclear valosin-containing protein-like isoform 2 [Homo sapiens]. 2851e-76
Contig/Assembly ProteinNVLnuclear valosin-containing protein-like isoform 4 [Homo sapiens]. 2851e-76
Contig/Assembly ProteinNVLnuclear valosin-containing protein-like isoform 3 [Homo sapiens]. 2851e-76
Contig/Assembly ProteinNVLnuclear valosin-containing protein-like isoform 1 [Homo sapiens]. 2851e-76
Contig/Assembly ProteinSPATA5L1spermatogenesis-associated protein 5-like protein 1 [Homo sapiens]. 2574e-68
Contig/Assembly ProteinPEX1peroxisome biogenesis factor 1 [Homo sapiens]. 2343e-61
Contig/Assembly ProteinPEX6peroxisome biogenesis factor 6 [Homo sapiens]. 2343e-61
Contig/Assembly ProteinPSMC226S protease regulatory subunit 7 isoform 1 [Homo sapiens]. 1973e-50


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVcptransitional endoplasmic reticulum ATPase [Mus musculus]. 7550.0
Contig/Assembly ProteinSpata5spermatogenesis-associated protein 5 isoform 2 [Mus musculus]. 3081e-83
Contig/Assembly ProteinSpata5spermatogenesis-associated protein 5 isoform 1 [Mus musculus]. 3081e-83
Contig/Assembly ProteinNvlnuclear valosin-containing protein-like [Mus musculus]. 2864e-77
Contig/Assembly ProteinPex6peroxisome assembly factor 2 [Mus musculus]. 2399e-63
Contig/Assembly ProteinSpata5l1PREDICTED: LOW QUALITY PROTEIN: spermatogenesis associated 5-like 1 [Mus musculus]. 2382e-62
Contig/Assembly ProteinPex1peroxisome biogenesis factor 1 [Mus musculus]. 2303e-60
Contig/Assembly ProteinPsmc226S protease regulatory subunit 7 [Mus musculus]. 1972e-50
Contig/Assembly ProteinPsmc626S protease regulatory subunit 10B [Mus musculus]. 1965e-50
Contig/Assembly ProteinPsmc526S protease regulatory subunit 8 [Mus musculus]. 1921e-48


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC481590PREDICTED: similar to Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)-ATPase p97 subunit) (Valosin-containing protein) (VCP) isoform 9 [Canis familiaris]. 7550.0
Contig/Assembly ProteinLOC481590PREDICTED: similar to Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)-ATPase p97 subunit) (Valosin-containing protein) (VCP) isoform 10 [Canis familiaris]. 7550.0
Contig/Assembly ProteinLOC481590PREDICTED: similar to valosin-containing protein isoform 3 [Canis familiaris]. 7550.0
Contig/Assembly ProteinLOC481590PREDICTED: similar to valosin-containing protein isoform 4 [Canis familiaris]. 7550.0
Contig/Assembly ProteinLOC481590PREDICTED: similar to Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)-ATPase p97 subunit) (Valosin-containing protein) (VCP) isoform 13 [Canis familiaris]. 7490.0
Contig/Assembly ProteinLOC481590PREDICTED: similar to Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)-ATPase p97 subunit) (Valosin-containing protein) (VCP) isoform 1 [Canis familiaris]. 7490.0
Contig/Assembly ProteinLOC481590PREDICTED: similar to Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)-ATPase p97 subunit) (Valosin-containing protein) (VCP) isoform 12 [Canis familiaris]. 7460.0
Contig/Assembly ProteinLOC481590PREDICTED: similar to Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)-ATPase p97 subunit) (Valosin-containing protein) (VCP) isoform 11 [Canis familiaris]. 7260.0
Contig/Assembly ProteinLOC481590PREDICTED: similar to Transitional endoplasmic reticulum ATPase (TER ATPase) (15S Mg(2+)-ATPase p97 subunit) (Valosin-containing protein) (VCP) isoform 5 [Canis familiaris]. 6430.0
Contig/Assembly ProteinLOC483840PREDICTED: similar to spermatogenesis associated factor SPAF [Canis familiaris]. 3152e-85


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVCPtransitional endoplasmic reticulum ATPase [Bos taurus]. 7550.0
Contig/Assembly ProteinLOC100297992PREDICTED: spermatogenesis associated 5-like, partial [Bos taurus]. 3081e-83
Contig/Assembly ProteinNVLPREDICTED: nuclear VCP-like [Bos taurus]. 2705e-72
Contig/Assembly ProteinNVLPREDICTED: nuclear VCP-like [Bos taurus]. 2681e-71
Contig/Assembly ProteinSPATA5L1spermatogenesis-associated protein 5-like protein 1 [Bos taurus]. 2565e-68
Contig/Assembly ProteinSPATA5PREDICTED: Cell Division Cycle related family member (cdc-48.2)-like, partial [Bos taurus]. 2498e-66
Contig/Assembly ProteinPEX1PREDICTED: peroxisomal biogenesis factor 1 [Bos taurus]. 2365e-62
Contig/Assembly ProteinPEX6peroxisome assembly factor 2 [Bos taurus]. 2351e-61
Contig/Assembly ProteinPEX1peroxisome biogenesis factor 1 [Bos taurus]. 2351e-61
Contig/Assembly ProteinPEX6PREDICTED: peroxisomal biogenesis factor 6 [Bos taurus]. 2351e-61


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVCPtransitional endoplasmic reticulum ATPase [Sus scrofa]. 7540.0
Contig/Assembly ProteinSPATA5spermatogenesis-associated protein 5 [Sus scrofa]. 3063e-83
Contig/Assembly ProteinSPATA5L1spermatogenesis-associated protein 5-like protein 1 [Sus scrofa]. 2596e-69
Contig/Assembly ProteinLOC100626142PREDICTED: LOW QUALITY PROTEIN: peroxisome biogenesis factor 1-like [Sus scrofa]. 2365e-62
Contig/Assembly ProteinPEX6peroxisome biogenesis factor 6 [Sus scrofa]. 2342e-61
Contig/Assembly ProteinLOC100514865PREDICTED: 26S protease regulatory subunit 7-like [Sus scrofa]. 1972e-50
Contig/Assembly ProteinLOC100624151PREDICTED: 26S protease regulatory subunit 7-like [Sus scrofa]. 1972e-50
Contig/Assembly ProteinPSMC6PREDICTED: 26S protease regulatory subunit 10B [Sus scrofa]. 1964e-50
Contig/Assembly ProteinTBP1026S protease regulatory subunit 8 [Sus scrofa]. 1927e-49
Contig/Assembly ProteinPSMC1PREDICTED: 26S protease regulatory subunit 4 isoform 2 [Sus scrofa]. 1912e-48


Assembly Members: 26      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010001A08ADR01_0001_A08.bDB781572 
ADR010004C02ADR01_0004_C02.bDB781857 
ADR010020D04ADR01_0020_D04.bDB783245 
ADR010045C10ADR01_0045_C10.bDB785486 
ADR010068B10ADR01_0068_B10.bDB787526 
AMP010010G05AMP01_0010_G05.bBW955729 
HTMT10058B11HTMT1_0058_B11.bFS668308 
ITT010055A11ITT01_0055_A11.bBW980854 
LNG010031C09LNG01_0031_C09.bBP435640 
LVRM10081H03LVRM1_0081_H03.bCJ002494 
MLN010031E08MLN01_0031_E08.bCJ010061 
OVR010030G01OVR01_0030_G01.bBP143961 
OVR010031G01OVR01_0031_G01.bBP143962 
OVR010089D11OVR01_0089_D11.bBW967305 
OVRM10091F09OVRM1_0091_F09.bBP152026 
OVRM10107C06OVRM1_0107_C06.bBP147974 
OVRM10166F12OVRM1_0166_F12.bBP460348 
OVRM10168D01OVRM1_0168_D01.bBP457516 
OVRM10176A03OVRM1_0176_A03.b  
OVRM10193E05OVRM1_0193_E05.bBP458818 
OVRM10198B02OVRM1_0198_B02.bBP455689 
PBL010049A08PBL01_0049_A08.bBW970948 
PTG010057D10PTG01_0057_D10.bFS709418 
SPL010087E02SPL01_0087_E02.bCJ020859 
THY010093A04THY01_0093_A04.bBP159739 
UTR010072B06UTR01_0072_B06.bBP463101 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
892C630.562WSCCC/P
