[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-003292

Length: 1,104

Sequence [FASTA format sequence]
AGATGCGCTC GCCCCAGCCA GGGGCTGCCG AACGCCTTTG CGTGGAGTCT CCCGGACGCC
CCAGCGAGGA GGCAGCGGCC GCACCGCGCT GGAGCAGAGC CCGAGGACTG TGCCCCCGGG
ATCCGGCGCT CAGAGAAGCC TCCTGAGCTG TCTGAGGATG ATATCCGGCT GAAAAGCGAG
AGAGAGAACT ATAGTGCCAA CTCCCTGGAG CCTGCCACCA ACTCTCTTCC TGCAGATCAC
AAAACCATGG AAATTGAGGT CTCTGTTACA GAATGTAAGA GTGTGCCCGG AATCACCTCC
ACTCCGCATT CCTTGGACCA CCCCTCCCCT TTCTACTCGC CCCCCCACAA TGGCCTCCTC
CCTGATCACC ATGAATCTCT GGATAACGAT GTGGCCAGAG AGATCCGATA TCTAGACGAG
GTGCTGGAGG CCAACTGCTG TGATTCTGCT GTGGACGGAA CTTACAACGG CACTTCCTCC
CCGGAGCCTG GAGCAGCCGT CTTGGCAGGC AGCTCAAGCC CACCCGCGCA CACGGCCCTC
CAGCCGGAGC CCACGGAGAG AGTGGCTGGC AGGCAGGCGC CACCTCACAT TGAGCTCCAT
CAGAGCAACT CTGACACCAT GGCAGAGGGT GGAAGGGCCA ATGGCCACCC CCCCGAGCAG
CCCAGAGACC TGCCGGGCGA CAGCCTCCAG ATGCCCGTGA GCCCCAGCTC CTCCACCAGC
TCACGGGGTT CCTCCCGAGA TGGGGAGTTC ACCCTCACCA CGCTGAAGAA GGAAGCTAAG
TTCGAGCTGC GTGCCTTCCA TGAGGACAAG AAGCCCTCCA AGCTCTTCGA GGACGACGAG
AATGAGAAAG AGCAGTACTG CGTCAGAAAA GTGCGGCCTT CGGAAGAGAT GATGGAGCTG
GAAAAGGAGA GGAGAGAGCT CATCCGGAGT CAGGCTGTGA AAAAAATCCT GGCATCGCAG
CAAAGTGGTG GAACCCTCCC CAGAAAAGAC CATTGNAGAG CAGCTGGACG AAGAACATCT
GGAGTCGCAC AAAAAGTACA AGGAGCGCAA GGAGAGAAGG GCACAGCAGG AGCAATTGCT
GATGCAGCAG CAGCAGCAAC AGCA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAKAP2A-kinase anchor protein 2 isoform 3 [Homo sapiens]. 437e-132
Contig/Assembly ProteinAKAP2A-kinase anchor protein 2 isoform 1 [Homo sapiens]. 437e-132
Contig/Assembly ProteinPALM2-AKAP2PALM2-AKAP2 protein isoform 1 [Homo sapiens]. 412e-125
Contig/Assembly ProteinPALM2-AKAP2PALM2-AKAP2 protein isoform 2 [Homo sapiens]. 412e-125
Contig/Assembly ProteinAKAP2A-kinase anchor protein 2 isoform 2 [Homo sapiens]. 362e-110O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAkap2A-kinase anchor protein 2 isoform 1 [Mus musculus]. 337e-102O
Contig/Assembly ProteinAkap2A-kinase anchor protein 2 isoform 2 [Mus musculus]. 337e-102O
Contig/Assembly ProteinAkap2A-kinase anchor protein 2 isoform 3 [Mus musculus]. 337e-102O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPALM2-AKAP2PREDICTED: PALM2-AKAP2 readthrough transcript [Bos taurus]. 422e-128
Contig/Assembly ProteinAKAP2A-kinase anchor protein 2 [Bos taurus]. 371e-112O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAKAP2A-kinase anchor protein 2 [Sus scrofa]. 422e-128O


Assembly Members: 15      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
OVRM10014D01OVRM1_0014_D01.bBP148662 
OVRM10046C03OVRM1_0046_C03.bBP147607 
OVRM10089A11OVRM1_0089_A11.bBP145977 AK348182
OVRM10174B08OVRM1_0174_B08.bBP456173 
OVRT10002A08OVRT1_0002_A08.bFS686505 
OVRT10027C10OVRT1_0027_C10.bFS688610 
OVRT10036A07OVRT1_0036_A07.bFS689300 
OVRT10039E08OVRT1_0039_E08.bFS689594 
OVRT10043A12OVRT1_0043_A12.bFS689883 
OVRT10053A03OVRT1_0053_A03.bFS690696 
OVRT10074F02OVRT1_0074_F02.bFS692449 
OVRT10109E10OVRT1_0109_E10.bHX235535 
OVRT10122D06OVRT1_0122_D06.bHX236583 
OVRT10128B03OVRT1_0128_B03.bHX237034 
PST010036F07PST01_0036_F07.bFS699673 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
499A140.333WNATC/I
G1000.667GTC/V


Alignment:      TOP

20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0174_B08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0053_A03.b : nncccgggggnnnnnnnnccttcagcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_D06.b : nnaacgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_E08.b : nnttctttnnnnnnnnnccctcagcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_D01.b : xxxxxxxxxxxxxxxxxxx
OVRM1_0089_A11.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0046_C03.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_A08.b : naattccgttagctgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0027_C10.b : nnnccgttctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_A12.b : ngggtttnnnnnncnnccgttagcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_A07.b : nnngggctnnnnnngnnncgtctgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0109_E10.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_B03.b : nnnnccgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_F02.b : nnccctttnnnnnnnnccgtttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0036_F07.b :
