[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-003518

Length: 1,043

Sequence [FASTA format sequence]
GACTGGGAAG CGGAAGTAGG AGTGGAGGGC GTGTTTGGCG GGGGACGCAC CTTCGCTGCA
GCGTTCCCGG TTTTGATGGT TTCTCTGCGA TGCTTCCGAG GGTCTCTGCT GTCATCCCTC
TTCGCCCCCT TTCCCGCCTC CCTCTGTGCT CCGGAGGCCC AGAGGCATCG GCGGCTGCCA
TCCTGCTGCT CGATTCTCTG CGTGGAACGG TCAGGACAGA AAATAATATC CAAAGATATT
TTGGCACTAA CAACTTGGTC TATAGCAAGA AAGATGAGCA GTCTGGTCCA ACCTGTGAGA
TTTCCAAGGA GACAGAGAGC AAAGGCAGTG TAAAGGAGAA TTCGAAAAAA GACTTGCTAA
ATATTATTAA GGGCATGAAA GTTGAATTAA GCACAGTAAA TGTACAAACT ACAAAGCCAT
CCAACAAAAG ACAACTTAAA AATTTGGAGA CTGCAATTGG CAGAATTAAA AAAGCGCCAG
AAGATACTCC GCAAAAGAGG AGTGAGTCTC TGAGCTCTGA GTTGGTGGCG GCTGTGTCTG
CTGTTGCAGA CTCTCTCCCT TTTGACAGAC GGATGACCAA GTCAGAGCTG CTCAGGCAGC
TGCAGAAGCA TGAGGAAGAC TCAAGGGCTC AGAAGGATGG AGAGAAGCCT AAAATTAGTT
TCAGTAACAT CATATCAGAT ATGAAAGTTG CCAGATCTGC CACAGCTAGA GTTAGTACAA
GACCAGTGCA TCAGATTCAG TTTGATGAAG GAACCGATGA TTTTGCTGAC CAAGAGAAGA
CTCTCAATCT TAAAAAAAGT TTTAGGAAAA ATATATTCAA GGGAAGGAGA CTTAATATTT
TTGAGCCTCA GGCAGTTACT GAAGAGGCAC CTGAAACAGA GGCAGTGCCT TCTCTTTGGG
ATATAGAATT TGCTAAGCAG TTAGCAGCAG TCACTGAACG GCCCTTTCAA AATGGTTTTG
AAGAGATGAT TCAGTGGACA AAGAAGGGGA AGTTGTGGGA GTTCCCATTT ACAACGAGCA
GGTTTTGATG ATGACGGTTC AAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMRPS3128S ribosomal protein S31, mitochondrial precursor [Homo sapiens]. 3218e-88O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMrps3128S ribosomal protein S31, mitochondrial precursor [Mus musculus]. 2787e-75O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477294PREDICTED: similar to 28S ribosomal protein S31, mitochondrial precursor (S31mt) (MRP-S31) (Imogen 38) [Canis familiaris]. 3493e-96O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMRPS3128S ribosomal protein S31, mitochondrial precursor [Bos taurus]. 391e-109O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMRPS31PREDICTED: 28S ribosomal protein S31, mitochondrial isoform 1 [Sus scrofa]. 471e-133O
Contig/Assembly ProteinMRPS31PREDICTED: 28S ribosomal protein S31, mitochondrial isoform 2 [Sus scrofa]. 454e-128O
Contig/Assembly ProteinLOC100511280PREDICTED: 28S ribosomal protein S31, mitochondrial-like isoform 2 [Sus scrofa]. 2508e-67O


Assembly Members: 12      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010036A07ADR01_0036_A07.bDB784648 
BFLT10050A01BFLT1_0050_A01.bFS643907 
BFLT10137B02BFLT1_0137_B02.bHX204634 
DCI010002G06DCI01_0002_G06.bDB790732 
HTMT10113G10HTMT1_0113_G10.bHX224182 
MLTL10086C10MLTL1_0086_C10.bFS685077 
OVRM10005A01OVRM1_0005_A01.bBP454651 
OVRM10049G09OVRM1_0049_G09.bBP153238 
OVRM10149E06OVRM1_0149_E06.bBP458867 AK236064
SPLT10004F07SPLT1_0004_F07.bHX239545 
TCH010014E12TCH01_0014_E12.bCJ023482 
UTR010023F07UTR01_0023_F07.bBP172315 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
75A400.444W-
G230.556
486A600.500WNACT/T
G330.500GCT/A


Alignment:      TOP

20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b :
ADR01_0036_A07.b :
MLTL1_0086_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
DCI01_0002_G06.b : tgtcatctattggaatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b :
TCH01_0014_E12.b :
SPLT1_0004_F07.b :
BFLT1_0050_A01.b :
20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0149_E06.b : cgttgtcxxxxxxxxxxxxxxxxxx
OVRM1_0049_G09.b : agttgacxxx
BFLT1_0137_B02.b : nnccgacagctgtcgxxxxxx
ADR01_0036_A07.b : nnnnggtg
MLTL1_0086_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0002_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_F07.b : ggggggcacxxxxxxx
OVRM1_0005_A01.b :
HTMT1_0113_G10.b :
TCH01_0014_E12.b :
SPLT1_0004_F07.b :
BFLT1_0050_A01.b :
20110601C-003518 : ...................................GACTGGGAAGCGGAAGTAGGAGTGG
---------+---------+---------+---------+---------+---------+ 25