T700.438CCT/P
997A1020.800WSCGA/R
C300.200CGC/R
1180C720.818WSACC/T
T200.182ACT/T


Alignment:      TOP

20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
MLN01_0031_E08.b : nggctaggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0057_D10.b : nnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : ...............GATTGGAATTCCTGATGCTACAGGACGCTTGGAAATTCTTCAAAT
---------+---------+---------+---------+---------+---------+ 45
MLN01_0031_E08.b : xxxxxxxxxxxxxxxGATTGGAATTCCTGATGCTACAGGACGCTTGGAAATTCTTCAAAT
PTG01_0057_D10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxACAGGACGCTTGGAAATTCTTCAGAT
OVRM1_0193_E05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0166_F12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CCATACCAAGAATATGAAGCTGGCAGATGATGTGGACCTTGAACAGGTAGCCAATGAAAC
---------+---------+---------+---------+---------+---------+ 105
MLN01_0031_E08.b : CCATACCAAGAATATGAAGCTGGCAGATGATGTGGACCTTGAACAGGTAGCCAATGAAAC
PTG01_0057_D10.b : CCATACCAAGAATATGAAGCTGGCAGATGATGTGGACCTTGAACAGGTAGCCAATGAAAC
OVRM1_0193_E05.b : xxxxxxxxxxxxTATGAAGCTGGCAGATGATGTGGACCTTGAACAGGTAGCCAATGAAAC
OVRM1_0166_F12.b : xxxxxxxxxxxxxxTGAAGCTGGCAGATGATGTGGACCTTGAACAGGTAGCCAATGAAAC
OVRM1_0107_C06.b : cagttgtcxxxx
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : TCATGGGCATGTTGGTGCTGACTTAGCAGCCCTGTGCTCAGAGGCTGCTCTGCAAGCCAT
---------+---------+---------+---------+---------+---------+ 165
MLN01_0031_E08.b : TCATGGGCATGTTGGTGCTGACTTAGCAGCCTTGTGCTCAGAGGCTGCTCTGCAAGCCAT
PTG01_0057_D10.b : TCATGGGCATGTTGGTGCTGACTTAGCAGCCCTGTGCTCAGAGGCTGCTCTGCAAGCCAT
OVRM1_0193_E05.b : TCATGGGCATGTTGGTGCTGACTTAGCAGCCCTGTGCTCAGAGGCTGCTCTGCAAGCCAT
OVRM1_0166_F12.b : TCATGGGCATGTTGGTGCTGACTTAGCAGCCCTGTGCTCAGAGGCTGCTCTGCAAGCCAT
OVRM1_0107_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCAAGCCAT
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CCGCAAAAAGATGGACCTCATTGACCTAGAAGACGAAACCATCGATGCTGAGGTCATGAA
---------+---------+---------+---------+---------+---------+ 225
MLN01_0031_E08.b : CCGCAAAAAGATGGACCTCATTGACCTAGAAGACGAAACCATCGATGCTGAGGTCATGAA
PTG01_0057_D10.b : CCGCAAAAAGATGGACCTCATTGACCTAGAAGACGAAACCATCGATGCTGAGGTCATGAA
OVRM1_0193_E05.b : CCGCAAAAAGATGGACCTCATCGACCTAGAAGACGAAACCATCGATGCTGAGGTCATGAA
OVRM1_0166_F12.b : CCGCAAAGAGATGGACCTCATTGACCTAGAAGACGAAACCATCGATGCTGAGGTCATGAA
OVRM1_0107_C06.b : CCGCAAAAAGATGGACCTCATTGACCTAGAAGACGAAACCATCGATGCTGAGGTCATGAA
LVRM1_0081_H03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CTCCCTGGCAGTTACCATGGATGACTTCCGATGGGCCCTAAGCCAGAGCAACCCATCAGC
---------+---------+---------+---------+---------+---------+ 285
MLN01_0031_E08.b : CTCCCTGGCAGTTACCATGGATGACTTCCGATGGGCCCTAAGCCAGAGCAACCCATCAGC
PTG01_0057_D10.b : CTCCCTGGCAGTTACCATGGATGACTTCCGATGGGCCCTAAGCCAGAGCAACCCATCAGC
OVRM1_0193_E05.b : CTCCCTGGCAGTTACCATGGATGACTTCCGATGGGCCCTAAGCCAGAGCAACCCATCAGC
OVRM1_0166_F12.b : CTCCCTGGCAGTTACCATGGATGACTTCCGATGGGCCCTAAGCCAGAGCAACCCATCAGC
OVRM1_0107_C06.b : CTCCCTGGCAGTTACCATGGATGACTTCCGATGGGCCCTAAGCCAGAGCAACCCATCAGC
LVRM1_0081_H03.b : xxxxxxxxxxGTTACCATGGATGACTTCCGATGGGCCCTAAGCCAGAGCAACCCATCAGC
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : ACTTCGGGAAACTGTGGTAGAGGTGCCACAGGTGACCTGGGAGGACATTGGGGGCTTGGA
---------+---------+---------+---------+---------+---------+ 345
MLN01_0031_E08.b : ACTTCGGGAAACTGTGGTAGAGGTGCCACAGGTGACCTGGGAGGACATTGGGGGCTTGGA
PTG01_0057_D10.b : ACTTCGGGAAACTGTGGTAGAGGTGCCACAGGTGACCTGGGAGGACATTGGGGGCTTGGA
OVRM1_0193_E05.b : ACTTCGGGAAACTGTGGTAGAGGTGCCACAGGTGACCTGGGAGGACATTGGGGGCTTGGA
OVRM1_0166_F12.b : ACCTCGGGAAACTGTGGTAGAGGTGCCACAGGTGACCTGGGAGGACATTGGGGGCTTGGA
OVRM1_0107_C06.b : ACTTCGGGAAACTGTGGTAGAGGTGCCACAGGTGACCTGGGAGGACATTGGGGGCTTGGA
LVRM1_0081_H03.b : ACTTCGGGAAACTGTGGTAGAGGTGCCACAGGTGACCTGGGAGGACATTGGGGGCTTGGA
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : GGATGTCAAACGTGAGCTTCAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATT
---------+---------+---------+---------+---------+---------+ 405
MLN01_0031_E08.b : GGATGTCAAACGTGAGCTTCAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATT
PTG01_0057_D10.b : GGATGTCAAACGTGAGCTTCAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATT
OVRM1_0193_E05.b : GGATGTCAAACGTGAGCTTCAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATT
OVRM1_0166_F12.b : GGATGTCAAACGTGAGCTTCAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATT
OVRM1_0107_C06.b : GGATGTCAAACGTGAGCTTCAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATT
LVRM1_0081_H03.b : GGATGTCAAACGTGAGCTTCAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATT
ADR01_0001_A08.b : gtaacaxxx
SPL01_0087_E02.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CCTCAAGTTTGGCATGACACCCTCCAAGGGAGTGCTATTCTATGGACCTCCTGGCTGTGG
---------+---------+---------+---------+---------+---------+ 465
MLN01_0031_E08.b : CCTCAAGTTTGGCATGACACCCTCCAAGGGAGTGCTATTCTATGGACCTCCTGGCTGTGG
PTG01_0057_D10.b : CCTCAAGTTTGGCATGACACCCTCCAAGGGAGTGCTATTCTATGGACCTCCTGGCTGTGG
OVRM1_0193_E05.b : CCTCAAGTTTGGCATGACACCCTCCAAGGGAGTGCTATTCTATGGACCTCCTGGCTGTGG
OVRM1_0166_F12.b : CCCCAAGTTTGGCATGACACCCTCCAAGGGAGTGCTATTCTATGGACCTCCTGGCTGTGG
OVRM1_0107_C06.b : CCTCAAGTTTGGCATGACACCCTCCAAGGGAGTGCTATTCTATGGACCTCCTGGCTGTGG
LVRM1_0081_H03.b : CCTCAAGTTTGGCATGACACCCTCCAAGGGAGTGCTATTCTATGGACCTCCTGGCTGTGG
ADR01_0001_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGGACCTCCTGGCTGTGG
SPL01_0087_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGGACCTCCTGGCTGTGG
OVRM1_0198_B02.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0004_C02.b : nnngggtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0068_B10.b : nngcataannnn
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
---------+---------+---------+---------+---------+---------+ 525
MLN01_0031_E08.b : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
PTG01_0057_D10.b : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
OVRM1_0193_E05.b : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
OVRM1_0166_F12.b : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
OVRM1_0107_C06.b : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
LVRM1_0081_H03.b : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
ADR01_0001_A08.b : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
SPL01_0087_E02.b : GAAAACCTTGCTGGCCAAAGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
OVRM1_0198_B02.b : xxxxxggTTGCTGGTCAAAGCCATTGCTGATGAGTGCCAGGCCAACTTCATCTCCATCAA
ADR01_0004_C02.b : xxxxxxxxxxxxxxxxxxxGCCATTGCTAATGAGTGCCAGGCCAACTTCATCTCCATCAA
ADR01_0068_B10.b : nnggagtaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggAA
ADR01_0020_D04.b : tgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcA
OVRM1_0176_A03.b : agtt
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