20110601C-003292 : .........................AGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
---------+---------+---------+---------+---------+---------+ 35
OVRM1_0174_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxAGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0053_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxAGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0122_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxcAGATGCGCTCGCCCCAGCCAAGGGCTGCCGAACGC
OVRT1_0039_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxAGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRM1_0014_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGTGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRM1_0089_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRM1_0046_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0002_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0027_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0043_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0036_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0109_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0128_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
OVRT1_0074_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGATGCGCTCGCCCCAGCCAGGGGCTGCCGAACGC
PST01_0036_F07.b :
20110601C-003292 : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
---------+---------+---------+---------+---------+---------+ 95
OVRM1_0174_B08.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0053_A03.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0122_D06.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0039_E08.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRM1_0014_D01.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRM1_0089_A11.b : CTTTGCGTGGAGTCTCACGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRM1_0046_C03.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0002_A08.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0027_C10.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0043_A12.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0036_A07.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0109_E10.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0128_B03.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
OVRT1_0074_F02.b : CTTTGCGTGGAGTCTCCCGGACGCCCCAGCGAGGAGGCAGCGGCCGCACCGCGCTGGAGC
PST01_0036_F07.b : nnncctactgttgcactgnag
20110601C-003292 : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
---------+---------+---------+---------+---------+---------+ 155
OVRM1_0174_B08.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0053_A03.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0122_D06.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0039_E08.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRM1_0014_D01.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRM1_0089_A11.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRM1_0046_C03.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0002_A08.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0027_C10.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0043_A12.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0036_A07.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0109_E10.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0128_B03.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
OVRT1_0074_F02.b : AGAGCCCGAGGACTGTGCCCCCGGGATCCGGCGCTCAGAGAAGCCTCCTGAGCTGTCTGA
PST01_0036_F07.b : tcagtctgattgctacctggatgctcttctctttctttAGAAGCCTCCTGAGCTGTCTGA
20110601C-003292 : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
---------+---------+---------+---------+---------+---------+ 215
OVRM1_0174_B08.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAAAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0053_A03.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0122_D06.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0039_E08.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRM1_0014_D01.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRM1_0089_A11.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRM1_0046_C03.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0002_A08.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0027_C10.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0043_A12.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0036_A07.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0109_E10.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0128_B03.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
