[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-006970

Length: 1,108

Sequence [FASTA format sequence]
CCTCTCCTTT CTCCCTCTCA GAACCTTCCT GCCGCCGTGT TCGGACCTCG CTGCTCCAGC
CTCCGGGGCC CGTCCCATCC TTCCAGCCTG CGACCGGGAG CAGAGAAAAC CAAAATTACT
TATCATTTTC TTGCCCCGTA CACACCTTGA GGCGAGCAAA AAGATTAGAA TAAATTTTAA
CAATGAGGGA AATCGTGCAT ATCCAGGCCG GTCAGTGTGG CAACCAGATC GGTGCCAAGT
TCTGGGAGGT GATCAGTGAT GAACATGGCA TCGACCCCAC CGGCACCTAT CATGGGGACA
GCGACCTGCA GCTGGACCGC ATCTCCGTGT ACTACAATGA AGCCACAGGT GGCAAATATG
TTCCTCGTGC TATCTTGGTG GATCTAGAAC CCGGGACTAT GGACTCTGTT CGCTCAGGTC
CTTTCGGTCA GATCTTCAGA CCAGACAACT TTGTTTTTGG TCAGTCTGGG GCAGGCAACA
ACTGGGCCAA GGGCCACTAT ACAGAAGGGG CTGAGCTGGT TGACTCAGTC CTGGATGTGG
TTCGGAAGGA GGCTGAGAGC TGTGACTGCC TTCAGGGCTT CCAGCTGACC CACTCGCTGG
GCGGTGGCAC AGGCTCTGGA ATGGGCACTT TGCTCATCAG CAAGATCCGT GAAGAATATC
CCGACCGCAT CATGAATACC TTCAGTGTCG TGCCCTCACC CAAAGTGTCT GACACCGTGG
TTGAGCCCTA CAACGCCACC CTCTCTGTCC ATCAGTTGGT GGAGAACACT GATGAGACCT
ACTGCATCGA CAATGAGGCC CTTTACGACA TCTGCTTCCG CACTCTCAAG CTGACCACGC
CAACCTATGG GGACCTGAAC CACCTTGTCT CTGCCACCAT GAGTGGTGTC ACCACCTGCC
TCCGCTTCCC TGGCCAGCTC AATGCTGACC TCCGCAAGCT GGCAGTCAAT ATGGTGCCCT
TCCCACGTCT CCACTTCTTC ATGCCCGGCT TTGCCCCTCT GACCAGCCGT GGAAGCCAGC
AGTACCGGGC CCTCACTGTG CCTGAGCTCA CCCAGCAGGT CTTCGATGCC AAGACATGAT
GGCTGCCTGT GACCCCCGCC AGGCCCGG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTUBBtubulin beta chain [Homo sapiens]. 566e-162O
Contig/Assembly ProteinTUBB2Ctubulin beta-2C chain [Homo sapiens]. 561e-160O
Contig/Assembly ProteinTUBB4tubulin beta-4 chain [Homo sapiens]. 556e-159O
Contig/Assembly ProteinTUBB2Btubulin beta-2B chain [Homo sapiens]. 555e-158O
Contig/Assembly ProteinTUBB2Atubulin beta-2A chain [Homo sapiens]. 549e-157O
Contig/Assembly ProteinTUBB3tubulin beta-3 chain isoform 1 [Homo sapiens]. 532e-152O
Contig/Assembly ProteinTUBB6tubulin beta-6 chain [Homo sapiens]. 524e-149O
Contig/Assembly ProteinTUBB8tubulin beta-8 chain isoform 1 [Homo sapiens]. 518e-147O
Contig/Assembly ProteinTUBB1tubulin beta-1 chain [Homo sapiens]. 475e-134O
Contig/Assembly ProteinTUBB3tubulin beta-3 chain isoform 2 [Homo sapiens]. 399e-112O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTubb5tubulin beta-5 chain [Mus musculus]. 566e-162O
Contig/Assembly ProteinTubb2ctubulin beta-2C chain [Mus musculus]. 561e-160O
Contig/Assembly ProteinTubb4tubulin beta-4 chain [Mus musculus]. 556e-159O
Contig/Assembly ProteinTubb2btubulin beta-2B chain [Mus musculus]. 555e-159O
Contig/Assembly ProteinTubb2atubulin beta-2A chain [Mus musculus]. 549e-157O
Contig/Assembly ProteinTubb3tubulin beta-3 chain [Mus musculus]. 532e-152O
Contig/Assembly ProteinTubb6tubulin beta-6 chain [Mus musculus]. 525e-150O
Contig/Assembly ProteinLOC100502903PREDICTED: tubulin beta-3 chain-like [Mus musculus]. 500e-142O
Contig/Assembly ProteinLOC100502903PREDICTED: tubulin beta-3 chain-like [Mus musculus]. 498e-141O
Contig/Assembly ProteinTubb1tubulin, beta 1 [Mus musculus]. 481e-136O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474830PREDICTED: similar to tubulin, beta 5 [Canis familiaris]. 566e-162O
Contig/Assembly ProteinLOC476730PREDICTED: similar to tubulin, beta 4 [Canis familiaris]. 562e-161
Contig/Assembly ProteinLOC491231PREDICTED: similar to tubulin, beta, 2 isoform 3 [Canis familiaris]. 561e-160O
Contig/Assembly ProteinLOC491231PREDICTED: similar to tubulin, beta, 2 isoform 1 [Canis familiaris]. 561e-160O
Contig/Assembly ProteinLOC478702PREDICTED: similar to tubulin, beta isoform 4 [Canis familiaris]. 555e-158O
Contig/Assembly ProteinLOC478702PREDICTED: similar to tubulin, beta isoform 1 [Canis familiaris]. 555e-158O
Contig/Assembly ProteinLOC491231PREDICTED: similar to tubulin, beta, 2 isoform 2 [Canis familiaris]. 546e-156O