---------+---------+---------+---------+---------+---------+ 585
MLN01_0031_E08.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
PTG01_0057_D10.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
OVRM1_0193_E05.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
OVRM1_0166_F12.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
OVRM1_0107_C06.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
LVRM1_0081_H03.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
ADR01_0001_A08.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
SPL01_0087_E02.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
OVRM1_0198_B02.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGACGGCAATGTTAAGGAAATCTT
ADR01_0004_C02.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
ADR01_0068_B10.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
ADR01_0020_D04.b : AGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAATCAGAGGCCAATGTTAGGGAAATCTT
OVRM1_0176_A03.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagtatccT
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b : nttatcgtaatcxxxxxxxxxxxxxxxx
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
---------+---------+---------+---------+---------+---------+ 645
MLN01_0031_E08.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
PTG01_0057_D10.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
OVRM1_0193_E05.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
OVRM1_0166_F12.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
OVRM1_0107_C06.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
LVRM1_0081_H03.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
ADR01_0001_A08.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
SPL01_0087_E02.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
OVRM1_0198_B02.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
ADR01_0004_C02.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
ADR01_0068_B10.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
ADR01_0020_D04.b : TGACAAGGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
OVRM1_0176_A03.b : TGACAAAGCCCGCCAAGCTGCCCCCTGTGTACTGTTCTTTGATGAGCTGGATTCAATTGC
OVR01_0089_D11.b : gctttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0072_B06.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0045_C10.b : nnggtgxxxxxxxxxxxxxxxx
THY01_0093_A04.b : ttgcgtttaacggctttaggxxxxxxxx
AMP01_0010_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0030_G01.b : tctaacagat
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
---------+---------+---------+---------+---------+---------+ 705
MLN01_0031_E08.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
PTG01_0057_D10.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
OVRM1_0193_E05.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
OVRM1_0166_F12.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
OVRM1_0107_C06.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
LVRM1_0081_H03.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
ADR01_0001_A08.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
SPL01_0087_E02.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
OVRM1_0198_B02.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
ADR01_0004_C02.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
ADR01_0068_B10.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
ADR01_0020_D04.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
OVRM1_0176_A03.b : CAAGGCCCGTGGTGGCAACATTGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
OVR01_0089_D11.b : xxxxxxxxxxxxxxxxxxxxxxGGAGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
UTR01_0072_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxGATGGTGGTGGGGCTGCCGACCGAGTCATCAACCA
ADR01_0045_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGGGGCTGCCGACCGAGTCATCAACCA
THY01_0093_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0030_G01.b : ctagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0091_F09.b : tagttgtcxx
PBL01_0049_A08.b : nngg
OVR01_0031_G01.b : caaaggatcxxxx
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
---------+---------+---------+---------+---------+---------+ 765
MLN01_0031_E08.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
PTG01_0057_D10.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
OVRM1_0193_E05.b : GATCTTGACAGAAATGGACGGCATGTCCNACAAAAAAAATGTGTTTATCATTGGCGCTNA
OVRM1_0166_F12.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAA*AAAATGTGTTTATCATTGGCGCTAC
OVRM1_0107_C06.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
LVRM1_0081_H03.b : GATCTTGACAGANATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
ADR01_0001_A08.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
SPL01_0087_E02.b : GATCTTGACAGAAATGGATGGCATGTCCAC*AAAAAAAATGTGTTTATCATTGGCGCTAC
OVRM1_0198_B02.b : AATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
ADR01_0004_C02.b : GATCTTGACAGAAATGGATGGCATGTCCAC*AAAAAAAATGTGTTTATCATTGGCGCTAC
ADR01_0068_B10.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
ADR01_0020_D04.b : GATCTTGACAGAAATGGATGGCATGTCCAC*AAAAAAAATGTGTTTATCATTGGCGCTAC
OVRM1_0176_A03.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
OVR01_0089_D11.b : GATCTTGACAGAAATGGATGGCATGTCCAC*AAAAAAAATGTGTTTATCATTGGCGCTAC
UTR01_0072_B06.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
ADR01_0045_C10.b : GATCTTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
THY01_0093_A04.b : xxxxTTGACAGAAATGGATGGCATGTCCAC*AAAAAAAATGTGTTTATCATTGGCGCTAC
AMP01_0010_G05.b : xxxxxxxxxxxxxATGGATGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
OVR01_0030_G01.b : xxxxxxxxxxxxxxxxxxxGGCATGTCCACAAAAAAAAATGTGTTTATCATTGGCGCTAC
OVRM1_0091_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCGCTAC
PBL01_0049_A08.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCGCTAC
OVR01_0031_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0031_C09.b : gggtctaactggcatatg
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
---------+---------+---------+---------+---------+---------+ 825
MLN01_0031_E08.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGNCCGCCTTGATCAGCTCAT
PTG01_0057_D10.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGAACTGGCCGCCCTTGATCACTCAT
OVRM1_0193_E05.b : CCACCGACCTGACATCATTt
OVRM1_0166_F12.b : C*ACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGn
OVRM1_0107_C06.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
LVRM1_0081_H03.b : CAACCGACCCGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAACTCAT
ADR01_0001_A08.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
SPL01_0087_E02.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
OVRM1_0198_B02.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGATCAT
ADR01_0004_C02.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
ADR01_0068_B10.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
ADR01_0020_D04.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
OVRM1_0176_A03.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
OVR01_0089_D11.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
UTR01_0072_B06.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
ADR01_0045_C10.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
THY01_0093_A04.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
AMP01_0010_G05.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
OVR01_0030_G01.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
OVRM1_0091_F09.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
PBL01_0049_A08.b : CAACCGACCTGACATCATTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
OVR01_0031_G01.b : xxxxxxxxxxxxxxxxxTTGATCCTGCCATCTTGCGACCTGGCCGCCTTGATCAGCTCAT
LNG01_0031_C09.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
---------+---------+---------+---------+---------+---------+ 885
MLN01_0031_E08.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCA*AGGCCCACTGCGCAA
PTG01_0057_D10.b : CTACATCCCACTTCCTGATGAGAAATCCCGTGGTCGCCTTCCTCAGGGCAACCTGCGCAA
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCA*AGGCAACCTGCGCAA
LVRM1_0081_H03.b : CTACATCCCACTTCCTGATGAGAACTCCCGTGTCGCCATTCTCACAAGCCAACTGCGCGA
ADR01_0001_A08.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
SPL01_0087_E02.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
OVRM1_0198_B02.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCGTTCTCAAGGCCAACCTGCGCAA
ADR01_0004_C02.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
ADR01_0068_B10.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
ADR01_0020_D04.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
OVRM1_0176_A03.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
OVR01_0089_D11.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
UTR01_0072_B06.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
ADR01_0045_C10.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
THY01_0093_A04.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
AMP01_0010_G05.b : CTACATCCCACTTCCTGATGAGAGGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
OVR01_0030_G01.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
OVRM1_0091_F09.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
PBL01_0049_A08.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
OVR01_0031_G01.b : CTACATCCCACTTCCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
LNG01_0031_C09.b : xxxxxxxxxxxxxxCTGATGAGAAGTCCCGTGTCGCCATTCTCAAGGCCAACCTGCGCAA
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
---------+---------+---------+---------+---------+---------+ 944
MLN01_0031_E08.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCT*GCTAAAATGACTAATGGCTTCT
PTG01_0057_D10.b : GTCCCCTGTTGCCAGGGATGTGGATTTGGAatttcctggcctaaaagaacaagggcttct
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b : GTCCCCCGGTGCCNAGGATGTGGGATTTGGAGTTCCTGGCTAAGATGACTAATGG
LVRM1_0081_H03.b : GTCCCCCGTTGCCAAGGATGTGG*Aatctcgagttcctggctcagaagacttatggcgtc
ADR01_0001_A08.b : GTCCCCCGTTGCCAATGATGTGG*ATTTGGAGTTCCTGGCTAAGAAGACTAATGGCTTCT
SPL01_0087_E02.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
OVRM1_0198_B02.b : GTCCCCCGTTGCCAAGGATGTGC*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
ADR01_0004_C02.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
ADR01_0068_B10.b : GTCCCCTGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
ADR01_0020_D04.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
OVRM1_0176_A03.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
OVR01_0089_D11.b : GTCCCCTGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
UTR01_0072_B06.b : GTCCCCTGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
ADR01_0045_C10.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
THY01_0093_A04.b : GTCCCCTGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
AMP01_0010_G05.b : GTCCCCTGTTGCCAAGGACGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
OVR01_0030_G01.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
OVRM1_0091_F09.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
PBL01_0049_A08.b : GTCCCCCGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
OVR01_0031_G01.b : GTCCCCTGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
LNG01_0031_C09.b : GTCCCCTGTTGCCAAGGATGTGG*ATTTGGAGTTCCTGGCTAAGATGACTAATGGCTTCT
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
---------+---------+---------+---------+---------+---------+ 1004
MLN01_0031_E08.b : CTGGACCTGACTTGACAAAAATTTGCCAACTTGCTTGCAAGCTGGCCCTCCGAGAttcat
PTG01_0057_D10.b : cgggaactaatttgaccaaaattttccaacggtcttgcagcttggccatcaaaaattcat
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b : tatggagctgacccgggaga
ADR01_0001_A08.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAACTGGCCATCCGAAAATCAA
SPL01_0087_E02.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
OVRM1_0198_B02.b : CTGGAGCTGACTTGACAGAGATTTGCCAACTTGCTTGCAAGCTGGCCATCCGAGAATCAA
ADR01_0004_C02.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
ADR01_0068_B10.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
ADR01_0020_D04.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
OVRM1_0176_A03.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
OVR01_0089_D11.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGCGAATCAA
UTR01_0072_B06.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGCGAATCAA
ADR01_0045_C10.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCTGAGAATCAA
THY01_0093_A04.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
AMP01_0010_G05.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
OVR01_0030_G01.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
OVRM1_0091_F09.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
PBL01_0049_A08.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
OVR01_0031_G01.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGCGAATCAA
LNG01_0031_C09.b : CTGGAGCTGACTTGACAGAGATTTGCCAACGTGCTTGCAAGCTGGCCATCCGAGAATCAA
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
---------+---------+---------+---------+---------+---------+ 1064
MLN01_0031_E08.b : cgagagtgaaattaggccaaaacgggaaaaggcaaacaacccctcgggcctggaggtaaa
PTG01_0057_D10.b : ccaaagggaatttagccaaaacggaaaagcaaaccaccctcccccctggaggtaaaaaaa
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : TCCAAAATGATATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCCGGCATGGAGGTAA
SPL01_0087_E02.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
OVRM1_0198_B02.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCTGCCATGCACGTAG
ADR01_0004_C02.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