OVRT1_0074_F02.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
PST01_0036_F07.b : GGATGATATCCGGCTGAAAAGCGAGAGAGAGAACTATAGTGCCAACTCCCTGGAGCCTGC
20110601C-003292 : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
---------+---------+---------+---------+---------+---------+ 275
OVRM1_0174_B08.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0053_A03.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0122_D06.b : CACCAACTCTCTTCCTGCAGATCAAAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0039_E08.b : CACCAACTCTTTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRM1_0014_D01.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRM1_0089_A11.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRM1_0046_C03.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0002_A08.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0027_C10.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0043_A12.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0036_A07.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0109_E10.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0128_B03.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
OVRT1_0074_F02.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
PST01_0036_F07.b : CACCAACTCTCTTCCTGCAGATCACAAAACCATGGAAATTGAGGTCTCTGTTACAGAATG
20110601C-003292 : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
---------+---------+---------+---------+---------+---------+ 335
OVRM1_0174_B08.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCATTTCTA
OVRT1_0053_A03.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRT1_0122_D06.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRT1_0039_E08.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRM1_0014_D01.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRM1_0089_A11.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRM1_0046_C03.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRT1_0002_A08.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRT1_0027_C10.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRT1_0043_A12.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRT1_0036_A07.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGGCCACCCCTCCCCTTTCTA
OVRT1_0109_E10.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRT1_0128_B03.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
OVRT1_0074_F02.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
PST01_0036_F07.b : TAAGAGTGTGCCCGGAATCACCTCCACTCCGCATTCCTTGGACCACCCCTCCCCTTTCTA
20110601C-003292 : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
---------+---------+---------+---------+---------+---------+ 395
OVRM1_0174_B08.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0053_A03.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0122_D06.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0039_E08.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRM1_0014_D01.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRM1_0089_A11.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRM1_0046_C03.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0002_A08.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0027_C10.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0043_A12.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0036_A07.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0109_E10.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0128_B03.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
OVRT1_0074_F02.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
PST01_0036_F07.b : CTCGCCCCCCCACAATGGCCTCCTCCCTGATCACCATGAATCTCTGGATAACGATGTGGC
20110601C-003292 : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
---------+---------+---------+---------+---------+---------+ 455