Contig/Assembly ProteinLOC608025PREDICTED: similar to tubulin, beta 3 isoform 1 [Canis familiaris]. 532e-152O
Contig/Assembly ProteinLOC608025PREDICTED: similar to tubulin, beta 3 isoform 2 [Canis familiaris]. 529e-151O
Contig/Assembly ProteinLOC480213PREDICTED: similar to tubulin, beta 6 isoform 2 [Canis familiaris]. 528e-150O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTUBB2Btubulin beta-5 chain [Bos taurus]. 566e-162O
Contig/Assembly ProteinTUBB2Ctubulin beta-2C chain [Bos taurus]. 561e-160O
Contig/Assembly ProteinTUBB4tubulin beta-4 chain [Bos taurus]. 556e-159O
Contig/Assembly ProteinTUBB2Atubulin beta-2B chain [Bos taurus]. 551e-157O
Contig/Assembly ProteinLOC100295973PREDICTED: tubulin, beta 2-like [Bos taurus]. 549e-157O
Contig/Assembly ProteinLOC100295973PREDICTED: tubulin, beta 2 [Bos taurus]. 549e-157O
Contig/Assembly ProteinTUBB3tubulin beta-3 chain [Bos taurus]. 532e-152O
Contig/Assembly ProteinTUBBPREDICTED: tubulin, beta 5-like [Bos taurus]. 530e-150O
Contig/Assembly ProteinTUBBPREDICTED: tubulin, beta 5-like [Bos taurus]. 530e-150O
Contig/Assembly ProteinTUBB6tubulin beta-6 chain [Bos taurus]. 527e-150O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTUBB2Atubulin beta chain [Sus scrofa]. 566e-162O
Contig/Assembly ProteinLOC100516352PREDICTED: tubulin beta-2C chain-like [Sus scrofa]. 561e-161O
Contig/Assembly ProteinTUBB2Btubulin beta-2B chain [Sus scrofa]. 555e-159O
Contig/Assembly ProteinTUBB1tubulin beta-1 chain [Sus scrofa]. 472e-133O
Contig/Assembly ProteinLOC100620928PREDICTED: tubulin beta-3 chain-like [Sus scrofa]. 399e-112O
Contig/Assembly ProteinLOC100516780PREDICTED: far upstream element-binding protein 2-like [Sus scrofa]. 371e-104
Contig/Assembly ProteinLOC100623583PREDICTED: tubulin beta-6 chain-like, partial [Sus scrofa]. 363e-101O
Contig/Assembly ProteinLOC100624785PREDICTED: tubulin beta-2A chain-like [Sus scrofa]. 362e-114O
Contig/Assembly ProteinLOC100622742PREDICTED: tubulin beta-6 chain-like, partial [Sus scrofa]. 2446e-65O
Contig/Assembly ProteinLOC100127131PREDICTED: tubulin alpha-1C chain isoform 1 [Sus scrofa]. 2445e-65O


Assembly Members: 300      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010005B06ADR01_0005_B06.bDB781936 
ADR010040F04ADR01_0040_F04.bDB785068 
ADR010075B08ADR01_0075_B08.bDB788136 
AMP010001G04AMP01_0001_G04.bBW955048 
AMP010009F10AMP01_0009_F10.bBW955636 
AMP010037G03AMP01_0037_G03.b  
AMP010039G06AMP01_0039_G06.bBW957812 
AMP010041D04AMP01_0041_D04.bBW957916 
AMP010050H08AMP01_0050_H08.bBW958581 
AMP010059B04AMP01_0059_B04.bBW959238 
AMP010062F08AMP01_0062_F08.bBW959507 
AMP010065E02AMP01_0065_E02.bBW959708 
AMP010079F01AMP01_0079_F01.bBW960714 
AMP010086E02AMP01_0086_E02.bBW961270 
AMP010099A06AMP01_0099_A06.bBW962356 
AMP010101H07AMP01_0101_H07.bBW962610 
BFLT10022C11BFLT1_0022_C11.bFS641782 
BFLT10024G02BFLT1_0024_G02.bFS641980 
BFLT10032F04BFLT1_0032_F04.bFS642639 
BFLT10126G11BFLT1_0126_G11.bHX203913 
BFLT10152F05BFLT1_0152_F05.bHX205624 
BKFL10022F11BKFL1_0022_F11.bFS649243 
BMWN10008D04BMWN1_0008_D04.bHX206081 
BMWN10030D07BMWN1_0030_D07.bHX207414 
BMWN10045B10BMWN1_0045_B10.bHX208220 
BMWN10061E05BMWN1_0061_E05.bHX209280 
BMWN10080E03BMWN1_0080_E03.bHX210494 
BMWN10083C07BMWN1_0083_C07.bHX210676 
BMWN10088D07BMWN1_0088_D07.bHX210982 
BMWN10097B06BMWN1_0097_B06.bHX211545 
CBLT10003C10CBLT1_0003_C10.bHX211939 
CBLT10012C08CBLT1_0012_C08.bHX212645 
CBLT10012C09CBLT1_0012_C09.b  
CBLT10062H10CBLT1_0062_H10.bHX216104 
CBLT10076B05CBLT1_0076_B05.bHX217217 
CBLT10079D01CBLT1_0079_D01.bHX217459 
CLNT10070B01CLNT1_0070_B01.bFS662562 
CLNT10092D05CLNT1_0092_D05.bFS663707 
CLNT10098E03CLNT1_0098_E03.bFS664183 
CLNT10115H10CLNT1_0115_H10.bHX220353 
CLNT10133D12CLNT1_0133_D12.bHX221687 
CLNT10152A01CLNT1_0152_A01.bHX223134 
DCI010001D08DCI01_0001_D08.bDB790648 
DCI010001G08DCI01_0001_G08.bDB790674 
DCI010003A06DCI01_0003_A06.bDB790748 
DCI010003H08DCI01_0003_H08.bDB790813 
DCI010004F03DCI01_0004_F03.bDB790861 
DCI010005G06DCI01_0005_G06.bDB790943 
DCI010007G01DCI01_0007_G01.bDB791024 
DCI010008E05DCI01_0008_E05.bDB791071 
DCI010010B05DCI01_0010_B05.bDB791173 
DCI010012G09DCI01_0012_G09.bDB791403 
DCI010014C03DCI01_0014_C03.bDB791524 
DCI010015E06DCI01_0015_E06.bDB791635 
DCI010017G09DCI01_0017_G09.bDB791840 
DCI010018F12DCI01_0018_F12.bDB791924 
DCI010019C11DCI01_0019_C11.bDB791979 
DCI010019D02DCI01_0019_D02.bDB791982 
DCI010019D10DCI01_0019_D10.bDB791990 
DCI010021E06DCI01_0021_E06.bDB792178 
DCI010022H02DCI01_0022_H02.bDB792299 
DCI010022H04DCI01_0022_H04.bDB792301 
DCI010022H08DCI01_0022_H08.bDB792305 
DCI010023F11DCI01_0023_F11.bDB792374 
DCI010024E08DCI01_0024_E08.bDB792451 
DCI010024F06DCI01_0024_F06.bDB792459 
DCI010025H08DCI01_0025_H08.bDB792575 
DCI010028B06DCI01_0028_B06.bDB792774 
DCI010030B06DCI01_0030_B06.bDB792937 
DCI010031G10DCI01_0031_G10.bDB793084 
DCI010032A06DCI01_0032_A06.bDB793102 
DCI010033C11DCI01_0033_C11.bDB793221 
DCI010033F09DCI01_0033_F09.bDB793255 
DCI010033H08DCI01_0033_H08.bDB793277 
DCI010034C03DCI01_0034_C03.bDB793308 
DCI010037B11DCI01_0037_B11.bDB793576 
DCI010041A10DCI01_0041_A10.bDB793810 
DCI010041F08DCI01_0041_F08.bDB793863 
DCI010059E10DCI01_0059_E10.bDB794825 
DCI010061F05DCI01_0061_F05.bDB795015 
DCI010064H12DCI01_0064_H12.bDB795317 
DCI010072F09DCI01_0072_F09.bDB795993 
DCI010080D02DCI01_0080_D02.bDB796663 
DCI010095D05DCI01_0095_D05.bDB797998 
DCI010096C03DCI01_0096_C03.bDB798072 
DCI010107B01DCI01_0107_B01.bDB799030 
DCI010113A12DCI01_0113_A12.bDB799551 
DCI010113H11DCI01_0113_H11.bDB799627 
HTMT10002G01HTMT1_0002_G01.bFS664482 
HTMT10011H05HTMT1_0011_H05.bFS665034 
HTMT10055A12HTMT1_0055_A12.bFS668078 
HTMT10060C07HTMT1_0060_C07.bFS668463 AK392245
HTMT10104F03HTMT1_0104_F03.bHX223509 
HTMT10124A03HTMT1_0124_A03.bHX224756 
HTMT10127E07HTMT1_0127_E07.bHX224987 
ILNT10062E03ILNT1_0062_E03.bHX231672 
ITT010001D11ITT01_0001_D11.bBW976079 
ITT010007D08ITT01_0007_D08.bBW976626 
ITT010022G11ITT01_0022_G11.bBW978021 
ITT010028H07ITT01_0028_H07.bBW978574 
ITT010037D10ITT01_0037_D10.bBW979336 
ITT010050G03ITT01_0050_G03.bBW980455 
ITT010053E02ITT01_0053_E02.bBW980706 
ITT010075B02ITT01_0075_B02.b  
ITT010089B01ITT01_0089_B01.bBW983872 
ITT010090D05ITT01_0090_D05.bBW983989 
ITT010096A11ITT01_0096_A11.bBW984500 
KDN010019B05KDN01_0019_B05.bFS672601 
KDN010020D05KDN01_0020_D05.bFS672684 
KDN010025B08KDN01_0025_B08.bFS673065 
KDN010065B03KDN01_0065_B03.bFS675595 
LNG010010B07LNG01_0010_B07.bBP434474 
LNG010013F07LNG01_0013_F07.bBP438463 
LNG010024D11LNG01_0024_D11.bBP436768 
LNG010064A12LNG01_0064_A12.bBP433942 
LNG010073H04LNG01_0073_H04.bBP440257 
LVR010057E10LVR01_0057_E10.bBP445241 
LVR010058F06LVR01_0058_F06.bBP445843 
LVR010089C08LVR01_0089_C08.bCJ000537 
LVR010099D01LVR01_0099_D01.bBP443747 
LVRM10005D07LVRM1_0005_D07.bBP139139 
LVRM10007F11LVRM1_0007_F11.bBP140205 
LVRM10024A05LVRM1_0024_A05.bBP137648 
LVRM10056B04LVRM1_0056_B04.bBP138085 
LVRM10065E11LVRM1_0065_E11.bBP139760 
LVRM10081D01LVRM1_0081_D01.bCJ002448 
LVRM10098C07LVRM1_0098_C07.bBW963066 
LVRM10107A09LVRM1_0107_A09.bBP448673 
LVRM10122A06LVRM1_0122_A06.bBP448486 
LVRM10148A07LVRM1_0148_A07.bBP448574 
LVRM10153B07LVRM1_0153_B07.bBP449381 
LVRM10180B09LVRM1_0180_B09.bCJ005431 
MLN010035F10MLN01_0035_F10.bCJ010399 
MLN010078G08MLN01_0078_G08.bCJ013864 
MLTL10100H05MLTL1_0100_H05.bFS686378 
OVR010005B07OVR01_0005_B07.bBP141907 
OVR010010B08OVR01_0010_B08.bBP141949 
OVR010012D03OVR01_0012_D03.bBP142670 
OVR010013B02OVR01_0013_B02.bBP141737 
OVR010022F06OVR01_0022_F06.bBP143687 
OVR010029E11OVR01_0029_E11.bBP143420 
OVR010035G06OVR01_0035_G06.bBP144155 
OVR010037B06OVR01_0037_B06.b  
OVR010037D04OVR01_0037_D04.bBP142728 
OVR010051F02OVR01_0051_F02.bBW964174 
OVR010061B11OVR01_0061_B11.bBW965039 
OVR010062H02OVR01_0062_H02.b  
OVR010071F08OVR01_0071_F08.bBW965970 
OVR010072D07OVR01_0072_D07.bBW966036 
OVR010075C04OVR01_0075_C04.bBW966279 
OVR010082E12OVR01_0082_E12.bBW966825 
OVR010083H11OVR01_0083_H11.bBW966887 
OVR010087C02OVR01_0087_C02.bBW967150 
OVR010095A09OVR01_0095_A09.bBW967727 
OVR010100A02OVR01_0100_A02.bBW968114 
OVRM10003F11OVRM1_0003_F11.bBP152176 
OVRM10008A06OVRM1_0008_A06.bBP145366 
OVRM10014A05OVRM1_0014_A05.bBP145262 
OVRM10014B04OVRM1_0014_B04.bBP146452 
OVRM10014B12OVRM1_0014_B12.bBP147310 
OVRM10022B03OVRM1_0022_B03.bBP146351 
OVRM10022G09OVRM1_0022_G09.bBP153224 
OVRM10023E12OVRM1_0023_E12.bBP459325 
OVRM10033A07OVRM1_0033_A07.bBP145491 
OVRM10040H07OVRM1_0040_H07.bBP461826 
OVRM10043A12OVRM1_0043_A12.bBP455486 
OVRM10048C07OVRM1_0048_C07.bBP457020 
OVRM10050B05OVRM1_0050_B05.bBP146577 
OVRM10050C01OVRM1_0050_C01.bBP147422 
OVRM10057D11OVRM1_0057_D11.bBP149740 
OVRM10058H04OVRM1_0058_H04.bBP154029 
OVRM10064G04OVRM1_0064_G04.bBP152709 
OVRM10066B11OVRM1_0066_B11.bBP147238 
OVRM10073D04OVRM1_0073_D04.bBP149009 
OVRM10075A10OVRM1_0075_A10.bBP145847 
OVRM10078F07OVRM1_0078_F07.bBP151802 
OVRM10079A03OVRM1_0079_A03.bBP145092 
OVRM10087F04OVRM1_0087_F04.bBP151501 
OVRM10088F07OVRM1_0088_F07.bBP151810 
OVRM10091G01OVRM1_0091_G01.bBP152440 
OVRM10100F04OVRM1_0100_F04.bBP151512 
OVRM10101A11OVRM1_0101_A11.bBP145989 
OVRM10113A12OVRM1_0113_A12.bBP146110 
OVRM10114A03OVRM1_0114_A03.bBP145124 
OVRM10119A07OVRM1_0119_A07.bBP145562 
OVRM10121B10OVRM1_0121_B10.bBP147176 
OVRM10125H11OVRM1_0125_H11.bBP154869 
OVRM10126G08OVRM1_0126_G08.bBP153197 
OVRM10134G08OVRM1_0134_G08.bBP153205 
OVRM10137E01OVRM1_0137_E01.bBP150013 
OVRM10148F02OVRM1_0148_F02.bBP459495 
OVRM10151B07OVRM1_0151_B07.bBP456070 
OVRM10154A11OVRM1_0154_A11.bBP455418 
OVRM10154B02OVRM1_0154_B02.bBP455651 
OVRM10168G07OVRM1_0168_G07.bBP460921 
OVRM10173E03OVRM1_0173_E03.bBP458647 
OVRM10200C08OVRM1_0200_C08.bBP457145 
OVRM10201C09OVRM1_0201_C09.bBP457221 
OVRM10202F04OVRM1_0202_F04.bBP459708 
OVRM10207F07OVRM1_0207_F07.bBP459961 
OVRM10210C06OVRM1_0210_C06.bBP456994 
OVRT10018E06OVRT1_0018_E06.bFS687877 
OVRT10021C12OVRT1_0021_C12.bFS688100 
OVRT10036B04OVRT1_0036_B04.bFS689309 
OVRT10039G06OVRT1_0039_G06.bFS689612 
OVRT10050C12OVRT1_0050_C12.bFS690483 
OVRT10055G10OVRT1_0055_G10.bFS690924 
OVRT10063H07OVRT1_0063_H07.bFS691597 
OVRT10076D12OVRT1_0076_D12.bFS692602 
OVRT10079G08OVRT1_0079_G08.bFS692878 
OVRT10085H04OVRT1_0085_H04.bFS693366 
OVRT10085H09OVRT1_0085_H09.bFS693370 
OVRT10106C11OVRT1_0106_C11.bHX235268 
OVRT10111H02OVRT1_0111_H02.bHX235729 
OVRT10122G06OVRT1_0122_G06.bHX236618 
OVRT10127H05OVRT1_0127_H05.bHX237014 
OVRT10133B01OVRT1_0133_B01.bHX237432 
OVRT10140A08OVRT1_0140_A08.bHX237995 
OVRT10143A01OVRT1_0143_A01.bHX238235 
PBL010002E05PBL01_0002_E05.bBP155884 
PBL010066F03PBL01_0066_F03.bBW972109 
PBL010081A05PBL01_0081_A05.bBW973328 
PBL010093B05PBL01_0093_B05.bBW974356 
PCT010036A09PCT01_0036_A09.bFS697001 
PST010003D02PST01_0003_D02.bFS697230 
PST010041F01PST01_0041_F01.bFS700062 
PST010057H03PST01_0057_H03.bFS701374 
PST010062H09PST01_0062_H09.bFS701778 
PST010065H05PST01_0065_H05.bFS702008 
PST010074C01PST01_0074_C01.bFS702644 
PST010079A05PST01_0079_A05.bFS703041 
PST010080E09PST01_0080_E09.bFS703168 
PST010095G01PST01_0095_G01.bFS704371 
PTG010021H10PTG01_0021_H10.bFS706288 
PTG010041H03PTG01_0041_H03.bFS708065 
PTG010044B11PTG01_0044_B11.bFS708274 
PTG010048D01PTG01_0048_D01.bFS708641 
SKNB10004H11SKNB1_0004_H11.bDB800332 
SKNB10043D07SKNB1_0043_D07.bDB802408 
SKNB10049A05SKNB1_0049_A05.bDB802801 
SMG010002H05SMG01_0002_H05.bFS713642 
SMG010067D06SMG01_0067_D06.bFS719056 
SPL010009H09SPL01_0009_H09.bBP159266 
SPL010019G11SPL01_0019_G11.bBP158999 
SPL010029F02SPL01_0029_F02.bCJ016258 
SPL010032H03SPL01_0032_H03.bCJ016554 
SPL010039D01SPL01_0039_D01.bBP157691 
SPL010048A11SPL01_0048_A11.bCJ017309 
SPL010061C04SPL01_0061_C04.bCJ018486 
SPL010063B06SPL01_0063_B06.bCJ018663 
SPL010102C09SPL01_0102_C09.bCJ022169 
SPLT10035A10SPLT1_0035_A10.bHX241881 
SPLT10059E12SPLT1_0059_E12.bHX243786 
SPLT10062G07SPLT1_0062_G07.bHX244033 
SPLT10066G07SPLT1_0066_G07.bHX244353 
TCH010036C07TCH01_0036_C07.bCJ025103 
TCH010041A04TCH01_0041_A04.bCJ025466 
TCH010051G03TCH01_0051_G03.bBW975796 
TES010001H09TES01_0001_H09.bCJ030085 
TES010006H08TES01_0006_H08.bCJ030424 
TES010016C07TES01_0016_C07.bCJ031069 
TES010021E09TES01_0021_E09.bCJ031416 
TES010022G07TES01_0022_G07.b  
TES010051B04TES01_0051_B04.bCJ033242 
TES010099C11TES01_0099_C11.bCJ036474 
TES010112H12TES01_0112_H12.bCJ037435 
THY010007A03THY01_0007_A03.bBP159567 
THY010016H05THY01_0016_H05.bBP168536 
THY010037D02THY01_0037_D02.bBP163214 
THY010041G12THY01_0041_G12.bBP168020 
THY010044H01THY01_0044_H01.bBP168129 
THY010046B05THY01_0046_B05.bBP161029 
THY010049C02THY01_0049_C02.bBP161977 
THY010050A12THY01_0050_A12.bBP160515 
THY010061G10THY01_0061_G10.bBP167831 
THY010062D09THY01_0062_D09.bBP163953 
THY010062H07THY01_0062_H07.bBP168793 
THY010063A06THY01_0063_A06.bBP159922 
THY010064F10THY01_0064_F10.bBP166565 
THY010070B01THY01_0070_B01.bBP160633 
THY010071H09THY01_0071_H09.bBP169017 
THY010072D05THY01_0072_D05.bBP163553 
THY010072D11THY01_0072_D11.bBP164171 
THY010086D10THY01_0086_D10.bBP164066 
THY010105C06THY01_0105_C06.bBP162426 
THY010107G09THY01_0107_G09.bBP167759 
THY010108F04THY01_0108_F04.bBP165991 
THY010118A11THY01_0118_A11.bBP160460 
THY010118B05THY01_0118_B05.bBP161084 
THY010119D04THY01_0119_D04.bBP163482 
THY010119F11THY01_0119_F11.bBP166706 
THY010120B01THY01_0120_B01.bBP160666 
THY010126C10THY01_0126_C10.bBP162863 
THY010207G03THY01_0207_G03.bBP462620 
UTR010009F10UTR01_0009_F10.bBP172431 
UTR010012F06UTR01_0012_F06.bBP172259 
UTR010038D07UTR01_0038_D07.bBP171267 
UTR010060F12UTR01_0060_F12.bBP464382 
UTR010080B05UTR01_0080_B05.bBP463080 
UTR010087C06UTR01_0087_C06.bCJ038015 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
110A13800.489WNAAA/K
C89550.511AAC/N
392C156560.731WNCCG/P
T7800.269CTG/L


Alignment:      TOP

20110601C-006970 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVR01_0051_F02.b :
THY01_0044_H01.b :
BFLT1_0126_G11.b :
DCI01_0001_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxx
OVR01_0062_H02.b :
OVR01_0072_D07.b :
PST01_0041_F01.b :
DCI01_0034_C03.b : nnnnccgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_A01.b :
OVRT1_0140_A08.b :
TES01_0001_H09.b :
BFLT1_0152_F05.b :
LVRM1_0056_B04.b :
BMWN1_0045_B10.b :
LNG01_0010_B07.b :
PTG01_0048_D01.b :
OVRM1_0003_F11.b :
OVRM1_0014_B04.b :
UTR01_0012_F06.b :
OVR01_0022_F06.b :
TCH01_0051_G03.b :
OVRT1_0106_C11.b :
OVRT1_0079_G08.b :
OVR01_0029_E11.b :
ITT01_0090_D05.b :
OVR01_0035_G06.b : tctttttttttttttttc
LVRM1_0098_C07.b :
OVRM1_0079_A03.b :
THY01_0007_A03.b :
PST01_0003_D02.b :
PST01_0057_H03.b :
OVRM1_0066_B11.b :
OVR01_0083_H11.b :
DCI01_0018_F12.b : nnttaagatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0041_H03.b :
BMWN1_0097_B06.b :
DCI01_0021_E06.b : nnaaactatcttggggctxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_F03.b :
HTMT1_0055_A12.b :
OVRT1_0111_H02.b :
BMWN1_0088_D07.b :
DCI01_0024_E08.b : nnnaactatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_A06.b :
OVRM1_0043_A12.b :
DCI01_0022_H08.b : nttaatatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_H02.b : nttaatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_H07.b : gtggctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0071_H09.b : tt
CLNT1_0115_H10.b :
OVRM1_0154_A11.b :
OVRM1_0202_F04.b :
OVRM1_0008_A06.b :
OVRM1_0119_A07.b :
OVRT1_0063_H07.b :
SPL01_0032_H03.b :
OVR01_0037_B06.b :
TES01_0006_H08.b :
CLNT1_0092_D05.b :
LNG01_0013_F07.b :
DCI01_0037_B11.b : nnnaaggtaccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_G04.b : tatgtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0200_C08.b :
OVRM1_0033_A07.b :
SPL01_0029_F02.b :
DCI01_0025_H08.b : nnttacgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_H08.b : nnnaaacgatactaxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0022_G07.b :
DCI01_0017_G09.b : nnnaagtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0004_H11.b :
SPLT1_0062_G07.b :
ADR01_0040_F04.b :
HTMT1_0060_C07.b :
DCI01_0003_H08.b : atctctatggcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0037_D10.b :
ITT01_0075_B02.b :
BMWN1_0083_C07.b :
ITT01_0050_G03.b :
LVR01_0057_E10.b :
THY01_0062_H07.b :
CBLT1_0079_D01.b :
SPL01_0063_B06.b :
OVRT1_0021_C12.b :
DCI01_0041_F08.b : nnnnggtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0003_A06.b : tactctatggcatctcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0126_C10.b :
HTMT1_0124_A03.b :
BMWN1_0008_D04.b : nnggatagagag
CBLT1_0012_C08.b :
OVRM1_0148_F02.b :
SPLT1_0059_E12.b :
BMWN1_0061_E05.b :
ILNT1_0062_E03.b :
SPLT1_0066_G07.b :
BMWN1_0030_D07.b :
CLNT1_0133_D12.b :
DCI01_0041_A10.b : nnnnggatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0127_E07.b :
AMP01_0039_G06.b : nnnggatatatatagggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_G10.b :
DCI01_0032_A06.b : nnaaaaggtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0062_H10.b :
DCI01_0096_C03.b : nnnnccgatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0003_C10.b :
DCI01_0113_A12.b : nnnnggtctaaananatcgatatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_C07.b :
OVRM1_0040_H07.b :
OVRM1_0173_E03.b :
THY01_0118_B05.b :
THY01_0108_F04.b :
THY01_0118_A11.b :
LVRM1_0005_D07.b :
DCI01_0059_E10.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_B09.b :
DCI01_0028_B06.b : nnnaaactaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_A05.b :
OVR01_0075_C04.b :
OVRM1_0114_A03.b :
OVRM1_0137_E01.b :
OVRM1_0154_B02.b :
LVRM1_0065_E11.b :
OVRM1_0151_B07.b :
LVRM1_0153_B07.b :
OVRM1_0058_H04.b :
OVRM1_0126_G08.b :
OVRM1_0125_H11.b :
OVRM1_0014_A05.b :
OVRM1_0050_C01.b :
OVRM1_0168_G07.b :
OVRM1_0121_B10.b :
THY01_0050_A12.b :
DCI01_0022_H04.b : nnnaactaacatxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0070_B01.b :
OVRM1_0022_G09.b :
DCI01_0033_F09.b : nnnttacatactaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_D10.b : nnnttagatacatxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_D02.b : nnnaactaatctaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0024_F06.b : nnttactaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0071_F08.b :
THY01_0046_B05.b :
DCI01_0019_C11.b : nnnaacgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0073_H04.b :
DCI01_0014_C03.b : nnaagtaacttxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_G10.b : nnnnacatacttaxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_F11.b : nnnaaactaactaaxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_A06.b : ggggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_C11.b : nnnnaccgatactaxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_D07.b :
OVR01_0061_B11.b :
PTG01_0021_H10.b :
CLNT1_0152_A01.b :
AMP01_0065_E02.b : tagcgaatcttxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_B04.b :
ITT01_0096_A11.b :
ITT01_0022_G11.b :
PST01_0074_C01.b :
DCI01_0015_E06.b : nnttacatacttxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_B07.b :
DCI01_0012_G09.b : nnnaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0055_G10.b :
ITT01_0089_B01.b :
BKFL1_0022_F11.b : nnnncccttatnnnnnaacgatacntatgggctxxxxxxxxxxxxxxxxxxx
SMG01_0067_D06.b :
DCI01_0005_G06.b : ntttctatctatagggctgctcgcgcgccgxxxxxxx
DCI01_0010_B05.b : tctatancgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0086_D10.b :
OVRT1_0050_C12.b :
ITT01_0053_E02.b :
MLTL1_0100_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxx
DCI01_0001_D08.b : tactctataggggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_F12.b :
DCI01_0004_F03.b : atctctatgggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0036_C07.b :
DCI01_0095_D05.b : nnnnnggatactatagggctxxxxxxxxxxxxxxxxxxxx
OVR01_0037_D04.b :
THY01_0207_G03.b :
LVR01_0099_D01.b :
LVR01_0058_F06.b :
THY01_0037_D02.b :
ITT01_0001_D11.b :
UTR01_0087_C06.b :
AMP01_0050_H08.b : nnttgtaatntttagggtattttxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_G11.b :
DCI01_0072_F09.b : nnnaaaactaccatggggctgctcxxxxxxxxxxxxxxx
AMP01_0079_F01.b : acctataggggatactatxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_D03.b :
THY01_0072_D05.b :
DCI01_0064_H12.b : nnttaatatctaccttxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_E02.b : nggtatcttxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
DCI01_0061_F05.b : nnnnttggtaccatxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxx
DCI01_0080_D02.b : ncccgaaannnnnccgatactatagggctxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_D11.b :
OVRT1_0127_H05.b :
OVR01_0013_B02.b :
THY01_0072_D11.b :
LVRM1_0081_D01.b :
OVRM1_0073_D04.b :
OVRT1_0039_G06.b :
PBL01_0002_E05.b :
THY01_0119_F11.b :
OVRM1_0210_C06.b :
LVRM1_0007_F11.b :
DCI01_0030_B06.b : nnaagtatcttxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0085_H09.b :
SPL01_0061_C04.b :
OVRT1_0085_H04.b :
OVR01_0010_B08.b :
THY01_0107_G09.b :
THY01_0119_D04.b :
SPL01_0039_D01.b :
AMP01_0037_G03.b : nngggatatctatagcgatacttxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_E05.b : ttatagggtacttxxxxxxxxxxxxxxxxxxxxxxx
THY01_0120_B01.b :
LVRM1_0107_A09.b :
OVRM1_0087_F04.b :
OVRM1_0091_G01.b :
OVRM1_0100_F04.b :
OVRM1_0014_B12.b :
OVRM1_0201_C09.b :
OVRM1_0022_B03.b :
THY01_0041_G12.b :
UTR01_0009_F10.b :
PTG01_0044_B11.b :
SPL01_0009_H09.b :
BFLT1_0024_G02.b :
THY01_0062_D09.b :
OVRT1_0122_G06.b :
OVRT1_0133_B01.b :
SPL01_0102_C09.b :
LVR01_0089_C08.b :
THY01_0064_F10.b :
MLN01_0035_F10.b :
PBL01_0081_A05.b :
LNG01_0064_A12.b :
OVR01_0100_A02.b :
OVRT1_0076_D12.b :
PBL01_0066_F03.b :
THY01_0063_A06.b :
SPLT1_0035_A10.b :
TES01_0051_B04.b :
TES01_0112_H12.b :
TES01_0016_C07.b :
TES01_0021_E09.b :
PCT01_0036_A09.b :
PST01_0062_H09.b :
PST01_0079_A05.b :
PST01_0080_E09.b :
PST01_0065_H05.b :
PST01_0095_G01.b :
KDN01_0065_B03.b :
HTMT1_0011_H05.b :
DCI01_0007_G01.b : ttttagggatcttxxxxxxxxxxxxxxxxxx
AMP01_0041_D04.b : nngggagannttaagggatacttxxxxxxxxxxxxxxxxxx
BFLT1_0032_F04.b :
OVRT1_0018_E06.b :
ADR01_0075_B08.b :
OVRM1_0064_G04.b :
KDN01_0019_B05.b :
CLNT1_0098_E03.b :
KDN01_0020_D05.b :
KDN01_0025_B08.b :
PBL01_0093_B05.b :
SKNB1_0043_D07.b :
TCH01_0041_A04.b :
MLN01_0078_G08.b :
OVR01_0087_C02.b :
LVRM1_0148_A07.b :
OVRM1_0113_A12.b :
CBLT1_0012_C09.b :
SKNB1_0049_A05.b :
OVRM1_0075_A10.b :
OVRM1_0078_F07.b :
OVRM1_0101_A11.b :
BFLT1_0022_C11.b :
OVR01_0095_A09.b :
CLNT1_0070_B01.b :
ITT01_0028_H07.b :
CBLT1_0076_B05.b :
ITT01_0007_D08.b :
TES01_0099_C11.b :
BMWN1_0080_E03.b :
DCI01_0113_H11.b : nnnntttcttaaaanacgtacca
OVRM1_0134_G08.b :
OVRM1_0050_B05.b :
SPL01_0048_A11.b :
UTR01_0080_B05.b :
LNG01_0024_D11.b :
HTMT1_0002_G01.b :
ADR01_0005_B06.b :
THY01_0105_C06.b :
OVRM1_0023_E12.b :
OVR01_0082_E12.b :
AMP01_0009_F10.b :
OVRM1_0088_F07.b :
OVRM1_0207_F07.b :
THY01_0049_C02.b :
SMG01_0002_H05.b :
DCI01_0107_B01.b :
THY01_0016_H05.b :
20110601C-006970 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVR01_0051_F02.b : nnnnggcatggactaagacxxxxxxxxxxxxxxx
THY01_0044_H01.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0126_G11.b : nnnntacgacagcggacgxxxxxxx
