[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002416

Length: 1,316

Sequence [FASTA format sequence]
GAAGGAGGCA CGTGGTTAAG CTCGCAGGAG GTGGATTCCA TGGGTGTTAA TTTCAGTTCC
TTTTGTAAGA AGAGCTCAGA ATCACAAGAG GGAAACTTGC CCCAAAGATG AGCCTCGCAT
GTACAACCTT GGCCAGCTTC CTCCTGATTT TCATTGTTTC CAACAAAGGT ACAGTCTCTC
AAATTACTGA GGTTGTCTGG GGCATCGTGG ATCAAGACAT CAACCTGGAC ATTCCTGAAC
TTTCAAAACA TGATAACGTA GATCATATAC GATGGCAGAA GAATGAAAAC AAGATCGCAG
AATTTAAAAA AAACAAAGAA ACTCACCCTG TGAAAGACAC ATACATGATG TTACCAAATG
GAACTCTGAG AATTAAAGAT CTGAAGAGAG ATGATGAGGG TATCTACAAG GTAACTGTCT
ATGCTACGGA TGGAAAACAC ATGCTGGAGA GAAAATTTGA TTTGCAGATT CTAGATGGGG
TCTCAAAACC TGTAATCTCC TGGAGCTGTG CCAACAAAAC GGTGACCTGT GAGGTAGCAG
AAGGAAGTGA CCCTAAGTTA AAACTGTATG TAAATAAGTC CACTGCCAGA GAAGGTCGTC
AGAAGGTCAT CCTGTGGAAG TGGAACACCA AATGGAGCAC ATTATTCAAG TGTGTGGCCA
GTAACAACGC CAGTGAGCAA ATCAGCATGG TGACCATCAG TTGTACGGGG CAAGGTCTGG
ATATCTATCT CATCATCGGC ATCTGCGGAG GAGGCACCGT ATTCCTCATC TTCATAGCAC
TACTCATATT CTACACCAGC AAGAGGAAAA AGCAGAGCAG CAGGAGAAAT GATGAGGAGC
TGGAGATAAG AGCGAAGAGA GCGAGCCCCG AGGAAAGGGG CCGGAAGCCC CATCCATTTC
CAGGCTCAAC TCCTCAAAAT CCGGTCATTT CCCAAACTCC TCCAATGCCT GGTCATCGTT
CTCAGGCACC TACTCCTCGT CCCGGGCCTC CTGGCCCCCG TGTCCAGCAC CCACAGAAGA
AGAGGCCTCC TCCTACCCCG GGCACACAAG TTCACCAGCA AAAAGGCCCT CCCCTCCCCA
AGCCTCGAGT TCAAACAAAA CCTACCCATG AGGGCAAAGA AAACTCATAA CTCTGTCTCC
TGATGCGGGT GTCCCTTCCC CTCTANTAAA AGAGAACAGA AACTGTCCTT TCCCTGTAAA
NGCACTGTGG AGTTTCTCCA CTCAGGCGCG CATGCTAGCC GCTTCATCAA GCGTGCTCTG
CAGGNNGACC GGGACAGCGC CCCAGCCTAG NAGCCACGCC CTGTCTGTAC CATCTA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD2T-cell surface antigen CD2 precursor [Homo sapiens]. 388e-108O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCd2T-cell surface antigen CD2 precursor [Mus musculus]. 2862e-77O
Contig/Assembly ProteinSlamf7SLAM family member 7 precursor [Mus musculus]. 55.59e-08O
Contig/Assembly ProteinHepacamhepatocyte cell adhesion molecule precursor [Mus musculus]. 50.43e-06O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC607448PREDICTED: similar to T-cell surface antigen CD2 precursor (T-cell surface antigen T11/Leu-5) (LFA-2) (LFA-3 receptor) (Erythrocyte receptor) (Rosette receptor) [Canis familiaris]. 3418e-94O
Contig/Assembly ProteinLOC489305PREDICTED: similar to hepatocyte cell adhesion molecule [Canis familiaris]. 50.83e-06O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD2T-cell surface antigen CD2 [Bos taurus]. 383e-106O
Contig/Assembly ProteinHEPACAMhepatocyte cell adhesion molecule precursor [Bos taurus]. 50.43e-06O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD2T-cell surface antigen CD2 [Sus scrofa]. 6660.0O


Assembly Members: 33      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
CLNT10028C02CLNT1_0028_C02.bFS659241 
CLNT10046B11CLNT1_0046_B11.bFS660671 
DCI010002H07DCI01_0002_H07.bDB790741 
ILNT10038B08ILNT1_0038_B08.bHX229684 
ITT010012F11ITT01_0012_F11.bBW977115 
ITT010018A02ITT01_0018_A02.bBW977579 AK392860
ITT010093B12ITT01_0093_B12.bBW984244 
LNG010005E11LNG01_0005_E11.bBP437774 
LNG010010B09LNG01_0010_B09.bBP434636 
LNG010017D02LNG01_0017_D02.bBP436034 
LNG010018A02LNG01_0018_A02.bBP433117 
LNG010101A01LNG01_0101_A01.bBP433094 
MLN010001F08MLN01_0001_F08.bCJ007781 
MLN010005B02MLN01_0005_B02.bCJ008041 
MLN010042F04MLN01_0042_F04.bCJ010968 
PBL010023C01PBL01_0023_C01.bBP155478 
PBL010028E08PBL01_0028_E08.bBP155921 
PBL010031D08PBL01_0031_D08.bBP155760 
PBL010037E09PBL01_0037_E09.bBW970250 
PBL010067G06PBL01_0067_G06.bBW972204 
PBL010068B01PBL01_0068_B01.bBW972228 
SPL010022F09SPL01_0022_F09.bBP158613 
SPL010078B11SPL01_0078_B11.bCJ020022 
THY010003F07THY01_0003_F07.bBP166217 
THY010019A06THY01_0019_A06.bBP159887 
THY010033C01THY01_0033_C01.bBP161853 
THY010054D10THY01_0054_D10.bBP164043 
THY010058H01THY01_0058_H01.bBP168142 
THY010092H08THY01_0092_H08.bBP168921 
THY010107A12THY01_0107_A12.bBP160553 AK351901
THY010110D10THY01_0110_D10.bBP164088 
THY010124B11THY01_0124_B11.bBP161719 AK239691
UTR010074B08UTR01_0074_B08.bBP463150 AK240451

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
500A400.121WSTCA/S
C2900.879TCC/S


Alignment:      TOP

20110601C-002416 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
ITT01_0018_A02.b : nnaagatgaacaxxxxxxxxxxxxxxxxxxxxxx
LNG01_0017_D02.b : c
THY01_0092_H08.b : tataacgggctgccgcc
UTR01_0074_B08.b :
MLN01_0042_F04.b :
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b :
MLN01_0001_F08.b :
THY01_0003_F07.b :
LNG01_0101_A01.b :
THY01_0054_D10.b :
ITT01_0093_B12.b :
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b :
MLN01_0005_B02.b :
ILNT1_0038_B08.b :
DCI01_0002_H07.b : tgagacctataggggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0019_A06.b :
THY01_0033_C01.b :
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b :
PBL01_0067_G06.b :
PBL01_0028_E08.b :
LNG01_0005_E11.b :
CLNT1_0028_C02.b :
LNG01_0018_A02.b :
CLNT1_0046_B11.b :
PBL01_0031_D08.b :
THY01_0110_D10.b :
PBL01_0068_B01.b :
20110601C-002416 : ................................GAAGGAGGCACGTGGTTAAGCTCGCAGG
---------+---------+---------+---------+---------+---------+ 28
ITT01_0018_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGGAGGCACGTGGTTAAGCTCGCAGG
LNG01_0017_D02.b : tcttggctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0092_H08.b : tcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0074_B08.b : ttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_F04.b : nnnggctaggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0058_H01.b : gccattatgcctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0124_B11.b : agtgtcaaaaacagct
PBL01_0037_E09.b : ngactaacaxxxxxx
MLN01_0001_F08.b : nnngttccctgtactaaaacagtttnacxxxxxxxxxxxxxxxx
THY01_0003_F07.b : agcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0101_A01.b : nnttttgctgtatatgacagtttnacxxxxxxxxxxxxxxxx
THY01_0054_D10.b : cttttggattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0093_B12.b : nnaatgxxxxxxxxxxxxx
SPL01_0022_F09.b : ctttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0107_A12.b : gtgtxxxxxxxxxxx
PBL01_0023_C01.b : tgatgaaca
MLN01_0005_B02.b : nnntttatgcatggactaagacagtttnac
ILNT1_0038_B08.b : nnnnggcgagag
DCI01_0002_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0019_A06.b : ggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0033_C01.b : ggggacctatxxxxxxxxxxxxxxxxxxxxx
LNG01_0010_B09.b : gcattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_B11.b : nnnggcttggactataacxxxxxxx
ITT01_0012_F11.b : n
PBL01_0067_G06.b :
PBL01_0028_E08.b :
LNG01_0005_E11.b : tttttttttagcattagtgxxxxxxxxxxxx
CLNT1_0028_C02.b : aaacg
LNG01_0018_A02.b : ttctttaactcggattagtgxxxxxxx
CLNT1_0046_B11.b : gggtccg
PBL01_0031_D08.b :
THY01_0110_D10.b :
PBL01_0068_B01.b :
20110601C-002416 : AGGTGGATTCCATGGGTGTTAATTTCAGTTCCTTTTGTAAGAAGAGCTCAGAATCACAAG
---------+---------+---------+---------+---------+---------+ 88
ITT01_0018_A02.b : AGGTGGATTCCATGGGTGTTAATTTCAGTTCCTTTTGTAAGAAGAGCTCAGAATCACAAG
LNG01_0017_D02.b : xxxxxxxxxxxxxxxxxxxxxgttgtAGTTCCTTTTGTAAGAAGAGCTCAGAATCACAAG
THY01_0092_H08.b : xxxxxxxxxxxxxxxxxgttaatttcAGTTCCTTTTGTAAGAAGAGCTCAGAATCACAAG
UTR01_0074_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCTTTTGTAAGAAGAGCTCAGAATCACAAG
MLN01_0042_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTGTAAGAAGAGCTCAGAATCACAAG
THY01_0058_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGTAAGAAGAGCTCAGAATCACAAG
THY01_0124_B11.b : ggtaccggtcggaatcctcagcacgtggcctactggGTAAGAAGA*CTCAGAATCACAAG
PBL01_0037_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAAGAAGAGCTCAGAATCACAAG
MLN01_0001_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAAGAAGAGCTCAGAATCACAAG
THY01_0003_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAAGAAGAGCTCAGAATCACAAG
LNG01_0101_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAAGAAGAGCTCAGAATCACAAG
THY01_0054_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAAGAAGAGCTCAGAATCACAAG
ITT01_0093_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAAGGAGAGCTCAGAATCACAAG
SPL01_0022_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGAAGAGCTCAGAATCACAAG
THY01_0107_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCAGAATCACAAG
PBL01_0023_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggAGAATCACAAG
MLN01_0005_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAATCACAAG
ILNT1_0038_B08.b : tagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAGAATCACAAG
DCI01_0002_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAATCACAAG
THY01_0019_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAATCACAAG
THY01_0033_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAATCACAAG
LNG01_0010_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgggggctgaatcatcGAATCACAAG
SPL01_0078_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAAG
ITT01_0012_F11.b : nnggttgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAAG
PBL01_0067_G06.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0028_E08.b : nnnngtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0028_C02.b : ttagctnacgaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0018_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0046_B11.b : ttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0031_D08.b : nngatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0110_D10.b : ttgcaaacggtggtcggt
PBL01_0068_B01.b :
20110601C-002416 : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
---------+---------+---------+---------+---------+---------+ 148
ITT01_0018_A02.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCCTCCTCCTGAT
LNG01_0017_D02.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0092_H08.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
UTR01_0074_B08.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
MLN01_0042_F04.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0058_H01.b : AGGGAAACTTGCCCCAAAGACGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0124_B11.b : A*GGAAACTTGCCCCAAAGAT*AGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
PBL01_0037_E09.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
MLN01_0001_F08.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0003_F07.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
LNG01_0101_A01.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0054_D10.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
ITT01_0093_B12.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
SPL01_0022_F09.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0107_A12.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
PBL01_0023_C01.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
MLN01_0005_B02.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
ILNT1_0038_B08.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
DCI01_0002_H07.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0019_A06.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0033_C01.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
LNG01_0010_B09.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
SPL01_0078_B11.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
ITT01_0012_F11.b : AGGGAAACTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
PBL01_0067_G06.b : xxxxxxxCTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
PBL01_0028_E08.b : xxxxxxxCTTGCCCCAAAGATGAGCCTCGCATGTACAACCCTGGCCAGCTTCCTCCTGAT
LNG01_0005_E11.b : xxxxxxxCTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
CLNT1_0028_C02.b : xxxxxxxCTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
LNG01_0018_A02.b : xxxxxxxCTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
CLNT1_0046_B11.b : xxxxxxxCTTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
PBL01_0031_D08.b : xxxxxxxxxTGCCCCAAAGATGAGCCTCGCATGTACAACCTTGGCCAGCTTCCTCCTGAT
THY01_0110_D10.b : cggaatcccagcacgtggcctactggaaaatgtgatgaaaacacctctcgaccgctgttc
PBL01_0068_B01.b :
20110601C-002416 : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
---------+---------+---------+---------+---------+---------+ 208
ITT01_0018_A02.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
LNG01_0017_D02.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0092_H08.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
UTR01_0074_B08.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
MLN01_0042_F04.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0058_H01.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0124_B11.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
PBL01_0037_E09.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
MLN01_0001_F08.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0003_F07.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTAAAATTACTGAGGTTGTCTGGGGCATCGT
LNG01_0101_A01.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0054_D10.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
ITT01_0093_B12.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
SPL01_0022_F09.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0107_A12.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
PBL01_0023_C01.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
MLN01_0005_B02.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
ILNT1_0038_B08.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
DCI01_0002_H07.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0019_A06.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0033_C01.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
LNG01_0010_B09.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
SPL01_0078_B11.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
ITT01_0012_F11.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
PBL01_0067_G06.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
PBL01_0028_E08.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
LNG01_0005_E11.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
CLNT1_0028_C02.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
LNG01_0018_A02.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
CLNT1_0046_B11.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
PBL01_0031_D08.b : TTTCATTGTTTCCAACAAAGGTACAGTCTCTCAAATTACTGAGGTTGTCTGGGGCATCGT
THY01_0110_D10.b : agcaaggaacacatcgccgGGTACAGTCTCTCA*ATTACTGAGGTTGT*TGGGGCTTCG*
PBL01_0068_B01.b :
20110601C-002416 : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
---------+---------+---------+---------+---------+---------+ 268
ITT01_0018_A02.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
LNG01_0017_D02.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
THY01_0092_H08.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
UTR01_0074_B08.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
MLN01_0042_F04.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
THY01_0058_H01.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
THY01_0124_B11.b : GGATCAAGACATCAACTTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
PBL01_0037_E09.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
MLN01_0001_F08.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
THY01_0003_F07.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
LNG01_0101_A01.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
THY01_0054_D10.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
ITT01_0093_B12.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
SPL01_0022_F09.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
THY01_0107_A12.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
PBL01_0023_C01.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
MLN01_0005_B02.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
ILNT1_0038_B08.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
DCI01_0002_H07.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
THY01_0019_A06.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
THY01_0033_C01.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
LNG01_0010_B09.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
SPL01_0078_B11.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
ITT01_0012_F11.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
PBL01_0067_G06.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
PBL01_0028_E08.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
LNG01_0005_E11.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
CLNT1_0028_C02.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
LNG01_0018_A02.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAAATCATAT
CLNT1_0046_B11.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATAT
PBL01_0031_D08.b : GGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAGACATGATAACGTAGATCATAT
THY01_0110_D10.b : GGATCA*GACTTC*ACCTGCACTTTCTGAAACTTTCAA*ACATGATAACGTAGATCATAT
PBL01_0068_B01.b : nnnggtg
20110601C-002416 : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
---------+---------+---------+---------+---------+---------+ 327
ITT01_0018_A02.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
LNG01_0017_D02.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
THY01_0092_H08.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
UTR01_0074_B08.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAA*CAAAGAAACTCACC
MLN01_0042_F04.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAATTTTAAAAAAAACAAAGAAACTCACC
THY01_0058_H01.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
THY01_0124_B11.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAATTTAAAAAAAAACAAAGAAACTCACC
PBL01_0037_E09.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
MLN01_0001_F08.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
THY01_0003_F07.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
LNG01_0101_A01.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
THY01_0054_D10.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
ITT01_0093_B12.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
SPL01_0022_F09.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
THY01_0107_A12.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
PBL01_0023_C01.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
MLN01_0005_B02.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
ILNT1_0038_B08.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
DCI01_0002_H07.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
THY01_0019_A06.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
THY01_0033_C01.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
LNG01_0010_B09.b : ACGATGGCAGAGGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
SPL01_0078_B11.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
ITT01_0012_F11.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
PBL01_0067_G06.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
PBL01_0028_E08.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
LNG01_0005_E11.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
CLNT1_0028_C02.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
LNG01_0018_A02.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
CLNT1_0046_B11.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
PBL01_0031_D08.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
THY01_0110_D10.b : ACGATGGCAGAAGAATGAAAACAAGATCGCAGAAT*TTAAAAAAAACAAAGAAACTCACC
PBL01_0068_B01.b : acacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC
20110601C-002416 : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
---------+---------+---------+---------+---------+---------+ 387
ITT01_0018_A02.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
LNG01_0017_D02.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0092_H08.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
UTR01_0074_B08.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
MLN01_0042_F04.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0058_H01.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0124_B11.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
PBL01_0037_E09.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
MLN01_0001_F08.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0003_F07.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
LNG01_0101_A01.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0054_D10.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
ITT01_0093_B12.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
SPL01_0022_F09.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0107_A12.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
PBL01_0023_C01.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
MLN01_0005_B02.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
ILNT1_0038_B08.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
DCI01_0002_H07.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0019_A06.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0033_C01.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
LNG01_0010_B09.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
SPL01_0078_B11.b : CTGTGAAAGACACGTACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
ITT01_0012_F11.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
PBL01_0067_G06.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
PBL01_0028_E08.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGG
LNG01_0005_E11.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
CLNT1_0028_C02.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
LNG01_0018_A02.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
CLNT1_0046_B11.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
PBL01_0031_D08.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
THY01_0110_D10.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
PBL01_0068_B01.b : CTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGATCTGAAGA
20110601C-002416 : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
---------+---------+---------+---------+---------+---------+ 447
ITT01_0018_A02.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
LNG01_0017_D02.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0092_H08.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
UTR01_0074_B08.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
MLN01_0042_F04.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0058_H01.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0124_B11.b : GAGATGATGAGGGTATCTACNAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
PBL01_0037_E09.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
MLN01_0001_F08.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0003_F07.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
LNG01_0101_A01.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0054_D10.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
ITT01_0093_B12.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
SPL01_0022_F09.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0107_A12.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
PBL01_0023_C01.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
MLN01_0005_B02.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
ILNT1_0038_B08.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
DCI01_0002_H07.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0019_A06.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0033_C01.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
LNG01_0010_B09.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
SPL01_0078_B11.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
ITT01_0012_F11.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
PBL01_0067_G06.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
PBL01_0028_E08.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
LNG01_0005_E11.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
CLNT1_0028_C02.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
LNG01_0018_A02.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
CLNT1_0046_B11.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
PBL01_0031_D08.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
THY01_0110_D10.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
PBL01_0068_B01.b : GAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGG
20110601C-002416 : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
---------+---------+---------+---------+---------+---------+ 507
ITT01_0018_A02.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
LNG01_0017_D02.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0092_H08.b : AGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
UTR01_0074_B08.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
MLN01_0042_F04.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0058_H01.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0124_B11.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
PBL01_0037_E09.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
MLN01_0001_F08.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0003_F07.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
LNG01_0101_A01.b : AGAGAAAATTTGATTTGCAGATTCTAGATGCGCTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0054_D10.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
ITT01_0093_B12.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
SPL01_0022_F09.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0107_A12.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
PBL01_0023_C01.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCATGGAGCT
MLN01_0005_B02.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
ILNT1_0038_B08.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
DCI01_0002_H07.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0019_A06.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0033_C01.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
LNG01_0010_B09.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
SPL01_0078_B11.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCATGGAGCT
ITT01_0012_F11.b : AGAGAAAATTTGATTTGCAGATTCTGGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
PBL01_0067_G06.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
PBL01_0028_E08.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
LNG01_0005_E11.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
CLNT1_0028_C02.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCATGGAGCT
LNG01_0018_A02.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
CLNT1_0046_B11.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCATGGAGCT
PBL01_0031_D08.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
THY01_0110_D10.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
PBL01_0068_B01.b : AGAGAAAATTTGATTTGCAGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCT
20110601C-002416 : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
---------+---------+---------+---------+---------+---------+ 567
ITT01_0018_A02.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
LNG01_0017_D02.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0092_H08.b : GTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
UTR01_0074_B08.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
MLN01_0042_F04.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0058_H01.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0124_B11.b : GTGCCCACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
PBL01_0037_E09.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
MLN01_0001_F08.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0003_F07.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
LNG01_0101_A01.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0054_D10.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
ITT01_0093_B12.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
SPL01_0022_F09.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0107_A12.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
PBL01_0023_C01.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
MLN01_0005_B02.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
ILNT1_0038_B08.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
DCI01_0002_H07.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0019_A06.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0033_C01.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
LNG01_0010_B09.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
SPL01_0078_B11.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTGAGTTAAAACTGT
ITT01_0012_F11.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
PBL01_0067_G06.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
PBL01_0028_E08.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGC
LNG01_0005_E11.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
CLNT1_0028_C02.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
LNG01_0018_A02.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
CLNT1_0046_B11.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
PBL01_0031_D08.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
THY01_0110_D10.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
PBL01_0068_B01.b : GTGCCAACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGT
20110601C-002416 : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
---------+---------+---------+---------+---------+---------+ 627
ITT01_0018_A02.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
LNG01_0017_D02.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0092_H08.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
UTR01_0074_B08.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
MLN01_0042_F04.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0058_H01.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0124_B11.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAAGTCCTCCTGTGGAAGTGGAACA
PBL01_0037_E09.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
MLN01_0001_F08.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0003_F07.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
LNG01_0101_A01.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0054_D10.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
ITT01_0093_B12.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
SPL01_0022_F09.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0107_A12.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
PBL01_0023_C01.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
MLN01_0005_B02.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
ILNT1_0038_B08.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
DCI01_0002_H07.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0019_A06.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0033_C01.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
LNG01_0010_B09.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
SPL01_0078_B11.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
ITT01_0012_F11.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
PBL01_0067_G06.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
PBL01_0028_E08.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
LNG01_0005_E11.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
CLNT1_0028_C02.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
LNG01_0018_A02.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
CLNT1_0046_B11.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
PBL01_0031_D08.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
THY01_0110_D10.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCCTCCTGTGGAAGTGGAACA
PBL01_0068_B01.b : ATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACA
20110601C-002416 : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
---------+---------+---------+---------+---------+---------+ 687
ITT01_0018_A02.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
LNG01_0017_D02.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
THY01_0092_H08.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCNGTGAGCAAATCAGCA
UTR01_0074_B08.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
MLN01_0042_F04.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
THY01_0058_H01.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
THY01_0124_B11.b : CCCAATGGAGCAattaattcaggtgtttgccc
PBL01_0037_E09.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
MLN01_0001_F08.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCANCA
THY01_0003_F07.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCG
LNG01_0101_A01.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
THY01_0054_D10.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
ITT01_0093_B12.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
SPL01_0022_F09.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
THY01_0107_A12.b : CCCAATGGAGCACATTATTCAgttgtgggccc
PBL01_0023_C01.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
MLN01_0005_B02.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
ILNT1_0038_B08.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
DCI01_0002_H07.b : CCAAATGGAGCACATTATTCGAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
THY01_0019_A06.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCCAATCAGCA
THY01_0033_C01.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
LNG01_0010_B09.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
SPL01_0078_B11.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
ITT01_0012_F11.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
PBL01_0067_G06.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
PBL01_0028_E08.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
LNG01_0005_E11.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGGGCAAATCAGCA
CLNT1_0028_C02.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
LNG01_0018_A02.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
CLNT1_0046_B11.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
PBL01_0031_D08.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
THY01_0110_D10.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCCGTAACAcgcccggaacccatcccctgg
PBL01_0068_B01.b : CCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCA
20110601C-002416 : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
---------+---------+---------+---------+---------+---------+ 747
ITT01_0018_A02.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
LNG01_0017_D02.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0092_H08.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
UTR01_0074_B08.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
MLN01_0042_F04.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0058_H01.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0124_B11.b :
PBL01_0037_E09.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
MLN01_0001_F08.b : TGGTGACCATCANTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0003_F07.b : TGGTGACCATCAGTTGTACGGNGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
LNG01_0101_A01.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0054_D10.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
ITT01_0093_B12.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
SPL01_0022_F09.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0107_A12.b :
PBL01_0023_C01.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCNGCATCTGCG
MLN01_0005_B02.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
ILNT1_0038_B08.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
DCI01_0002_H07.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0019_A06.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0033_C01.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
LNG01_0010_B09.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
SPL01_0078_B11.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
ITT01_0012_F11.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
PBL01_0067_G06.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
PBL01_0028_E08.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
LNG01_0005_E11.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
CLNT1_0028_C02.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
LNG01_0018_A02.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
CLNT1_0046_B11.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
PBL01_0031_D08.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
THY01_0110_D10.b : tgacccccgtgtgcgggggcagggggggattttttttcatcggcgcgcggg
PBL01_0068_B01.b : TGGTGACCATCAGTTGTACGGGGCAAGGTCTGGATATCTATCTCATCATCGGCATCTGCG
20110601C-002416 : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
---------+---------+---------+---------+---------+---------+ 807
ITT01_0018_A02.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
LNG01_0017_D02.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
THY01_0092_H08.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
UTR01_0074_B08.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
MLN01_0042_F04.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
THY01_0058_H01.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCTGCAAGAGGA
THY01_0124_B11.b :
PBL01_0037_E09.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
MLN01_0001_F08.b : GAGGATGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCATCTAGAGGA
THY01_0003_F07.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCCAGCAGAGGA
LNG01_0101_A01.b : GAAGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
THY01_0054_D10.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
ITT01_0093_B12.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
SPL01_0022_F09.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
THY01_0107_A12.b :
PBL01_0023_C01.b : GAAGAAGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
MLN01_0005_B02.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
ILNT1_0038_B08.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
DCI01_0002_H07.b : GAGGAGGCACCGTATTCCTCATNCTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
THY01_0019_A06.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACccagtaaagagga
THY01_0033_C01.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
LNG01_0010_B09.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
SPL01_0078_B11.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCGCTACTCATATTCTACACCAGCAAGAGGA
ITT01_0012_F11.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
PBL01_0067_G06.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
PBL01_0028_E08.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
LNG01_0005_E11.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
CLNT1_0028_C02.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
LNG01_0018_A02.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
CLNT1_0046_B11.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
PBL01_0031_D08.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
THY01_0110_D10.b :
PBL01_0068_B01.b : GAGGAGGCACCGTATTCCTCATCTTCATAGCACTACTCATATTCTACACCAGCAAGAGGA
20110601C-002416 : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
---------+---------+---------+---------+---------+---------+ 866
ITT01_0018_A02.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
LNG01_0017_D02.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
THY01_0092_H08.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
UTR01_0074_B08.b : AAAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
MLN01_0042_F04.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
THY01_0058_H01.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
THY01_0124_B11.b :
PBL01_0037_E09.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
MLN01_0001_F08.b : *AAAAGCAGAGCACCATGGAAAATGATAAGGAGCTGGAGATAAGAGCTAACACATCGAGC
THY01_0003_F07.b : *AAAAGCAGAGCAGCAGGAGAAATGATGACGAGCTGGAGATAAGAGCGAAGAGA*CGAGC
LNG01_0101_A01.b : *AAAAGCAGAGCAGCAAGAGAAATGATGAGGAGCTGGAGATA*GAGCGAAGAAAGCGAGC
THY01_0054_D10.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
ITT01_0093_B12.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
SPL01_0022_F09.b : *AAAAGCAGAGCAGCAGGAGAAATGACGAGGAGCTGGAGATAAGAGCGAAGAGA
THY01_0107_A12.b :
PBL01_0023_C01.b : *AAAAGCAGAGCAGCCGGAGAAATGATGAGGAGCTGGAAATAAGAGCGA*GAGAGCGAGC
MLN01_0005_B02.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
ILNT1_0038_B08.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
DCI01_0002_H07.b : *AAAAGCACAGCAGCAGGAGAAATGATGCAGAGCTGGGAGATAAAGCGAAGAGAGCGAGC
THY01_0019_A06.b : aaaagctagcacccggaaaaatgatgaagagctggagatatcaacgaaaaagaccagccc
THY01_0033_C01.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
LNG01_0010_B09.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
SPL01_0078_B11.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
ITT01_0012_F11.b : *AAAAGCAGAGCAGCGGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
PBL01_0067_G06.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
PBL01_0028_E08.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
LNG01_0005_E11.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
CLNT1_0028_C02.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
LNG01_0018_A02.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
CLNT1_0046_B11.b : *AAAAGCAGAGCAGCANGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
PBL01_0031_D08.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
THY01_0110_D10.b :
PBL01_0068_B01.b : *AAAAGCAGAGCAGCAGGAGAAATGATGAGGAGCTGGAGATAAGAGCGAAGAGAGCGAGC
20110601C-002416 : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
---------+---------+---------+---------+---------+---------+ 923
ITT01_0018_A02.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCGG
LNG01_0017_D02.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
THY01_0092_H08.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
UTR01_0074_B08.b : CCCGAGGAAAAGGGGGCCGGAAGCCCCATCCATTTTCCAGGCTCAACTCCTCAAAATCCG
MLN01_0042_F04.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
THY01_0058_H01.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
THY01_0124_B11.b :
PBL01_0037_E09.b : TCCGAGGAAA***GGGGCTCGAAGCCCATCCAT*TTCCA*GCTCA*CTCCTCAAAATCCG
MLN01_0001_F08.b : CCCCGAGGAA**GGGGCCAAATACCCCCTCAAT*TTTCAGGCTCAACTCCTCAAAAccag
THY01_0003_F07.b : CCCGAGGAAA**AGGGCCGGAAGCCCCATTCAT*TTCCAGGC*CAACTCCTCAAAtccng
LNG01_0101_A01.b : CCCGAGGAAA***GGGCCCGAAACCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
THY01_0054_D10.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCTTCAAAATCCG
ITT01_0093_B12.b : CCCGAGGAAA**GGGGGCGGAAGCCCCATCCAT*TTCCANNGCTCACTCCTCAAAATCCG
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : CCCCGAGAAA**GGGGCCGAAAGCCCCATCAAT**TTCAGGCTCTACTCCTCAAAACCCG
MLN01_0005_B02.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT**TTCAGGCTCA*CTCCTCAAAATC*G
ILNT1_0038_B08.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
DCI01_0002_H07.b : CCCCGAGAAA**GGGCCNGAAAGCCCCATCA***TTTCAGGCTCA*CTCCTCAAA*TCCG
THY01_0019_A06.b : ctcagcaatggggcccgaaagccccatcttttttaggcttcaactccctaaaatcgggtc
THY01_0033_C01.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
LNG01_0010_B09.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
SPL01_0078_B11.b : CCCGAGGAAA**GGTGCCGGAAGCCCCATCCAT*TTCCAGGCTCACCTCCTCAAAATCCG
ITT01_0012_F11.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCANNGCTCACTCCTCAAAATCCG
PBL01_0067_G06.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
PBL01_0028_E08.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCATTTCCANNGCTCACTCCCTCAAAAT*CG
LNG01_0005_E11.b : CCCGAGGAAA**AGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
CLNT1_0028_C02.b : CCCGAGGAAA**AGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCCTCAAATCCG
LNG01_0018_A02.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
CLNT1_0046_B11.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCANNGCTCACTCCTCAAAATC*G
PBL01_0031_D08.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAA*TCCG
THY01_0110_D10.b :
PBL01_0068_B01.b : CCCGAGGAAA**GGGGCCGGAAGCCCCATCCAT*TTCCAGGCTCAACTCCTCAAAATCCG
20110601C-002416 : GTCATTTCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
---------+---------+---------+---------+---------+---------+ 983
ITT01_0018_A02.b : GTCATTTCCCAAACTCCTCCAATG*CTGGTCATCGTTCTCAGGCAACTACTCCTCGTTCC
LNG01_0017_D02.b : GTCATTTCCCAAACTCCTTCAATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
THY01_0092_H08.b : GTCATTTCCCAAACTCCTCCNATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
UTR01_0074_B08.b : GTCATTTCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAAGCACCTACTCCctcgttc
MLN01_0042_F04.b : GTCATTTTCCAAACTCCTCCCATGCCTGGTCATCGTTTCTCAGGCACTACTCCTCGTCCC
THY01_0058_H01.b : GTCATTCCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
THY01_0124_B11.b :
PBL01_0037_E09.b : *TCATTTCCCAACTCctcnnatgctgtcatcgttctcagcactactctcgtccgggncct
MLN01_0001_F08.b : tcatttccaaaatcctccaatgaattgttaccctcccaggatcttattcttcatccggga
THY01_0003_F07.b : tcattccccaactcctccaatgctggn
LNG01_0101_A01.b : *TCATTTCCCAACTCCTCCatgcctggtcatctttctaggcacctactctcgtcccggcc
THY01_0054_D10.b : GTCATTTCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
ITT01_0093_B12.b : GTCATTTCCCAAACTCCCTCCATG*CTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : GTCATTTCCaaactcctcaacgcctggtcatgttctcaggaactactcttcgtccgggcc
MLN01_0005_B02.b : GTCATTTCCCAA*CTCCTCCatgcctgtcatcttctcagcactactcctcgtccggggct
ILNT1_0038_B08.b : GTCATTTCCCAAACTCCTC*AATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCG
DCI01_0002_H07.b : GTCATTTCCCAACTCCTCgatgcctggtctcggtctccagcactactcctcgcccgggcc
THY01_0019_A06.b : cattcccta
THY01_0033_C01.b : GTCATTTCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAGGCACCTACTCCCTCGTCC
LNG01_0010_B09.b : GTCATTTCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAGGCACTTACTCCTCGTCCC
SPL01_0078_B11.b : GTCATTTCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
ITT01_0012_F11.b : GTCATTTTNCCAACTCCCTCNATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
PBL01_0067_G06.b : GTCATTTCCCCAACTCCTCCNATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
PBL01_0028_E08.b : GTCATTTCCCAAACTCCCTCCATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
LNG01_0005_E11.b : GTCATTTCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCCTCCC
CLNT1_0028_C02.b : GTCATTTCC*AAACTCCTCC*ATGCCTGGTCATCGTTCTCAAGCACCTACTCTTCGTCCC
LNG01_0018_A02.b : GTCATTTCCCAAACTCCTCC*ATGCCTGGTCATCGTTCTCAAGCACTTACTCCTCGTCCC
CLNT1_0046_B11.b : GTCATTTTCC*AACTCCTCAAATG*CTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
PBL01_0031_D08.b : GTCATTTCCCAA*CTCCTCCNATG*CTGNTCATCGNTCTCAGGCA*CTACTCCTCGTCCC
THY01_0110_D10.b :
PBL01_0068_B01.b : GTCATTTCCCAAACTCCTCCAATGCCTGGTCATCGTTCTCAGGCACCTACTCCTCGTCCC
20110601C-002416 : GGG*CCTCCTGGCCCCCGTGTCCAGCACCC*ACAGAAGAAGAGGCCTCCTCCTACCCCGG
---------+---------+---------+---------+---------+---------+ 1041
ITT01_0018_A02.b : GGG*CCTCTTGCCCCCCGTGTCagccaccaaagaagaagaagccntctccctaccccggg
LNG01_0017_D02.b : GGG*GCTCCTGGCCCCCCGTGTCcagcacccccagaagaaaaaggccctcctcctacccc
THY01_0092_H08.b : GGG*CCTCCTGGCCCCCGTGTCCAGCACCC*ACAGAAGAAGAGGCCTtcctcctaccccc
UTR01_0074_B08.b : ccgggcctcctggccccccgtgtccagcacccacagaaaaaaaaagccctccttcctacc
MLN01_0042_F04.b : GGG*CCTCCTGGCCCCCGTGTCCAGCACCC*ACAaagaagaaggttcctcnaccccgggc
THY01_0058_H01.b : GGG*CCTCCCTGCCCCCGTGTCCAGTACCCCACAAAAAAAGAGGCCTCCTCCTACCCCGG
THY01_0124_B11.b :
PBL01_0037_E09.b : ctgnncccctgtcagcaccacagagaagaagctcctctacccgggcacccagttcacagc
MLN01_0001_F08.b : ctcttggcccccgttcctctccctaaaaaaaaaggctccctctactctggatattaattt
THY01_0003_F07.b :
LNG01_0101_A01.b : tcctggccccgtgtccagaccaaaaaaaagaagcctcctcctacccgggcaaaaaattta
THY01_0054_D10.b : GGGGCCTCCTGGCCCCCCGTGTCAGCACCC*ACAAAAGAAGAGGCCTCCTCCTACCCCGG
ITT01_0093_B12.b : GGG*CCTCCTG*CCCCCGTGTCCAGCACCC**ACAGAAGAGAGGCCTCCT*CTACCCCGG
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : tcctgcccccgtggtcagcaccaaaaaaaagaggcttcttctaccccgggcaccaagttc
MLN01_0005_B02.b : tctggccccgtgtcagcacccacaaagagaagctcctcctaccccggcaacaagttacca
ILNT1_0038_B08.b : GGG*GCTCCTGGCCCC*GTGTCCAGCACCCACAGAAGAgaaggctcctcctacccgggca
DCI01_0002_H07.b : tcctggccccgtgtcagcaccaaagagaagaggctcctccaccccgggcaccaagtcaca
THY01_0019_A06.b :
THY01_0033_C01.b : cgggcctccttggcccccgtgtccaacacccacaagaaaaggaaggcctcttcctacccc
LNG01_0010_B09.b : GGGCCTCCTGGCCCCCCGTGTtcagcacccaccaaaggaaaaggcctcctcctacccccg
SPL01_0078_B11.b : CGGGCCTCCTGGCCCC*GTGTCCAGCACCCACAGAAaaaaaaggcctccctcctaccccg
ITT01_0012_F11.b : GGG*CCTCCTGGCCCCCGTGTCCAGCACCC*ACAGAAGAAGAAGCCTCCTNCCTACCCGG
PBL01_0067_G06.b : GGGCCCTC*TGGNCCCCGTGTCCAGCACCT*ACAGAAGAAGAAGCCTCCCTCTACCCCGG
PBL01_0028_E08.b : GGGCCCCTCTGGCCCC*GTGTCCAGCACCC*ACAGAAGAAGAAGCCCCTCTCTA*CCCGG
LNG01_0005_E11.b : GGG*CCTCCTGGCCCCCGTGTCCAGCACCCACAGAAaaaagaggcctccttcctaccccg
CLNT1_0028_C02.b : GGG*CCTCCTGGCCCCCGTGTCCAGCACCC**CAGAAGAAGAAGCCTCCTCCTACCCGGG
LNG01_0018_A02.b : GGG*CCTCTTGGCCCCCGTGTCCAGCACCC*ACAAAAAAAAAAGCCTCCTTCTACCCCcg
CLNT1_0046_B11.b : GGG*CCTCCTGGCCCCCGTGTCCAGCACCC*ACAGAAGAAGAAGCCTCCTCCTACCCCGG
PBL01_0031_D08.b : GGG*CCTC*TGGCCCCCGTGTCCAGCACCacagaagaagaagcctcctctaccccgggca
THY01_0110_D10.b :
PBL01_0068_B01.b : GGG*CCTCCTGGCCCCCGTGTCCAGCACCC*ACAGAAGAAGAGGCCTCCTCCTACCCCGG
20110601C-002416 : GCACACAAGTTCACCAGCAAAAAGGCCCTCCCCTCCCCAAGCCTCGAGTTCAAACAAAAC
---------+---------+---------+---------+---------+---------+ 1101
ITT01_0018_A02.b : cacccagttcaccagcaaaaaggccttcccctccccagcctcggagtcaaacaaacccta
LNG01_0017_D02.b : cgggcacacaagttcccccagcaaaaagggcccctcccccttccccagcccctcgagttt
THY01_0092_H08.b : ggccaccccagatccacccacaaaaaaggcccctccc
UTR01_0074_B08.b : ccggggcaccacaagttcaccaagccaaaaagggccctcccccttccccaagccctccaa
MLN01_0042_F04.b : aaacaattcaccaacaaaaaggcctcccctccccagcctcgagttcaaacaacctaccca
THY01_0058_H01.b : GGACACAAGT*TCcacaagcaaaaagggccttcccctccccaagccctcaagtttaaaca
THY01_0124_B11.b :
PBL01_0037_E09.b : aaaaggcctccctccccagctcgagttcaacaacctacccatgagcaaggaactccaact
MLN01_0001_F08.b : cacggaaaaaggcctcccttttttattttatgtaaaaaaacttaccaaaatgcaagaaag
THY01_0003_F07.b :
LNG01_0101_A01.b : ccaccaaaaggcctcccctcccaaccctcagttcaaacaacctaccctgaggcaaaaaac
THY01_0054_D10.b : Ggcacacaaattcccccagcaaaaagggccttcccctccccaaaccctcgaggttcaaac
ITT01_0093_B12.b : GCACACAGTT*CACCAGCAAAAAGGCCCTCCCtccccagcctcgagttcaaacaaaacta
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : ccagcaaaaggcctttccttcccaagctcaagttaaacaaacctcccctgaggccagaaa
MLN01_0005_B02.b : caaaaagcctccctccccagcctgagttaaaaaaacctacctgagccaagaaacccaaac
ILNT1_0038_B08.b : cacaagtcacagcaaaaggccctccctcccaagctcgagtccaaacaaactaccctgagc
DCI01_0002_H07.b : ggaaaggccctcccccccagcctcagttaacaaacctacctgaggccaagaaaacctacc
THY01_0019_A06.b :
THY01_0033_C01.b : cggggcacacaaagttcacccaccaaaaaagggcctcccccttccccaagccttcgaagt
LNG01_0010_B09.b : ggcacacaaatttcaccagcaaaaaagcccctccccctccccaagccctcgagtttaaaa
SPL01_0078_B11.b : ggcacacaagtttcccagccaaaaagccccttcccctccccagccctcggtttcaaacaa
ITT01_0012_F11.b : GCACACAAGT*CACCAGCAAAAAGCCCTCCCCCTCCCCAggctcgagttcaancaaaccc
PBL01_0067_G06.b : GCACACAgtttcacagcaaaaagccctctcctccccagcctcgagttcaaacaaaaccta
PBL01_0028_E08.b : GCACACAAGTcaccagcaaaaagccctcccctccnnagctcgagttcaaacaaactacca
LNG01_0005_E11.b : gggcacacaaatttcccccagcaaaaaaggcccctccccctcccccaagccctccaagtt
CLNT1_0028_C02.b : GCACACAgttcaccaagcaaaagcccttcccttcccaggctccagttcaacaaaactacc
LNG01_0018_A02.b : ggcaccaaatttccccaacaaaaaaggcccccccctcccaaacccccaatttcaacaaaa
CLNT1_0046_B11.b : GCAACCAAGTTCACCAGCAAAAAGcctccccctcccnagcctcgagttcaacaaacctac
PBL01_0031_D08.b : cacagttcaccagcaaaaggccctcccctcccnnagctcgagttcaacaaaactacccat
THY01_0110_D10.b :
PBL01_0068_B01.b : GCACACAAGTTCACCAGCAAAAAGGCCCTCCCCTCCCCAAGCCTCGAGTTCAAACAAAAC
20110601C-002416 : CTACCCATGAGGGCAAAGAAAACTCATAACTCTGTCTCCTGATGCGGGTGTCCCTTCCCC
---------+---------+---------+---------+---------+---------+ 1161
ITT01_0018_A02.b : ccttgaggccaagaaactcataactcgtctccgaagcggttggccctcccctcaattaaa
LNG01_0017_D02.b : taaaacaaaaacctaacccctggaaaggcccaaaaaaaaaactttaataaactttttttc
THY01_0092_H08.b :
UTR01_0074_B08.b : gttccaaaacaaaaaccctacccattgaagggccaaaaaaaaaaaacttcaataacttcc
MLN01_0042_F04.b : tgagggccaaaaaacccaaactctgtcccctgaagcggtgcccctcccccatttaaaaaa
THY01_0058_H01.b : aaacccaacccatgaaggccaaagaaaaactcaaaaactcctttccc
THY01_0124_B11.b :
PBL01_0037_E09.b : cgtctctgagcgntgtccttccctctataagagacagaacgtcttcctgtaaagcactgg
MLN01_0001_F08.b : ttcttaattctgtgggtaaggatggtactcaggtaattaaaaaaaaaaaactctcttttt
THY01_0003_F07.b :
LNG01_0101_A01.b : tctaactcgttcccggagcgttgccctcccccaattaaaaaaacaaaatgtctttctgaa
THY01_0054_D10.b : aaaacctacccatgaggccaaagaaaaaactataacctttgtcttcctgattgcggtttt
ITT01_0093_B12.b : cccatgagccaagaaactctaactctgcctccgatgcggtgtccctccctcctattaaga
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : ttcaacccgtccccggaagggtgtccctccccaataaaaaaaaaaaatgcctttccgtaa
MLN01_0005_B02.b : tcgccccgagcgttgtccttccccaataaaaaaaaaacgcctttctgtaaggactgtgat
ILNT1_0038_B08.b : caaagaaactcatctctgtctctgaagcggtgtcctccctcaataaaaaaacaaaactgt
DCI01_0002_H07.b : ctgtcccggaggggtgcccctccctcaataagaaaacaaactgtccttccgaaagagatg
THY01_0019_A06.b :
THY01_0033_C01.b : tccaacaaaaaacctaccccatggaggcccaaagaaaaaattcaaaaactcctggtcttc
LNG01_0010_B09.b : acaaaaccttaccccattaaaggccaaaaaaaaaattcctaaaactcttttcttccttga
SPL01_0078_B11.b : aacctacccatggaaggccaaagaaaattcaaaaatccgttcccc
ITT01_0012_F11.b : taccatgaggccaaagaaaactcatactctgtctcctgaatgcggtgtcctttccctcta
PBL01_0067_G06.b : cctatgagccaagaaaactcatactctgtctcctgagcgntgtccctccntccantaaag
PBL01_0028_E08.b : ntgagccaagaaactcatactcgtctctgaagcgttgtccttccnntctataaagagacg
LNG01_0005_E11.b : tcaaaaaaaaaacctaaccccttgaaagcccaaaaaaaaaaacttccaaaaacctttttt
CLNT1_0028_C02.b : catgaggccaaggaaactcaaactctgtctccgaagggttgtccctccccctaataaaga
LNG01_0018_A02.b : cccaaccctgaaggcaaaaaaaaacccataattctttctcctaaatgcgtttttcccttc
CLNT1_0046_B11.b : cccatgaggcaaagaaactcataactctgtctcctgaagcggttgtccctcccctctatt
PBL01_0031_D08.b : gagccaagaaactcatactctgtctctgagcgntgtccctcctctnnataagagaacgaa
THY01_0110_D10.b :
PBL01_0068_B01.b : CTACCCATGAGGGCAAAGAAAACTCATAACTCTGTCTCCTGATGCGGGTGTCCCTTCCCC
20110601C-002416 : TCTANTAAAAGAGAACAGAAACTGTCCTTTCCCTGTAAANGCACTGTGGAGTTTCTCCAC
---------+---------+---------+---------+---------+---------+ 1221
ITT01_0018_A02.b : aaaaacgaaactgtcccttcctgtaaagggcgtgggagattctcacctcggggggcggtt
LNG01_0017_D02.b : ttcctcggaatggccgggttttgttccccctttttcccccctcttttaatttttaaaaaa
THY01_0092_H08.b :
UTR01_0074_B08.b : tgtctccccccgaaaaggcgggtttggtcccccctttccctctccttaaatttttaaaaa
MLN01_0042_F04.b : acaaaattgccttcctgaaaagcacgtgggatttccattcaggcggctgcaagcggttca
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b : gattcccctcaggcgnatgtanccctcataactgtctcagggacggaagccaatcagagc
MLN01_0001_F08.b : tttaacattttgttnttttttttgtggaacaagaaaatttcacaaccagcccctaggtcn
THY01_0003_F07.b :
LNG01_0101_A01.b : aaggctgtgaatttccactcaggccctgtaaccctcctaaactttcttaggaaacggaac
THY01_0054_D10.b : tccctttccctccaaatttaaaaaaaaaaaaaaaaaa
ITT01_0093_B12.b : aaacaaaactgtcctttctgttaagggactgggaatttctccattcagggggcagtgtaa
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : agccgtggaatttcccttcaggccaggtaacctttctaaatggtcttagggaacggaacc
MLN01_0005_B02.b : ttccctcaggcgatgaaccctcctaaggtgttgggggacggaaccccaccaaccaacctt
ILNT1_0038_B08.b : ctttctgtaaaaggatgggaattttccatccaggggcagctaacgttcctcaacgggttt
DCI01_0002_H07.b : gggaatctcccccggggcgcgccccccttctccagggggtggagggggagggacgcccaa
THY01_0019_A06.b :
THY01_0033_C01.b : cctggattggcgggtttggtccccctttccccctctttaattaaaaaaaaaaaaaaaaaa
LNG01_0010_B09.b : atgccgggtttgttcccccttttccccctcttaaatttaaaaaaaaaaaaaaaa
SPL01_0078_B11.b :
ITT01_0012_F11.b : atnaaaagagacggnaactgtcttttcctgtaaaggacctgtggagtttctccatccaag
PBL01_0067_G06.b : agacagaactgtcttcctgtaaagccctgtgagttctccctcagncggcagctagcgctc
PBL01_0028_E08.b : aactgtcaaaaaaaaaaaagcccatgtgtcnactgagtccggcgtcaaagatcttcaggc
LNG01_0005_E11.b : tcccccctgaaatggccgggttgtc
CLNT1_0028_C02.b : agaaaaaactggccttccggaaaggcactgggaatttctcatccgggggcatgttaccgt
LNG01_0018_A02.b : ccctccaattaaaaaaaaaaaaaaaactgtccctttccttaaaaaaacacctgtgggaat
CLNT1_0046_B11.b : aaaagaaaacaaaactgtctttccgtaaaaggacttgggattttctcacttcaaggggca
PBL01_0031_D08.b : ctgtctttctgtaagncctgtgagttctcatcagnccgatgcaccctcatcactgcctca
THY01_0110_D10.b :
PBL01_0068_B01.b : TCTANTAAAAGAGAACAGAAACTGTCCTTTCCCTGTAAANGCACTGTGGAGTTTCTCCAC
20110601C-002416 : TCAGGCGCGCATGCTAGCCGCTTCATCAAGCGTGCTCTGCAGGNNGACCGGGACAGCGCC
---------+---------+---------+---------+---------+---------+ 1281
ITT01_0018_A02.b : accccttcctaagggtgctctcagggaacgggaaccccccaacccagaacccacccggtt
LNG01_0017_D02.b : aaaaaaaaaaaaaaacaaaaaaaaaaaaac
THY01_0092_H08.b :
UTR01_0074_B08.b : aaaaaaaaaaaaacaaaaaaaaactcgggtctccccctcttttttcccttggtgttaaaa
MLN01_0042_F04.b : taaggggctctcaggggaccgggacccccaacccaaaccacacctgtgtgacttaatcac
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b : aaccgttgacattataaccagcgaatggatctgccccccctcgaggaactcaaaagatag
MLN01_0001_F08.b : nttacctacttccaaatttacccttaatatataaattatcattctctcat
THY01_0003_F07.b :
LNG01_0101_A01.b : cccaaccaagacaaacctttttacattaatacccagacgaaatggattttggccccccct
THY01_0054_D10.b :
ITT01_0093_B12.b : gccctccatcaagcgtgcttcaaggggaccgggaaacgcccaacccaaaaacaaatcctt
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : ccacccagacccacccgttttaattaaatacccaagcgaattgatttggcccccctctcg
MLN01_0005_B02.b : tgaataaatcccaggtaattagtggctcccccggggaacccaaagttgagggcccaacga
ILNT1_0038_B08.b : cagggaaggaaaagcccaaccagaacaaaccgttgtactttaatacccaaggcgaattgg
DCI01_0002_H07.b : ccagaccgtccttttttatctcacacccaggggatttgggtcctccctcccctgtgggga
THY01_0019_A06.b :
THY01_0033_C01.b : aaaaaaacttgtttcccttttttcccgtgtgaaaaaaaaaaaggggaagaacatttgtgg
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b : ggcgcatgctaccgcttcaatcaacgggctttgcagggggaccgggaaaaccccaaaccc
PBL01_0067_G06.b : catagctgccttcagggaccgaagccccaaccagaccaacctgttgacattactcaccca
PBL01_0028_E08.b : ccaaactacgtaccccttctgtaaaggtccaatggatcaataaacagaccgccccttaac
LNG01_0005_E11.b :
CLNT1_0028_C02.b : tccttaaagggccgggagggacggaaagcccaaccagaacacacctgttgtacataatta
LNG01_0018_A02.b : tttttccccccccccggccccccaaagctaaaccccctttttccactaaaacctgtttct
CLNT1_0046_B11.b : atgtaacccttcattaaatgttctgaaagggaaccggaaacccccaacccaagaccaaac
PBL01_0031_D08.b : aggacggaaggccaccaagacaccctgtgtcattaataccgagctaattgatctgcctct
THY01_0110_D10.b :
PBL01_0068_B01.b : TCAGGCGCGCATGCTAGCCGCTTCATCAAGCGTGCTCTGCAGGNNGACCGGGACAGCGCC
20110601C-002416 : CCAGCCTAGNAGCCACGCCCTGTCTGTACCATCTA.........................
---------+---------+---------+---------+---------+---------+ 1316
ITT01_0018_A02.b : gttttttatattcccgagaggttaattgtacttgg
LNG01_0017_D02.b :
THY01_0092_H08.b :
UTR01_0074_B08.b : aagaaaaa
MLN01_0042_F04.b : ccaaggcgtgaatggacttggcccccccgcgggagggaaacctcaaaacgataagaaggt
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b : ataggcaacaatcgattcccttcctgggcaaaaaagggggtttccacccggaattttcct
MLN01_0001_F08.b :
THY01_0003_F07.b :
LNG01_0101_A01.b : cggaagaaaaccccaatcgttaaatgggaaaacaaaccggaatcccccctcaccggggga
THY01_0054_D10.b :
ITT01_0093_B12.b : ttgtacactaatatccccagggcgaaatgggaatttggcccccccccacc
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : aggaaacccaaatcgttgaggggtcgccaatcggattccctttcccctggccaaaaaagg
MLN01_0005_B02.b : tcccctccgcgaaaaaggggtgtaccgatttcctaatagaacatacagnnnnnnnnnnnn
ILNT1_0038_B08.b : aatcgccccccccccgggagagaaaccccaaaaaagttaataggggcacaaaaatcgaaa
DCI01_0002_H07.b : acccnatagggtgggggggggggaaatttttttcccctctccacaaaaaaaaaaaggggc
THY01_0019_A06.b :
THY01_0033_C01.b : gtggggaagaaaggtttttt
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b : gaacccacacctgttggtacattaaatcacccaaggcggaattgggattttgggccctcc
PBL01_0067_G06.b : ggcgaattggattctgccctcccctcggaggaaaccccaaacgattgtaggggccacaaa
PBL01_0028_E08.b : ctggtggaacccactggattgtagaacttttttggtacattcaaccccaattaccggaaa
LNG01_0005_E11.b :
CLNT1_0028_C02.b : cccgagcggaattggatttggcctccccctgcggaggaacaccacaatcgtttgaatggt
LNG01_0018_A02.b : tttccgggggggaaaccggggaaaaaacaccccccccacaaccccccaaaaaaaaaaccc
CLNT1_0046_B11.b : ctttttgtactttattaacccaaaccgtaattggaatttgggcccccccctggggaggaa
PBL01_0031_D08.b : ccctgcgagaacctcaaatcgatgaatgggcacaaacgaatccctttccccgggctaaaa
THY01_0110_D10.b :
PBL01_0068_B01.b : CCAGCCTAGNAGCCACGCCCTGTCTGTACCATCTActcagccccgagcctgacatctgna
20110601C-002416 : ............................................................
---------+---------+---------+---------+---------+---------+ 1316
ITT01_0018_A02.b :
LNG01_0017_D02.b :
THY01_0092_H08.b :
UTR01_0074_B08.b :
MLN01_0042_F04.b : gcaccaacatcggatt
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b : tgaaaaagtcaaaaaaaacccgcccctccgccccttttnnnnnnnccnngngggggggcc
MLN01_0001_F08.b :
THY01_0003_F07.b :
LNG01_0101_A01.b : aaaaaagaggggggtttttaaaccccagaatttttccttgggaaaaaaaagtcccctttt
THY01_0054_D10.b :
ITT01_0093_B12.b :
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : gggggttgtgaccccggaatttttcctttggaaaaaaatgcccttttggaaccccccaaa
MLN01_0005_B02.b : nnnaagnttctacgccccgcccgccgacgccaacagacacacgagggggnnnnnnnnnnn
ILNT1_0038_B08.b : tcccccttccccgggggaaaaaaatgggggggggttttttaacaccggaaaatttttttc
DCI01_0002_H07.b : gtctcctccactccactg
THY01_0019_A06.b :
THY01_0033_C01.b :
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b : cccatgcgaaaga
PBL01_0067_G06.b : cgaaattctccttccccggggcaaaaagaagggggtttttaacacccggaaatttttccc
PBL01_0028_E08.b : aattagtaggttaccccccgcgaattccgaataataccgccatatttttaaacgctgccc
LNG01_0005_E11.b :
CLNT1_0028_C02.b : gccaacactcgaattcccctttcaccggggaaaaataaggagggggtgtttcacacgcgg
LNG01_0018_A02.b : aaacca
CLNT1_0046_B11.b : acccctaaatcggtttagagtggggcaacaaaactggatttttcccttt
PBL01_0031_D08.b : gagggcgttttaaccccgaatgtttcctggaaaaaagtcccctttgaacccccacagggg
THY01_0110_D10.b :
PBL01_0068_B01.b : tctctggcctctccacactgcaggagggaaaacccgtcaagatacggattagatgatggt
20110601C-002416 : ............................................................
---------+---------+---------+---------+---------+---------+ 1316
ITT01_0018_A02.b :
LNG01_0017_D02.b :
THY01_0092_H08.b :
UTR01_0074_B08.b :
MLN01_0042_F04.b :
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b : catagtttgttatttcct
MLN01_0001_F08.b :
THY01_0003_F07.b :
LNG01_0101_A01.b : tgtaaaccccccaaaagggggaaaaaatttctgcccaccaacccccccattattattaaa
THY01_0054_D10.b :
ITT01_0093_B12.b :
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b : gggggaaacttcctctccc
MLN01_0005_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0038_B08.b : tatggaaaaaaa
DCI01_0002_H07.b :
THY01_0019_A06.b :
THY01_0033_C01.b :
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b :
PBL01_0067_G06.b : cggaaagaagggccaaaaaaaacctccgggcgcccccgcgccccctcttgaaaaaaaacc
PBL01_0028_E08.b : cctttaccctggtttccccccaaaagttgtgaaaaaatatttgtttacgtcacgcctttn
LNG01_0005_E11.b :
CLNT1_0028_C02.b : aaaatgtttctcttggaaagaaaagctcaaaaaaacgtgtgtgggcgcaataaacccc
LNG01_0018_A02.b :
CLNT1_0046_B11.b :
PBL01_0031_D08.b : ggaaaggggggcnaannnnnnnnnnngttaaccttttttaggtcaacattnnnnnnnnnn
THY01_0110_D10.b :
PBL01_0068_B01.b : gacgagcccaaatctgnaaattctccccctcgtctcacctgtgcggcctcaaatccaggt
20110601C-002416 : ............................................................
---------+---------+---------+---------+---------+---------+ 1316
ITT01_0018_A02.b :
LNG01_0017_D02.b :
THY01_0092_H08.b :
UTR01_0074_B08.b :
MLN01_0042_F04.b :
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b :
MLN01_0001_F08.b :
THY01_0003_F07.b :
LNG01_0101_A01.b : aatttgttaaatataataa
THY01_0054_D10.b :
ITT01_0093_B12.b :
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b :
MLN01_0005_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0038_B08.b :
DCI01_0002_H07.b :
THY01_0019_A06.b :
THY01_0033_C01.b :
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b :
PBL01_0067_G06.b : tcagaagagattaatttaat
PBL01_0028_E08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0005_E11.b :
CLNT1_0028_C02.b :
LNG01_0018_A02.b :
CLNT1_0046_B11.b :
PBL01_0031_D08.b : nnnnnna
THY01_0110_D10.b :
PBL01_0068_B01.b : gagggtgggcgtgcctgttgcaccaactcctgctgaaatgcttgctttgcctccttggga
20110601C-002416 : ............................................................
---------+---------+---------+---------+---------+---------+ 1316
ITT01_0018_A02.b :
LNG01_0017_D02.b :
THY01_0092_H08.b :
UTR01_0074_B08.b :
MLN01_0042_F04.b :
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b :
MLN01_0001_F08.b :
THY01_0003_F07.b :
LNG01_0101_A01.b :
THY01_0054_D10.b :
ITT01_0093_B12.b :
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b :
MLN01_0005_B02.b :
ILNT1_0038_B08.b :
DCI01_0002_H07.b :
THY01_0019_A06.b :
THY01_0033_C01.b :
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b :
PBL01_0067_G06.b :
PBL01_0028_E08.b : n
LNG01_0005_E11.b :
CLNT1_0028_C02.b :
LNG01_0018_A02.b :
CLNT1_0046_B11.b :
PBL01_0031_D08.b :
THY01_0110_D10.b :
PBL01_0068_B01.b : ttaaaggaataagctgcctgcaaaaaaaaaagccctgttcgactcgggcggcccctaatc
20110601C-002416 : ............................................................
---------+---------+---------+---------+---------+---------+ 1316
ITT01_0018_A02.b :
LNG01_0017_D02.b :
THY01_0092_H08.b :
UTR01_0074_B08.b :
MLN01_0042_F04.b :
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b :
MLN01_0001_F08.b :
THY01_0003_F07.b :
LNG01_0101_A01.b :
THY01_0054_D10.b :
ITT01_0093_B12.b :
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b :
MLN01_0005_B02.b :
ILNT1_0038_B08.b :
DCI01_0002_H07.b :
THY01_0019_A06.b :
THY01_0033_C01.b :
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b :
PBL01_0067_G06.b :
PBL01_0028_E08.b :
LNG01_0005_E11.b :
CLNT1_0028_C02.b :
LNG01_0018_A02.b :
CLNT1_0046_B11.b :
PBL01_0031_D08.b :
THY01_0110_D10.b :
PBL01_0068_B01.b : cccagggccactcccccctttttaaaggcccaaggtattaaagcggcccctttacccgga
20110601C-002416 : ............................................................
---------+---------+---------+---------+---------+---------+ 1316
ITT01_0018_A02.b :
LNG01_0017_D02.b :
THY01_0092_H08.b :
UTR01_0074_B08.b :
MLN01_0042_F04.b :
THY01_0058_H01.b :
THY01_0124_B11.b :
PBL01_0037_E09.b :
MLN01_0001_F08.b :
THY01_0003_F07.b :
LNG01_0101_A01.b :
THY01_0054_D10.b :
ITT01_0093_B12.b :
SPL01_0022_F09.b :
THY01_0107_A12.b :
PBL01_0023_C01.b :
MLN01_0005_B02.b :
ILNT1_0038_B08.b :
DCI01_0002_H07.b :
THY01_0019_A06.b :
THY01_0033_C01.b :
LNG01_0010_B09.b :
SPL01_0078_B11.b :
ITT01_0012_F11.b :
PBL01_0067_G06.b :
PBL01_0028_E08.b :
LNG01_0005_E11.b :
CLNT1_0028_C02.b :
LNG01_0018_A02.b :
CLNT1_0046_B11.b :
PBL01_0031_D08.b :
THY01_0110_D10.b :
PBL01_0068_B01.b : aaaaccggttttagactctgtggaaaaaccccaaacgcgaaatttgggcccccccgctct