OVRM1_0174_B08.b : CAGAGAGATCCGATATCTAGACGAGGTGCTAGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0053_A03.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0122_D06.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0039_E08.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRM1_0014_D01.b : CAGAGAGATCCGATATCTAGACTAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRM1_0089_A11.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRM1_0046_C03.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0002_A08.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0027_C10.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0043_A12.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0036_A07.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0109_E10.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0128_B03.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
OVRT1_0074_F02.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
PST01_0036_F07.b : CAGAGAGATCCGATATCTAGACGAGGTGCTGGAGGCCAACTGCTGTGATTCTGCTGTGGA
20110601C-003292 : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
---------+---------+---------+---------+---------+---------+ 515
OVRM1_0174_B08.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCATCTTGGCAGGCAGCTC
OVRT1_0053_A03.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRT1_0122_D06.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRT1_0039_E08.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRM1_0014_D01.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCATCTTGGCAGGCAGCTC
OVRM1_0089_A11.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCATCTTGGCAGGCAGCTC
OVRM1_0046_C03.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCATCTTGGCAGGCAGCTC
OVRT1_0002_A08.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRT1_0027_C10.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRT1_0043_A12.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRT1_0036_A07.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRT1_0109_E10.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRT1_0128_B03.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
OVRT1_0074_F02.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCGTCTTGGCAGGCAGCTC
PST01_0036_F07.b : CGGAACTTACAACGGCACTTCCTCCCCGGAGCCTGGAGCAGCCATCTTGGCAGGCAGCTC
20110601C-003292 : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
---------+---------+---------+---------+---------+---------+ 575
OVRM1_0174_B08.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCANGCA
OVRT1_0053_A03.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0122_D06.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0039_E08.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRM1_0014_D01.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRM1_0089_A11.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRM1_0046_C03.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0002_A08.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0027_C10.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0043_A12.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0036_A07.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0109_E10.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0128_B03.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
OVRT1_0074_F02.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAAAGTGGCTGGCAGGCA
PST01_0036_F07.b : AAGCCCACCCGCGCACACGGCCCTCCAGCCGGAGCCCACGGAGAGAGTGGCTGGCAGGCA
20110601C-003292 : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
---------+---------+---------+---------+---------+---------+ 635
OVRM1_0174_B08.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0053_A03.b : GGCGGCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0122_D06.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0039_E08.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRM1_0014_D01.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRM1_0089_A11.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRM1_0046_C03.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0002_A08.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0027_C10.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0043_A12.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0036_A07.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0109_E10.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0128_B03.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