ADR01_0068_B10.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
ADR01_0020_D04.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
OVRM1_0176_A03.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAA
OVR01_0089_D11.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
UTR01_0072_B06.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
ADR01_0045_C10.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
THY01_0093_A04.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
AMP01_0010_G05.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
OVR01_0030_G01.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
OVRM1_0091_F09.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
PBL01_0049_A08.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
OVR01_0031_G01.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
LNG01_0031_C09.b : TCGAGAGTGAGATTAGGCGAGAACGGGAGAGGCAGACCAACCCATCGGCCATGGAGGTAG
OVRM1_0168_D01.b : agttgtcxxxxxxxxxxxxx
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
---------+---------+---------+---------+---------+---------+ 1124
MLN01_0031_E08.b : ggaaaagattcatggcctgaaatccaacgggatcccttttagaagccctgccttttgccc
PTG01_0057_D10.b : aatatccctgcccgaataccacgggatccttttgggaaccctgcgttttccccccttctt
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : AAGAAGATGATTCCATGCCTGAAATCCAACGGATTCACTTTAAGGAAGCCATGCGTTTTG
SPL01_0087_E02.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
OVRM1_0198_B02.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
ADR01_0004_C02.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
ADR01_0068_B10.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
ADR01_0020_D04.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
OVRM1_0176_A03.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCCCTTTGAAGAAACCATGCGTTTTG
OVR01_0089_D11.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
UTR01_0072_B06.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
ADR01_0045_C10.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
THY01_0093_A04.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
AMP01_0010_G05.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
OVR01_0030_G01.b : AGGAAGATGATCCAGCGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
OVRM1_0091_F09.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
PBL01_0049_A08.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
OVR01_0031_G01.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
LNG01_0031_C09.b : AGGAAGATGATCCAGTGCCTGAGATCCGACGGGATCACTTTGAGGAAGCCATGCGTTTTG
OVRM1_0168_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGAGGAAGCCATGCGTTTTG
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
---------+---------+---------+---------+---------+---------+ 1184
MLN01_0031_E08.b : gccgtttggttaggaataagactcccggaatttgaaagtttgctcaaaccttcacaaatc
PTG01_0057_D10.b : taataaaaaaactcccaaaataaaaattggtccaaacttcacaaaataaagtttgggaat
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : CCCccccttctggtaatgaaaaaggacatccggaatatgaaaattttgcttcaacccttt
SPL01_0087_E02.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
OVRM1_0198_B02.b : CCCGCCGTTCTGTTAGTGATAATGACATCTGGAAGTATGAGATGTTAGCTCAAACCCTTC
ADR01_0004_C02.b : *CCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
ADR01_0068_B10.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
ADR01_0020_D04.b : CCCGCCGTTCTGTTAGTGATAATGACATCCCGGAGTATGAGATGTTTGCTCAAACCCTTT
OVRM1_0176_A03.b : CCCGCCATTCCGTTAGTGATAATGACATCCGGAACAAAGAGATGCTTGAACAGACCCTTC
OVR01_0089_D11.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACTCTTC
UTR01_0072_B06.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACTCTTC
ADR01_0045_C10.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
THY01_0093_A04.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
AMP01_0010_G05.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
OVR01_0030_G01.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
OVRM1_0091_F09.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
PBL01_0049_A08.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
OVR01_0031_G01.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACTCTTC
LNG01_0031_C09.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
OVRM1_0168_D01.b : CCCGCCGTTCTGTTAGTGATAATGACATCCGGAAGTATGAGATGTTTGCTCAGACCCTTC
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
---------+---------+---------+---------+---------+---------+ 1244
MLN01_0031_E08.b : aagtcttggccgttctaattccttcggaaacagggggacctgacccttcggccagggcgg
PTG01_0057_D10.b : ttaattcctttggaaacaaggggaagtggcccccttggggttggggggcaagtggaattg
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : aacaaaattcaaggctttggcaactttaaatttccctccagaaaaccaagggggacctgg
SPL01_0087_E02.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAAGAAAACCAGGTGGAGCTGGAC
OVRM1_0198_B02.b : TACATAGTCGAGGC
ADR01_0004_C02.b : AGCAGAGTCGAAGCTTTGGCAGCTTCAGATTCCCTTCAGGGAACCAAGGTGGAGCTGGGA
ADR01_0068_B10.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
ADR01_0020_D04.b : CACAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAAGAAA*CCAGGTTGAACTGGAC
OVRM1_0176_A03.b : Acccaaatcgaggctacggacagcgtgagcatccctttcagaaaacaaagtagtacccgg
OVR01_0089_D11.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
UTR01_0072_B06.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
ADR01_0045_C10.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAAGAAACCAAGGTGGAGCTGGAC
THY01_0093_A04.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
AMP01_0010_G05.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
OVR01_0030_G01.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
OVRM1_0091_F09.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
PBL01_0049_A08.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
OVR01_0031_G01.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
LNG01_0031_C09.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
OVRM1_0168_D01.b : AGCAGAGTCGAGGCTTTGGCAGCTTCAGATTCCCTTCAGGAAACCAAGGTGGAGCTGGAC
ITT01_0055_A11.b :
HTMT1_0058_B11.b :
20110601C-002265 : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
---------+---------+---------+---------+---------+---------+ 1304
MLN01_0031_E08.b : tgcccagggcaattttcccgcaaaaaatataaaccctttggcctagggggccccccgcag
PTG01_0057_D10.b : ttaccaaaaaaaaaaacccctgggaaaggggggcacccgcggaggggccggggatttctc
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : acccaatcagggcaattggcggtggaaaaggtggcaatgtgtcacccgaaaaaaagatga
SPL01_0087_E02.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGAATATGATGATG
OVRM1_0198_B02.b :
ADR01_0004_C02.b : CCAGTCTGGGCAGTGGGCGTGGCACCAGTGGCAGTGTGTACAC*GAAGATNATGATGATG
ADR01_0068_B10.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
ADR01_0020_D04.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAattgtgtacccgaaaaatatgataatg
OVRM1_0176_A03.b : accacaaccgaaaaatggacgttgaaacgaataacaatcgccagagtgaatgaagaagag
OVR01_0089_D11.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
UTR01_0072_B06.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
ADR01_0045_C10.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACTCGGAAGATAATGATGATG
THY01_0093_A04.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
AMP01_0010_G05.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
OVR01_0030_G01.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
OVRM1_0091_F09.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
PBL01_0049_A08.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
OVR01_0031_G01.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
LNG01_0031_C09.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
OVRM1_0168_D01.b : CCAGTCAGGGCAGTGGCGGTGGCACAGGTGGCAGTGTGTACACGGAAGATAATGATGATG
ITT01_0055_A11.b : nnnggatgxxxxxxxxxxxxxxxxxx
HTMT1_0058_B11.b :
20110601C-002265 : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
---------+---------+---------+---------+---------+---------+ 1363
MLN01_0031_E08.b : agctgc
PTG01_0057_D10.b : ccaggggggccccccaaaaaacgggcccacctttttctttttgaattttctcccactggg
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : agaactgtaaggcaaactggggtaacccactgcaatgaacttggctggctggaacttttt
SPL01_0087_E02.b : ACCTGGATGGCTAATTGGGGGTAGCCAGCATGCATTGAACCTGGCCTGGCTGAACTTTGG
OVRM1_0198_B02.b :
ADR01_0004_C02.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAATG*AGCTGGGCTGGCTGGACTTTGT
ADR01_0068_B10.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
ADR01_0020_D04.b : acctgtatggctaattggtggtacccaccatgcattgaccgggcctgcctgactttgttc
OVRM1_0176_A03.b : agaatgcgccacgagccgacacaatggataacgaaag
OVR01_0089_D11.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
UTR01_0072_B06.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
ADR01_0045_C10.b : ACCTGTATGGCTAAGTGGTGGTAAGCAGCATGCAATG*AGCTGGCCTGGCTGGAATTTGT
THY01_0093_A04.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
AMP01_0010_G05.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
OVR01_0030_G01.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
OVRM1_0091_F09.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
PBL01_0049_A08.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
OVR01_0031_G01.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
LNG01_0031_C09.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
OVRM1_0168_D01.b : ACCTGTATGGCTAAGTGGTGGTAGCCAGCATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
ITT01_0055_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCAGTG*AGCTGGCCTGGCTGGACTTTGT
HTMT1_0058_B11.b :
20110601C-002265 : *TCCCTGAGGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
---------+---------+---------+---------+---------+---------+ 1421
MLN01_0031_E08.b :
PTG01_0057_D10.b : ggggtttagaaaaacaaaaagatacactttttggggagaaaacagagggccgcctctttt
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : ttctgaagggggggggccccccccggagggaacccgggtggccccccgcctgttcaatcc
SPL01_0087_E02.b : *TCCCTGAAGGTGGGGGCGgccccgcccagaagggaaccaggggtgccccccagggcggt
OVRM1_0198_B02.b :
ADR01_0004_C02.b : *TCCtgagggtgggggccccccgcccggaaggaccaacggtgcgcccacgccttgtccat
ADR01_0068_B10.b : TTCCCTGAGGGTGGGGGCGCCCGCCC*AGNAGGNNACACGGGTGCGCCCACGGCCTGTTC
ADR01_0020_D04.b : ccgaaggtggggccccccccccggaaggacaccggtggccccacgcctgttccattcttc
OVRM1_0176_A03.b :
OVR01_0089_D11.b : *TCCCTGAAGGTGGGGGCGCCCGCCCCAGGAGGGACTACGGGTGCGCCCACGGCCTGTTC
UTR01_0072_B06.b : *TCCCTGAGGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
ADR01_0045_C10.b : *TCCCTGAAGGTGGGGGCccccacccaagaggaaaccagggtgcacccaacgccatgtcc
THY01_0093_A04.b : *TCCCTGAGGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
AMP01_0010_G05.b : *TCCCTGAAGGTGGGGGGCGCCGCCCCAGAAG*GACCACGGGCGCGCCCACcggcctgtt
OVR01_0030_G01.b : *TCCCTGAGGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
OVRM1_0091_F09.b : TCCTGNNGAGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
PBL01_0049_A08.b : *TCCCTGAGGGTGGGGGCGCCCGCCC*GGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
OVR01_0031_G01.b : *TCCCTGAGGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
LNG01_0031_C09.b : *TCCCTGAGGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
OVRM1_0168_D01.b : *TCCCTGAGGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
ITT01_0055_A11.b : *TCCCTGAGGGTGGGGGCGCCCGCCC*AGGAGGGACCACGGGTGCGCCCACGGCCTGTTC
HTMT1_0058_B11.b :
20110601C-002265 : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTG*TTG
---------+---------+---------+---------+---------+---------+ 1480
MLN01_0031_E08.b :
PTG01_0057_D10.b : ttgggggcgggtggaagattccacaaattctgccctccccagagaggggtttatttttat
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : tcgtattgaacaatttccttacttcatatctgtaagggggtttacttttggaaaaatttc
SPL01_0087_E02.b : ttcatttcctaagcttgaaaagatttagcttccgttcaaaacccggaaaaggggggttaa
OVRM1_0198_B02.b :
ADR01_0004_C02.b : tcctcatttgaacatttccctacattcgaactctgaacagggggttaattgttggaaaaa
ADR01_0068_B10.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTGG*TG
ADR01_0020_D04.b : atttgaacatttcacttaatccaaatctggaagggggttaccttttgaaaaaaatttaaa
OVRM1_0176_A03.b :
OVR01_0089_D11.b : CATTCCTCAATCTGAACAGTTCAACTACCGTCAAACTCTGGACACGGGGTTAACTTGTTG
UTR01_0072_B06.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGNGGTTAAACTGTTG
ADR01_0045_C10.b : attcctcattccgaaactttcaaacaaaagtactaaacctagaaagggattaattgtttg
THY01_0093_A04.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTGTTGG
AMP01_0010_G05.b : ccttccctcatctgaacagtttagctacagtccaaactctggaaaagggggtaaattggt
OVR01_0030_G01.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTG*TTG
OVRM1_0091_F09.b : CATTCCACAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTG*TTG
PBL01_0049_A08.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTNAACTGTTG
OVR01_0031_G01.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTG*TTG
LNG01_0031_C09.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTG*TTG
OVRM1_0168_D01.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTG*TTG
ITT01_0055_A11.b : CATTCCTCAGTCTGAACAGTTCAGCTACAGTCAGACTCTGGACAGGGGGTTAACTG*TTG
HTMT1_0058_B11.b :
20110601C-002265 : GAAAAAAATTCAAAACAAAAGTGATAAAATAAAAGCAATTTTCATTTGGGAGGCGGAGAG
---------+---------+---------+---------+---------+---------+ 1540
MLN01_0031_E08.b :
PTG01_0057_D10.b : aa
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : aaacaaatgtataaaaatacattttcttttttgataagaatacttaaaaataatatttta
SPL01_0087_E02.b : atgtttgaaaaaaaatttcaaaaaaaaagggtataaaataaaacgcaattttctaatttg
OVRM1_0198_B02.b :
ADR01_0004_C02.b : attcaaaacaaaatgaataaataaagccattttctttgggaggcggagatggattaccac
ADR01_0068_B10.b : GAAAAAAATTCAAAA*CAAAGTGATAAAATAAAAGCAATTTTCCATTGGGAGagcgaaaa