OVRM1_0149_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTGGGAAGCGGAAGTAGGAGTGG
OVRM1_0049_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTAGGAGTGG
BFLT1_0137_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgatTAGGAGTGG
ADR01_0036_A07.b : aaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagTAGGAGTGG
MLTL1_0086_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGTGG
DCI01_0002_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGTGG
UTR01_0023_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_A01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0113_G10.b : nnttaagatggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0014_E12.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0004_F07.b : nnggggcaggtagaggccxxxxxxxxxxx
BFLT1_0050_A01.b : ggggccgtcagcgtacgxxxxxxxxxxxxxxxxxxx
20110601C-003518 : AGGGCGTGTTTGGCGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTGATGGTTTCTC
---------+---------+---------+---------+---------+---------+ 85
OVRM1_0149_E06.b : AGGGCGTGTTTGGCGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTGATGGTTTCTC
OVRM1_0049_G09.b : AGGGCGTGTTTGGCGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTGATGGTTTCTC
BFLT1_0137_B02.b : GGGGCGTGTTTGGCGGGGGACGCACCTTCGCTGCAGCGTCCCCGGTTTTAATGGTTTCTC
ADR01_0036_A07.b : AGGGCGTGTTTGGCGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTGATGGTTTCTC
MLTL1_0086_C10.b : AGGGCGTGTTTGGCGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTAATGGTTTCTC
DCI01_0002_G06.b : AGGGCGTGTTTGGCGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTGATGGTTTCTC
UTR01_0023_F07.b : xxxxxggGTTTGGCGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTAATGGTTTCTC
OVRM1_0005_A01.b : xxxxxxgtTTTGGCGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTGATGGTTTCTC
HTMT1_0113_G10.b : xxxxxxxxxxxxxxGGGGGACGCACCTTCGCTGCAGCGTTCCCGGTTTTAATGGTTTCTC
TCH01_0014_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxgCTTCGCTGCAGCGTTCCCGGTTTTGATGGTTTCTC
SPLT1_0004_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCAGCGTTCCCGGTTTTAATGGTTTCTC
BFLT1_0050_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGTTCCCGGTTTTAATGGTTTCTC
20110601C-003518 : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
---------+---------+---------+---------+---------+---------+ 145
OVRM1_0149_E06.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
OVRM1_0049_G09.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
BFLT1_0137_B02.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCTCTCTTCGCCCCCTTTCCCGCCTCCCTCT
ADR01_0036_A07.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
MLTL1_0086_C10.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
DCI01_0002_G06.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
UTR01_0023_F07.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
OVRM1_0005_A01.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
HTMT1_0113_G10.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
TCH01_0014_E12.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
SPLT1_0004_F07.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
BFLT1_0050_A01.b : TGCGATGCTTCCGAGGGTCTCTGCTGTCATCCCTCTTCGCCCCCTTTCCCGCCTCCCTCT
20110601C-003518 : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
---------+---------+---------+---------+---------+---------+ 205
OVRM1_0149_E06.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
OVRM1_0049_G09.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
BFLT1_0137_B02.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
ADR01_0036_A07.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
MLTL1_0086_C10.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
DCI01_0002_G06.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
UTR01_0023_F07.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