OVRT1_0074_F02.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
PST01_0036_F07.b : GGCGCCACCTCACATTGAGCTCCATCAGAGCAACTCTGACACCATGGCAGAGGGTGGAAG
20110601C-003292 : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
---------+---------+---------+---------+---------+---------+ 695
OVRM1_0174_B08.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0053_A03.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0122_D06.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0039_E08.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRM1_0014_D01.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCTGGCGACAGCCTCCAGATGCC
OVRM1_0089_A11.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRM1_0046_C03.b : GGCCAATGGCCACCCCTCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0002_A08.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0027_C10.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0043_A12.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0036_A07.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0109_E10.b : GGCCAATGGTCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0128_B03.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
OVRT1_0074_F02.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
PST01_0036_F07.b : GGCCAATGGCCACCCCCCCGAGCAGCCCAGAGACCTGCCGGGCGACAGCCTCCAGATGCC
20110601C-003292 : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
---------+---------+---------+---------+---------+---------+ 755
OVRM1_0174_B08.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGTGTTCCTCCCGAGATGGGGAGTTCccct
OVRT1_0053_A03.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRT1_0122_D06.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCCTCCGAGATGGGGAGTTCACCCT
OVRT1_0039_E08.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRM1_0014_D01.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGNGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRM1_0089_A11.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRM1_0046_C03.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRT1_0002_A08.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRT1_0027_C10.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRT1_0043_A12.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRT1_0036_A07.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRT1_0109_E10.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRT1_0128_B03.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
OVRT1_0074_F02.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
PST01_0036_F07.b : CGTGAGCCCCAGCTCCTCCACCAGCTCACGGGGTTCCTCCCGAGATGGGGAGTTCACCCT
20110601C-003292 : CACCACGCTGAAGAAGGAAGCTAAGTTCGAGCTGCGTGCCTTCCATGAGGACAAGAAGCC
---------+---------+---------+---------+---------+---------+ 815
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : CACCACGCTGAAGAAGGAAAGCTAGTTCGAGCTGCGTGCCTTCCCATGAGGACAGAAGCC
OVRT1_0122_D06.b : CACCACGCTGAAGAAGGAAGCTAAGTTCGAGCTGCGTGCCTTCCATGAGGACAAGAAGCC
OVRT1_0039_E08.b : CACCACGCTGAAGAAGGAAGCTAAGTTCGAGCTGCGTGCCTTCCATGANNGACAGAAGCC
OVRM1_0014_D01.b : CACCACGCTGAAGAAG
OVRM1_0089_A11.b : CACCACGCTGAAAGAGGAAGCTAAG
OVRM1_0046_C03.b : CACCACGCTGAAGAAGGAAGCTAAGT
OVRT1_0002_A08.b : CACCACGCTGAAGAAGGAAAGCTAGTTCGAGCTGCGTGCCTTCCATGAGGACAAGAAGCC
OVRT1_0027_C10.b : CACCACGCTGAAGAAGGAAGCTAAGTTCGAGCTGCGTGCCTTCCATGAGGACAAGAAGCC
OVRT1_0043_A12.b : CACCACGCTGAAGAAGGAAAGCTAGTTCGAGCTGCGTGCCTTCCATGAGGACAAGAAGCC
OVRT1_0036_A07.b : CACCACGCTGAAGAAGGAAGCTAAGTTCGAGCTGCGTGCCTTCCCATGAGGACAGAAGCC
OVRT1_0109_E10.b : CACCACGCTGAAGAAGGAAGCTAAGTTCGAGCTGCGTGCCTTCCATGANGACAAGAAGCC
OVRT1_0128_B03.b : CACCACGCTGAAGAAGGAAAGCTAGTTCGAGCTGCGTGCCCTCCATGAGGACAAGAAGCC
OVRT1_0074_F02.b : CACCACGCTGAAGAAGGAAGCTAAGTTCGAGCTGCGTGCCTTCCATGAGGACAAGAAG*C
PST01_0036_F07.b : CACCACGCTGAAGAAGGAAGCTAAGTTCGAGCTGCGTGCCTTCCATGAGGACAAGAAGCC
20110601C-003292 : CTCCA*AGCTCTTCGAGGACGACGAGAATGAGAAAGAGCAGTACTGCGTCAGAAAAGTGC
---------+---------+---------+---------+---------+---------+ 874
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : CTCCNNAGCTCTCGAGGGACGACGAG*ATGANGAAAAGCAGTACTGCGTCAGAAAAGTGC
OVRT1_0122_D06.b : CTCCA*AGCTCTTCGAGGACGACGAGGATGAGAAAGAGCAGTACTGCGTCAGAAAAGTGC
OVRT1_0039_E08.b : CTCCN*AGCTCTTCGAGGACGACGAGAATGAGAAAGAGCAGTACTGCGTCAGAAAAGTGC
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : CTCCN*AGCTCTTCGAGGACGACGAGAATGAGAAAGAGCAGTACTGCGTCAGAAAAGTGC
OVRT1_0027_C10.b : CCTCC*AGCTCTTCGAGGACGACGAGNATGAGAAAGAGCAGTACTGCGTCAGAAAAGTGC
OVRT1_0043_A12.b : CTCCN*AGCTCTTTCGAGACGACGAGNATGAGAAAGAGCAGTACTGCGTCAGAAAAGTGC
OVRT1_0036_A07.b : CTCCA*AGCTCTTCGAGGACGACGAGNATGANAAAGAGCAGTACTGCGTCAGAAAAGTGC
OVRT1_0109_E10.b : CTCC**AGCTCTTCGAGGACGACGAGAATGANAAAGAGCAGTACTGCGTCAGAAAAGTGC
OVRT1_0128_B03.b : CTCCC*AGCTCTTCGAGGACGACGAGAATGAGAAAGAGCCGTACTGCGTCAGAAAAGTGC
OVRT1_0074_F02.b : CTCCA*AGCTCTTCGAGGACGACGAGAATGAGAAAGAGCAGTACTGCGTCAGAAAAGTGC
PST01_0036_F07.b : CTCCA*AGCTCTTTGAGGACGACGAGAATGAGAAAGAGCAGTACTGCGTCAGAAAAGTGC
20110601C-003292 : GGCCTTCGGAAGAGATGATGGAGCTGGAAAAGGAGAGGAGAGAGCTCATCCGGAGTCAGG
---------+---------+---------+---------+---------+---------+ 934
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : GGCCTTcngaagagatgatggagctggnaaaggaaaggaaagagctcatccggagtcagc
OVRT1_0122_D06.b : GGGCCTCCGAAGAGATGATGGAGCTGGAAAAGgagaggagaaactcctccggagtccggc
OVRT1_0039_E08.b : GGCCTTCGGGAGAGATGATGGAGCTGGAAAAggagagganagagctcatccggagtcagg
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : GGCCTTcggagagatgatggagctggaaaaggaaaggagaaagctcatccgaagtcaggc
OVRT1_0027_C10.b : GGCCCTCGGAagaaatgatggagctgggaaaggaaaggaaagagctcatccggagtcagg
OVRT1_0043_A12.b : GGCCTTCGGAagagatgatgganctggnaaangannagaaagagctcatccggagtccag
OVRT1_0036_A07.b : GGCCTTCGGAagagatgatgganctgggaaaggagaagagagagctcattcggagtcagg
OVRT1_0109_E10.b : CGGCCTTCGGAGAAATGATGGAACTGGAAAAgaaaggagaaagctctccggaatcggctg
OVRT1_0128_B03.b : GGCCTTCGGAAAAGATGATGGAGCTGGAAAAaggagaggagagagctcatccggagtcag
OVRT1_0074_F02.b : GNCCTTCGGA*GAGATGATGGAGCTGGAAAAGganagaaagagctcatccggagtcagct
PST01_0036_F07.b : GGCCTTCGGAAGAGATGATGGAGCTGGAAAAGGAGAGGAGAGAGCTCATCCGGAGTCAGG
20110601C-003292 : CTGTGAAAAAAATCCTGGCATCGCAGCAAAGTGGTGGAACCCTCCCCAGAAAAGACCATT
---------+---------+---------+---------+---------+---------+ 994
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : tgttgaaaaagatcctggcatcccanccaaatggtggaccctcccaggaaaaaaccatgt
OVRT1_0122_D06.b : tgtgaaaaaaaatcctggcatccccaccaaggggtggaacctccccagggaaaaacaatg
OVRT1_0039_E08.b : ctgtgaaaagaatcctggcatcgcagcaaagtgttggaacccntcccagaaaagaccatt
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : tgtgaaaaagaatcctggcatcccagcaaaatggtggacccctccccagaaaagaccatt
OVRT1_0027_C10.b : ctgtgaaaaagaatcctgccatcccagccaagtggtggacccttccccaggaaaaaacca
OVRT1_0043_A12.b : ctggtgaaaaggatcctggcatcccaccaaggtggtggaaccctccccagaaaaaaccat
OVRT1_0036_A07.b : ctgtgaaaagaatcctggcatcgcancaaagtggtgaaccctccccaggaaaagaccatt
OVRT1_0109_E10.b : tgaaaaaaatcctgcatcgcaacaaatggtggaccctccccggaaagacattagggacac
OVRT1_0128_B03.b : ggcgtgaaaaagaatctggcatcgcaccaagtggttggaccctccccaggaaaaaccttg
OVRT1_0074_F02.b : gtgaaaagaatcctggctcgcaccaagtgttggaccctccccagaaaagaccattgagag
PST01_0036_F07.b : CTGTGAAAAAAATCCTGGCATCGCAGCAAAGTGGTGGAACCCTCCCCAGAAAAGACCATT
20110601C-003292 : GNAGAGCAGCTGGACGAAGAACATCTGGAGTCGCACAAAAAGTACAAGGAGCGCAAGGAG
---------+---------+---------+---------+---------+---------+ 1054
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : agagcacctggcgaggaaattcggggtcccccaaaaatcagggaccgcaggggagagggc
OVRT1_0122_D06.b : aggagcacctggaccaggaactcttgattccccaaaaattcaggggcccaagagaggagg
OVRT1_0039_E08.b : gagagcacctggacaagaacatcttgaatcccacaaaagtccagggacgccaggaaaaga
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : ggagacaactggacaagaaattccggagtcgccaaaaaatacaaggacccagggagagaa
OVRT1_0027_C10.b : ttgaggacaactggacaaggaactctggaatccccaaaaagtacaagagcccaaggagag
OVRT1_0043_A12.b : tgaggaacaactggacaaggaaatctggagtcccccaaaatttcagggcccccagggaag
OVRT1_0036_A07.b : tgaagacactggaccaggaccatctggatcgccaaaaaatacagggacccaaggagaagg
OVRT1_0109_E10.b : cggacaagactctggatcccaaaaaagtccagaccgcaggaaggaggccaccggacattg
OVRT1_0128_B03.b : agggacccctggacaagaaactttggatcccacaaaagtacagggggcccaggagaggag
OVRT1_0074_F02.b : cactggacgaggacatctgagtgcccaaaattaaggaccccaaggaagagggccaccggg
PST01_0036_F07.b : GNAGAGCAGCTGGACGAAGAACATCTGGAGTCGCACAAAAAGTACAAGGAGCGCAAGGAG
20110601C-003292 : AGAAGGGCACAGCAGGAGCAATTGCTGATGCAGCAGCAGCAGCAACAGCA..........
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : cacccgggcatttttgtgtttatannnnnnnnanannaaagncccccacctgggcccccg
OVRT1_0122_D06.b : gcaccccagaccattgttgaggacaacacaacaaagaacaccacaccccaccgggccacc
OVRT1_0039_E08.b : gggccccccngggcaattgctgatgcnnanncnnancancananncanaacacccccacc
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : ggcccccaggaccattgtgatgcacaccncaganccacannaaancaccccccctgggcc
OVRT1_0027_C10.b : aagggccacagggacaatgttgatgcacaaccncacnnnancacancaacccccccccct
OVRT1_0043_A12.b : gggggcacccggggcctttttgttggannacnnnannnnnnnnnnnnnnccccccccccg
OVRT1_0036_A07.b : aggcccacccggagcattggtgatgggnancncannngcacngcannngaccccccaccc
OVRT1_0109_E10.b : cttagcgcncccnnngcgcggngcaccccccactggggccctgggctctcagaacttccc
OVRT1_0128_B03.b : gccacccgggacatttgtgatggaacacanannnggaggcacgggggccccaccgtggcc
OVRT1_0074_F02.b : acattgctatgggcancncacagcacgcagagcaccccacctggtgcccttgatccctga
PST01_0036_F07.b : AGAAGGGCACAGCAGGAGCAATTGCTGATgcagcagcagcagcaacagcagcagcagcag
20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : ggtcttctagaattttcctgggggaacccaaggaaaatccccgggcaaaaattttccggg
OVRT1_0122_D06.b : tggtctctggaaatttcccggtggaacccagggaactccccggaaaaaatttttggggcc
OVRT1_0039_E08.b : tgtggcacccgtggttccttcagaaccttccgggtggaggaaacccagagaacttctccg
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : ccctggttctttagaacctcccgtgtggaaacccagggaaatctccgcgacaatatttcc
OVRT1_0027_C10.b : gggccccctggtccttcgagaactcccccgtggtgaaaccaagggaaactcttcggagca
OVRT1_0043_A12.b : tggcccccctggttccttcgaaaacttcccggggttgaaaacccaggggaaactctcccg
OVRT1_0036_A07.b : tgggaccccgtttcctttgggaatttccggggatggaaacccaggaaactcctcgggaat
OVRT1_0109_E10.b : agggaaacccagggaaacccccggaaaaatttctggcgccaaattcccggggaattcgga
OVRT1_0128_B03.b : ccctggtctttggagaactctccgggggaaacccagggaaaatttccgggaaaaatatcc
OVRT1_0074_F02.b : gacctcccgtggtaaacccaagaaaaccccccggagaaatatttccgggcccaaattccc
PST01_0036_F07.b : cccacaccctgtgccacccctgcatcctctcgaagacttccagcatgactgaaacccaaa
20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : ccacatttccccggaggatttgggaaaagtccgggggaaaaccgctttcctacccctttg
OVRT1_0122_D06.b : taaaattccgcgggaaatccggaaaacgcaggggcaaaacacgccttcccaaccctttgg
OVRT1_0039_E08.b : gaaaaataatttccggggcccgaaaatttcctgtaggaaattcgggaaacttgccgggga
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : cgggccccaaattccccggagaaattctgggaaggtcggggccaaaaaccggcttcccaa
OVRT1_0027_C10.b : ataaatttcgggcccgaaacatccgcctgggaaatccggaaaacggcgggggcgagaaca
OVRT1_0043_A12.b : gacaaaaaatttttttggggcgcaaaaatttctgggag
OVRT1_0036_A07.b : aaaatttctcgggcccgaaaattcccgtgagagaattcggaaaagtgcgaggggaaaacc
OVRT1_0109_E10.b : aactcgggggaaaacccccttcccccccttaggcgggggacccaaaaaaacacccaggtt
OVRT1_0128_B03.b : cgccgcgcaaatttcccggaggaaatcggaaacggcggggggaaaccggctctccccacc
OVRT1_0074_F02.b : ataggaatccggaaagtccggggaaaccccggctttccaacccttatgccggggaaccaa
PST01_0036_F07.b : ggaagactcgtccggagcaaatagattctctggcgcccgtaaccagttcagctgatgaag
20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : gctgggggcaccaaaaacaactcaaatcttgggggctaactcccggaaaaactcggaacc
OVRT1_0122_D06.b : cggggggaccacaaaagcaacacccaagctttgggggccaaactcctccgggaaaccttg
OVRT1_0039_E08.b : aaaacccggccttctacaccctttgaggcgggggacacccaaaagccacatcaaacgttc