ADR01_0020_D04.b : caaagtttaaaataaaagcattttttttttggaaggcgaaaaggatttccaacgggaatt
OVRM1_0176_A03.b :
OVR01_0089_D11.b : GAAAAAAATTCAAAACCAAAGTGAataaattaaaaccaatttttcatttgggaagccaaa
UTR01_0072_B06.b : GAAAAAAAattcaaaaacaaaagtgaataaaataaaaccaattttcattttggaggcaga
ADR01_0045_C10.b : aaaataaattaaatatataaatgataaataaaaacaattataattgggaaagaagaaaat
THY01_0093_A04.b : AAAAAAAATTCAAAACAAAAGTGATAAAATAAAAGCAATTTTCATTTGGGAGGCGGAGAG
AMP01_0010_G05.b : ggaaaaaatttccaaacaaaatggaaaaaataaaaaccattttttatttggggaggcgga
OVR01_0030_G01.b : GAAAAAAATTCAAAACAAAAGTGATAAAATAAAAGCAATTTTCATTTGGGAGGCGGAGAG
OVRM1_0091_F09.b : GAAAAAAATTCAAAAACAAAGTGNATAAATAAAAGCAATTTTCATTTGGGAGGCGGAGAG
PBL01_0049_A08.b : GAAAAAA**TCAAAACAAAAGTGATAAAATAAAAAGCATTTTCATTTGGGAAGGCGAGAG
OVR01_0031_G01.b : GAAAAAAATTCAAAACAAAAGTGATAAAATAAAAGCAATTTTCATTTGGGAGGCAGAGAG
LNG01_0031_C09.b : GAAAAAAATTCAAAACAAAAGTGATAAAATAAAAGCAATTTTCATTTGGGAGGCGGAGAG
OVRM1_0168_D01.b : GAAAAAAATTCAAAACAAAAGTGATAAAATAAAAGCAATTTTCATTTGGGAGGCGGAGAG
ITT01_0055_A11.b : GAAAAAAATTCAAAACAAAAGTGATAAAATAAAAGCAATTTTCATTTGGGAGGCGGAGAG
HTMT1_0058_B11.b :
20110601C-002265 : TGAATTACCAACAGGGAATTGGGCCTTGGGCCTATGCCACTTCTGTTGTAGTTGGGGCAG
---------+---------+---------+---------+---------+---------+ 1600
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : ccattagtacttatataaatatactaataaataaatggcttttgtcttcaccttgttctg
SPL01_0087_E02.b : ggagg
OVRM1_0198_B02.b :
ADR01_0004_C02.b : cgggaatgggccttggcctagccacttccgtgtattggggcntgcaggggacttgttggt
ADR01_0068_B10.b : tgaattacancagggaaatgggccctggggctatgccccttctgtttaattggggcaatg
ADR01_0020_D04.b : gggcttgggcccatcccttttttttaatttgggcaatccaggaactctttggtttccaaa
OVRM1_0176_A03.b :
OVR01_0089_D11.b : aagtgaaattacccaacagggaaattggggccttgggccctatgcccctttctgtttgaa
UTR01_0072_B06.b : gaattaaatttaccacagggaaattgggcctttggggcctatgccactttctgttgtagt
ADR01_0045_C10.b : aaattatatccaagtattttgtatttagctctattccctatcaagatattagaggaatgc
THY01_0093_A04.b : TGAATTACCAACAGGGAATTGGGCCTTGGGCCTATGCCACTTCTGTTGTAATTTGGGCAG
AMP01_0010_G05.b : agagggaatttcccaacagggaaattggcccctggggccctatgccccctttttttttta
OVR01_0030_G01.b : TGAATTACCAACAGGGAAATGGGCCTTGGGCCTATGCCACTTCTGTTGTAGTTGGGGCAG
OVRM1_0091_F09.b : TGAATTACCA
PBL01_0049_A08.b : TGAATTACCAcaggnaantgggctnnggctatgccactctgntgtattggggcagtgcaa
OVR01_0031_G01.b : TGAATTACCAACAGGGAATTGGGCCTTGGGCCTATGCCACTTCTGTTGTAGTTGGGGCAG
LNG01_0031_C09.b : TGAATTACCAACAGGGAATTGGGCCTTGGGCCTATGCCACTTCTGTTGTAGTTGGGGCAG
OVRM1_0168_D01.b : TGAATTACCAACAGGGAATTGGGCCTTGGGCCTATGCCACTTCTGTTGTAGTTGGGGCAG
ITT01_0055_A11.b : TGAATTACCAACAGGGAATTGGGCCTTGGGCCTATGCCACTTCTGTTGTAGTTGGGGCAG
HTMT1_0058_B11.b : nnnaaggcaagtacgaxxxxxxxxxxx
20110601C-002265 : TGCAGGGGACCTCTGTGGGTGCGAAGAAAGGCATTATTGCCACTCCCCACAGTAAAGCAT
---------+---------+---------+---------+---------+---------+ 1660
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : gactctaaaatttttgaggggtcgctctcatgtactctttcttgaaagagcctattatgt
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b : gcaaaaaaggattattccactcccaattaagaattgcactaataaggtggcaggcctcct
ADR01_0068_B10.b : cagggaacccttttgggtgcaaaaaagccttatttcccctcccccaataaaaaactgcct
ADR01_0020_D04.b : aaggtttttgcccccccaaaaaaaaattgactttcttaatgggccaggcctcctttttcc
OVRM1_0176_A03.b :
OVR01_0089_D11.b : atttggggccagtgctaggggaacctccgtttggggtgcccaaaaaaaggccttttattt
UTR01_0072_B06.b : tgggggaagtggcaggggggcctctgtgggttgccaaagaaagggcattatttgccccct
ADR01_0045_C10.b : aaagaaacacttatgtgttaataattcatttatcctaacttaaaaaaaataaaaaaagaa
THY01_0093_A04.b : TGCAGGGGACCTCTGTGGGTGCAAAAAA*GGCATTATTGCCACTCCCCACAGTAAAGCAT
AMP01_0010_G05.b : attgggggaaatgccaggggaacctcttggggtggccaaaaaaaggccttttttggccct
OVR01_0030_G01.b : TGCAGGGGACCTCTGTGGGTGCAAAAAAAGGCATTATTGCCACTCCCCACAGTAAAGCAT
OVRM1_0091_F09.b :
PBL01_0049_A08.b : ggaactctgtgggtgcgaagaaagcattatgccatccccaagtaagcatctgcactcact
OVR01_0031_G01.b : TGCAGGGGACCTCTGTGGGTGCGAAGAAAGGCATTATTGCCACTCCCCACAGTAAAGCAT
LNG01_0031_C09.b : TGCAGGGGACCTCTGTGGGTGCGAAGAAAGGCATTATTGCCACTCCCCACAGTAAAGCAT
OVRM1_0168_D01.b : TGCAGGGGACCTCTGTGGGTGCGAAGAAAGGCATTATTGCCACTCCCCACAGTAAAGCAT
ITT01_0055_A11.b : TGCAGGGGACCTCTGTGGGTGCGAAGAAAGGCATTATTGCCACTCCCCACAGTAAAGCAT
HTMT1_0058_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTGCCACTCCCCACAGTAAAGCAT
20110601C-002265 : CTGCACTTCACTCAATGCTGCCCATGCCCT*CCCTTCTTCCCCCTACCCAACTTGGGCAG
---------+---------+---------+---------+---------+---------+ 1719
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : tacttatcatagctgggtcttttattctctccggataactctgtgtatttaagaacctct
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b : tttccctacaaattggagggaaaaagggcccttttgggttaataaaagtgatttttttcg
ADR01_0068_B10.b : ttattaaaaggggccaggccccctttttccccaacaaaatgggcaaaagaaaaaagcccc
ADR01_0020_D04.b : caccaattggaaaaagaaaagcctcctttcggggtttaaaagaaggggattttttccacc
OVRM1_0176_A03.b :
OVR01_0089_D11.b : gccccctcccccccacaaataaagcattctggtcattatcacttccaagtgacggcccca
UTR01_0072_B06.b : cccccacagtaaaagccttctggcactttcccttcaaatggcttcccccaggcccctccc
ADR01_0045_C10.b : aaatcaaaggtcaaaagactacactattaaaaactgcaattataagacaaaataagctaa
THY01_0093_A04.b : CTTCACTTCCTTCCATGCTGCCCATGCCCT*CCCTTCCTCCCCCTACCCcactttgggca
AMP01_0010_G05.b : ccccccaaaaaaaaccaccggcaccttcacctaaaggtggcctaggcccctccctttttt
OVR01_0030_G01.b : CTGCACTTCACTCAATGgctgccatgccctcccttcttcccccctacccaactttggggc
OVRM1_0091_F09.b :
PBL01_0049_A08.b : caatgtgccatggcctccttctcccctacccactggggcagagatgagggctcaatgctg
OVR01_0031_G01.b : CTGCACTTCACTCAATGCTGCCCATGCCCT*CCCTTCTTCCCCCTACCCAACTTGGGCAG
LNG01_0031_C09.b : CTGCACTTCACTCAATGCTGCCCATGGCCTCCCCTTCTTCCCCCTACCCAACTTGGGCAG
OVRM1_0168_D01.b : CTGCACTTCACTCAATGCTGCCCATGCCCT*CCCTTCTTCCCCCTACCCAACTTGGGCAG
ITT01_0055_A11.b : CTGCACTTCACTCAATGCTGCCCATGCCCT*CCCTTCTTCCCCCTACCCAACTTGGGCAG
HTMT1_0058_B11.b : CTGCACTTCACTCAATGCTGCCCATGCCCT*CCCTTCTTCCCCCTACCCAACTTGGGCAG
20110601C-002265 : GAGGATGAAGGG*CTCCAGTTGCTGGGTGTTTATATAGAGTAGGTTGA*TTTTTATTTTA
---------+---------+---------+---------+---------+---------+ 1777
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : ccggtggatatcgacaacctcaaaattctcagtgattaatgtataagattctaccacctc
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b : cctttggtaggggaaaaaccacgttttaccaaaaaatgtaagaaaaaatgtaaggaaaaa
ADR01_0068_B10.b : attttgggggtttatataaaagggggtatttttttaacgcctttgaataagggggaaaca
ADR01_0020_D04.b : cttgataaggggaaacattaaacgttctaacaaataatcttaaagcaaaaattgttatag
OVRM1_0176_A03.b :
OVR01_0089_D11.b : atggccctctcctctttctttccgcccctaacccaaacattggtggccaagaagagggtg
UTR01_0072_B06.b : ccttctttccccccctacccccaacttttggggcagggaaaggggtgaaaaggggccccc
ADR01_0045_C10.b : tcttctaaaaaatatcaacataaaattatatactactttttatttaatattccataataa
THY01_0093_A04.b : ggaagaataaagggctccattttgctgggggtttatttttaaataagttgaattt
AMP01_0010_G05.b : cccccataacaaatttgggcaagaaagaataaaaggccccccctttccgtgggggtttta