OVRM1_0005_A01.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
HTMT1_0113_G10.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
TCH01_0014_E12.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
SPLT1_0004_F07.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
BFLT1_0050_A01.b : GTGCTCCGGAGGCCCAGAGGCATCGGCGGCTGCCATCCTGCTGCTCGATTCTCTGCGTGG
20110601C-003518 : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
---------+---------+---------+---------+---------+---------+ 265
OVRM1_0149_E06.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
OVRM1_0049_G09.b : AACGGTCAGGACAGAAAATAATATCCNAAGATATTTTGGCACTAACAACTTGGTCTATAG
BFLT1_0137_B02.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
ADR01_0036_A07.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
MLTL1_0086_C10.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
DCI01_0002_G06.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
UTR01_0023_F07.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
OVRM1_0005_A01.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCGCTAACAACTTGGTCTATAG
HTMT1_0113_G10.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
TCH01_0014_E12.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
SPLT1_0004_F07.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
BFLT1_0050_A01.b : AACGGTCAGGACAGAAAATAATATCCAAAGATATTTTGGCACTAACAACTTGGTCTATAG
20110601C-003518 : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
---------+---------+---------+---------+---------+---------+ 325
OVRM1_0149_E06.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
OVRM1_0049_G09.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
BFLT1_0137_B02.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
ADR01_0036_A07.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
MLTL1_0086_C10.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
DCI01_0002_G06.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
UTR01_0023_F07.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGGGACGGAGAGCAAAGG
OVRM1_0005_A01.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
HTMT1_0113_G10.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
TCH01_0014_E12.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
SPLT1_0004_F07.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
BFLT1_0050_A01.b : CAAGAAAGATGAGCAGTCTGGTCCAACCTGTGAGATTTCCAAGGAGACAGAGAGCAAAGG
20110601C-003518 : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
---------+---------+---------+---------+---------+---------+ 385
OVRM1_0149_E06.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
OVRM1_0049_G09.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
BFLT1_0137_B02.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
ADR01_0036_A07.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
MLTL1_0086_C10.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
DCI01_0002_G06.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
UTR01_0023_F07.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
OVRM1_0005_A01.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
HTMT1_0113_G10.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
TCH01_0014_E12.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
SPLT1_0004_F07.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
BFLT1_0050_A01.b : CAGTGTAAAGGAGAATTCGAAAAAAGACTTGCTAAATATTATTAAGGGCATGAAAGTTGA
20110601C-003518 : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
---------+---------+---------+---------+---------+---------+ 445
OVRM1_0149_E06.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
OVRM1_0049_G09.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCCACAAAAGACAACTTAAAAATTT
BFLT1_0137_B02.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
ADR01_0036_A07.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
