[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002297

Length: 1,540

Sequence [FASTA format sequence]
GCATTGTGGG AATCCCGGGG CCGCGGCGAC TGGTTCCAGT TCACTCGGCA GCGGAGCCGG
GCGGAGGGGG CGAGCGCGGG GCGCGCGGGC GGGAAGCGAG GAGGCGGGCG GGCCAGTGAG
GAGAGCGGAG AGAAAAGGCG CGAGCGGCCG AGAGGGCACG GGCCGGACAC CTTGCTGCTG
CCGCCGCCGC CGCCGCTGCG GCCGAGCCTC CCCTGAGCTT ACTGATCCAT CTCCAGGGCC
ACCGCCATGT CCAGCCGGGG TGGGAAGAAG AAGTCCACCA AAACCTCCCG GTCCGCCAAG
GCGGGCGTCA TCTTCCCCGT GGGCCGGATG CTGCGGTACA TCAAGAAAGG CCACCCCAAG
TACAGGATTG GAGTGGGGGC GCCGGTGTAC ATGGCCGCCG TCCTGGAGTA CCTGACAGCG
GAGATTCTGG AACTGGCTGG CAACGCAGCA AGAGACAACA AGAAGGGCCG GGTCACCCCC
CGACACATCC TGCTGGCCGT GGCCAACGAT GAAGAGCTCA ATCAGCTGCT AAAAGGAGTC
ACCATAGCCA GCGGAGGGGT GTTACCGAAC ATCCACCCGG AGTTGCTAGC GAAGAAACGA
GGATCCAAAG GGAAGTTGGA AGCCATCATC ACGCCACCCC CAGCCAAAAA GGCCAAGTCT
CCGTCCCAGA AGAAGCCCGT GTCTAAGAAA ACAGGCGGCA AGAAGGGGGC CCGGAAATCC
AAGAAGCAGG GAGAAGTCAG CAAGGCAGCC AGCGCCGACA GCACAACTGA GGGCACTCCC
GCCGACGGCT TCACCGTGCT GTCCACCAAG AGCCTCTTTC TCGGCCAGAA GTTGCAAGTT
GTACAGGCTG ACATTGCCTC GATCGACAGT GACGCTGTCG TTCACCCGAC AAACACTGAC
TTCTACACCG GTGGTGAAGT AGGAAACACG CTGGAGAAGA AGGGTGGCAA GGAGTTTGTG
GAAGCTGTTC TGGAACTCCG GAAAAAGAAC GGGCCCTTGG AAGTAGCCGG AGCTGCTGTC
AGTGCGGGCC ATGGCCTGCC CGCCAAGTTT GTGATCCACT GTAACAGTCC CGTGTGGGGT
GCAGACAAGT GTGAGGAGCT TCTGGAAAAG ACAGTGAAGA ACTGCTTGGC CCTGGCAGAC
GATAAGAAGC TCAAGTCCAT CGCCTTTCCA TCCATCGGCA GCGGCAGGAA ACGGTTTCCG
AAGCAGACGG CAGCTCAGCT GATCCTGANG GCCATCTCCA GCTACTTCGT GTCACCCATG
TCCTCTTCCA TCAAAAACGT GTATTTTGTG CTGTTTGACA GCGAGAGTAT AGGCATCTAC
GTGCAGGAAA ATGGCCAGCT GGACGCAAAC TANGCTGAAG AACTGCAGAA ACAGCCCGGC
ACATGCCCCC GCCTCCACCT GAAAGAAAAG CAAGAAATAT CCCCCTCCGC TCCTCGGGGA
AGGCGGGAAC CTCTTCAATT TACATTTTTG CCCATCAAGG AAAAATGAGG TTTTGGGTTT
CAAGTTTAAT GGTTTTTGAC CTTCAAAAAG GTTTTTCCGT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2AFYcore histone macro-H2A.1 isoform 1 [Homo sapiens]. 597e-170O
Contig/Assembly ProteinH2AFYcore histone macro-H2A.1 isoform 2 [Homo sapiens]. 560e-159O
Contig/Assembly ProteinH2AFYcore histone macro-H2A.1 isoform 2 [Homo sapiens]. 560e-159O
Contig/Assembly ProteinH2AFYcore histone macro-H2A.1 isoform 3 [Homo sapiens]. 555e-158O
Contig/Assembly ProteinH2AFY2core histone macro-H2A.2 [Homo sapiens]. 419e-117O
Contig/Assembly ProteinH2AFXhistone H2A.x [Homo sapiens]. 1421e-33O
Contig/Assembly ProteinHIST2H2ABhistone H2A type 2-B [Homo sapiens]. 1404e-33O
Contig/Assembly ProteinHIST1H2AAhistone H2A type 1-A [Homo sapiens]. 1399e-33O
Contig/Assembly ProteinHIST2H2AA3histone H2A type 2-A [Homo sapiens]. 1381e-32O
Contig/Assembly ProteinHIST2H2AA4histone H2A type 2-A [Homo sapiens]. 1381e-32O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2afycore histone macro-H2A.1 isoform 4 [Mus musculus]. 600e-171O
Contig/Assembly ProteinH2afycore histone macro-H2A.1 isoform 3 [Mus musculus]. 595e-170O
Contig/Assembly ProteinH2afycore histone macro-H2A.1 isoform 2 [Mus musculus]. 556e-158O
Contig/Assembly ProteinH2afycore histone macro-H2A.1 isoform 1 [Mus musculus]. 551e-157O
Contig/Assembly ProteinH2afy2core histone macro-H2A.2 [Mus musculus]. 420e-117O
Contig/Assembly ProteinH2afxhistone H2A.x [Mus musculus]. 1429e-34O
Contig/Assembly ProteinHist2h2abhistone H2A type 2-B [Mus musculus]. 1412e-33O
Contig/Assembly ProteinHist1h2alPREDICTED: src substrate cortactin [Mus musculus]. 1381e-32
Contig/Assembly ProteinHist2h2aa1histone H2A type 2-A [Mus musculus]. 1381e-32O
Contig/Assembly ProteinHist1h2alPREDICTED: src substrate cortactin [Mus musculus]. 1381e-32


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC481514PREDICTED: similar to H2A histone family, member Y isoform 3 [Canis familiaris]. 557e-159O
Contig/Assembly ProteinLOC489024PREDICTED: similar to Core histone macro-H2A.2 (Histone macroH2A2) (mH2A2) isoform 3 [Canis familiaris]. 422e-118O
Contig/Assembly ProteinLOC489024PREDICTED: similar to Core histone macro-H2A.2 (Histone macroH2A2) (mH2A2) isoform 6 [Canis familiaris]. 422e-118O
Contig/Assembly ProteinLOC489024PREDICTED: similar to Core histone macro-H2A.2 (Histone macroH2A2) (mH2A2) isoform 7 [Canis familiaris]. 421e-117O
Contig/Assembly ProteinLOC489024PREDICTED: similar to Core histone macro-H2A.2 (Histone macroH2A2) (mH2A2) isoform 5 [Canis familiaris]. 416e-116O
Contig/Assembly ProteinLOC489024PREDICTED: similar to Core histone macro-H2A.2 (Histone macroH2A2) (mH2A2) isoform 1 [Canis familiaris]. 2497e-66O
Contig/Assembly ProteinLOC489024PREDICTED: similar to Core histone macro-H2A.2 (Histone macroH2A2) (mH2A2) isoform 4 [Canis familiaris]. 1896e-48O
Contig/Assembly ProteinLOC489372PREDICTED: similar to Histone H2A.x (H2a/x) [Canis familiaris]. 1421e-33
Contig/Assembly ProteinLOC483175PREDICTED: similar to histone H2A [Canis familiaris]. 1404e-33O
Contig/Assembly ProteinLOC608631PREDICTED: similar to Histone H2A.o (H2A/o) (H2A.2) (H2a-615) [Canis familiaris]. 1381e-32O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2AFYH2A histone family, member Y [Bos taurus]. 560e-159O
Contig/Assembly ProteinH2AFY2H2A histone family, member Y2 [Bos taurus]. 417e-116O
Contig/Assembly ProteinH2AFXH2A histone family, member X [Bos taurus]. 1421e-33O
Contig/Assembly ProteinHIST2H2ABPREDICTED: histone cluster 2, H2ab [Bos taurus]. 1404e-33O
Contig/Assembly ProteinHIST2H2ABPREDICTED: histone cluster 2, H2ab [Bos taurus]. 1404e-33O
Contig/Assembly ProteinLOC541108PREDICTED: histone cluster 2, H2aa3-like [Bos taurus]. 1381e-32O
Contig/Assembly ProteinLOC100297758PREDICTED: histone cluster 2, H2aa3-like [Bos taurus]. 1381e-32O
Contig/Assembly ProteinLOC100297758PREDICTED: histone cluster 2, H2aa3-like [Bos taurus]. 1381e-32O
Contig/Assembly ProteinHIST2H2AChistone H2A type 2-C [Bos taurus]. 1372e-32O
Contig/Assembly ProteinHIST3H2Ahistone cluster 3, H2a [Bos taurus]. 1372e-32O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2AFYPREDICTED: core histone macro-H2A.1 isoform 2 [Sus scrofa]. 560e-160O
Contig/Assembly ProteinH2AFYPREDICTED: core histone macro-H2A.1 isoform 1 [Sus scrofa]. 555e-158O
Contig/Assembly ProteinLOC100522201PREDICTED: histone H2A.x-like [Sus scrofa]. 1427e-34O
Contig/Assembly ProteinLOC100154181PREDICTED: histone H2A type 2-B-like [Sus scrofa]. 1403e-33O
Contig/Assembly ProteinLOC100153329PREDICTED: histone H2A type 1-A-like [Sus scrofa]. 1396e-33O
Contig/Assembly ProteinLOC100524803PREDICTED: histone H2A type 2-A-like [Sus scrofa]. 1387e-33O
Contig/Assembly ProteinH2AFY2PREDICTED: core histone macro-H2A.2, partial [Sus scrofa]. 1381e-32O
Contig/Assembly ProteinLOC100154508PREDICTED: histone H2A type 1-F-like [Sus scrofa]. 1371e-32O
Contig/Assembly ProteinLOC100627582PREDICTED: histone H2A type 1-like [Sus scrofa]. 1371e-32O
Contig/Assembly ProteinLOC100623449PREDICTED: histone H2A type 1-F-like [Sus scrofa]. 1371e-32O


Assembly Members: 17      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010058H08ADR01_0058_H08.bDB786708 AK389385
BFLT10060H10BFLT1_0060_H10.bFS644797 
BFLT10104C02BFLT1_0104_C02.bHX202046 
CBLT10019B07CBLT1_0019_B07.bHX213140 
CLNT10041B01CLNT1_0041_B01.bFS660252 
DCI010014H09DCI01_0014_H09.bDB791581 
HTMT10025F05HTMT1_0025_F05.bFS666067 
HTMT10108F11HTMT1_0108_F11.bHX223806 
ITT010020G01ITT01_0020_G01.bBW977828 
LVRM10043B12LVRM1_0043_B12.bCJ002063 AK394143
LVRM10162H11LVRM1_0162_H11.bBP454580 
OVRM10010C08OVRM1_0010_C08.bBP148109 
OVRM10121C11OVRM1_0121_C11.bBP148526 
OVRM10140C10OVRM1_0140_C10.bBP148429 
OVRT10095E03OVRT1_0095_E03.bFS694157 
PTG010049H03PTG01_0049_H03.bFS708776 
SPL010026A03SPL01_0026_A03.bBP156742 AK350276

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
187C900.562W-
G250.438
510C240.400WSGAC/D
T900.600GAT/D


Alignment:      TOP

20110601C-002297 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BFLT1_0104_C02.b : nnnnccgttcagctgtngxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_A03.b : gcatttagggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0049_H03.b : tatttttgcgtaacaxxxxxxxxxxxxxxxxx
LVRM1_0162_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_B12.b : xxxxxxxxxxxxxxxxxxx
OVRM1_0010_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0041_B01.b : attccgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0058_H08.b : nnnaatctgaagxxxxxxxxxxxxxxxxxxx
ITT01_0020_G01.b : nnggtgcaacaxxxxxxx
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : gattccg
OVRT1_0095_E03.b : nncccccg
HTMT1_0025_F05.b :
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b :
20110601C-002297 : ..........................GCATTGTGGGAATCCCGGGGCCGCGGCGACTG*G
---------+---------+---------+---------+---------+---------+ 33
BFLT1_0104_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGTGGGAATCCCGGGGCCGCGGCGACTG*G
SPL01_0026_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGTGGGAATCCCGGGGCCGCGGCGACTG*G
PTG01_0049_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGTGGGAATCCCGGGGCCGCGGCGACTG*G
LVRM1_0162_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGTGGGAATCCCGGGGCCGCGGCGACTG*G
LVRM1_0043_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGTGGGAATCCCGGGGCCGCGGCGACTG*G
OVRM1_0010_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGTGGGAATCCCGGGGCCGCGGCGACTG*G
CLNT1_0041_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGTGGGAATCCCGGGGCCGCGGCGACTG*G
ADR01_0058_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxctgTTGTGGGAATCCCGGGGCCGCGGCGACTG*G
ITT01_0020_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCGCGCTGCCGGCGCTGGTGCG
OVRM1_0121_C11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0140_C10.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0060_H10.b : tctgcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_E03.b : tttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0025_F05.b : tttagcaggtaagcggccgtxxxxxxxxxxxxxxxxxxx
HTMT1_0108_F11.b : nnnaaggatggtacgxxxxxxxxxxxxxxxxxxxx
CBLT1_0019_B07.b : nnttcgatgttaagacgccxxxxxxxxxxx
DCI01_0014_H09.b :
20110601C-002297 : TTCCAGTTCACTCGGCAGCGGAGCCGGGCGGAGGGGGCGAGCGCGGGGCGCGCGGGCGGG
---------+---------+---------+---------+---------+---------+ 93
BFLT1_0104_C02.b : TTCCAGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
SPL01_0026_A03.b : TTCCAGTTCACTCGGCGGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
PTG01_0049_H03.b : TTCCAGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
LVRM1_0162_H11.b : TTCCAGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
LVRM1_0043_B12.b : TTCCAGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
OVRM1_0010_C08.b : TTCCAGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
CLNT1_0041_B01.b : TTCCAGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
ADR01_0058_H08.b : TTCCAGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
ITT01_0020_G01.b : GGACAGCTGGCGCCGGCAGCAACCCGGGGGCTGGAggcg*gcgcggggcgcgcgggcggg
OVRM1_0121_C11.b : xxxxAGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
OVRM1_0140_C10.b : xxxxxGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
BFLT1_0060_H10.b : xxxxxGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
OVRT1_0095_E03.b : xxxxxGTTCACTCGGCAGCGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
HTMT1_0025_F05.b : xxxxxxxxxxxxxxxxxxxGGAGCcgggcggagggggcgagcgcggggcgcgcgggcggg
HTMT1_0108_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGAGGgggcgagcgcggggcgcgcgggcggg
CBLT1_0019_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGGGGCGAGCGCGGTGCGCGCGGGCGGG
DCI01_0014_H09.b :
20110601C-002297 : AAGCGAGGAGGCGGGCGGGCCAGTGAGGAGAGCGGAGAGAAAAGGCGCGAGCGGCCGAGA
---------+---------+---------+---------+---------+---------+ 153
BFLT1_0104_C02.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
SPL01_0026_A03.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
PTG01_0049_H03.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
LVRM1_0162_H11.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
LVRM1_0043_B12.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
OVRM1_0010_C08.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
CLNT1_0041_B01.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
ADR01_0058_H08.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
ITT01_0020_G01.b : AAGCGAGGAGGCGGGCGGGCCAGTGAGGAGAGCGGAGAGAAAAGGCGCGAGCGGCCGAGA
OVRM1_0121_C11.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
OVRM1_0140_C10.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
BFLT1_0060_H10.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
OVRT1_0095_E03.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
HTMT1_0025_F05.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
HTMT1_0108_F11.b : aagcgaggaggcgggcgggccagtgaggagagcggagagaaaaggcgcgagcggccgaga
CBLT1_0019_B07.b : AAGCGAGGAGGCGGGCGGGCCAGTGAGGAGAGCGGAGAGAAAAGGCGCGAGCGGCCGAGA
DCI01_0014_H09.b :
20110601C-002297 : GGGCACGGGCCGGACACCTTGCTGCTGCCGCCGCCGCCGCCGCTGCGGCCGAGCCTCCCC
---------+---------+---------+---------+---------+---------+ 213
BFLT1_0104_C02.b : gggcACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcagccgAGCCTCCCC
SPL01_0026_A03.b : gggcACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcggccgAGCCTCCCC
PTG01_0049_H03.b : gggcACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcggccgAGCCTCCCC
LVRM1_0162_H11.b : gggcACGGGCCGGACACCTTGCTGCTGCCGCCGGCGCCGCCGCTGCGGCCGAGCCTCCCC
LVRM1_0043_B12.b : gggcACGGGCCGGACACCTTGCTGCTGCCGCCGGCGCCGCCGCTGCGGCCGAGCCTCCCC
OVRM1_0010_C08.b : gggcACGGGCCGGACACCTTGCTGCTGCCGCCGGCGCCGCCGCTGCGGCCGAGCCTCCCC
CLNT1_0041_B01.b : gggcACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcggccgAGCCTCCCC
ADR01_0058_H08.b : gggcACGGGCCGGACACCTTGCTGCTGCCGCCGGCGCCGCCGCTGCGGCCGAGCCTCCCC
ITT01_0020_G01.b : GGGCACGGGCCGGACACCTTGCTGCTGCCGCCGGCGCCGCCGCTGCGGCCGAGCCTCCCC
OVRM1_0121_C11.b : gggcACGGGCCGGACACCTTGCTGCTGCCGCCGGCGCCGCCGCTGCGGCCGAGCCTCCCC
OVRM1_0140_C10.b : gggcACGGGCCGGACACCTTGCTGCTGCCGCCGGCGCCGCCGCTGCGGCCGAGCCTCCCC
BFLT1_0060_H10.b : gggcACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcggccgAGCCTCCCC
OVRT1_0095_E03.b : gggcACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcggccgAGCCTCCCC
HTMT1_0025_F05.b : gggcACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcggccgAGCCTCCCC
HTMT1_0108_F11.b : gggcACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcggccgAGCCTCCCC
CBLT1_0019_B07.b : GGGCACGGGCCGGACACCTTgctgctgccgccgccgccgccgctgcggccgAGCCTCCCC
DCI01_0014_H09.b :
20110601C-002297 : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
---------+---------+---------+---------+---------+---------+ 273
BFLT1_0104_C02.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
SPL01_0026_A03.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
PTG01_0049_H03.b : TGAGCTTGCTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
LVRM1_0162_H11.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
LVRM1_0043_B12.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
OVRM1_0010_C08.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
CLNT1_0041_B01.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
ADR01_0058_H08.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
ITT01_0020_G01.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGCCCAGCCGGGGTGGGAAGAAGAAG
OVRM1_0121_C11.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
OVRM1_0140_C10.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
BFLT1_0060_H10.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
OVRT1_0095_E03.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
HTMT1_0025_F05.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
HTMT1_0108_F11.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
CBLT1_0019_B07.b : TGAGCTTACTGATCCATCTCCAGGGCCACCGCCATGTCCAGCCGGGGTGGGAAGAAGAAG
DCI01_0014_H09.b :
20110601C-002297 : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
---------+---------+---------+---------+---------+---------+ 333
BFLT1_0104_C02.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
SPL01_0026_A03.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGTTGCTG
PTG01_0049_H03.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
LVRM1_0162_H11.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
LVRM1_0043_B12.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
OVRM1_0010_C08.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
CLNT1_0041_B01.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
ADR01_0058_H08.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
ITT01_0020_G01.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
OVRM1_0121_C11.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
OVRM1_0140_C10.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
BFLT1_0060_H10.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
OVRT1_0095_E03.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
HTMT1_0025_F05.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
HTMT1_0108_F11.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
CBLT1_0019_B07.b : TCCACCAAAACCTCCCGGTCCGCCAAGGCGGGCGTCATCTTCCCCGTGGGCCGGATGCTG
DCI01_0014_H09.b :
20110601C-002297 : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
---------+---------+---------+---------+---------+---------+ 393
BFLT1_0104_C02.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
SPL01_0026_A03.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
PTG01_0049_H03.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
LVRM1_0162_H11.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
LVRM1_0043_B12.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
OVRM1_0010_C08.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
CLNT1_0041_B01.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
ADR01_0058_H08.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
ITT01_0020_G01.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
OVRM1_0121_C11.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
OVRM1_0140_C10.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
BFLT1_0060_H10.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
OVRT1_0095_E03.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
HTMT1_0025_F05.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
HTMT1_0108_F11.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
CBLT1_0019_B07.b : CGGTACATCAAGAAAGGCCACCCCAAGTACAGGATTGGAGTGGGGGCGCCGGTGTACATG
DCI01_0014_H09.b :
20110601C-002297 : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
---------+---------+---------+---------+---------+---------+ 453
BFLT1_0104_C02.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
SPL01_0026_A03.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
PTG01_0049_H03.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
LVRM1_0162_H11.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
LVRM1_0043_B12.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
OVRM1_0010_C08.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
CLNT1_0041_B01.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
ADR01_0058_H08.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
ITT01_0020_G01.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
OVRM1_0121_C11.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
OVRM1_0140_C10.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCNACGCAGCAAGA
BFLT1_0060_H10.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
OVRT1_0095_E03.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
HTMT1_0025_F05.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
HTMT1_0108_F11.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
CBLT1_0019_B07.b : GCCGCCGTCCTGGAGTACCTGACAGCGGAGATTCTGGAACTGGCTGGCAACGCAGCAAGA
DCI01_0014_H09.b :
20110601C-002297 : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
---------+---------+---------+---------+---------+---------+ 513
BFLT1_0104_C02.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
SPL01_0026_A03.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
PTG01_0049_H03.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
LVRM1_0162_H11.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGACGAA
LVRM1_0043_B12.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGACGAA
OVRM1_0010_C08.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGACGAA
CLNT1_0041_B01.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
ADR01_0058_H08.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGACGAA
ITT01_0020_G01.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGACGAA
OVRM1_0121_C11.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGACGAA
OVRM1_0140_C10.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGACGAA
BFLT1_0060_H10.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
OVRT1_0095_E03.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
HTMT1_0025_F05.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
HTMT1_0108_F11.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
CBLT1_0019_B07.b : GACAACAAGAAGGGCCGGGTCACCCCCCGACACATCCTGCTGGCCGTGGCCAACGATGAA
DCI01_0014_H09.b :
20110601C-002297 : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
---------+---------+---------+---------+---------+---------+ 572
BFLT1_0104_C02.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
SPL01_0026_A03.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
PTG01_0049_H03.b : GAGCTCAATCAGCTGCTAAAAGGTGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
LVRM1_0162_H11.b : GAGCTCAATCATCTGCTCAAAGGAGTCACCATAGCCCGC*GGAGGGGTGTTACCGAACAT
LVRM1_0043_B12.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
OVRM1_0010_C08.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
CLNT1_0041_B01.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
ADR01_0058_H08.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
ITT01_0020_G01.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
OVRM1_0121_C11.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
OVRM1_0140_C10.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGCCGGAGGGGTGTTACCGAACAT
BFLT1_0060_H10.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
OVRT1_0095_E03.b : GAGCTCAATCAGCTGCTAAAAGGAGTTACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
HTMT1_0025_F05.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
HTMT1_0108_F11.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
CBLT1_0019_B07.b : GAGCTCAATCAGCTGCTAAAAGGAGTCACCATAGCCAGC*GGAGGGGTGTTACCGAACAT
DCI01_0014_H09.b : nnnaaggatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-002297 : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
---------+---------+---------+---------+---------+---------+ 632
BFLT1_0104_C02.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
SPL01_0026_A03.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
PTG01_0049_H03.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
LVRM1_0162_H11.b : CCACCCGGAGTTGCTAGTGAAGAAACTAGGATCCccatgggggttgtgagccatcatctc
LVRM1_0043_B12.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
OVRM1_0010_C08.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
CLNT1_0041_B01.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
ADR01_0058_H08.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
ITT01_0020_G01.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
OVRM1_0121_C11.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
OVRM1_0140_C10.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCACAGGGGAGTTGGAAGCCATCATCAC
BFLT1_0060_H10.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
OVRT1_0095_E03.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
HTMT1_0025_F05.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCATAGGGAAGTTGGAAGCCATCATCAC
HTMT1_0108_F11.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
CBLT1_0019_B07.b : CCACCCGGAGTTGCTAGCGAAGAAACGAGGATCCAAAGGGAAGTTGGAAGCCATCATCAC
DCI01_0014_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-002297 : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAAAAC
---------+---------+---------+---------+---------+---------+ 692
BFLT1_0104_C02.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCNTANAAAAC
SPL01_0026_A03.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGATAAC
PTG01_0049_H03.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAAAAC
LVRM1_0162_H11.b : gcccccctctccaaaaaagtcaagtctccgtccccacagaaacccgtgttttataaaaag
LVRM1_0043_B12.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCGCGTGTCTAAGAAAAC
OVRM1_0010_C08.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAANATAAC
CLNT1_0041_B01.b : GCCACCCCCAGCCAAAAAGGCCAAGACTCCGTCCCAGAAGAAGCCCGTGTCTAAGACAAC
ADR01_0058_H08.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAAAAC
ITT01_0020_G01.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGNAAAC
OVRM1_0121_C11.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAAAAC
OVRM1_0140_C10.b : GCCACCCCCAGCCAAAAAGGGCCAGTCTCCGTCCCAGAAGAAGCCCGTGGTCTAGAAAAC
BFLT1_0060_H10.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAAAAC
OVRT1_0095_E03.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAGAAC
HTMT1_0025_F05.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAAAAC
HTMT1_0108_F11.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAAAAC
CBLT1_0019_B07.b : GCCACCCCCAGCCAAAAAGGCCAAGTCTCCGTCCCAGAAGAAGCCCGTGTCTAAGAAAAC
DCI01_0014_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTCTAAGAAAAC
20110601C-002297 : AGGCGGCAAGAA*GGGGGCCCGGAAATCCAAGAAG***CAGGGAGAAGTCAGCAAGGCAG
---------+---------+---------+---------+---------+---------+ 748
BFLT1_0104_C02.b : AGGCGGCAAGAA*GGGGGGCCGGAAATCCNAGAAG***CAGGGAGAAGTCAGCAAGGCAG
SPL01_0026_A03.b : AGGCGGCAAGAA*GGGGGCCCGGAAATCCAAGAAG***CAGGGAGAAGTCAGCAAGGCAG
PTG01_0049_H03.b : AGGCGGNCAGAA*GGGGGCCGGNAAATCCAAGAAG***CAGGGAGAAGTCAGCAAGGCAG
LVRM1_0162_H11.b : gcgggctagaagggggcccggaatcctataatctggcagagtctgc
LVRM1_0043_B12.b : AGGCGGCAAGGAGGGGGGCCCGGAAATCCagaagaagcgtggagaatcggcaaggcagcc
OVRM1_0010_C08.b : AGGCNGCAAGAA*TGGGGCCCGGATATCCAAGAAG***CAGGGAGAAGTCAGCATGGCAG
CLNT1_0041_B01.b : AGGCGGCAAGAA*GGGGGCCCGGAAATCCAAGAAG***CAGGGAGAAGTCAGCAAGGCAG
ADR01_0058_H08.b : AGGCGGCAAGAA*GGGGGCCCGGAAATCCAAGAAG***CAGGGAGAAGTCAGCAAGGCAG
ITT01_0020_G01.b : AGGCGGCAAGAAGGGGGCCCGGGAAATCCA*GAAGAAGCAGGGAGAAGTCAGCAAGGCAG
OVRM1_0121_C11.b : AGGCGGNCAGAA*GGGGGCCCGGAAATCCAAGAAGAAACAGGGAGAAGTCAGCAAGGCAG
OVRM1_0140_C10.b : AAGCGGGCAGAAAGGGGGCCCGGAAATCCAAGGAG***CAAGGAGTAGTCAGCTAGGGAG
BFLT1_0060_H10.b : AGGCGGCAAGAA*GGGGGCCCGGAAATCCAAGAAGAAGCAGGGAGAAGTCAGCAAGGCAG
OVRT1_0095_E03.b : AGGCGGCAAGAA*GGGGGCCCGGATCATCCAGAAG***CAGGGAGAAGTCAGCAAGGCAG
HTMT1_0025_F05.b : AGGCGGCCAATAAGGGGGCCCGGAAATCCCTGAAG***CTGGTAGAAGTCAGCAAGGCAG
HTMT1_0108_F11.b : AGGCGGCAAGAA*GGGGGCCCGGAAATCCAAGAAGAAGCAGGGAGAAGTCAGCAAGGCAG
CBLT1_0019_B07.b : AGGCGGCAAGAA*GGGGGCCCGGAAATCCAAGAAG***CAGGGAGAAGTCAGCAAGGCAG
DCI01_0014_H09.b : AGGCGGCAAGAA*GGGGGCCCGGAAATCCAAGAAG***CAGGGAGAAGTCAGCAAGGCAG
20110601C-002297 : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGTCCACCA
---------+---------+---------+---------+---------+---------+ 808
BFLT1_0104_C02.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGTCCACCA
SPL01_0026_A03.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGT
PTG01_0049_H03.b : CCAGCGCCGAACAGCACACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGTCCACCA
LVRM1_0162_H11.b :
LVRM1_0043_B12.b : agcg
OVRM1_0010_C08.b : CCAGCGCCTACAGCACAACTGAGGGCACTTCCGCCGACGGCTTCACCG
CLNT1_0041_B01.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGTCCACCA
ADR01_0058_H08.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTCTCCACCA
ITT01_0020_G01.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTCTCCACCA
OVRM1_0121_C11.b : CCAGCGCCCGACAGCACACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTCTCCACNA
OVRM1_0140_C10.b : CTAGCGCCGACAGCccgactggagggcctc
BFLT1_0060_H10.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGTCCACCA
OVRT1_0095_E03.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGTCCACCA
HTMT1_0025_F05.b : CCTTCGCCGACAGCACAACTGAGGGCACTCCCGCCGATCGCTTCACCGGGCTTTCCACCA
HTMT1_0108_F11.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGTCCACCA
CBLT1_0019_B07.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTGTCCACCA
DCI01_0014_H09.b : CCAGCGCCGACAGCACAACTGAGGGCACTCCCGCCGACGGCTTCACCGTGCTCTCCACCA
20110601C-002297 : AGAGCCTCTTTCTCGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACA
---------+---------+---------+---------+---------+---------+ 868
BFLT1_0104_C02.b : *AGAGCtctttctcggccgaagtttgcagtgtacaggctgaaatgcttccatcaaaatga
SPL01_0026_A03.b :
PTG01_0049_H03.b : *GAGCCTCTTTCTCGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACA
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b : AGAGCCTCTTTCTCGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACA
ADR01_0058_H08.b : AGAGCCTCTTTCTCGGCCAGAAGTTTGCAGTTGTACAGGCTGACATTGCCTCGATCGACA
ITT01_0020_G01.b : AGAGCCTCTTTCTCGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACA
OVRM1_0121_C11.b : GAGC
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : AGAGCCTCTTTCTCGGCCAGAAGTTGCAAGTTGTACAGGCTGACCTTGCCTCGATCGACA
OVRT1_0095_E03.b : AGAGCCTCTTTCTCGACCAGAAAGTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACA
HTMT1_0025_F05.b : AGAGCCTCTTTCTTGG*CAAAAGTTTCAAGTTGTACAGGCCTGAATTGCCTCCTTCGAAA
HTMT1_0108_F11.b : AGAGCCTCTTTCTCGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACA
CBLT1_0019_B07.b : AGAGCCTCTTTCTCGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACA
DCI01_0014_H09.b : AGAGCCTCTTCCTCGGCCAGAAGTTGCAAGTTGTACAGGCTGACATTGCCTCGATCGACA
20110601C-002297 : GTGACGCTGTCGTTCACCCGACAAACACTGACTTCTACACCGGTGGTGAAGTAGGAAACA
---------+---------+---------+---------+---------+---------+ 928
BFLT1_0104_C02.b : ccctgtccttcacccaacaacctgacttctccccgggggtaaattagaaacccctgaaaa
SPL01_0026_A03.b :
PTG01_0049_H03.b : GTGACGCTGTCGTTtcacccgaaaaccctgaactctacaccggtggtgaattaggaaccc
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b : GTGACGCTGTCGTTCACCCGAC*AACACTGACTTCTACACCGGTGGTGAAGTAGGAAACA
ADR01_0058_H08.b : GTGACGCTGTCGTTCACCCGACAAACACTGACTTCTACACCGGTGGTGAAGTANNGAACA
ITT01_0020_G01.b : GTGGCGCTGTCGTTCACCCGAACAACACTGACTTCTACACCGGTGGTGAAGTAAGAAACA
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : GTGACGCTGTCGTTCACCCGACAAACACTGGACTCTACACGGGTGGTGAAGTAGGAAACA
OVRT1_0095_E03.b : GTGACGCTGTCGTTCACCCGACAAACACTGACTTCTACACCGGTGGNTGAGTAGGAAACA
HTMT1_0025_F05.b : GTGACGCTGgtcttctccccataaacactgatttctaacccggttggtgaattggataac
HTMT1_0108_F11.b : GTGACGCTGTCGTTCACCCGAC*AACACTGACTTCTACACCGGTGGTGAAGTAAGAAACc
CBLT1_0019_B07.b : GTGACGCTGTCGTTCACCC*AACAACACTGACTTCCACACGGGTGGTGAAGTAGGAAACc
DCI01_0014_H09.b : GTGACGCTGTCGTTCACCCGACAAACACTGACTTCTACACCGGTGGTGAAGTAGGAAACA
20110601C-002297 : CGCTGGAGAAGAAGGGTGGCAAGGAGTTTGTGGAAGCTGTTCTGGAACTCCGGAAAAAGA
---------+---------+---------+---------+---------+---------+ 988
BFLT1_0104_C02.b : aaaaggtggcaaggatttttgaacctttttggaatccgaaaagatggccctttaattacc
SPL01_0026_A03.b :
PTG01_0049_H03.b : gctgaaaaaaaagggtggcaagagtttgtgaaacttgtctgaactccggaaaaaaatggg
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b : CGCTGGAGAgaaaggtggcaggagtttgtggaancttgtctgaaactccggaaaagattg
ADR01_0058_H08.b : CGCTGGAGAAGAAGGGTGGGCAGGAGTTTGTGGAAGCTGTTCTGGNACTCCNG*AAAAGA
ITT01_0020_G01.b : CGCTGGAGAAAAAGGGTGGCAAGGAGTTTGTGGAAGCTGTTCTGGAACTCCCG*AAAAag
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : CGCTGGAaaaaaggggggcaaggaattgtggaaactgttctggaactccggaaaaagatg
OVRT1_0095_E03.b : CGCTGGAAAAGAAGGGTGGCAGGAAGTTTGTGGAAGCTGTTCTGGAACTTCGG*AAAAag
HTMT1_0025_F05.b : ccccttgataaagaggttggcaaggattttgtggaaattgtcctggaaccctagaaaaaa
HTMT1_0108_F11.b : ccctggaaaagaaagggtggcaaggattttgttgaaactgttctggacctccggaaaaga
CBLT1_0019_B07.b : gctggaaagaagggtggcaaggaattgtggaaactgttctggaactcggaaaaaaatggg
DCI01_0014_H09.b : CGCTGGAGAAGAAGGGTGGCAAGGAGTTTGTGGAAGCTGTTCTGGAACTCCGGAAAAAGA
20110601C-002297 : ACGGGCCCTTGGAAGTAGCCGGAGCTGCTGTCAGTGCGGGCCATGGCCTGCCCGCCAAGT
---------+---------+---------+---------+---------+---------+ 1048
BFLT1_0104_C02.b : ggacttctttatacgggcaggctgcccccaattttatcccgtaccctccggggggtgaaa
SPL01_0026_A03.b :
PTG01_0049_H03.b : cccttgaattacccgaactctgtcttgcggccgggcctgcccccaagttgggatccctga
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b : ggccctggaagtanccgacctgctgtcgtgcggccatgccttgccgccagttgggatcac
ADR01_0058_H08.b : ATGGGCCCTTTGGAGTAGCCGGAGCTGCTGtcagtgcgggcatggcctgcccgccnagtt
ITT01_0020_G01.b : atgggcccttggaattacccggactgctgtcatggcggggcatgccctgccccccagttt
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : ggccctgtgaatanccggagctgctttcatgcggggcagggcctgcccgccagttgggat
OVRT1_0095_E03.b : aatgggcccttggaagtaccgggcctgctgtcagggcgggcatggccttgccgccaattt
HTMT1_0025_F05.b : ataggcccctggaaattatcctgatctgcttttatgggcggctttggcctgccccacgtt
HTMT1_0108_F11.b : attggccctttgaaattacccgaacttctttccatgcgggcccgggcctgccccccaatt
CBLT1_0019_B07.b : cccttggaaataaccggaactgctgtcattgggggcctggctcgccccccaatttgggat
DCI01_0014_H09.b : ACGGGCCCTTGGAAGTAGCCGGAGCTGCTGTCAGTGCGGGCCATGGCCTGCCCGCCAAGT
20110601C-002297 : TTGTGATCCACTGTAACAGTCCCGTGTGGGGTGCAGACAAGTGTGAGGAGCTTCTGGAAA
---------+---------+---------+---------+---------+---------+ 1108
BFLT1_0104_C02.b : aatttgggaccttcggaaaaatgaaaaattttgcctgaaaaaaaaaactattcttccttt
SPL01_0026_A03.b :
PTG01_0049_H03.b : acatcccggggggggcaaaaatgggggaatttggaaaaaatggaaaactgtggcccggaa
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b : tgtacatccctgggggggcaaacagtggaggacttctgaaaaaacttgaaactgctggcc
ADR01_0058_H08.b : tgtgatccactgtacagtcccgtgtggggtgcnacaaatgttgagagcttctggaagaag
ITT01_0020_G01.b : gggaatcccgtaaacatccccggtggggggcacacagtgggaggacctctcggaaaaact
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : ccctggaacaaccccgggggggggcaaacagtgggagggcttccggaaaaacagggaaaa
OVRT1_0095_E03.b : gggatcactggacagccccggggggtgcaaaaaggtgagacctccggaaaaaagtggaaa
HTMT1_0025_F05.b : tttgagaccactgtaacagtccccggtgggggtgtaacaattggggggattcttctgaaa
HTMT1_0108_F11.b : ttgtattccctgttaaatctcccggttgggggcaaacaatttggggaacttcgggaaaaa
CBLT1_0019_B07.b : tccctgtaacatcccctggggggggcaaaaaaattggagggctttcggaaaaaaaatgaa
DCI01_0014_H09.b : TTGTGATCCACTGTAACAGTCCCGTGTGGGGTGCAGACAAGTGTGAGGAGCTTCTGGAAA
20110601C-002297 : AGACAGTGAAGAACTGCTTGGCCCTGGCAGACGATAAGAAGCTCAAGTCCATCGCCTTTC
---------+---------+---------+---------+---------+---------+ 1168
BFLT1_0104_C02.b : cctctgggcgggaggagttttaaaaaaggctcttttttgggccccccctttttttcaggc
SPL01_0026_A03.b :
PTG01_0049_H03.b : aaaaaaaaaccaatcccccctttctccccgggaggggggagggttttcaaaaagggctcc
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b : tggaaacataaaacctagtcctcccttttctcctcggggggggggaggttttcaaaaaaa
ADR01_0058_H08.b : gtgaagactgcttgtccctgcaacaataaaagctaagtcatcgctttctctcttggggag
ITT01_0020_G01.b : tgnaaaatggttggccctggcaaaaaaaaaacccagttcctcccttttcttcttgggagg
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : ttcttggcctgccaaaaaaaaaaaccagtcttccctttctcccctggaggggaggaaagg
OVRT1_0095_E03.b : atgcttgccttgaaaaaaaaaaatcaatcctccccttcctcacggggggggggaaggttt
HTMT1_0025_F05.b : aatgagatgataaattttgtgaccctggaataataaggatatctgctcttcacttttcat
HTMT1_0108_F11.b : catgaaaaattgcttggcccctgcaaacaataaaaacctaagttctctccccttcctccc
CBLT1_0019_B07.b : aaaacgcttggccctggcaaaaaaaaaaaaccaagttcctcccttttcccccccgggggg
DCI01_0014_H09.b : AGACAGTGAAGAACTGCTTGGCCCTGGCAGACGATAAGAAGCTCAAGTCCATCGCCTTTC
20110601C-002297 : CATCCATCGGCAGCGGCAGGAAACGGTTTCCGAAGCAGACGGCAGCTCAGCTGATCCTGA
---------+---------+---------+---------+---------+---------+ 1228
BFLT1_0104_C02.b : tttttaaaaggttttttgttttccaaatattttctcggaaggcccgcgcccttgggataa
SPL01_0026_A03.b :
PTG01_0049_H03.b : ctttctggggcccccccttttggtgaacgtgtctcttaaaaaggtttggtgttttcccaa
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b : ggggttccgtttcggaggccttcccttttttggaacggtcccttttaaaagggtttttgt
ADR01_0058_H08.b : gggggaagggtttccaaccaaggggtcccctgatcctgggcgtcctccgcctttggtaac
ITT01_0020_G01.b : gggggaaggtttttcaaaaaaagggactcccgtgatctggaggccctcccgcctcttggg
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : tttccaaaaaagggccccccttttcggaggccctccgctttgggttccattcctttccta
OVRT1_0095_E03.b : caaacaaaggcccccgtttccgaggctttccctttttgggaccggtcctttcaaaaaggt
HTMT1_0025_F05.b : ctcctgggttgtgggtagtgttttcgaaatgattggcatcctcgtaattcggggcatctc
HTMT1_0108_F11.b : tgggggggggggagaggttttttaaaaaaaaggacctttttatttcggggggcccccccc
CBLT1_0019_B07.b : ggggggaaggtttccaaaaaaagggcctcccctgttttgaggggccttcccccttttttg
DCI01_0014_H09.b : CATCCATCGGCAGCGGCAGGAAACGGTTTCCGAAGCAGACGGCAGCTCAGCTGATCCTGA
20110601C-002297 : NGGCCATCTCCAGCTACTTCGTGTCACCCATGTCCTCTTCCATCAAAAACGTGTATTTTG
---------+---------+---------+---------+---------+---------+ 1288
BFLT1_0104_C02.b : cacccccccccccctttaaaaaaatctcccgggggctttttttcgagggatttttttttt
SPL01_0026_A03.b :
PTG01_0049_H03.b : atttcctcccgggagagcggggcccatggggaagccaacccccccccccccttataaaaa
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b : tttttccgatttttcctcctcggaaaggcc
ADR01_0058_H08.b : agggctcttcacaaa
ITT01_0020_G01.b : tcacctgtcccttctccaaagggtttttggtctttaccccaatttagctttcctccaan
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : aaagtgtttttgtgtttcacgaaattatccctctccgaaaggcaccgggcccctggggag
OVRT1_0095_E03.b : atttggttgttgaccaatttggccctctgggaaggcactggcccatgggtgaaagcaaac
HTMT1_0025_F05.b : cagtctttagtgatcggtgctctctttccacatatgattcttgttgtcttacacgctaca
HTMT1_0108_F11.b : ctttttgtgtacacattcccttccccaaaaaggtgtttttttttttttaaccaaaatagt
CBLT1_0019_B07.b : gcaaatgtcccctcttaaaaagtgtattttggcgttttaaccagaaatagctccctcctc
DCI01_0014_H09.b : NGGCCATCTCCAGCTACTTCGTGTCACCCATGTCCTCTTCCATCAAAAACGTGTATTTTG
20110601C-002297 : TGCTGTTTGACAGCGAGAGTATAGGCATCTACGTGCAGGAAAATGGCCAGCTGGACGCAA
---------+---------+---------+---------+---------+---------+ 1348
BFLT1_0104_C02.b : ttttcnnannnnnccnnnnnnttcnnngggcctcctcgcgcgccccctattttttattac
SPL01_0026_A03.b :
PTG01_0049_H03.b : aaacccccccggggggactctttttttttaaagagttgttcttttttcacatttcct
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b : aaggaacaccccctcccccccccttaagaaagaaaatccctctcgcgggggaccttt
OVRT1_0095_E03.b : ccccccgccccccttttaaaagaaaaatccccccggggggaactttttgttgctcgaaga
HTMT1_0025_F05.b : attactctttgctgtaggcgcttgcatcgcaatatgagtgatgatgaaacgcagtccttt
HTMT1_0108_F11.b : atcccccttgggggaggcccgcgcgcccccttgggagagaagtaaaacccccccctcgcc
CBLT1_0019_B07.b : gaaaaggccccgggggccccctggggaagaagtgaaaaccccccctcgccccctccaata
DCI01_0014_H09.b : TGCTGTTTGACAGCGAGAGTATAGGCATCTACGTGCAGGAAAATGGCCAGCTGGACGCAA
20110601C-002297 : ACTANGCTGAAGAACTGCAGAAACAGCCCGGCACATGCCCCCGCCTCCACCTGAAAGAAA
---------+---------+---------+---------+---------+---------+ 1408
BFLT1_0104_C02.b : ttnnnnnnt
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b : ggttttttttttactttattccgaaaaaaagggggcg
HTMT1_0025_F05.b : cttctcatactatagaaatagattatctctccaccgctgctgagagagatcttattgatt
HTMT1_0108_F11.b : cctccattaataaaagaaatatcccctcctcgggg
CBLT1_0019_B07.b : aaaaaaaaaaaatcccccctccgcgggaggggccattctttttttttctcgagaaaaagt
DCI01_0014_H09.b : ACTANGCTGAAGAACTGCAGAAACAGCCCGGCACATGCCCCCGCCTCCACCTGAAAGAAA
20110601C-002297 : AGCAAGAAATATCCCCCTCCGCTCCTCGGGGAAGGCGGGAACCTCTTCAATTTACATTTT
---------+---------+---------+---------+---------+---------+ 1468
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b : ctctatgacagagcgttgtactgttattttaccgataacttatagcgangtcacaatact
HTMT1_0108_F11.b :
CBLT1_0019_B07.b : ttttcttctttttttttctta
DCI01_0014_H09.b : AGCAAGAAATATCCCCCTCCGCTCCTCGGGGAAGGCGGGAACCTCTTCAATTTACATTTT
20110601C-002297 : TGCCCATCAAGGAAAAATGAGGTTTTGGGTTTCAAGTTTAATGGTTTTTGACCTTCAAAA
---------+---------+---------+---------+---------+---------+ 1528
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b : atgcgctatgctatgc
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b : TGCCCATCAAGGAAAAATGAGGTTTTGGGTTTCAAGTTTAATGGTTTTTGACCTTCAAAA
20110601C-002297 : AGGTTTTTCCGT................................................
---------+---------+---------+---------+---------+---------+ 1540
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b :
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b : AGGTTTTTCCGTaccacgaaaattagaattacggttaagccatgtgtcccgacgggtctg
20110601C-002297 : ............................................................
---------+---------+---------+---------+---------+---------+ 1540
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b :
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b : attttatgtacctaggaaatttaaagttttatttatggaatcctgctgacccaaacaacc
20110601C-002297 : ............................................................
---------+---------+---------+---------+---------+---------+ 1540
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b :
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b : ggaaaagcatgtcctccactgggccaatccagaaaccccttgtaaccgggtgctggggct
20110601C-002297 : ............................................................
---------+---------+---------+---------+---------+---------+ 1540
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b :
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b : tattgaaccccgggggtcctttacaaaaggtcccttatttcctcaaaaaaaaactagatt
20110601C-002297 : ............................................................
---------+---------+---------+---------+---------+---------+ 1540
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b :
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b : tcgccacttaatttgtatttttctttgggggttttaaaaaaattaaggggaaaaaccccg
20110601C-002297 : ............................................................
---------+---------+---------+---------+---------+---------+ 1540
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b :
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b : ccctcaatatccttggaattggggggttgtaaaagaaacccaaaaaaaaaaaaaaaaaag
20110601C-002297 : ............................................................
---------+---------+---------+---------+---------+---------+ 1540
BFLT1_0104_C02.b :
SPL01_0026_A03.b :
PTG01_0049_H03.b :
LVRM1_0162_H11.b :
LVRM1_0043_B12.b :
OVRM1_0010_C08.b :
CLNT1_0041_B01.b :
ADR01_0058_H08.b :
ITT01_0020_G01.b :
OVRM1_0121_C11.b :
OVRM1_0140_C10.b :
BFLT1_0060_H10.b :
OVRT1_0095_E03.b :
HTMT1_0025_F05.b :
HTMT1_0108_F11.b :
CBLT1_0019_B07.b :
DCI01_0014_H09.b : ggccggcccccaaattatatatttgggcggggataaagaaaaattatatt