OVR01_0030_G01.b : aggaagatgaaagggttccagtttgctgggggggttaatattaaaaaaagggtggatttt
OVRM1_0091_F09.b :
PBL01_0049_A08.b : ggtgttaaatgaggaagtgattttattcccgctttgaataggttgaaactatccaaacgt
OVR01_0031_G01.b : GAGGggtgaagggctccagttgctggggtgtttatataaaaataaggttgattttttatt
LNG01_0031_C09.b : GGAGATGAAGGGGCTCCATTTGCTGGGTGGTTATATAAAGTAGGGTGAATTTTTATTTTA
OVRM1_0168_D01.b : GAGGGTGAAGGG*CTCCAGTTGCTGGGTGTTTATATAGAGTAGGTTGA*TTTTTATTTTA
ITT01_0055_A11.b : GAGGATGAAGGG*CTCCAGTTGCTGGGTGTTTATATAGAGTAGGTTGA*TTTTTATTTTA
HTMT1_0058_B11.b : GAGGATGAAGGG*CTCCAGTTGCTGGGTGTTTATATAGAGTAGGTTGA*TTTTTATTTTA
20110601C-002265 : CATGCTTTTGAGTTAATGTTGGAAAACTAATCACAAGCAGTTTCTAAACCAAAAATGACA
---------+---------+---------+---------+---------+---------+ 1837
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b : ctggcttatcatcaaatataaata
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b : aaaaaatttttaggggggcgcttttttggggctctccctttttaggcatgtataat
ADR01_0068_B10.b : aaacacacccttttacacaa
ADR01_0020_D04.b : aaaaaaaaaaagcctgtgtctgtgggggccctaaatctcgggcaactcaccccttttaaa
OVRM1_0176_A03.b :
OVR01_0089_D11.b : taaaggggctctcccacacttgtcgtggggta
UTR01_0072_B06.b : ccaattttccctgggggggggtttttataaaaagaaaagtaaaaggtttttaaatatttt
ADR01_0045_C10.b : tactattaaaaacaaaatataagagaactaaaacttacttctcttgaactcatatataag
THY01_0093_A04.b :
AMP01_0010_G05.b : ataaaaataagatgaat
OVR01_0030_G01.b : ttattttttaa
OVRM1_0091_F09.b :
PBL01_0049_A08.b : ttctaaccaaatgactgcgaaaggaaaaaacgtggtcaaatggaannnnnnnnnnnnnan
OVR01_0031_G01.b : tttaactgcttttttgaattaatggttgggaaaaactaattcacaaagcaatttttctaa
LNG01_0031_C09.b : CATGCTTTTGAatttatggttggaaaactaaccacaaacagttttccaaaccaaaaatgg
OVRM1_0168_D01.b : CATGCTTTTGAGTTAATGTTGGAAAACTAATCACAAGCAGTTTCTAAACCAAAAATGACA
ITT01_0055_A11.b : CATGCTTTTGAGTTAATGTTGGAAAACTAATCACAAGCAGTTTCTAAACCAAAAATGACA
HTMT1_0058_B11.b : CATGCTTTTGAGTTAATGTTGGAAAACTAATCACAAGCAGTTTCTAAACCAAAAATGACA
20110601C-002265 : TGCTGTAAAAGGACAATAAACGTTGGGTCAAAATGGAGCCTGAGTCCTGGCCCCTGTGCC
---------+---------+---------+---------+---------+---------+ 1897
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b : gcctagatatataaggcgccctttttgtgaaactttttaga
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b : tttattttttttaaaaacgtgcgcccttttttttttaaaaaatttttataaaagggtttt
ADR01_0045_C10.b : ccnnccaccaccactactacatctaatcgattttacctaatgaacacaactgctaaatca
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b : nnnnnnnaaaagcactgcccacttagccggccccaaaatcctggggcaagtaccaaccct
OVR01_0031_G01.b : aaccaaaaaaattgaaaattgcttggtaaaaaagggaaaaaaaaaaaaacgtttg
LNG01_0031_C09.b : aattggctgtaaaaggggacataaaccgttggggccaaaaagggaaaaaaaaaaaaaaaa
OVRM1_0168_D01.b : TGCTGTAAAAGGACAAT
ITT01_0055_A11.b : TGCTGTAAAAGGACAATAAACGTTGGGTCAAAATGGAGCCTGAGTCCTGGCCCCTGTGCC
HTMT1_0058_B11.b : TGCTGTAAAAGGACAATAAACGTTGGGTCAAAATGGaaaaaaaaaaaaaaaaaaaaaaaa
20110601C-002265 : TGCTTCTTTTCCTGGGAAGGGCCTTGGGCCTCATTGCCAAGGCACTCTTCCACATGTGAA
---------+---------+---------+---------+---------+---------+ 1957
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b : gtgtggaaaaaaaaaaaaaaatatac
ADR01_0045_C10.b : actacacatataaattatcatattaacatacaccactatctattattataactatttatc
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b : ttttaagggtccaaggacaataacaagcgcccctttaacctggggaaactctggtttgga
OVR01_0031_G01.b :
LNG01_0031_C09.b : aaaaaagggcccccctgggggcccccaaaaccctgccagggcgcccgggggccccccctc
OVRM1_0168_D01.b :
ITT01_0055_A11.b : TGCTTCTTTTCCTGGGAAGGGCCTTGGGCCTCATTGCCAAGGCACTCTTCCACATGTGAA
HTMT1_0058_B11.b : aaaaaaaaaaaaaaaaaaaaaaaaaaacaacataaaaaaaxxxxxxxxnnnnnnnnnnnn
20110601C-002265 : ATCCTGGGAGTAGGATTGCACCACCTTCCCCTCCTGATAACATTGGTATGCTGCTGCCTC
---------+---------+---------+---------+---------+---------+ 2017
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b : ttatttgataaataataatacttgcttctatatattac
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b : acctctggggaatgcaacccaatacccggaaatttgtaggaaccccgctccggttctaaa
OVR01_0031_G01.b :
LNG01_0031_C09.b : ctctaagagaaataatccccccctccgggggggggggggcccccccacaaggcccctctt
OVRM1_0168_D01.b :
ITT01_0055_A11.b : ATCCTGGGAGTAGGATTGCACCACCTTCCCCTCCTGATAACATTGGTATGCTGCTGCCTC
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : GCCCAGTGTTTGCAGTATCATTGGAGAGGACTGCAGTGGAGGGAGAGCAGTCTTACAGAG
---------+---------+---------+---------+---------+---------+ 2077
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b : aaaaacaggatatgtttaacccctccccccggtacccgggttcccccacaatttttgaaa
OVR01_0031_G01.b :
LNG01_0031_C09.b : taatacccc
OVRM1_0168_D01.b :
ITT01_0055_A11.b : GCCCAGTGTTTGCAGTATCATTGGAGAGGACTGCAGTGGAGGGAGAGCAGTCTTACAGAG
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : TTCCAGTGCGGAGAATGTGGCATCCTCCACCTGTGTCTGGTTGGGTGGTGAGACTAGTCC
---------+---------+---------+---------+---------+---------+ 2137
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b : actttcttctcgggccctccactnnnnnnna
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : TTCCAGTGCGGAGAATGTGGCATCCTCCACCTGTGTCTGGTTGGGTGGTGAGACTAGTCC
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : TGGAGAGCCCCCATTTTCTGACTGANGCTGGATTGGGGTGCCCNTCAAAAATCTTAAGGT
---------+---------+---------+---------+---------+---------+ 2197
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : TGGAGAGCCCCCATTTTCTGACTGANGCTGGATTGGGGTGCCCNTCAAAAATCTTAAGGT
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : TGTAGAAAAGTAAAGTCTCTGTCTGGAGAGATGGATGTTTCTCTGATGCATCTAAAAGTT
---------+---------+---------+---------+---------+---------+ 2257
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : TGTAGAAAAGTAAAGTCTCTGTCTGGAGAGATGGATGTTTCTCTGATGCATCTAAAAGTT
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : CCATATATTCATGTTTCTGGTAAGGATCACTTNACAATTATGTCCACCTTTATCTTATGT
---------+---------+---------+---------+---------+---------+ 2317
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : CCATATATTCATGTTTCTGGTAAGGATCACTTNACAATTATGTCCACCTTTATCTTATGT
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : AATTT.......................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : AATTTgtataataaaacatagcttggttttctatataaatttctagtatggatgtgnnnn
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-002265 : ............................................................
---------+---------+---------+---------+---------+---------+ 2322
MLN01_0031_E08.b :
PTG01_0057_D10.b :
OVRM1_0193_E05.b :
OVRM1_0166_F12.b :
OVRM1_0107_C06.b :
LVRM1_0081_H03.b :
ADR01_0001_A08.b :
SPL01_0087_E02.b :
OVRM1_0198_B02.b :
ADR01_0004_C02.b :
ADR01_0068_B10.b :
ADR01_0020_D04.b :
OVRM1_0176_A03.b :
OVR01_0089_D11.b :
UTR01_0072_B06.b :
ADR01_0045_C10.b :
THY01_0093_A04.b :
AMP01_0010_G05.b :
OVR01_0030_G01.b :
OVRM1_0091_F09.b :
PBL01_0049_A08.b :
OVR01_0031_G01.b :
LNG01_0031_C09.b :
OVRM1_0168_D01.b :
ITT01_0055_A11.b :
HTMT1_0058_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn