[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002551

Length: 1,859

Sequence [FASTA format sequence]
GGTACGGTCG GAATTCCGAG CACTGTTGGC TACTGGAGCT CCTCTTAGCT CCGCTCCTGC
TGGTGTCCTC CACTCGCGCT TTCCCGCTCT CGTCGGGGCC TCCCGTGCTT CTGCCGCCTG
TGCCGCCCCG CGCCGCTTGT AGCCCCGCGC GCAACCATGC CCAACATCGT GCTCTTCAGC
GGCAGCTCGC ACCAGGACCT GTCCCAGCGC GTGGCCGACC GGCTCGGCCT GGAGCTGGGC
AAGGTGGTCA CCAAGAAGTT CAGCAACCAG GAGACCAGCG TGGAGATTGG CGAAAGCGTG
AGGGGGGAGG ATGTGTACAT CATCCAGAGT GGCTGCGGCG AAATCAACGA CAACCTGATG
GAGCTGCTCA TCATGATCAA CGCCTGCAAG ATCGCCTCCT CCTCCAGGGT GACCGCCGTG
ATCCCATGCT TCCCCTACGC CCGGCAAGAC AAAAAGGACA AGAGTCGTGC TCCGATTTCA
GCAAAACTTG TGGCCAATAT GCTGTCGGTG GCTGGGGCAG ATCACATCAT CACCATGGAC
CTGCATGCCT CTCAGATCCA GGGCTTCTTT GATATCCCCG TGGACAACTT GTACGCGGAG
CCCGCGGTCC TGCAGTGGAT TCGGGAGAAC ATCGCCGAGT GGAGGAACTG CATCATCGTT
TCCCCTGATG CCGGCGGCGC CAAAAGGGTC ACGTCAATTG CAGACAGGTT GAATGTGGAG
TTTGCCTTGA TTCACAAGGA GAGGAAGAAG GCGAATGAAG TGGACCGGAT GGTCCTGGTG
GGCGACGTGA AGGACCGAGT GGCCATCCTT GTGGATGACA TGGCTGACAC GTGTGGCACC
ATCTGCCATG CTGCAGACAA GCTACTCTCT GCCGGAGCCA CCAAAGTATA TGCTATCCTT
ACCCATGGGA TCTTCTCTGG GCCAGCTATT TCCAGAATAA ATAATGCCGC CTTTGAGGCT
GTTGTTGTCA CCAACACCAT TCCACAAGAG GACAAAATGA AGCACTGCTC CAAGATTCAG
GTTATCGACA TTTCGATGAT CTTGGCCGAG GCCATCCGCA GGACCCACAA CGGCGAATCT
GTGTCTTACC TGTTCAGCCA CGTCCCGCTC TAAGGCCAGG ATGGGAGGTG TGGAGCAAGC
CTGAGCTGGC TTCTGACTCG CGTGCATTTG TCTGATGTTT TCTTTAGCTT TAGAACTGAG
TAGTTATATT AATGCAGAAG CATCAGAACT TTGTGTGCTC CCCAGCCCAG TGTTTCTCCT
TCTAAAGCTC TTGACCGTTG ATTTCCAGTT TGCTGGGGAG GGCGGTGGTT TATTTGATCT
TTAAGTGCAC AGCCTTCAAT GAGAAGTATT TTTGTCGTCT TGACCTGTTC TGATAGGTGA
CCTTTTCCTT TGTTCTGGCA GTACTTGGAG GCCACAACTT AAGTGCATGT TGCCATTCTG
GAAGTTCATA GTTTATGTGT TTCGGGGTTG CCAAAGGTCA CGTCAGATTA AAGCCTCTGT
GTAAATATAA AATGACAATG CCTATGGACA TTCGGATAAC ACCTCGTAGA GAATTAGCCT
TTTACTTCTG AGTCAACCTT TAGAAAATGT GTAATACCCT GAGTGTTGAA TATTTGTTTC
ACTGATCAGG TTTCCAATAA ACCCTTTGGG CCATTATGCT GAATTTAGAC CAAATTTTAT
GTAGCTGAAG GTGGCCACTG ACACATCGAT TTTGGGTAAA CATTAAACCT ATCAGAGGCA
GTGTAATTCA GAATTTTTTC TGTGGCCACT TTTGAAAAAC ATGACTATCA CTTACGTGNC
ATATCATGTT CTCAAACTCC AAAATTGTGT TCAGCGGTAG ATCTGATTGA GGAACTGTT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPRPS2ribose-phosphate pyrophosphokinase 2 isoform 2 [Homo sapiens]. 621e-178O
Contig/Assembly ProteinPRPS2ribose-phosphate pyrophosphokinase 2 isoform 1 [Homo sapiens]. 616e-176O
Contig/Assembly ProteinPRPS1ribose-phosphate pyrophosphokinase 1 isoform 1 [Homo sapiens]. 607e-173O
Contig/Assembly ProteinPRPS1L1ribose-phosphate pyrophosphokinase 3 [Homo sapiens]. 577e-164O
Contig/Assembly ProteinPRPSAP2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform 1 [Homo sapiens]. 2826e-76O
Contig/Assembly ProteinPRPSAP1phosphoribosyl pyrophosphate synthase-associated protein 1 [Homo sapiens]. 2681e-71O
Contig/Assembly ProteinPRPSAP2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform 3 [Homo sapiens]. 2343e-61O
Contig/Assembly ProteinPRPSAP2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform 2 [Homo sapiens]. 2295e-60O
Contig/Assembly ProteinPRPSAP2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform 5 [Homo sapiens]. 2251e-58O
Contig/Assembly ProteinPRPSAP2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform 4 [Homo sapiens]. 2251e-58O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPrps2ribose-phosphate pyrophosphokinase 2 [Mus musculus]. 620e-177O
Contig/Assembly ProteinPrps1ribose-phosphate pyrophosphokinase 1 [Mus musculus]. 607e-173O
Contig/Assembly ProteinPrps1l3hypothetical protein LOC328099 [Mus musculus]. 604e-173O
Contig/Assembly ProteinPrps1l1phosphoribosyl pyrophosphate synthetase 1-like 1 [Mus musculus]. 584e-167O
Contig/Assembly ProteinPrpsap2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform a [Mus musculus]. 2795e-75O
Contig/Assembly ProteinPrpsap2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform a [Mus musculus]. 2795e-75O
Contig/Assembly ProteinPrpsap1phosphoribosyl pyrophosphate synthase-associated protein 1 [Mus musculus]. 2664e-71O
Contig/Assembly ProteinPrpsap2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform b [Mus musculus]. 2227e-58O
Contig/Assembly ProteinPrpsap2phosphoribosyl pyrophosphate synthase-associated protein 2 isoform b [Mus musculus]. 2227e-58O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC476855PREDICTED: similar to Ribose-phosphate pyrophosphokinase II (Phosphoribosyl pyrophosphate synthetase II) (PRS-II) isoform 1 [Canis familiaris]. 622e-178O
Contig/Assembly ProteinLOC476855PREDICTED: similar to Ribose-phosphate pyrophosphokinase II (Phosphoribosyl pyrophosphate synthetase II) (PRS-II) isoform 4 [Canis familiaris]. 622e-178O
Contig/Assembly ProteinLOC476855PREDICTED: similar to Ribose-phosphate pyrophosphokinase II (Phosphoribosyl pyrophosphate synthetase II) (PRS-II) isoform 3 [Canis familiaris]. 615e-176O
Contig/Assembly ProteinLOC476855PREDICTED: similar to Ribose-phosphate pyrophosphokinase II (Phosphoribosyl pyrophosphate synthetase II) (PRS-II) (PPRibP) isoform 6 [Canis familiaris]. 610e-174O
Contig/Assembly ProteinLOC481011PREDICTED: similar to Ribose-phosphate pyrophosphokinase I (Phosphoribosyl pyrophosphate synthetase I) (PRS-I) isoform 2 [Canis familiaris]. 607e-173O
Contig/Assembly ProteinLOC481011PREDICTED: similar to Ribose-phosphate pyrophosphokinase I (Phosphoribosyl pyrophosphate synthetase I) (PRS-I) isoform 4 [Canis familiaris]. 600e-171O
Contig/Assembly ProteinLOC476855PREDICTED: similar to Ribose-phosphate pyrophosphokinase II (Phosphoribosyl pyrophosphate synthetase II) (PRS-II) isoform 8 [Canis familiaris]. 565e-161O
Contig/Assembly ProteinLOC476855PREDICTED: similar to Ribose-phosphate pyrophosphokinase II (Phosphoribosyl pyrophosphate synthetase II) (PRS-II) (PPRibP) isoform 5 [Canis familiaris]. 544e-154O
Contig/Assembly ProteinLOC481011PREDICTED: similar to Ribose-phosphate pyrophosphokinase I (Phosphoribosyl pyrophosphate synthetase I) (PRS-I) isoform 3 [Canis familiaris]. 529e-150O
Contig/Assembly ProteinLOC487688PREDICTED: similar to Ribose-phosphate pyrophosphokinase I (Phosphoribosyl pyrophosphate synthetase I) (PRS-I) [Canis familiaris]. 493e-139O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPRPS2ribose-phosphate pyrophosphokinase 2 [Bos taurus]. 614e-176O
Contig/Assembly ProteinPRPS1ribose-phosphate pyrophosphokinase 1 [Bos taurus]. 607e-173O
Contig/Assembly ProteinPRPS1L1ribose-phosphate pyrophosphokinase 3 [Bos taurus]. 552e-157O
Contig/Assembly ProteinPRPSAP2phosphoribosyl pyrophosphate synthase-associated protein 2 [Bos taurus]. 2751e-73O
Contig/Assembly ProteinPRPSAP1PREDICTED: phosphoribosyl pyrophosphate synthetase-associated protein 1 [Bos taurus]. 2704e-72O
Contig/Assembly ProteinPRPSAP1phosphoribosyl pyrophosphate synthase-associated protein 1 [Bos taurus]. 2627e-70O
Contig/Assembly ProteinLOC100336819PREDICTED: PRPS2 protein-like [Bos taurus]. 2403e-63


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPRPS2phosphoribosyl pyrophosphate synthetase 2 [Sus scrofa]. 622e-178O
Contig/Assembly ProteinLOC100517744PREDICTED: ribose-phosphate pyrophosphokinase 1-like [Sus scrofa]. 607e-174O
Contig/Assembly ProteinLOC100515567PREDICTED: ribose-phosphate pyrophosphokinase 1-like [Sus scrofa]. 577e-165O
Contig/Assembly ProteinPRPSAP1PREDICTED: phosphoribosyl pyrophosphate synthase-associated protein 1 [Sus scrofa]. 2702e-72O
Contig/Assembly ProteinLOC100511226PREDICTED: phosphoribosyl pyrophosphate synthase-associated protein 2-like isoform 2 [Sus scrofa]. 1072e-23O
Contig/Assembly ProteinLOC100511226PREDICTED: phosphoribosyl pyrophosphate synthase-associated protein 2-like isoform 1 [Sus scrofa]. 1072e-23O
Contig/Assembly ProteinLOC100625749PREDICTED: phosphoribosyl pyrophosphate synthase-associated protein 2-like [Sus scrofa]. 1072e-23O


Assembly Members: 42      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010102F03ADR01_0102_F03.bDB790582 
BFLT10057A10BFLT1_0057_A10.bFS644483 
CBLT10084A01CBLT1_0084_A01.bHX217787 
ILNT10003E02ILNT1_0003_E02.bHX226944 
ILNT10054B07ILNT1_0054_B07.bHX230977 
ILNT10069D02ILNT1_0069_D02.bHX232244 
ITT010008A08ITT01_0008_A08.bBW976685 
KDN010035B01KDN01_0035_B01.bFS673841 
KDN010039G07KDN01_0039_G07.b  
LNG010006D03LNG01_0006_D03.bBP436109 
LNG010060E06LNG01_0060_E06.bBP437384 
OVR010008C09OVR01_0008_C09.bBP142439 AK394777
OVR010009C05OVR01_0009_C05.b  
OVRM10083C03OVRM1_0083_C03.bBP147637 
OVRM10125F12OVRM1_0125_F12.bBP152372 
OVRM10174E05OVRM1_0174_E05.bBP458805 
OVRM10210G06OVRM1_0210_G06.bBP460880 
OVRT10007D07OVRT1_0007_D07.bFS686958 
OVRT10032D08OVRT1_0032_D08.bFS688991 
OVRT10054C09OVRT1_0054_C09.bFS690802 
OVRT10135C11OVRT1_0135_C11.bHX237609 
OVRT10144D09OVRT1_0144_D09.bHX238364 
PBL010034B12PBL01_0034_B12.bBW970111 
PBL010041G05PBL01_0041_G05.bBW970508 
PBL010074G08PBL01_0074_G08.bBW972775 
PCT010026E08PCT01_0026_E08.bFS696384 
PST010036G05PST01_0036_G05.bFS699683 
PST010055H12PST01_0055_H12.bFS701229 
PST010077A02PST01_0077_A02.bFS702876 
PST010098E06PST01_0098_E06.bFS704562 
SMG010085C08SMG01_0085_C08.bFS720601 
SPL010068A01SPL01_0068_A01.bCJ019093 
SPLT10032H07SPLT1_0032_H07.bHX241700 
TCH010012F06TCH01_0012_F06.bCJ023349 
TCH010094A05TCH01_0094_A05.bCJ029272 
TES010033B03TES01_0033_B03.bCJ032164 
THY010070C01THY01_0070_C01.bBP161887 
THY010115H01THY01_0115_H01.bBP168187 AK239604
UTR010018G02UTR01_0018_G02.bBP172617 
UTR010046H04UTR01_0046_H04.bBP173271 
UTR010095G07UTR01_0095_G07.bCJ038797 
UTR010104B05UTR01_0104_B05.bCJ039483 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
96C930.480WSCGC/R
G1300.520CGG/R
312C740.297WSGAC/D
T2600.703GAT/D
660C300.086WSGTC/V
T3020.914GTT/V


Alignment:      TOP

20110601C-002551 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
THY01_0115_H01.b :
OVRM1_0174_E05.b : agttgtxx
PBL01_0034_B12.b : na
OVRT1_0144_D09.b : nnnaacactctnnnnnnnnccgttagcgttagxxxx
UTR01_0095_G07.b : nnnggcttggactaaaacxxxxxxxxxx
OVRM1_0210_G06.b : nagttt
OVRM1_0125_F12.b : nagtttg
SMG01_0085_C08.b :
OVR01_0009_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
SPL01_0068_A01.b : nnnnggcataggactaagacxxxxxxx
ILNT1_0003_E02.b : ttt
PBL01_0041_G05.b :
BFLT1_0057_A10.b : nnnccgctttnnnngactccgttagcgt
OVRT1_0054_C09.b : nnccgtttnnnnnnnnnccgtt
OVRT1_0007_D07.b : nncctttagct
OVRT1_0032_D08.b : nnnnccgtcagc
TCH01_0012_F06.b : nnnnggataggactatgaca
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b : nnnnnggcattggactaaaac
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b : gggggccctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0102_F03.b : taaattgataaacaxxxxxxxxxxx
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b : gggt
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : ...............GGTACGGTCGGAATTCCGAGCACTGTTGGCTACTGGAGCTCCTCT
---------+---------+---------+---------+---------+---------+ 45
THY01_0115_H01.b : gttgacaaacagcGGTACGGTCGGAATTCCGAGCACTGTTGGCTACTGGAGC*CCTCT
OVRM1_0174_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCCTCT
PBL01_0034_B12.b : agatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCCTCT
OVRT1_0144_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcaGCTCCTCT
UTR01_0095_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCCTCT
OVRM1_0210_G06.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCT
OVRM1_0125_F12.b : tcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTCT
SMG01_0085_C08.b : aaaaaagactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCT
OVR01_0009_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagagCTCT
SPL01_0068_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCT
ILNT1_0003_E02.b : tggacagtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTCT
PBL01_0041_G05.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTCT
BFLT1_0057_A10.b : tacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCT
OVRT1_0054_C09.b : agcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
OVRT1_0007_D07.b : gacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
OVRT1_0032_D08.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
TCH01_0012_F06.b : gtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggtT
PST01_0036_G05.b : nnnttcgctgtggctctggctc
PST01_0055_H12.b : nttaaccactgtggctatggacncctc
PST01_0077_A02.b : nnnncctgctgttgctatggctc
UTR01_0104_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_A08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctg
PBL01_0074_G08.b : nnnggatacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0018_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxctcctgcccgctccgccccctccagctcctct
ADR01_0102_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgcccgctccgccccctccagctcctct
KDN01_0035_B01.b : nnccctgcgtggctatggct
PST01_0098_E06.b : nnncctgctgttgctatggct
PCT01_0026_E08.b : nnngggaccttnnnnnnncctacgttgtgcact
ILNT1_0069_D02.b : nnncgacggtacgaggxxxxxxxxxxxxxxxxxx
SPLT1_0032_H07.b : nnnggcgagtacacxxxxxxxxxxxxxxxxxxxx
CBLT1_0084_A01.b : tttttagacagtagaggxxxxxxxxxxxxxxxxx
ILNT1_0054_B07.b : nnnnggacggtacgaggxxxxxxxxxxxxxxxxxx
LNG01_0060_E06.b : ntttcgggcatggatatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_C03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0135_C11.b : nnaaaaaattcnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0006_D03.b : ttttaggcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0039_G07.b : nnnnnc
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
---------+---------+---------+---------+---------+---------+ 103
THY01_0115_H01.b : TA*CTCCGCTCCTGCTGGTGTC*TCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
OVRM1_0174_E05.b : TAGCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
PBL01_0034_B12.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
OVRT1_0144_D09.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
UTR01_0095_G07.b : TAGCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
OVRM1_0210_G06.b : TAGCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
OVRM1_0125_F12.b : TAGCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
SMG01_0085_C08.b : TAGCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
OVR01_0009_C05.b : TAGCTCCGCTCCAGCGGGTATCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
SPL01_0068_A01.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
ILNT1_0003_E02.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
PBL01_0041_G05.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
BFLT1_0057_A10.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
OVRT1_0054_C09.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
OVRT1_0007_D07.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
OVRT1_0032_D08.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
TCH01_0012_F06.b : TAGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
PST01_0036_G05.b : TAGCTCCGCTCCTGCGGGTGTCCT*CACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
PST01_0055_H12.b : TAGCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
PST01_0077_A02.b : TAGCTCCGCTCCTGCGGGTGTCCT*CACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
UTR01_0104_B05.b : xAGCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
ITT01_0008_A08.b : gAGCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
PBL01_0074_G08.b : xxGCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
UTR01_0018_G02.b : tagCTCCGCTCCTGCGGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
ADR01_0102_F03.b : tagCTCCGCTCCTGCTGGTGTCCTCCACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
KDN01_0035_B01.b : cttactCGCTCCTGCTGGTGTCCT*CACTCGCGCTTTCCCGCTCTCGCTCGTGGGCCTCC
PST01_0098_E06.b : ctagctCGCTCCTGCGGGTGTCCT*CACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
PCT01_0026_E08.b : cctanctcgctccGCGGGTGTCCTGCACTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
ILNT1_0069_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxGACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
SPLT1_0032_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxGACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
CBLT1_0084_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxGACTCGCGCTTTCTCGCTCTCGTCG**GGGCCTCC
ILNT1_0054_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxGACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
LNG01_0060_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxtACTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
OVRM1_0083_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCTCGCGCTTTCCCGCTCTCGTCG**CGGCCTCC
OVRT1_0135_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
LNG01_0006_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
KDN01_0039_G07.b : ctgcggtggctacgggctgggncctccCTCGCGCTTTCCCGCTCTCGTCG**GGGCCTCC
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
---------+---------+---------+---------+---------+---------+ 162
THY01_0115_H01.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVRM1_0174_E05.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
PBL01_0034_B12.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVRT1_0144_D09.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
UTR01_0095_G07.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVRM1_0210_G06.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVRM1_0125_F12.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
SMG01_0085_C08.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVR01_0009_C05.b : CGAGCTTCAGCCGCCAGTAGCCGCCCCGCGCCGCTAGTAGCCCCGCGCGCAACCAAGCCC
SPL01_0068_A01.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
ILNT1_0003_E02.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
PBL01_0041_G05.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
BFLT1_0057_A10.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVRT1_0054_C09.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTGGCCCCGCGCGCAACCATGCCC
OVRT1_0007_D07.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVRT1_0032_D08.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
TCH01_0012_F06.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
PST01_0036_G05.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
PST01_0055_H12.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
PST01_0077_A02.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
UTR01_0104_B05.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
ITT01_0008_A08.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
PBL01_0074_G08.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
UTR01_0018_G02.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
ADR01_0102_F03.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
KDN01_0035_B01.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
PST01_0098_E06.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
PCT01_0026_E08.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
ILNT1_0069_D02.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
SPLT1_0032_H07.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
CBLT1_0084_A01.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
ILNT1_0054_B07.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
LNG01_0060_E06.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVRM1_0083_C03.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVRT1_0135_C11.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
LNG01_0006_D03.b : CGTGCTTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
KDN01_0039_G07.b : CGTGCCTCTGCCGCCTGT*GCCGCCCCGCGCCGCTTGTAGCCCCGCGCGCAACCATGCCC
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
---------+---------+---------+---------+---------+---------+ 221
THY01_0115_H01.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRM1_0174_E05.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
PBL01_0034_B12.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRT1_0144_D09.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
UTR01_0095_G07.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRM1_0210_G06.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRM1_0125_F12.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
SMG01_0085_C08.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVR01_0009_C05.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCTAGTCCCAGCGCGTGGCCGACCG
SPL01_0068_A01.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
ILNT1_0003_E02.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
PBL01_0041_G05.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
BFLT1_0057_A10.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRT1_0054_C09.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRT1_0007_D07.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRT1_0032_D08.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
TCH01_0012_F06.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
PST01_0036_G05.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
PST01_0055_H12.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
PST01_0077_A02.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
UTR01_0104_B05.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
ITT01_0008_A08.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
PBL01_0074_G08.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
UTR01_0018_G02.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
ADR01_0102_F03.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
KDN01_0035_B01.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
PST01_0098_E06.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
PCT01_0026_E08.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
ILNT1_0069_D02.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
SPLT1_0032_H07.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
CBLT1_0084_A01.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
ILNT1_0054_B07.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
LNG01_0060_E06.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRM1_0083_C03.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVRT1_0135_C11.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
LNG01_0006_D03.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
KDN01_0039_G07.b : AACATCGTGCTCTTCAGCGGCAGCTCGCACCAGGACCT*GTCCCAGCGCGTGGCCGACCG
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
---------+---------+---------+---------+---------+---------+ 280
THY01_0115_H01.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRM1_0174_E05.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
PBL01_0034_B12.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRT1_0144_D09.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
UTR01_0095_G07.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRM1_0210_G06.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRM1_0125_F12.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
SMG01_0085_C08.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVR01_0009_C05.b : GCTCGGCCTAGGAGCTGGGCAAGAGGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
SPL01_0068_A01.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
ILNT1_0003_E02.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
PBL01_0041_G05.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
BFLT1_0057_A10.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRT1_0054_C09.b : GCTTGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRT1_0007_D07.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRT1_0032_D08.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
TCH01_0012_F06.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
PST01_0036_G05.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
PST01_0055_H12.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
PST01_0077_A02.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
UTR01_0104_B05.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
ITT01_0008_A08.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
PBL01_0074_G08.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
UTR01_0018_G02.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
ADR01_0102_F03.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
KDN01_0035_B01.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
PST01_0098_E06.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
PCT01_0026_E08.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
ILNT1_0069_D02.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
SPLT1_0032_H07.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
CBLT1_0084_A01.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
ILNT1_0054_B07.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
LNG01_0060_E06.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRM1_0083_C03.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
OVRT1_0135_C11.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
LNG01_0006_D03.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAACCAGGAGACCAGCG
KDN01_0039_G07.b : GCTCGGCCT*GGAGCTGGGCAAGGTGGTCACCAAGAAGTTCAGCAGCGGGGAGACCAGCG
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
---------+---------+---------+---------+---------+---------+ 339
THY01_0115_H01.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
OVRM1_0174_E05.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
PBL01_0034_B12.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
OVRT1_0144_D09.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
UTR01_0095_G07.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
OVRM1_0210_G06.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
OVRM1_0125_F12.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
SMG01_0085_C08.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
OVR01_0009_C05.b : TGGAGATTGGCGAAAGCGTGAGAGGGGAGAGATGTGTACATCATCCAGAGTGGCTGCGGC
SPL01_0068_A01.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
ILNT1_0003_E02.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
PBL01_0041_G05.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
BFLT1_0057_A10.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
OVRT1_0054_C09.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
OVRT1_0007_D07.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
OVRT1_0032_D08.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
TCH01_0012_F06.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
PST01_0036_G05.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
PST01_0055_H12.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGCACATCATCCAGAGTGGCTGCGGC
PST01_0077_A02.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
UTR01_0104_B05.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
ITT01_0008_A08.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
PBL01_0074_G08.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
UTR01_0018_G02.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
ADR01_0102_F03.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
KDN01_0035_B01.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
PST01_0098_E06.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
PCT01_0026_E08.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
ILNT1_0069_D02.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
SPLT1_0032_H07.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
CBLT1_0084_A01.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
ILNT1_0054_B07.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
LNG01_0060_E06.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
OVRM1_0083_C03.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GACGTGTACATCATCCAGAGTGGCTGCGGC
OVRT1_0135_C11.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
LNG01_0006_D03.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
KDN01_0039_G07.b : TGGAGATTGGCGAAAGCGTGAGGGGGGAG*GATGTGTACATCATCCAGAGTGGCTGCGGC
OVR01_0008_C09.b : agggggccctattttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
---------+---------+---------+---------+---------+---------+ 398
THY01_0115_H01.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRM1_0174_E05.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
PBL01_0034_B12.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRT1_0144_D09.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
UTR01_0095_G07.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRM1_0210_G06.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRM1_0125_F12.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
SMG01_0085_C08.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVR01_0009_C05.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCATAGATCAACGCCTGCAAGATCGCCTC
SPL01_0068_A01.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
ILNT1_0003_E02.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
PBL01_0041_G05.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
BFLT1_0057_A10.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRT1_0054_C09.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRT1_0007_D07.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRT1_0032_D08.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
TCH01_0012_F06.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
PST01_0036_G05.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
PST01_0055_H12.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
PST01_0077_A02.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
UTR01_0104_B05.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
ITT01_0008_A08.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
PBL01_0074_G08.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
UTR01_0018_G02.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
ADR01_0102_F03.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
KDN01_0035_B01.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
PST01_0098_E06.b : GAAATCAACGACAACTTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
PCT01_0026_E08.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
ILNT1_0069_D02.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
SPLT1_0032_H07.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
CBLT1_0084_A01.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
ILNT1_0054_B07.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
LNG01_0060_E06.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRM1_0083_C03.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVRT1_0135_C11.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
LNG01_0006_D03.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
KDN01_0039_G07.b : GAAATCAACGACAACCTGATGGAGCTGCTCATCAT*GATCAACGCCTGCAAGATCGCCTC
OVR01_0008_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACGCCTGCAAGATCGCCTC
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
---------+---------+---------+---------+---------+---------+ 457
THY01_0115_H01.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRM1_0174_E05.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
PBL01_0034_B12.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRT1_0144_D09.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
UTR01_0095_G07.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRM1_0210_G06.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRM1_0125_F12.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
SMG01_0085_C08.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVR01_0009_C05.b : CTCCTCCAGGGAGACCGCCGTGATCCCAAGCTTCCCCTACGCCCGGCAAGACAAAAAGAG
SPL01_0068_A01.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
ILNT1_0003_E02.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
PBL01_0041_G05.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
BFLT1_0057_A10.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRT1_0054_C09.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRT1_0007_D07.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRT1_0032_D08.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
TCH01_0012_F06.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
PST01_0036_G05.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
PST01_0055_H12.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
PST01_0077_A02.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
UTR01_0104_B05.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
ITT01_0008_A08.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
PBL01_0074_G08.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
UTR01_0018_G02.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
ADR01_0102_F03.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
KDN01_0035_B01.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
PST01_0098_E06.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
PCT01_0026_E08.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
ILNT1_0069_D02.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
SPLT1_0032_H07.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
CBLT1_0084_A01.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
ILNT1_0054_B07.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
LNG01_0060_E06.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRM1_0083_C03.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVRT1_0135_C11.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
LNG01_0006_D03.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
KDN01_0039_G07.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
OVR01_0008_C09.b : CTCCTCCAGGGTGACCGCCGTGATCCCATGCTTCCCCTACGCCCGGCAAGACAAAAAG*G
THY01_0070_C01.b : ccattttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
---------+---------+---------+---------+---------+---------+ 516
THY01_0115_H01.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRM1_0174_E05.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
PBL01_0034_B12.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRT1_0144_D09.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
UTR01_0095_G07.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRM1_0210_G06.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRM1_0125_F12.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
SMG01_0085_C08.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVR01_0009_C05.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTGGGG
SPL01_0068_A01.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
ILNT1_0003_E02.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
PBL01_0041_G05.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
BFLT1_0057_A10.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAATTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRT1_0054_C09.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRT1_0007_D07.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRT1_0032_D08.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
TCH01_0012_F06.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
PST01_0036_G05.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
PST01_0055_H12.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
PST01_0077_A02.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
UTR01_0104_B05.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
ITT01_0008_A08.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
PBL01_0074_G08.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGTTGTCGGTGGCTG*GG
UTR01_0018_G02.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
ADR01_0102_F03.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
KDN01_0035_B01.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
PST01_0098_E06.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
PCT01_0026_E08.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCAGTGGCTG*GG
ILNT1_0069_D02.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
SPLT1_0032_H07.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
CBLT1_0084_A01.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
ILNT1_0054_B07.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
LNG01_0060_E06.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRM1_0083_C03.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVRT1_0135_C11.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
LNG01_0006_D03.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
KDN01_0039_G07.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
OVR01_0008_C09.b : ACAAGAGTCGTGCTCCGATTTCAGCAAAACTTGTGGCCAATATGCTGTCGGTGGCTG*GG
THY01_0070_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCTGTCGGTGGCTG*GG
UTR01_0046_H04.b : ttggtggxxx
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
---------+---------+---------+---------+---------+---------+ 575
THY01_0115_H01.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATNCAGGGCTTCTTTGATTT
OVRM1_0174_E05.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
PBL01_0034_B12.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVRT1_0144_D09.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
UTR01_0095_G07.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVRM1_0210_G06.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVRM1_0125_F12.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
SMG01_0085_C08.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVR01_0009_C05.b : GCAGATCACATCATCACCATGGGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
SPL01_0068_A01.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
ILNT1_0003_E02.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
PBL01_0041_G05.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
BFLT1_0057_A10.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVRT1_0054_C09.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVRT1_0007_D07.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVRT1_0032_D08.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
TCH01_0012_F06.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
PST01_0036_G05.b : GCAGATCACACCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
PST01_0055_H12.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
PST01_0077_A02.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
UTR01_0104_B05.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
ITT01_0008_A08.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
PBL01_0074_G08.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
UTR01_0018_G02.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
ADR01_0102_F03.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
KDN01_0035_B01.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
PST01_0098_E06.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
PCT01_0026_E08.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
ILNT1_0069_D02.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
SPLT1_0032_H07.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
CBLT1_0084_A01.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
ILNT1_0054_B07.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
LNG01_0060_E06.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVRM1_0083_C03.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVRT1_0135_C11.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
LNG01_0006_D03.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
KDN01_0039_G07.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
OVR01_0008_C09.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
THY01_0070_C01.b : GCAGATCACATCATCACCAT*GGACCTGCATGCCTCTCAGATCCAGGGCTTCTTTGATAT
UTR01_0046_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
---------+---------+---------+---------+---------+---------+ 635
THY01_0115_H01.b : CCCCtggacaattgttagccgagcccgcggcctgcggtggatcgggagaaatcccgagtg
OVRM1_0174_E05.b : CCCCGCGGACAAATTGTACGCGGAGCCCGCGGTCCTGCAATGCATTCGGGATAACATCCC
PBL01_0034_B12.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVRT1_0144_D09.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
UTR01_0095_G07.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVRM1_0210_G06.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAATGGATTCGGGAGAACATCGC
OVRM1_0125_F12.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
SMG01_0085_C08.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVR01_0009_C05.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
SPL01_0068_A01.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
ILNT1_0003_E02.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
PBL01_0041_G05.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
BFLT1_0057_A10.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVRT1_0054_C09.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVRT1_0007_D07.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVRT1_0032_D08.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
TCH01_0012_F06.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
PST01_0036_G05.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
PST01_0055_H12.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
PST01_0077_A02.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
UTR01_0104_B05.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
ITT01_0008_A08.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
PBL01_0074_G08.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
UTR01_0018_G02.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
ADR01_0102_F03.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
KDN01_0035_B01.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
PST01_0098_E06.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
PCT01_0026_E08.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
ILNT1_0069_D02.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
SPLT1_0032_H07.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
CBLT1_0084_A01.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
ILNT1_0054_B07.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
LNG01_0060_E06.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVRM1_0083_C03.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVRT1_0135_C11.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
LNG01_0006_D03.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
KDN01_0039_G07.b : CCCCGTGGACAACTTGTACGCGAAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
OVR01_0008_C09.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
THY01_0070_C01.b : CCCCGTGGACAACTTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
UTR01_0046_H04.b : xxxxxxxxxxxttgTGTACGCGGAGCCCGCGGTCCTGCAGTGGATTCGGGAGAACATCGC
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
---------+---------+---------+---------+---------+---------+ 695
THY01_0115_H01.b : aggaagtgatatcttttcccattcgcggggggccaagggggtttt
OVRM1_0174_E05.b : CTAATGAAAGAACTGCCACATCGCTTCCCCGGATGCCGagcgctcccaataagggcccgg
PBL01_0034_B12.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVRT1_0144_D09.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCNGCCGCGCCAAAAGGGTCACGTC
UTR01_0095_G07.b : CGAGTGGAGGAACTGCATCATCGTCTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVRM1_0210_G06.b : CGAGTGGAGGAACTGCATCATCGTTTTCCCTGATGCCGGCGGCGCCAAAAAGGTCACGTC
OVRM1_0125_F12.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
SMG01_0085_C08.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVR01_0009_C05.b : CGAGTGGAGGAACTGCATCATCGTCTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
SPL01_0068_A01.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
ILNT1_0003_E02.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
PBL01_0041_G05.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
BFLT1_0057_A10.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVRT1_0054_C09.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVRT1_0007_D07.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVRT1_0032_D08.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
TCH01_0012_F06.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
PST01_0036_G05.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
PST01_0055_H12.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
PST01_0077_A02.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
UTR01_0104_B05.b : CGAGTGGAGGAACTGCATCATCGTCTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
ITT01_0008_A08.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
PBL01_0074_G08.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
UTR01_0018_G02.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCCAAAGGGTCACGTC
ADR01_0102_F03.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
KDN01_0035_B01.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
PST01_0098_E06.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
PCT01_0026_E08.b : CGAGTGGAGGAACTGCATCATCGTCTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
ILNT1_0069_D02.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAA*GGGTCACGTC
SPLT1_0032_H07.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
CBLT1_0084_A01.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
ILNT1_0054_B07.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
LNG01_0060_E06.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVRM1_0083_C03.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVRT1_0135_C11.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
LNG01_0006_D03.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
KDN01_0039_G07.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
OVR01_0008_C09.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
THY01_0070_C01.b : CGAGTGGAGGAACTGCATCATCGTTTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
UTR01_0046_H04.b : CGAGTGGAGGAACTGCATCATCGTCTCCCCTGATGCCGGCGGCGCCAAAAGGGTCACGTC
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
---------+---------+---------+---------+---------+---------+ 753
THY01_0115_H01.b :
OVRM1_0174_E05.b : taattacagacaggttgaaatgtggagtatgccatgattccccataaataaaatcaagcc
PBL01_0034_B12.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAANGAGAGGAA*AAAAGCG
OVRT1_0144_D09.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTTGATCACAAGGAGAGGAA*GAAGGCG
UTR01_0095_G07.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAANGCG
OVRM1_0210_G06.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGACTCACCAGGAGAGGAA*GAAGGCG
OVRM1_0125_F12.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAANGCG
SMG01_0085_C08.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
OVR01_0009_C05.b : AATTGTAGACAGGTTGAATGGTGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
SPL01_0068_A01.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
ILNT1_0003_E02.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
PBL01_0041_G05.b : AATTGCGGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
BFLT1_0057_A10.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
OVRT1_0054_C09.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
OVRT1_0007_D07.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
OVRT1_0032_D08.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAAGCG
TCH01_0012_F06.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
PST01_0036_G05.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
PST01_0055_H12.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
PST01_0077_A02.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
UTR01_0104_B05.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAAGCG
ITT01_0008_A08.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
PBL01_0074_G08.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
UTR01_0018_G02.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
ADR01_0102_F03.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
KDN01_0035_B01.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
PST01_0098_E06.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
PCT01_0026_E08.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAAGCG
ILNT1_0069_D02.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAAAGAAGGCA
SPLT1_0032_H07.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
CBLT1_0084_A01.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
ILNT1_0054_B07.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
LNG01_0060_E06.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
OVRM1_0083_C03.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
OVRT1_0135_C11.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
LNG01_0006_D03.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
KDN01_0039_G07.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
OVR01_0008_C09.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
THY01_0070_C01.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
UTR01_0046_H04.b : AATTGCAGACAGGTTGAATG*TGGAGTTTGCCTTGATTCACAAGGAGAGGAA*GAAGGCG
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
---------+---------+---------+---------+---------+---------+ 812
THY01_0115_H01.b :
OVRM1_0174_E05.b : cattgcatttgcacggcaagtgtcttgatggggaac
PBL01_0034_B12.b : AATGAAGTGGACCGGATGGTCCCTGGTGGGCGACGTGAAAGAACGAGTGGCCATCCTTGT
OVRT1_0144_D09.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAAGACCGAGTGGCCATCCTTGT
UTR01_0095_G07.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
OVRM1_0210_G06.b : AATGACTTGGACCGGATGGTC*TTGGTGCGCGACGTGAACGGACGAATGGCCATtct
OVRM1_0125_F12.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGGCATCCTTG
SMG01_0085_C08.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
OVR01_0009_C05.b : AATGAAGTGGACCGGATGGTC*CTGGGGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
SPL01_0068_A01.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGAACGAGTGGCCATCCTTGT
ILNT1_0003_E02.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
PBL01_0041_G05.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
BFLT1_0057_A10.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
OVRT1_0054_C09.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAAGACCGAGTGGCCATCCTTGT
OVRT1_0007_D07.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
OVRT1_0032_D08.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACTTGAAGGACCGAGTGGCCATCCTTGT
TCH01_0012_F06.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAANGACCGAGTGGCCATCCTTGT
PST01_0036_G05.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
PST01_0055_H12.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
PST01_0077_A02.b : TATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
UTR01_0104_B05.b : AATGAAGTGGACCCGATGGTC*CTGGTGGGCGACGTGAANGAACGAGTGGCCATCCTTGT
ITT01_0008_A08.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
PBL01_0074_G08.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
UTR01_0018_G02.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
ADR01_0102_F03.b : AATGAAGTGGACCGAATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
KDN01_0035_B01.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
PST01_0098_E06.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
PCT01_0026_E08.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
ILNT1_0069_D02.b : TGTGAANTGNACCGGATGGTC*CTGGTGGGCGACGTGAAGGAACGAGTGGCCATCCTTGT
SPLT1_0032_H07.b : AATGAAGTGGACCGGATG*TC*CTGGTGGGCGACGTGAAAGACCGAGTGGCCATCCCTGT
CBLT1_0084_A01.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
ILNT1_0054_B07.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAANGACCGAGTGGCCATCCTTGT
LNG01_0060_E06.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAANGACCGAGTGGGCATCCTTGT
OVRM1_0083_C03.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
OVRT1_0135_C11.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
LNG01_0006_D03.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
KDN01_0039_G07.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
OVR01_0008_C09.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
THY01_0070_C01.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
UTR01_0046_H04.b : AATGAAGTGGACCGGATGGTC*CTGGTGGGCGACGTGAAGGACCGAGTGGCCATCCTTGT
TES01_0033_B03.b :
TCH01_0094_A05.b :
20110601C-002551 : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
---------+---------+---------+---------+---------+---------+ 872
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : GGATGACATGGCTGACACGTGTGGGCACATCTGCCATGCTGCAGAACAGCTACTCTCTGC
OVRT1_0144_D09.b : GGATGAAATGGCTGACAAGTGTGGCAACATCTGCCATGCTGCAAACAACCTACTCTCTGC
UTR01_0095_G07.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : GGATGACATGGCTGACACATGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
OVR01_0009_C05.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
SPL01_0068_A01.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
ILNT1_0003_E02.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACNAGCTACTCTCTGC
PBL01_0041_G05.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
BFLT1_0057_A10.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
OVRT1_0054_C09.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
OVRT1_0007_D07.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
OVRT1_0032_D08.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAACTACTCTCTGC
TCH01_0012_F06.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
PST01_0036_G05.b : GGATGACATGGCTGACACATGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
PST01_0055_H12.b : GGATGACATGGCTGACACATGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
PST01_0077_A02.b : GGATGACATGGCTGACACATGTGGCACCATCTGCCATGCTGCAGACAAGCCACTCTCTGC
UTR01_0104_B05.b : GGATGACATGGCTGACACGTGTGGCACCATCTGGCATGCTGCAGAACAGCTACTCTCTGC
ITT01_0008_A08.b : GGATGACATGGCTGACACATGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
PBL01_0074_G08.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
UTR01_0018_G02.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
ADR01_0102_F03.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
KDN01_0035_B01.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
PST01_0098_E06.b : GGATGACATGGCTGACACATGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
PCT01_0026_E08.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
ILNT1_0069_D02.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAAACAAGCTAATCTCTGC
SPLT1_0032_H07.b : GAATGACATGGCTGAAACGTGTGGCACCATCTGCCATGCTGCAAACAAGCTACTCTCTGC
CBLT1_0084_A01.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
ILNT1_0054_B07.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
LNG01_0060_E06.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
OVRM1_0083_C03.b : GGATGACATGGCTGACA
OVRT1_0135_C11.b : GGATGACATGGCTGACACGTGTGCCACCATCTGCCATGCTGCAGAACAGCTACTCTCTGG
LNG01_0006_D03.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
KDN01_0039_G07.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
OVR01_0008_C09.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
THY01_0070_C01.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
UTR01_0046_H04.b : GGATGACATGGCTGACACGTGTGGCACCATCTGCCATGCTGCAGACAAGCTACTCTCTGC
TES01_0033_B03.b : ccgctgttgctct
TCH01_0094_A05.b : tttttggcatggactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-002551 : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
---------+---------+---------+---------+---------+---------+ 931
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : CGGAGC*CACCAAATATATGCTATCCCTA*CCCATGGGATCTTCctggggcagctaattc
OVRT1_0144_D09.b : CCGACC*CACAAAATAAATGCTATCCTTA*ACCATGGAATCTTCTCTGGGCCActatttc
UTR01_0095_G07.b : CGGAGC*CACCAAGTATATGCTATCCTTA*CCCATGGGAACTTCTCTGGGGCACCTATTT
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : CGGACCAC*CAAAGTAAATGCTATCCCTA*CCCATGGGATCCTCTCTGGGCCAACTATTT
OVR01_0009_C05.b : CGGGGAGCACAAAGTATATGCTANTCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
SPL01_0068_A01.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGGCAGCTATTT
ILNT1_0003_E02.b : CGGAGC*CACAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
PBL01_0041_G05.b : CGGAGCCCACCAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGggcagctatt
BFLT1_0057_A10.b : CGGAAGCCACAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
OVRT1_0054_C09.b : CGGAGCCCAC*AAGTATATGCTATCCTTA*C*CATGGGATCTTCTCTGGGCCAGCTATTT
OVRT1_0007_D07.b : CGGGACCACCAAAGTATATGCTATCCTTA*CCCATGGGAATCTCTCTTGGGCAGCTATTT
OVRT1_0032_D08.b : CGGAACCACCAAAGTATATGCTATCCTTAACCCATGGGATCTTCTCTGGGGCAACTATTT
TCH01_0012_F06.b : CGGAGCCCACAAAGTATATGCTATCCTTT*ACCATGGGATCTTCTCTGGGCCAGCTATTT
PST01_0036_G05.b : CGGAGCCACCAAAGTATATGCTATCCCTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
PST01_0055_H12.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
PST01_0077_A02.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
UTR01_0104_B05.b : CGGACC*ANCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGGCAGCTATTC
ITT01_0008_A08.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGGCAGCTATTT
PBL01_0074_G08.b : CGGAGC*CACAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
UTR01_0018_G02.b : CGGAG
ADR01_0102_F03.b : CGGAGCCCACAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
KDN01_0035_B01.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
PST01_0098_E06.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
PCT01_0026_E08.b : CGGAGC*CACAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGGCAGCTATTT
ILNT1_0069_D02.b : CGGAGC*CACAAAGTATATGCTATCCTTA*CCCATGGAATCTTCTCGGGGCaactatttc
SPLT1_0032_H07.b : CGGACCCCCCAAATTATA*GCTATCCTTA*CCCAGGGGATCTTCTCGGGGCCAactaatt
CBLT1_0084_A01.b : CGGAGCCCACAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGGCAGCTATTT
ILNT1_0054_B07.b : CGGAGCCACCAAAGTATATGCTATCCTTT*ACCATGGGATCTTCTCTGGGCCAGCTATTT
LNG01_0060_E06.b : CGGAAGCCACAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGGCAGCTAT*T
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : CGGAAGCACCAAAGTATATGCTATCCTTA*CCCATGGGGATCTCTCTGGGCCAACTATTT
LNG01_0006_D03.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
KDN01_0039_G07.b : CGGAAGCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
OVR01_0008_C09.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
THY01_0070_C01.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
UTR01_0046_H04.b : CGGAGCCACCAAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
TES01_0033_B03.b : gaccggaccccAAGTATATGCTATCCTTA*CCCATGGGATCTTCTCTGGGCCAGCTATTT
TCH01_0094_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggGGGATCTTCTCTGGGCCAGCTATTT
20110601C-002551 : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACCAACACCA*TTCCACAAGA
---------+---------+---------+---------+---------+---------+ 989
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : caaataaatatgccgcctttgagctggtgttgtcccaaaacccttccccaagaggacaaa
OVRT1_0144_D09.b : caaaataaatatggcccctttgagctgtgttgtccacaacccattcacaaaaagaaaaaa
UTR01_0095_G07.b : CCAGATAAAATAATGCCGCCCTTTGAGGCTGTTGTTGTCACCcaccacaattcccccaag
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : CCAGAATAAATAATGC*GCCCTTTGAGGCggtgttgtcaccaaccccttccccaagagga
OVR01_0009_C05.b : CAAGAATAAATAATGggcgctttganggctgtnnngtgtcacnnacacattnncacagag
SPL01_0068_A01.b : CCAGAATAAATATGCTGCC**TTTGAGGCTTGTGTTGTCACAAACACA**TTCCACAAGA
ILNT1_0003_E02.b : C*AGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTTTCACCAACACA**TTCCACAAGA
PBL01_0041_G05.b : cagaaataatatgcccgcttnngaggctgtgtgtcaccacaccattcccacagagacaaa
BFLT1_0057_A10.b : CCAGAATAATAATGNNCGC**TTTGANGCTGTTGTTGTCACTAACACCA*TTCCACANNG
OVRT1_0054_C09.b : CCAGAATAATAATGCCGCCTTTGAanngctgtgtgtcaccaacacatttcacaagaggaa
OVRT1_0007_D07.b : CCAGATAAATAAATGCCGC**TTTGAGGCTGTTGTTGTCACCAACACA**TTCCACAAGA
OVRT1_0032_D08.b : CCAAAAATAATAATGCCGC*CTTTGAAGCTGTTGGTGGCACCAACACC**TTTCCCCAAG
TCH01_0012_F06.b : C*AGAATAAATATGCCGCC**TTTTGAGCTGTTGTTGTCACCACACCA***TTCCACAGA
PST01_0036_G05.b : CCAGAATAATAATGCCGCC**TTTGAGGCTGTTGTTGTCACCAACACA**TTTCACAAGA
PST01_0055_H12.b : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACCACACCA***TTCCACAGA
PST01_0077_A02.b : TCAGAATAAATATGCCGCC**TTTGAGGCTGTTGTTGTCACCAACACCA*TTCCACAAGA
UTR01_0104_B05.b : CCAGAATA*ATAATGCCGC*CTTTGAGGCCTGTGTTGTCACNACACCA**TTTCACAAGA
ITT01_0008_A08.b : CCAGAATAAATAATGCCGC*CTTTGANNNGCTGTGTGTCACCNACACCA*TTCCACAAGA
PBL01_0074_G08.b : CCAGAATAAATAATGCCCGCCTT*GAGGCTGNTGNTGTCACCAACACC**ATTCCACAGN
UTR01_0018_G02.b :
ADR01_0102_F03.b : CCAGAATAAATAATGCCGCCTTTGAnggnctgtgtgtcacnnacacattccacaggagac
KDN01_0035_B01.b : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACCNACACCATTTCCACAAGA
PST01_0098_E06.b : CCAGAATAATAATGCCGCC**TTTGAGGCTGTTGTTGTCCCAACACCA**TT*CACAAGA
PCT01_0026_E08.b : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACaacaccatttcacaagaag
ILNT1_0069_D02.b : caaaataaaaatgcccccttttaggcgtgtgtgttcccaacccatttcacaaaggaaaaa
SPLT1_0032_H07.b : tcgaaaaaaaataaggccccttttgaggcgtttgttgtcccaacaccctttcaaaaaaga
CBLT1_0084_A01.b : CCAGAATAAAATATGCCGC*CTTTGAGGCTGTTGTTGTCACCAACACCA*Tccacaagag
ILNT1_0054_B07.b : CCAGAATAAATATGGCGCC**TTTGAGGCTGGTGTTGTCACCAACACC**ATTCACAAGA
LNG01_0060_E06.b : CCAGAATAAATAATGCCGC*CTTGGAAGCTGNTGTTGTCACCAACACC**ATTCaccaga
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : CCAGAAAAAAAATGCCGCCTTTGAGctgttgttgtccccaacacctttccacagaggaca
LNG01_0006_D03.b : TCAGAATAAATAATGCCGC*CTTTGAGGCTGGTTGTGTCACCAACACC**ATTTCACAAa
KDN01_0039_G07.b : CCAGAATAAATAATGCCCGCTTTTGAGGCTG*TGTTGTCACCACACCA***TTCCACAGA
OVR01_0008_C09.b : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACCAACACCA*TTCCACAAGA
THY01_0070_C01.b : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACCAACACCA*TTCCACAAGA
UTR01_0046_H04.b : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACCAACACCA*TTCCACAAGA
TES01_0033_B03.b : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACCAACACCA*TTCCACAAGA
TCH01_0094_A05.b : CCAGAATAAATAATGCCGC*CTTTGAGGCTGTTGTTGTCACCAACACCA*TTCCACAAGA
20110601C-002551 : GGACAAAATGAAGCACTGCTCCAAGATTCAGGTTATCGACATTTCGATGATCTTGGCCGA
---------+---------+---------+---------+---------+---------+ 1049
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : tgaaccactgctcaaaattcaggttatcgaatttcaatgatcttgccgaagcattccccg
OVRT1_0144_D09.b : tgaaaccctgtccaaaatacgggttaaaaaattttcaaaaatttggcgagaggctcccca
UTR01_0095_G07.b : aggacaaaatggaagcactgcctccaaaaatcaggttaatcaacttttcaatgaacttgg
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : aaaatgaacccggctccaaattcaggtaacaaatttcaaaaaatttggccaagcctcccc
OVR01_0009_C05.b : gacaaaatgaagcactgcntcaaagattcaggntatcgancatttcgatgaatcttgggc
SPL01_0068_A01.b : GGACAAAATGAgcactgctcccagaatcaggttt
ILNT1_0003_E02.b : AGACAAAATGAAGCACTGCTCCAAGATCAGG**TTATCGAATTTCGATGATTTTGGCCGA
PBL01_0041_G05.b : tgaacactgctccanngatcagtatcgactttcgatgatctggncgaaagcatcgcagac
BFLT1_0057_A10.b : AGAC*AAATGAAGCACTGCTCCAAGATTCAGtaatcgacatttcgatgatctgggcgaag
OVRT1_0054_C09.b : aaatgaagcactgctcaagatcaagttatcgactttccaagatcttggcgaaggcatcgg
OVRT1_0007_D07.b : GGACAAAtgagcactgctccaagatcaagttaccacttttcaagaatctgggcgagccat
OVRT1_0032_D08.b : AGAAAAAATGAACCACTGCTCCAAGAATCAGGTaatgaaatttccaagaatttgggcgaa
TCH01_0012_F06.b : GGACAAAAATGAGCACTGCTCCAAGAATCCAGGTATCGACATTTCGATGATCTTGGGCGA
PST01_0036_G05.b : GGACAAAATGAAGCACTGCTCCCAGATCAGGN*TATCGACATTTCGATGATCTTGGCCGA
PST01_0055_H12.b : GGACAAAATGAAGCACTGCTCCAAGATTCAAGTTATCGACATTTCGATGATCTTGGCCGA
PST01_0077_A02.b : GGACAAAATGAAGCACTGCTCCAAGAATCAAGTTATCGACATTTCGATGATCTTGGCCGA
UTR01_0104_B05.b : GGACAAAATGAAGCACTGCTCCAAGATcagggtatcgacattccatgaatctggccgagg
ITT01_0008_A08.b : ANGACAAATGAAGCACTGCTCCAAGATCANGG*TATCGACATTTCGATGATCTTGGCGAA
PBL01_0074_G08.b : AAGACAAATGAAGCACTGCTCCNAGATTCAGGNTATCGACATTTCGATGATCTTGGCCGA
UTR01_0018_G02.b :
ADR01_0102_F03.b : aaaatgagcactgctccnagatcangtatcgacattcgatgatcttggcgaaagcatcgc
KDN01_0035_B01.b : GGACAAAATGAAGCACTGCTCCAAGATCAGG*TTATCGACATTTCGATGATCTggccgaa
PST01_0098_E06.b : GGAC*AAATGAAGCACTGCTCCAGAATCAGT**TATCGACTTTTCGATGATCTTGGCCGA
PCT01_0026_E08.b : acaaatgaaacactgctccagattcaagtatcgacattcaatgatcttggcggagccatc
ILNT1_0069_D02.b : ataaaacctggctccaaatccggttacgaaatttcaaaaattggccaaagccctcccgag
SPLT1_0032_H07.b : caaaatgaacccctgctccaaaaattaggttttccaaatttttaatatttgggcaagagc
CBLT1_0084_A01.b : gacaaaatgagcactggctcaagatcaggttaacgacatttcgatgaatctgccgaaggc
ILNT1_0054_B07.b : GGAC*AAATGAAACACTGCTC*AAGATTCAGGTTATCGACTTTTCGATGATCTTGGCgaa
LNG01_0060_E06.b : ggacaaatgaagcactgctccaagatcaagttatcgacatttcnatgatctggcccaggc
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : aaagaagcctgcccaagatccaggttacgacattcgatgatttgggcaaggcctcccaga
LNG01_0006_D03.b : aagaacaaaatgaagcactgcttccaaaattcaggttatcaacattttcaagaattcttg
KDN01_0039_G07.b : GGACAAAATGAAGCACTGCTCCAAGATCAGG*TTATCGACATTTCGATGATCTTGGCCGA
OVR01_0008_C09.b : GGACAAAATGAAGCACTGCTCCAAGATTCAGGTTATCGACATTTCGATGATCTTGGCCGA
THY01_0070_C01.b : GGACAAAATGAAGCACTGCTCCAAGATTCAGGTTATCGACATTTCGATGATCTTGGCCGA
UTR01_0046_H04.b : GGACAAAATGAAGCACTGCTCCAAGATTCAGGTTATCGACATTTCGATGATCTTGGCCGA
TES01_0033_B03.b : GGACAAAATGAAGCACTGCTCCATGATTCAGGTTATCGACATTTCGATGATCTTGGCCGA
TCH01_0094_A05.b : GGACAAAATGAAGCACTGCTCCAAGATTCAGGTTATCGACATTTCGATGATCTTGGCCGA
20110601C-002551 : GGCCATCCGCAGGACCCACAACGGCGAATCTGTGTCTTACCTGTTCAGCCACGTCCCGCT
---------+---------+---------+---------+---------+---------+ 1109
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : gaccacaacggcaatttgtgtctaactgttcaccacctccccttaaagccaaaaaggaag
OVRT1_0144_D09.b : gaaccacaacgggaaaattgtgttttacttgttacacaactcccctctaaggcaaaaagg
UTR01_0095_G07.b : cccaagagcatccgcaggaacccaaaaacggcgaaacttggtgtcttacctgggttaagc
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : agaaccaaaagggaaactggtcttaacgttcacccctcccgtttaaggccgaatggaagt
OVR01_0009_C05.b : cgaggcccatcggaagggaccacaacgggcgaaaatctggggtcttacctgttttcagcc
SPL01_0068_A01.b :
ILNT1_0003_E02.b : AGCCATCCGCAGGAACCACAgggccaatctgtgtctaccggttcaccagtcccgctcaaa
PBL01_0041_G05.b : cacacggcgatctgtgtctactngtcagcacgtccgctctaggcaggatggactccactt
BFLT1_0057_A10.b : gcatccgcagacccaaaacgncaatctggtgtctaactgttcagcacgtccgngtttaag
OVRT1_0054_C09.b : aggaaccccagggcaattctggtcttacttgttcgcccgtcccttctaaggcagatggaa
OVRT1_0007_D07.b : cgcaggaccaacacgggaaatctggtcttacggttaacccttccgctctaagccagaatg
OVRT1_0032_D08.b : ggccttcccaggaacccaaagggcaaacttgttttaactgttaaaccctctccctttaag
TCH01_0012_F06.b : AGGCATCCGCAGGACCCCACACGGCAAATCTGTGTCTTACCTGTTCAcccagccccgctc
PST01_0036_G05.b : AGGCATCCGCAGAACCCACAcggcaaactgtgtctacctgttcagccactcccgctctaa
PST01_0055_H12.b : GGNCATCCGCAGGACCCAACACGGCGATTCTGTGTCTTACTGGTCAA*CCACGTCCCGCT
PST01_0077_A02.b : AGNCCATCGCAGGACCNACAACGGCGAATCTGTGTCTTACCTGGTCAGCCACGTCCCGCT
UTR01_0104_B05.b : catccgcaggacccacgggcaaatcgggtcttactgttcaccccgtccgccctaaagcca
ITT01_0008_A08.b : GNNCATCCGCAGacccacaacgcgaatctgtgtcttacctgtcagccacgtccgctctaa
PBL01_0074_G08.b : Gccatcccgcagacccacacggcgatctgtgtcttactgntcaccacgtccgctctaaag
UTR01_0018_G02.b :
ADR01_0102_F03.b : agaccaacacgcnaaatcgtgtcttactgtcagcacgtcggctctaggcagaatggnagt
KDN01_0035_B01.b : gccatcgcaggacccaaacggcgaatctgtggcttactgttcaccacgtcccgttctaag
PST01_0098_E06.b : GGCatccgcaggaaccacaacgggaatcggtgtcttactgttcagccacttccgctctag
PCT01_0026_E08.b : ccaagacccacacggcaatctgtgtcttactgtcaacccgtcccctctaggccaaatgga
ILNT1_0069_D02.b : accccaaggggaatttttttttacgtttacccaccccccttaaggcaaaagggaggggga
SPLT1_0032_H07.b : ctccccgggaacccaaaagggaatcgtgttttaactgtttacccatctcccctttaagcc
CBLT1_0084_A01.b : attcgcaagacccaaaggggcaaatgggtcttacctggttcaccacgtcccgtttaaagc
ILNT1_0054_B07.b : gccatccccaggacccacacggcgaatcgtggtcttactgttaaccacgtccccgtctag
LNG01_0060_E06.b : cattcgcaggacccacaacggggatttgtgtcctaactgttcagcacctcccgctctaag
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : gaccaaaagggaaatctgtgtcttactgttacccccctcccgcctaagggcaggaaggga
LNG01_0006_D03.b : gcccaaggccatccccaaggaacccaaaaacggcgaaatttggtgtccttaacttggttc
KDN01_0039_G07.b : AGCCATCCGCAAGAACCACAACGGCGAATCTGTGTCTTACCTGGTCAGCCACGTCCCGCT
OVR01_0008_C09.b : GGCCATCCGCAGGACCCACAACGGCAAATCTGTGTCTTACCTGTTCAGCCACGTCCCGCT
THY01_0070_C01.b : GGCCATCCGCAGGACCCACAACGGCGAATCTGTGTCTTACCTGTTCAGCCACGTCCCGCT
UTR01_0046_H04.b : GGCCATCCGCAGGACCCACAACGGCGAATCTGTGTCTTACCTGTTCAGCCACGTCCCGCT
TES01_0033_B03.b : GGCCATCCGCAGGACCCACAACGGCGAATCTGTGTCTTACCTGTTCAGCCACGTCCCGCT
TCH01_0094_A05.b : GGCCATCCGCAGGACCCACAACGGCGAATCTGTGTCTTACCTGTTCAGCCACGTCCCGCT
20110601C-002551 : CTAAGGCCAGGATGGGAGGTGTGGAGCAAGCCTGAGCTGGCTTCTGACTCGCGTGCATTT
---------+---------+---------+---------+---------+---------+ 1169
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : ggtgaacaaacctaaacggctttgaaacccgggaattttcgaagttttttacttttaaac
OVRT1_0144_D09.b : gagggggagaaaaaccaacgggctccaaaccgggatttttctaagttttttttctttgaa
UTR01_0095_G07.b : cacgttccccccttaaaggccaaaaggggaaaggttgtgaaaaagcctgaaactggcctt
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : gggaaaaaccaaatggctttaaaaccggaatttccaaatttttttatcttaaaacgaaat
OVR01_0009_C05.b : cacgtccccggtcttaaggccagggaaaaggggaaggggggggggaaga
SPL01_0068_A01.b :
ILNT1_0003_E02.b : ggcaagatggagggtggaacaaaccgaaccggcttccgacccgggcatttttcgaatttt
PBL01_0041_G05.b : ggatttaagggctctgtacattatcactactaactaactacccgtaaggacgttaactta
BFLT1_0057_A10.b : ccagaataggaaggtgggaacaacctgaactggctctgaacccgggaattgtccgaagtt
OVRT1_0054_C09.b : gggtggaccaccctaactgcttcaaccccgggattttccgaggtttccttactttaaaac
OVRT1_0007_D07.b : gaggttgaaaaagcttactggcttcgaccccgggatttccgaattttcttacttaaacgg
OVRT1_0032_D08.b : gaaaaagggaaacccatttttattttaaaggcttcgggaatttttaataaataaaaaaac
TCH01_0012_F06.b : taagccaggatggnaaggttgaacaagcctgaactggctccgactccgggcatttgccga
PST01_0036_G05.b : ggcagaatggagggggtgacagcctgaactggctcggactccgggcattgtccgatgttc
PST01_0055_H12.b : CTAAGGCCAGAATGGGAGGTGTGGAACAAGCTTGAACTGGCTTCTGAaccccgggcattt
PST01_0077_A02.b : CTAAGGCCCAGATGGGAGGTGTGAAGCA*GCCTGAGCTGGCTTCTGACTCGCGTGCATTT
UTR01_0104_B05.b : gaatgggaagtggggacaaacctgaaacgggtttgaaacccgggaatttgttt
ITT01_0008_A08.b : ggcagaatggnagtgtgaagcagctgaactgcttctgaccccgtgcaatgnctcgagttt
PBL01_0074_G08.b : ccacgatggagtgtgnagcaagctgaactggctctgaccccggcattgncggaagttcct
UTR01_0018_G02.b :
ADR01_0102_F03.b : gtgagcagcctgactggctctgactcgggcaatgtctgagttttcttaccttgaaccgat
KDN01_0035_B01.b : ccagaatggaagtggggaacaacctgaactggcttctgatcccgggcattggctgatgtt
PST01_0098_E06.b : gccaggatggaagtggtgaacaagcctgaactgcttcgaaatcccgggattggccgaagt
PCT01_0026_E08.b : agtgggacaacctgactggtttcgatccgggctttgctaagtttcttactttaaacgaag
ILNT1_0069_D02.b : aaaaccaaaaggtttaaaaacgggatttttaaaatttttttcctgaaaggggaatttatt
SPLT1_0032_H07.b : aaaagggggggtgtgaaaaactaaaagggttctaacacggggattttcgaaatttttttc
CBLT1_0084_A01.b : cagaagggaagggtggaacaacctaacttggcttcgaaccccggggattgccgaagtttc
ILNT1_0054_B07.b : gccagaaaggaaggtgtgaacaacccgaacgggcttctaaccccggggctttgtcgaaag
LNG01_0060_E06.b : caagaatggaggtgtgaacagcctgaactggctctgactccgggcatgtccgaagtttct
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : actcacttttgatttaaagggggtggggacattttcaacaaaaagaaaaaacccccccct
LNG01_0006_D03.b : caccccccgttccccgcttctaaagggccagggaaagggggaaagggggggggaaaacaa
KDN01_0039_G07.b : CTAAGGCCAGAATGGGAGtgtggaagcagccctgactggctctgactcgcggcattgtct
OVR01_0008_C09.b : CTAAGGCCAGGATGGGAGGTGTGGAGCAAGCCTGAGCTGGCTTCTGACTCGCGTGCATTT
THY01_0070_C01.b : CTAAGGCCAGGATGGGAGGTGTGGAGCAAGCCTGAGCTGGCTTCTGACTCGCGTGCATTT
UTR01_0046_H04.b : CTAAGGCCAGGATGGGAGGTGTGGAGCAAGCCTGAGCTGGCTTCTGACTCGCGTGCATTT
TES01_0033_B03.b : CTAAGGCCAGGATGGGAGGTGTGGAGCAAGCCTGAGCTGGCTTCTGACTCGCGTGCATTT
TCH01_0094_A05.b : CTAAGGCCAGGATGGGAGGTGTGGAGCAAGCCTGAGCTGGCTTCTGACTCGCGTGCATTT
20110601C-002551 : GTCTGATGTTTTCTTTAGCTTTAGAACTGAGTAGTTATATTAATGCAGAAGCATCAGAAC
---------+---------+---------+---------+---------+---------+ 1229
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : ggaaatttatttaggcaaaccccaaactttgtgttcccacccggttttcctttaaaactt
OVRT1_0144_D09.b : agagatttattttagggaaaaaccaaaatttttgtccccccccccgtttttcttaaacac
UTR01_0095_G07.b : ca
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : tttttttgggaaaccccaaaattttgtggcccaacccaggttttcctttaaactttgagg
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b : tcttaactttaaaaggagatttaattaggcaaaccttaaaattttggggcccccaaccag
PBL01_0041_G05.b : ccgttgagatcatccaaaatagaaaagcttgagacttatccaacggcccctccgttgggg
BFLT1_0057_A10.b : tctttaactttaaaccggaagttatttagggaaacaccaaacttttgggctcccacccag
OVRT1_0054_C09.b : gaaatttattatggcaaacctaaaatttggggccccaccagggttcccttaaaaccttac
OVRT1_0007_D07.b : agattaataggcaaacttaaacttggggtcccacccaggttccttctaacttaaccgtaa
OVRT1_0032_D08.b : actacccgtaaagaaagggaaacctacggggggaggatctttccaaaaaaaaaaaaagct
TCH01_0012_F06.b : ggtttccttacctttgaacgaatagttaattaagcaaaacctctaaattttgggccccca
PST01_0036_G05.b : ctaacctttgacggatattaattaagcaaaactccgactttggggctcccacccaggttt
PST01_0055_H12.b : gcctgaaggtttctttaccttaaaacggagtagttatattatggccaaaccttcgaaact
PST01_0077_A02.b : GTCGGAAGTTTTCTTTAGNCTTTAAACTGAGTAGTTAAATTAtggcgaaacatccaaact
UTR01_0104_B05.b :
ITT01_0008_A08.b : tctttaccttaaaacgagaagtaattatggcaaacttcaaacttggtgcctccagccaag
PBL01_0074_G08.b : agcttaaactgagtataatatatgcaagcctcgaactggtggccccagccactgttccct
UTR01_0018_G02.b :
ADR01_0102_F03.b : agttattatgcaaacctcgactttgtgctcccacccaggttcccttaagcttgacgtgat
KDN01_0035_B01.b : tctttactttaaaactgataatttataatgcaaaaccttcaaatttgggggctcccagcc
PST01_0098_E06.b : ttccttaccttagaacgagtatttaattatgccaaccttcaaactttggtgtcccccacc
PCT01_0026_E08.b : ttttttaagcaaagctcaaatttggggcccccaccaggtttctttaaaccttgagttaat
ILNT1_0069_D02.b : agggcaaacccaaattttgggccccacccagggttcctcttaaactgaagttttttcttt
SPLT1_0032_H07.b : ctttaaaaggaaatttttttgcgaaaacccaaaattttggcccccccccaatgttcctct
CBLT1_0084_A01.b : tttcctttgaacggggtgttatttaagggaaacctcaaaactgggggcccccacccaggg
ILNT1_0054_B07.b : ttttctttcctttaaaacggaatatttttttagggcaaaccttcaaaattgggggctccc
LNG01_0060_E06.b : taactttgaactgaatgtaatttatgcaaacctcaaaatttggggctcccagccaaggtc
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : taaacgaggggaaaacctcccggggggagggcccttaaaaaaaaaaaaaaggctgtgaga
LNG01_0006_D03.b : aaggcccgggaaacctgggggcttttcttaaaaactccccccgggggggcaatttttttt
KDN01_0039_G07.b : gaaggttccttaacttaaactgatagttaataatgccaaacctcgaactttggggctccc
OVR01_0008_C09.b : GTCTGATGTTTTCTTTAGCTTTAGAACTGAAGTAGTATATTAATGCAGAAGCATCAAAAC
THY01_0070_C01.b : GTCTGATGTTTTCTTTAGCTTTAGAACTGAGTAGTTATATTAATGCAGAAGCATCAGAAC
UTR01_0046_H04.b : GTCTGATGTTTTCTTTAGCTTTAGAACTGAGTAGTTATATTAATGCAGAAGCATCAGAAC
TES01_0033_B03.b : GTCTGATGTTTTCTTTAGCTTTAGAACTGAGTAGTTATATTAATGCAGAAGCATCAGAAC
TCH01_0094_A05.b : GTCTGATGTTTTCTTTAGCTTTAGAACTGAGTAGTTATATTAATGCAGAAGCATCAGAAC
20110601C-002551 : TTTGTGTGCTCCCC*AGCCCAGTGTTTCTCCTTCTAAAGCTCTTGACCGTTGATTTCCAG
---------+---------+---------+---------+---------+---------+ 1288
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : aaaggtaattcattgtctggagggggggttttttattttattccccctttaaaaaatttt
OVRT1_0144_D09.b : taagaggtattatttttgggggggggggtgttttattatttccccccccaaaaataattt
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : gatattttttgggggagggggggtttttttttttatagcccccctcaaaaaatttttccc
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b : ttttcccttcaaaactgaacttaattctatttcggggagggggtggtatattattaattc
PBL01_0041_G05.b : actgaagaccccaatgttttctcttgaggggcccgtacttccaggccaaaaaaaaaaccc
BFLT1_0057_A10.b : gtttcctcttaacccttgaagttatttcaatgtggggagagggggtttatttttttaagg
OVRT1_0054_C09.b : cgtaattctttttggggagggggggttttttttttaagcacccctagaaaaattttcctg
OVRT1_0007_D07.b : tctttggggaggggggttttttattaggaaccctcagaaaatttgcctcccgttaaagaa
OVRT1_0032_D08.b : ttaaaaactaaaccaaaacggggcccccctgttgggggaaattgaaaaaccccaattgtt
TCH01_0012_F06.b : cccaaggtttccttctaactc
PST01_0036_G05.b : ccctcaaaccttgaccttatatcagttgcggggggggggggttttttatttaaggccccc
PST01_0055_H12.b : ttggtgctccccaacccacagtttccccttctaagcccttggaccgttgattccacttgt
PST01_0077_A02.b : ttgggggttcccaaccactgtttccccttcaaaacctctgacggtgaatttcagtttgct
UTR01_0104_B05.b :
ITT01_0008_A08.b : tttccctttaaatcctgaccgtgattccatttgtggggagggggggttattgatttaatg
PBL01_0074_G08.b : ctagccctgacgttatccagttgcggggaggggggttattatctaaggccacctcagaaa
UTR01_0018_G02.b :
ADR01_0102_F03.b : tcaattgggggaagggggtttttttttaaggcccctcaagaaattttgcgctgccgttaa
KDN01_0035_B01.b : caggtttctctttaagccttgacgttgatttcaattggtggagaaggggggtttatttat
PST01_0098_E06.b : atgtttcccctttaagccttggcgttaattccattggggggagggggggttttttatttt
PCT01_0026_E08.b : tcattgctgggaggggggttttttttttaggcccctcagaaaattttgcctccgggttaa
ILNT1_0069_D02.b : tggggggggggggttttttttttaggccgctcccaaaaaaaatttttccactcggaggaa
SPLT1_0032_H07.b : aaaacttgacggtatttctttttggggggcgggggttatttttttatggcccccttaaaa
CBLT1_0084_A01.b : ttccctttaagatttgacgtttattcattggtgggggggggggttatttttcttaggccc
ILNT1_0054_B07.b : cacccaatgttctcctttaaagcctcttaccgttatatctattttggggggaggcggggt
LNG01_0060_E06.b : tcctttaagtccttacctgattcagtttgggggagggggggttattgattataagccacc
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : aattatcccaagagcggccccccccggggtgggggaaaaaaagaaaaaacaaaattgttt
LNG01_0006_D03.b : tttccttgaaaaaaagtttttttttttttttttttataatacccctt
KDN01_0039_G07.b : agccaggtttcccttcaaactctgacgtgatttcatttggggggggggggttattgatct
OVR01_0008_C09.b : TTTGTGTGCTCCCCCACCCCAGTGTTTCTCCTTCTAAAGCTCTTGACCGTTGATTTCCAG
THY01_0070_C01.b : TTTGTGTGCTCCCC*AGCCCAGTGTTTCTCCTTCTAAAGCTCTTGACCGTTGA
UTR01_0046_H04.b : TTTGTGTGCTCCCC*AGCCCAGTGTTTCTCCTTCTAAAGCTCTTGACCGTTGATTTCCAG
TES01_0033_B03.b : TTTGTGTGCTCCCC*AGCCCAGTGTTTCTCCTTCTAAAGCTCTTGACCGTTGATTTCCAG
TCH01_0094_A05.b : TTTGTGTGCTCCCC*AGCCCAGTGTTTCTCCTTCTAAAGCTCTTGACCGTTGATTTCCAG
20110601C-002551 : TTTGCTGGGGAGGGCGGTGGTTTATTTGATCT*TTAAGTGCACAGCCTTCAATGAGAAGT
---------+---------+---------+---------+---------+---------+ 1347
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b : tgccttcagtttaaaagaattttttttttggaaatt
OVRT1_0144_D09.b : tcggcctngggaaaatttttttttttntgcaccacaaactctaagtttttgggtcaacaa
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : ccacctgaaaaaggaatttttttggggaatggagccacaaagagtgctctccaaaataaa
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b : accttataaaaaatattttcctgaccttcgaaagcatttcttttctgaattgggacaaaa
PBL01_0041_G05.b : ccccatacttagaaaattttagagaaaaaaactgttgttaaaatttgaaattaataaaaa
BFLT1_0057_A10.b : cccccctaaaaaaatttttgtcttcacgttagaaaaacttctttttgggaaaggggccaa
OVRT1_0054_C09.b : tacggtgaaagaacttttttttgggaaggggacactttggtgttttt
OVRT1_0007_D07.b : atttctttggaatgggcaatagggttcccggaaatattttgggggaggccaaaccgggaa
OVRT1_0032_D08.b : tttttaccctgcaaagggggacccgcaccacttaaagaa
TCH01_0012_F06.b :
PST01_0036_G05.b : tcaagaaatatttgtcctctgccgtttaagggactttctttgttgggactgaggccaaaa
PST01_0055_H12.b : tgggagaggcgtggggtt
PST01_0077_A02.b : gggaaggcggtggttattgtatttaaaggccacccctcaaggaaaaatttttccccctgg
UTR01_0104_B05.b :
ITT01_0008_A08.b : ccacctctcaaaaaatatttttgcttgcccttcaaaaggaatattcctttttgggaattg
PBL01_0074_G08.b : atttttccctgacggtcaagggaccttcttttggagatggggcccataaaggggctctgg
UTR01_0018_G02.b :
ADR01_0102_F03.b : agggcttttttttggaattgaggccaaaagggccctgaaaaaatttgtgggcgaccacaa
KDN01_0035_B01.b : cttaagccaccctcagaaaaaattttgcccctgcacgtctaaggggactttctttgtgtg
PST01_0098_E06.b : aagccaccctcaggaaaatatttgcgcttgacctttaaaggaactttctttttgggaatt
PCT01_0026_E08.b : aagaattttttttggaattgggcaataagaggtccttaagaaaaatggttgggggggccc
ILNT1_0069_D02.b : gatttcgtttttgcggtaagacacaaaaggtttgcgagaaaatatattggcgcgggagcc
SPLT1_0032_H07.b : aaaatttttccttcactctgaaaggatttttttttggggaaaagaacaaaaaaatgttcc
CBLT1_0084_A01.b : cccccagaaatattttcccctacctttgaaaaaaccttcctttttgggatttgggaaaat
ILNT1_0054_B07.b : ttttttatttttaagcacccctcaaggaaaaaattttctccctcaccttttaaaagggac
LNG01_0060_E06.b : ctcggaaaaatttttccctacacttctaagagaactttttgtttgggaatagagaccaaa
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : ttcttctcctggagaggggtcttgcctcctctctcgaggggccaaaaaaaaaacaacacc
LNG01_0006_D03.b :
KDN01_0039_G07.b : taagccacgctcagaaaaaatttgcccttacggttcaaaggactttctttgctgggactg
OVR01_0008_C09.b : TTTGCTGGGGgagggcggggggttatttgatcttttaggtgcccggccttcaatgaaaaa
THY01_0070_C01.b :
UTR01_0046_H04.b : TTTGCTGGGGAGGGCGGTGGTTGATTTGATCT*TTAAGTGCACAGCCTTCAATGAGAAGT
TES01_0033_B03.b : TTTGCTGGGGAGGGCGGTGGTTTATTTGATCT*TTAAGTGCACAGCCTTCAATGAGAAGT
TCH01_0094_A05.b : TTTGCTGGGGAGGGCGGTGGTTTATTTGATCTTTTAAGTGCACAGCCTTCAATGAGAAGT
20110601C-002551 : ATTTTTGTCGTCTTGACCTGTTCTGATAGGTGACCTTTTCCTTTGTTCTGGCAGTACTTG
---------+---------+---------+---------+---------+---------+ 1407
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b : cgaaatcannnnancaacatgactaaat
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b : ttttggggggggggcaaaaacccctttataaaagagggccccaacacgaaatttcttt
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b : attggtcctcgaaataattatatttgggtcagaccataaccctgtaaaaaaacccaccca
PBL01_0041_G05.b : annnnnnnnngnnnttgtgnnggggagagaataagaacatatagtnnnnnnnnnnnnnnn
BFLT1_0057_A10.b : ataagtttttttaaaatt
OVRT1_0054_C09.b :
OVRT1_0007_D07.b : aaacgggcaacacaaattttcccaaaaaccgtttttacaaccgcgaatacgcct
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b : agaggtgctctgaaataattatgtgtggggcaagggccaaaacccgataataaaccgggc
PST01_0055_H12.b :
PST01_0077_A02.b : acgttccaaagggaacctttcctgtttgggagatgggagccaacttaagggtggccctgg
UTR01_0104_B05.b :
ITT01_0008_A08.b : ggaccacatatgagttgctctttt
PBL01_0074_G08.b : aaatatatgggggggcaggcccataaccgtgaaaaagccccgccaaaccgaaactctccc
UTR01_0018_G02.b :
ADR01_0102_F03.b : aa
KDN01_0035_B01.b : gaattgaggcacaatagggggtccttcggaaacaaataggttgggtgc
PST01_0098_E06.b : ggggcacataggggtgccttcgaatatattatgtttgggccaggccccaataacctggta
PCT01_0026_E08.b : caaaacccggaaaaaagcggggcgaaccaaaaatttcccctccaaaaaccggtattttcc
ILNT1_0069_D02.b : gacgcgcctataaaaaagggtaggcacaaagattcgttcaaaggagaagatatatcat
SPLT1_0032_H07.b : tccgaaaataatattttgggggcgcagcggaaaacccccttaaaaaaccccggaaccaaa
CBLT1_0084_A01.b : aaggtgttcttggaattaaatttgttgggggccagagccaaaaaac
ILNT1_0054_B07.b : ttctctttttggcgaacagggcgccaaatagaggggtcccttcgagaaataaaaggtgtt
LNG01_0060_E06.b : tagggagtcctgtgagaaaaaataggttggggccgggcccaaacacccaataaaaa
OVRM1_0083_C03.b :
OVRT1_0135_C11.b : ccccctctaatta
LNG01_0006_D03.b :
KDN01_0039_G07.b : aggccattaggggggccttgaaactattatgttcggggccagcccaaaaaccttggaaaa
OVR01_0008_C09.b : gtatttttgtcatcttgacccttgtctgaaaaggtgacccttttccctttgttccttggc
THY01_0070_C01.b :
UTR01_0046_H04.b : ATTTTTGTCGTCTTGACCTGTTCTGATAGGTGACCTTTTCCTTTGTTCTGGCAGTACTTG
TES01_0033_B03.b : ATTTTTGTCGTCTTGACCTGTTCTGATAGGTGACCTTTTCCTTTGTTCTGGCAGTACTTG
TCH01_0094_A05.b : ATTTTTGTCATCTTGACCTGTTCTGATAGGTGACCTTTTCCTTTGTTCTGGCAGTACTTG
20110601C-002551 : GAGGCCACAACTTAAGTGCATGTTGCCATTCTGGAAGTTCATAGTTTATGTGTTTCGGGG
---------+---------+---------+---------+---------+---------+ 1467
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b : aacgttaaatt
PBL01_0041_G05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b : ccaacccgaaacccttttacctaaaagcc
PST01_0055_H12.b :
PST01_0077_A02.b : agattaaat
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b : cccaaagcccggtattttgccccctgttaaaaaaaaacacgtccgccc
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b : aaaacacccggacccaac
PCT01_0026_E08.b : cccttttttttgggnnnntttgaannnnnnntcttttccaatcnnaaccctctttttttt
ILNT1_0069_D02.b :
SPLT1_0032_H07.b : caaaaaaatcttttcccataaaaaaccagttttgtttgtgt
CBLT1_0084_A01.b :
ILNT1_0054_B07.b : ggggggcgaaaccaaaaaatacaccgta
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b : agaaccgggcccaacccggaaaccctcttacccaaacaacccggattttggttcacccgc
OVR01_0008_C09.b : agaatttgggaaggcccccacctttaagtggcttggtttcccattttctggaaaattc
THY01_0070_C01.b :
UTR01_0046_H04.b : GAGGCCACAACTTAAGTGCATGTTGCCATTCTGGAAGTTCATAGTTTATGTGTTTTCGGG
TES01_0033_B03.b : GAGGCCACAACTTAAGTGCATGTTGCCATTCTGGAAGTTCATAGTTTATGTGTTTCGGGG
TCH01_0094_A05.b : GAGGCCACAACTTAAGTGCATGTTGCCATTCTGGAAGTTCATAGTTTATGTGTTTCGGGG
20110601C-002551 : TTGCCAAAGGTCACGTCAGATTAAAGCCTCTGTGTAAATATAAAATGACAATGCCTATGG
---------+---------+---------+---------+---------+---------+ 1527
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b : nnnnnn
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b : ttttttttaaaannnnt
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b : ggaaaaaaagaannnctatacaacacaccaaacaacat
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b : TTGCC*AAGGTCACGTCAGATTAAAGCCTCTGTGTAAATATAAAATGACAATGCCTATGG
TES01_0033_B03.b : TTGCCCAAGGTCACGTCAGATTAAAGCCTCTGTGTNAATATAAAATGACAATGCCTATGG
TCH01_0094_A05.b : TTGCCAAAGGTCACGTCAGATTAAAGCCTCTGTGTAAATATAAAATGACAATGCCTATGG
20110601C-002551 : ACATTCGGATAACACCTCGTAGAGAATTAGCCTTTTACTTCTGAGTCAACCTTTAGAAAA
---------+---------+---------+---------+---------+---------+ 1587
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b : ACATTCGGATAACACCTTGTAGAGGATTAGCCTTTTACTTCTGAGTCACCTTTTAGAAAA
TES01_0033_B03.b : ACATTCGGATAACACCTTGTAGAGAATTAGCCTTTTACTTCTGAGTCAACCTTTAGAAAA
TCH01_0094_A05.b : ACATTCGGATAACACCTCGTAGAGAATTAGCCTTTTACTTCTGAGTCAACCTTTAGAAAA
20110601C-002551 : TGTGTAATACCCTGAGTGTTGAATATTTGTTTCACTGATCAGGTTTCCAATAAACCCTTT
---------+---------+---------+---------+---------+---------+ 1647
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b : TGTGTAaataccctgaatgtttaaataatttgttttcagtgaatccaggttttccaataa
TES01_0033_B03.b : TGTGTATTACCCTGAGTGTTGAATATTTGTTTCAGTGATCAGGTTTCCCAATAACCCCTT
TCH01_0094_A05.b : TGTGTAATACCCTGAGTGTTGAATATTTGTTTCACTGATCAGGTTTCCAATAAACCCTTT
20110601C-002551 : GGGCCATTATGCTGAATTTAGACCAAATTTTATGTAGCTGAAGGTGGCCACTGACACATC
---------+---------+---------+---------+---------+---------+ 1707
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b : aacccccttttgggcccattttttttccctggaatttttaaaacccaaaaattttttttt
TES01_0033_B03.b : GGGCCATTGTGCTGAATTTAGACCAAATTTatgtacctgaaggtggcactgacacatcga
TCH01_0094_A05.b : GGGCCATTATGCTGAATTTAGACCAAATTTTATGTAGCTGAAGGTGGCCACTGACACATC
20110601C-002551 : GATTTTGGGTAAACATTAAACCTATCAGAGGCAGTGTAATTCAGAATTTTTTCTGTGGCC
---------+---------+---------+---------+---------+---------+ 1767
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b : gggttt
TES01_0033_B03.b : ttttggtaaacattaaacctatcaaagcagtgtaattcgaatttttttcgtggccacttt
TCH01_0094_A05.b : GATTTTGGGTAAACATTAAACCTATCAGAGGCAGTGTAATTCAGAATTTTTTCTGTGGCC
20110601C-002551 : ACTTTTGAAAAACATGACTATCACTTACGTGNCATATCATGTTCTCAAACTCCAAAATTG
---------+---------+---------+---------+---------+---------+ 1827
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b : ttgaaaacttgacatcccctacgtgcaaaatcatgttcccgaactccaaaattgtgtcca
TCH01_0094_A05.b : ACTTTTGAAAAACATGACTATCACTTACGTGNCATATCATGTTCTCAAACTCCAAAATTG
20110601C-002551 : TGTTCAGCGGTAGATCTGATTGAGGAACTGTT............................
---------+---------+---------+---------+---------+---------+ 1859
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b : ccggtaaatcgaattaagaactgttttgaaaaaatccccaatttcctgtcccctttcacg
TCH01_0094_A05.b : TGTTCAGCGGTAGATCTGATTGAGGAACTGTTttgagatagtctccaagttcactgtcac
20110601C-002551 : ............................................................
---------+---------+---------+---------+---------+---------+ 1859
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b : cccttcgggcccatcccaaatgccctcggggcccgccaccggggtttttatgtccctttt
TCH01_0094_A05.b : attcacgctcttctgtgcccctcccaaaagcactcctgtcctgccacccgggttttttaa
20110601C-002551 : ............................................................
---------+---------+---------+---------+---------+---------+ 1859
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b : ttacccctgcttttactttgcctttttcccagggtttcctgttgcgggtttccccttcta
TCH01_0094_A05.b : tgtccctttttacccttgccttaaatttcctttttccacgggttccaggtttcgggtttc
20110601C-002551 : ............................................................
---------+---------+---------+---------+---------+---------+ 1859
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b : aaatccccccccttgaccaacccaaaccggttttgtttttacaaaaaaagggggaacttt
TCH01_0094_A05.b : ccttcttaagatcccccccattggatatccaatactgtttgcttttaaaaaaaaaaaggt
20110601C-002551 : ............................................................
---------+---------+---------+---------+---------+---------+ 1859
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b : tataaaaaaaaaaaaaaaaggccctgtgtttcaacctcaggtgccgccccctaataat
TCH01_0094_A05.b : aattttaaaaaaaaaaaaaaaaaaaaaaaggaatttgttcacttcggccggccccctata
20110601C-002551 : ............................................................
---------+---------+---------+---------+---------+---------+ 1859
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b : ttcccggggcccaatacccacccttttttaaaggcccaagggcataaacaaccggccctt
20110601C-002551 : ............................................................
---------+---------+---------+---------+---------+---------+ 1859
THY01_0115_H01.b :
OVRM1_0174_E05.b :
PBL01_0034_B12.b :
OVRT1_0144_D09.b :
UTR01_0095_G07.b :
OVRM1_0210_G06.b :
OVRM1_0125_F12.b :
SMG01_0085_C08.b :
OVR01_0009_C05.b :
SPL01_0068_A01.b :
ILNT1_0003_E02.b :
PBL01_0041_G05.b :
BFLT1_0057_A10.b :
OVRT1_0054_C09.b :
OVRT1_0007_D07.b :
OVRT1_0032_D08.b :
TCH01_0012_F06.b :
PST01_0036_G05.b :
PST01_0055_H12.b :
PST01_0077_A02.b :
UTR01_0104_B05.b :
ITT01_0008_A08.b :
PBL01_0074_G08.b :
UTR01_0018_G02.b :
ADR01_0102_F03.b :
KDN01_0035_B01.b :
PST01_0098_E06.b :
PCT01_0026_E08.b :
ILNT1_0069_D02.b :
SPLT1_0032_H07.b :
CBLT1_0084_A01.b :
ILNT1_0054_B07.b :
LNG01_0060_E06.b :
OVRM1_0083_C03.b :
OVRT1_0135_C11.b :
LNG01_0006_D03.b :
KDN01_0039_G07.b :
OVR01_0008_C09.b :
THY01_0070_C01.b :
UTR01_0046_H04.b :
TES01_0033_B03.b :
TCH01_0094_A05.b : aacctagt