MLTL1_0086_C10.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
DCI01_0002_G06.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
UTR01_0023_F07.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
OVRM1_0005_A01.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
HTMT1_0113_G10.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
TCH01_0014_E12.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
SPLT1_0004_F07.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
BFLT1_0050_A01.b : ATTAAGCACAGTAAATGTACAAACTACAAAGCCATCCAACAAAAGACAACTTAAAAATTT
20110601C-003518 : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATACTCCGCAAAAGAGGAGTGA
---------+---------+---------+---------+---------+---------+ 505
OVRM1_0149_E06.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATGCTCCGCAAAAGAGGAGTGA
OVRM1_0049_G09.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATGCTCCGCANAAGAGGAGTGA
BFLT1_0137_B02.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATACTCCGCAAAAGAGGAGTGA
ADR01_0036_A07.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATGCTCCGCAAAAGAGGAGTGA
MLTL1_0086_C10.b : GGAGACTGCAATTGGCAGAATTAAAAAATCGCCAGAAGATACTCCGCAAAAGAGGTGTGA
DCI01_0002_G06.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATGCTCCGCAAAAGAGGAGTGA
UTR01_0023_F07.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATACTCCGCAAAAGAGGAGTGA
OVRM1_0005_A01.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATGCTCCGCAAAAGAGGAGTGA
HTMT1_0113_G10.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATACTCCGCAAAAGAGGAGTGA
TCH01_0014_E12.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATGCTCCGCAAAAGAGGAGTGA
SPLT1_0004_F07.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATACTCCGCAAAAGAGGAGTGA
BFLT1_0050_A01.b : GGAGACTGCAATTGGCAGAATTAAAAAAGCGCCAGAAGATACTCCGCAAAAGAGGAGTGA
20110601C-003518 : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
---------+---------+---------+---------+---------+---------+ 565
OVRM1_0149_E06.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
OVRM1_0049_G09.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
BFLT1_0137_B02.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
ADR01_0036_A07.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
MLTL1_0086_C10.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
DCI01_0002_G06.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCACACTCTCTCCCTTTTGA
UTR01_0023_F07.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
OVRM1_0005_A01.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
HTMT1_0113_G10.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
TCH01_0014_E12.b : GTCTCCGACCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
SPLT1_0004_F07.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
BFLT1_0050_A01.b : GTCTCTGAGCTCTGAGTTGGTGGCGGCTGTGTCTGCTGTTGCAGACTCTCTCCCTTTTGA
20110601C-003518 : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTGCAGAAGCATGAGGAAGACTCAAG
---------+---------+---------+---------+---------+---------+ 625
OVRM1_0149_E06.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTCCAGAAGCATGAGGAAGACTCAAG
OVRM1_0049_G09.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTCCAGAAGCATGAGGAAGACTCAAG
BFLT1_0137_B02.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTGCAGAAGCATGAGGAAGACTCAAG
ADR01_0036_A07.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTCCAGAAGCATGAGGAAGACTCAAA
MLTL1_0086_C10.b : CAGACGGATGACCAAGTCAGAGCTGCTCANGCAGCTGCAGAAGCATGAGGAAGACTCAAG
DCI01_0002_G06.b : CAGACGGATGACCAAGTCAGAGCTGCTCANGCAGCTCCAGAAGCATGAGGAAGACTCACA
UTR01_0023_F07.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTGCAGAAGCATGAGGAAGACTCAAG
OVRM1_0005_A01.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTCCAGAAGCATGAGGAAGACTCAAG
HTMT1_0113_G10.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTGCAGAAGCATGAGGAAGACTCAAG
TCH01_0014_E12.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTGCAGAAGCATGAGGAAGACTCAAG
SPLT1_0004_F07.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTGCAGAAGCATGAGGAAGACTCAAG
BFLT1_0050_A01.b : CAGACGGATGACCAAGTCAGAGCTGCTCAGGCAGCTGCAGAAGCATGAGGAAGACTCAAG
20110601C-003518 : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
---------+---------+---------+---------+---------+---------+ 685
OVRM1_0149_E06.b : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
OVRM1_0049_G09.b : GGCTCAGAAGGATGGAGAGAAGCCTAANATTAGTTTCAGTAACATCATATCAGATATGAN
BFLT1_0137_B02.b : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
ADR01_0036_A07.b : GGCTCAGAAGGATGGAGAGAAGCCTNAAATTAGTTTCAGTAACATCATATCAGATATGAA
MLTL1_0086_C10.b : GGCTCAGAAGGATGGAGAGAAGCCTAAA*TTAGTTTCAGTAACATCATATCAGATATGAA
DCI01_0002_G06.b : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
UTR01_0023_F07.b : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
OVRM1_0005_A01.b : GGCTCAGAAGGATGGAGAGAAGCCTNAAATTAGTTTCAGTAACATCATATCAGatatgaa
HTMT1_0113_G10.b : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
TCH01_0014_E12.b : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
SPLT1_0004_F07.b : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
BFLT1_0050_A01.b : GGCTCAGAAGGATGGAGAGAAGCCTAAAATTAGTTTCAGTAACATCATATCAGATATGAA
20110601C-003518 : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
---------+---------+---------+---------+---------+---------+ 745
OVRM1_0149_E06.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCAT
OVRM1_0049_G09.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACCAGACCAGTGCATCAGATTCAGCTTGA
BFLT1_0137_B02.b : AGTTGCCAGATCTGCCCCAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
ADR01_0036_A07.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
MLTL1_0086_C10.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
DCI01_0002_G06.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
UTR01_0023_F07.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
OVRM1_0005_A01.b : agttcccaggctaggggtctagtcggagctgtagtggcagcctacgccagatccacagca
HTMT1_0113_G10.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
TCH01_0014_E12.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
SPLT1_0004_F07.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
BFLT1_0050_A01.b : AGTTGCCAGATCTGCCACAGCTAGAGTTAGTACAAGACCAGTGCATCAGATTCAGTTTGA
20110601C-003518 : TGAAGGAACCGATGATTTTGCTGACCAAGAGAAGACTCTCAATCTTAAAAAAAGTTTTAG
---------+---------+---------+---------+---------+---------+ 805
OVRM1_0149_E06.b :
OVRM1_0049_G09.b : TGAAGAGACCGATGATTTTGCTGACCAAGAGAAGACTCTNCATCTTANAAAAgt
BFLT1_0137_B02.b : TGAAAGAACCGATGATTTTGCTGACCAAGAGAAGACTCTCCATTCTTAAAAAAGTTTTAG
ADR01_0036_A07.b : TGAAGGAACCGATGATTTTGCTGACCAAGAGAAGACTCTCAATCTTAAAAAAAGTTTTAG
MLTL1_0086_C10.b : TGAAGGAACCGATGATTTTGCTGACCNAGAGA*GACTCTCAATCTTAAAAAAG*TTTTAG
DCI01_0002_G06.b : TGAACGAACCTATGATTTTGCTGACCCAGAGA*GACTCTCAATCTTAAAAAAG**TTTAG
UTR01_0023_F07.b : TGAAGGAACCGATGATTTTGCTGACCAAGAGAAGACTCTCAATCTTAAAAAAAGTTTTAG
OVRM1_0005_A01.b : acacgggatccaagccacgtctgcgacctacaccatagctcatggcan
HTMT1_0113_G10.b : TGAAGGAACCGATGATTTTGCTGACCNAGAGA*GACTCTNCATCTTAAAAAAG**TTTTA
TCH01_0014_E12.b : TGAAGGAACCGATGATTTTGCTGACCAAGAGAAGACTCTCAATCTTAAAAAAAGTTTTAG
SPLT1_0004_F07.b : TGAAGGAACCGATGATTTTGCTGACCAAGAGAAGACTCTCAATCTTAAAAAA*GTTTTAG
BFLT1_0050_A01.b : TGAAGGAACCGATGATTTTGCTGACCAAGAGAAGACTCTNCATCTTAAAAAAAGTTTTAG
20110601C-003518 : GAAAAATATATTCAAGGGAAGGAGACTTAATATTTTTGAGCCTCAGGCAGTTACTGAAGA
---------+---------+---------+---------+---------+---------+ 865
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : GGAAAATtttatccaggggaaggaaacttatatttttgaagcccaggcatttctggagga
ADR01_0036_A07.b : GAAAAATATATTCAAGGGAAGGAGACNTANTATTTTTGAGCCTCAGGCAGTTACTGAAGA
MLTL1_0086_C10.b : GAAAAtatattcaaggaaagagacttatatttttgagctcangcattactngagaggcac
DCI01_0002_G06.b : GAAAAATATATTCAAGGGAAGGAGACTTTATATTTTgagcctcngccgttactgaacacg
UTR01_0023_F07.b : GAAAAATATATTCAAGGGAAGGAGACTTAATATTTTTGAGCCTCAGGCAGTTACTGAAGA
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : GGAAAATATATTCAAGGGGAGGAGACTTNATATTTTTGAGCCTCAGGCAGTTACTGAAGA
TCH01_0014_E12.b : GAAAAATATATTNCAGGGAAGGAGACTTAATATTTTTGAGCCTCAGGCAGTTACTGAAGA
SPLT1_0004_F07.b : GAAAAATATATTCAAGGGAAGGAGACTTAATATTTTTGAGCCTCAGGCAGTTACTGAAGA
BFLT1_0050_A01.b : GAAAAATATATTNCAGGGAAGGAGACTTAATATTTTTGAGCCTCAGGCAGTTACTGAAGA
20110601C-003518 : GGCACCTGAAACAGAGGCAGTGCCTTCTCTTTGGGATATAGAATTTGCTAAGCAGTTAGC
---------+---------+---------+---------+---------+---------+ 925
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : gcacctgaacagaggcagtgcctttcttttgggaattaaatttgctaaaccattagcacc
ADR01_0036_A07.b : GGCACCTGAAACAGAAGCAGTGGCTTCTCTTtgggattagaaattgctaancagttaaca
MLTL1_0086_C10.b : tgaaacagagcagtgcttctctttggattagaattgctaacactagcaacatcctgaacg
DCI01_0002_G06.b : cacctgaaacagaggcgtgccctcctcttnggaatattgatttgctaagcgttaccgcag
UTR01_0023_F07.b : GGCACCt
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : AGGCACTGAAACAGAGGCAGTGCCTTCTCcttgggatatagatttgcaagcagttagcaa
TCH01_0014_E12.b : GGCACCCTGAACAGAGGCAGTGCCTTCTCTTTGGGATATAGAATTTGCTAAGCAGTTAGC
SPLT1_0004_F07.b : GGCACCTGGAACAGAGGCAGTGCCTTCTCTTTGGGATATAGAtttgctaagcagttagca
BFLT1_0050_A01.b : GGCACCTGAAACAGAGGCAGTGCCTTCTCTTTGGGATATAGAATTTGCTAAACAGTTAGC
20110601C-003518 : AGCAGTCACTGAACGGCCCTTTCAAAATGGTTTTGAAGAGATGATTCAGTGGACAAAGAA
---------+---------+---------+---------+---------+---------+ 985
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : gttcctgacgggcctttcaaatggttttgaaaagataatcctgggacaaaaaggggattg
ADR01_0036_A07.b : gcagtccctgaacgccctttcaaaagggttttgagagaatattcatggacaaaaagggga
MLTL1_0086_C10.b : cctttcgatggttggaaaatgatcctggacaaaagggagttggggagtccaataacacag
DCI01_0002_G06.b : tcccgaaccgccctttcgaatggtttgagnaatgattcctggacaaagaggggagttgtg
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : cagtcctggaacgccccttcagattggttttgaagaaatgatttcgtggacaaaaagggg
TCH01_0014_E12.b : AGCAGTCACTGAACGGCCCTTTCAGAATGTTTTTGAAGAGATGATTCAGTGGACAAAAGA
SPLT1_0004_F07.b : gcagtcactggacggccctttcaaatggttttgaagaaatgattcagtggacaaaagagg
BFLT1_0050_A01.b : AACAGTCACTGGACGGGCCTTTCAAAATGGTTTTGAAGAGATGATTCATTGGACAAAGAA
20110601C-003518 : GGGGAAGTTGTGGGAGTTCCCATTTACAACGAGCAGGTTTTGATGATGACGGTTCAAA..
---------+---------+---------+---------+---------+---------+ 1043
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : ggggaatcccaattaacacaggcggttttgagaaaacggttaaatttcagaaattatttt
ADR01_0036_A07.b : gttgtgggaattcccatttacacgaggcaggtttgatgagagggtccaaattctgaacta
MLTL1_0086_C10.b : cagtttgaaatacgtcaaattctgaccaatttcggaaaccggcggattccaaagggcctt
DCI01_0002_G06.b : gactcccattaacacgaggcggtttgagatgacgctcaaattcacgaccttttccggaaa
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : agttggggggagtcccatttaacacgaggcaggtttgatgagacggtccaatttccggaa
TCH01_0014_E12.b : GGGGGAGTTGTGGGAGTTCCCATTAACAACGAGCAGGTTTTGATGATGACGGTTCAAAtt
SPLT1_0004_F07.b : ggaagttgtgggattccccaataacaacaaggcaggttttgatgatgacggttcaaattt
BFLT1_0050_A01.b : GGGGAAGTGTGGGGAGTTCCCATTTACAACGAagcagggtaagtctaacatccgaagtta
20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 1043
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : gggaaaacccgcgggatttccaatcgggccaattccctctttggaggggggctgtggctt
ADR01_0036_A07.b : tattctgataatactgcagatttcnaaacgaacattcgcccttctggactgggaccgggg
MLTL1_0086_C10.b : cccctcggagggggcggggcttccaacccatcttgtttacaattaccccggggttaaatt
DCI01_0002_G06.b : tacctgcgatttccaacgggcccttccccttctggactggggcgtgcctcccaacccctt
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : atttttcggggaaaacctggcgggatttcaaacagggacattcccctttgggggcggggg
TCH01_0014_E12.b : tcatgaacatattattctggataatacctgcaggatttccaaaaacagaaccaattccca