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : cccttaaggccgggggtcccccaaaaacacaccctcacggttttggggacttaaaactcc
OVRT1_0027_C10.b : ccggctttccccagcctcttaggcgggggggacccccaagaagccaccccccacggttct
OVRT1_0043_A12.b :
OVRT1_0036_A07.b : ggctctctaaagcctttaggccgggggaccccaaaaaaacacttccacagcttgggggcc
OVRT1_0109_E10.b : ttgggactaaactcccggaaaccccccaactcctggagggggcccctcggagagcccccc
OVRT1_0128_B03.b : cttgaggggggggacccaaagaacacctacccgttttgggggcttaaaatcttgaggaaa
OVRT1_0074_F02.b : aaaacaactccaactttttgggcctaaacttctcagaaaaacccccgaacctctgaaggg
PST01_0036_F07.b : atccagggcaacagctgcaaagggccaagtaaccaggtcttttccatcagccttcttagg
20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b : ctaagaaggggggcccggggggacccctctctttgggttttgtc
OVRT1_0122_D06.b : ccgaaaccttgggggggcgggcctctcgagagacgcgccccccccacgggaaattagccc
OVRT1_0039_E08.b : tgggggccctaaacttccggaggaaaactccccgcaacccttgagaagaggcgggctccc
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : caggaaaaccctcccgaaacctgtggagggggggcctccccagagagcccacccccccct
OVRT1_0027_C10.b : ctgggggctctaaatctctcacaagaaaaccggtccagagaactct
OVRT1_0043_A12.b :
OVRT1_0036_A07.b : taaacctccgagaaaaaacttgccaaactttaggagggggcggcttcctaaagaaacctc
OVRT1_0109_E10.b : ctcggggatatgct
OVRT1_0128_B03.b : ccccccgaaaccctggagaggggggcccccgaagaggcgcccccccctcctggagaatac
OVRT1_0074_F02.b : ggggcctcccgagacaaccccccccctgggtgt
PST01_0036_F07.b : gcctgggggcaatccctaaaagaacgtaactttccaaacgggttttggggggactctgaa
20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b :
OVRT1_0122_D06.b : ttgaacgatttttcttnnannttgggnnggaataagagagcaccggcgcannnnannnnn
OVRT1_0039_E08.b : ggagggagaccccccccctttcgtgggat
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b : ccggggggaagagccgcgcgcag
OVRT1_0027_C10.b :
OVRT1_0043_A12.b :
OVRT1_0036_A07.b :
OVRT1_0109_E10.b :
OVRT1_0128_B03.b : cccctcacaaccatattctcca
OVRT1_0074_F02.b :
PST01_0036_F07.b : aaccctgnacaagaaaaaagcactgtgccgaaaacccctctgaaaagaaggcccggcacc
20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b :
OVRT1_0122_D06.b : nnnnnnnnn
OVRT1_0039_E08.b :
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b :
OVRT1_0027_C10.b :
OVRT1_0043_A12.b :
OVRT1_0036_A07.b :
OVRT1_0109_E10.b :
OVRT1_0128_B03.b :
OVRT1_0074_F02.b :
PST01_0036_F07.b : tttcctcgaagagagctaaaaggcctaaggcccttcaagtggcgagaaaatataacggcc
20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b :
OVRT1_0122_D06.b :
OVRT1_0039_E08.b :
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b :
OVRT1_0027_C10.b :
OVRT1_0043_A12.b :
OVRT1_0036_A07.b :
OVRT1_0109_E10.b :
OVRT1_0128_B03.b :
OVRT1_0074_F02.b :
PST01_0036_F07.b : tccgtggagaaccggtgtttattttgcgttttcccaagacttgttatgtgtgcccacccc
20110601C-003292 : ............................................................
---------+---------+---------+---------+---------+---------+ 1104
OVRM1_0174_B08.b :
OVRT1_0053_A03.b :
OVRT1_0122_D06.b :
OVRT1_0039_E08.b :
OVRM1_0014_D01.b :
OVRM1_0089_A11.b :
OVRM1_0046_C03.b :
OVRT1_0002_A08.b :
OVRT1_0027_C10.b :
OVRT1_0043_A12.b :
OVRT1_0036_A07.b :
OVRT1_0109_E10.b :
OVRT1_0128_B03.b :
OVRT1_0074_F02.b :
PST01_0036_F07.b : gccctctccaa