SPLT1_0004_F07.b : catgaacattaatttccggataattacctgcaggattttccaaaaaagggaccaatttcc
BFLT1_0050_A01.b : taaaattcatgattgcaatggaaccgggcaatgtcagtggtaaattccaagggggattcc
20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 1043
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : tcaaaaccttttggggttaaaaaatgaacctaggggttttaaatttttaagaaacatttt
ADR01_0036_A07.b : cttccaaacccattcgatgttacaaattgaaccttaagggttaaatttttttggaacaat
MLTL1_0086_C10.b : tttaaaaactctcgaaagggcccccttgaccaaattttcgctggatcgtccaaaatttgg
DCI01_0002_G06.b : tgagttaaaaaattaaccttggggttgaattttaggaaccgcctcggaaaaggccccccc
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : actgggcctcccaaaccccttttgagttaaccaaatttacccataggggttaaaattttt
TCH01_0014_E12.b : cttcatggaactggtgacttgtggcctttcaaaaaccttttctgaaggtttaaccaaagt
SPLT1_0004_F07.b : ccctttctggacctggtgaccttggccctttccaaaaacccatttctgaatggtaaacca
BFLT1_0050_A01.b : aattcaaacttcgggaaaaaatgtgggaggaccaaagaaaaatggccggttttttaaaaa
20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 1043
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : ttaaaaaaggctacccctgaaacaaattttcgcgggggggatttttatataaatttccta
ADR01_0036_A07.b : ttttgaaaagggtaccctcatgaaaaaaaattctccgggtgggattgttaaaaaaaattt
MLTL1_0086_C10.b : aaaaaaaaaaaggcccccccattaattgggccggagagtttattttttcacaccccannn
DCI01_0002_G06.b : taaactatatttccggcgggttcttttacaaattttccacaaaaaaaaaagcgcccccct
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : aagaaaaatccttcgaaaaagtggcccccctttagacacaaattttcaggcgttggaatt
TCH01_0014_E12.b : tgaaccct
SPLT1_0004_F07.b : agtttgaacccatgagtggtttaaaatttttttatgaaaaacaagtccttctaaaaaagg
BFLT1_0050_A01.b : aggccaaaattccctaatcccgttggttgaaagggacccaattaattatgaaaggggccc
20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 1043
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : aaaaaaaggctgtgtccggggcgccaatatataaacactccaccaaaaaaagtgtttttt
ADR01_0036_A07.b : tccaaaaaaaaaaaaggcggtcggatgggggccttaatccggggcctccacctttttagg
MLTL1_0086_C10.b : nanngaaacccnntatggggcgttgttttgttgtttt
DCI01_0002_G06.b : cattttatttggggcgcggaattttttttttgtgttatttcccacccgcgctttattgt
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : gttccaaaaaattttccacaaaaaaaaaaaaaaaaaaaccgcccgtccccttggggtggt
TCH01_0014_E12.b :
SPLT1_0004_F07.b : ggcttccccctattggaaaccaaaaatttttacccggcgttgtgaatctctttaaacaca
BFLT1_0050_A01.b : cgaggtttttaaaataaatggcgaaaggcactaaaacattttttctgtaagaggaaatat
20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 1043
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : tgtgttgaaaaaacaaatatttttgtgttaatattttggtgttatatctcttcttgctcc
ADR01_0036_A07.b : ctaggataaaacgcctt
MLTL1_0086_C10.b :
DCI01_0002_G06.b :
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : cccaaaaatttgtggaccccggggaaaatttttttgtttttttttcacaaaaaaaatttt
TCH01_0014_E12.b :
SPLT1_0004_F07.b : aaaaatttttttcccccnnnnannnnnnnaaaaannnanaannnggtccaccgggccgct
BFLT1_0050_A01.b : cgggaacctctttttttttttgggcntttcccttcagagccccagaggatgaggtcccgg
20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 1043
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : ctaaaaacaaaggcgcgccccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0036_A07.b :
MLTL1_0086_C10.b :
DCI01_0002_G06.b :
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : ttttggggggtttaaaaagggtgttctccccccccctccttttttttggangggcgagcc
TCH01_0014_E12.b :
SPLT1_0004_F07.b : tccttttggggggtgttttgccacaaaaaaatctttgtggtgtgacccacctagggcgga
BFLT1_0050_A01.b : agggttc
20110601C-003518 : ............................................................
---------+---------+---------+---------+---------+---------+ 1043
OVRM1_0149_E06.b :
OVRM1_0049_G09.b :
BFLT1_0137_B02.b : nnnnnnnnnnnnnn
ADR01_0036_A07.b :
MLTL1_0086_C10.b :
DCI01_0002_G06.b :
UTR01_0023_F07.b :
OVRM1_0005_A01.b :
HTMT1_0113_G10.b : ctctccc
TCH01_0014_E12.b :
SPLT1_0004_F07.b : aaaatatttttttt
BFLT1_0050_A01.b :