DCI01_0001_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0062_H02.b : nnnntagctagtactaaaacxxxxxxxxxxxx
OVR01_0072_D07.b : nnnggcttggactataacxxxxxxxxxxxx
PST01_0041_F01.b :
DCI01_0034_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_A01.b : nnncccttcnnnnnnnnncccgttagcgcaggxxxx
OVRT1_0140_A08.b : nnngggcttctttnnnnnncccgttagcgnaggagtgxx
TES01_0001_H09.b :
BFLT1_0152_F05.b : nnnccgttagcgnacgxxxxx
LVRM1_0056_B04.b : caatgtcxx
BMWN1_0045_B10.b : nnnnggca
LNG01_0010_B07.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0048_D01.b : nnnggctttttatnn
OVRM1_0003_F11.b : xxxxxxxxxxx
OVRM1_0014_B04.b : xxxxxxxxxxx
UTR01_0012_F06.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0022_F06.b : atgggggggacctagtagxxxxxxxxxxxxxx
TCH01_0051_G03.b : cgcttggactatgacxxxxx
OVRT1_0106_C11.b : nnnccgtcagcggaggxx
OVRT1_0079_G08.b : nnnttcctattgcgnacgxx
OVR01_0029_E11.b : ggggaattagggtgxxxxxxxxxxxxxxxxxxxxx
ITT01_0090_D05.b : nnn
OVR01_0035_G06.b : tttttttttttttttttttttttttttttttttttcctataggactattacxxxxxxxxx
LVRM1_0098_C07.b : tagttgtc
OVRM1_0079_A03.b : cgttgx
THY01_0007_A03.b :
PST01_0003_D02.b :
PST01_0057_H03.b :
OVRM1_0066_B11.b : agttgt
OVR01_0083_H11.b : ngatagtgatatnacxxx
DCI01_0018_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0041_H03.b : tttn
BMWN1_0097_B06.b : nnnng
DCI01_0021_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_F03.b : nnngg
HTMT1_0055_A12.b : ttttnggat
OVRT1_0111_H02.b : ntttcccgtcagcgnac
BMWN1_0088_D07.b : nnn
DCI01_0024_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_A06.b : tagt
OVRM1_0043_A12.b : agt
DCI01_0022_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0071_H09.b : ggggtggacctactagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0115_H10.b : nnncccgtcagctga
OVRM1_0154_A11.b :
OVRM1_0202_F04.b : nagttgtcxxxxxx
OVRM1_0008_A06.b : cxx
OVRM1_0119_A07.b : nagtt
OVRT1_0063_H07.b : nccgttannnggncctccgtcgc
SPL01_0032_H03.b : nnnnaagcattggacttnac
OVR01_0037_B06.b : aggcattttggggaactaxxxxxxxxx
TES01_0006_H08.b :
CLNT1_0092_D05.b : ggttttttnnggggcccgttagc
LNG01_0013_F07.b : xxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0200_C08.b : a
OVRM1_0033_A07.b : cxxxx
SPL01_0029_F02.b : nnnnggttggacttgacxx
DCI01_0025_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0022_G07.b :
DCI01_0017_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0004_H11.b :
SPLT1_0062_G07.b : nn
ADR01_0040_F04.b :
HTMT1_0060_C07.b : ttt
DCI01_0003_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0037_D10.b :
ITT01_0075_B02.b :
BMWN1_0083_C07.b : nnnttagcagagtag
ITT01_0050_G03.b :
LVR01_0057_E10.b : ccattttttggtgxxxxxxxxxx
THY01_0062_H07.b : ttgxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0079_D01.b : ttt
SPL01_0063_B06.b : ntttttttnnacttaannnnnggcttggactaaaacxxxxx
OVRT1_0021_C12.b : gttatccgttagcg
DCI01_0041_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0003_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0126_C10.b :
HTMT1_0124_A03.b : ncccataaatcatatttn
BMWN1_0008_D04.b : gcggagtgttatagccccctttttggagtttnnnnnnnnnattttnntttnccgaggtxx
CBLT1_0012_C08.b :
OVRM1_0148_F02.b : tca
SPLT1_0059_E12.b :
BMWN1_0061_E05.b : n
ILNT1_0062_E03.b :
SPLT1_0066_G07.b : n
BMWN1_0030_D07.b : t
CLNT1_0133_D12.b : nttttcgttag
DCI01_0041_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0127_E07.b :
AMP01_0039_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_G10.b : ggggcacxxxxxxxxxxxxxxxx
DCI01_0032_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0062_H10.b : n
DCI01_0096_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0003_C10.b : ttt
DCI01_0113_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_C07.b : g
OVRM1_0040_H07.b : n
OVRM1_0173_E03.b : ca
THY01_0118_B05.b :
THY01_0108_F04.b : ngtgtx
THY01_0118_A11.b :
LVRM1_0005_D07.b : cxxx
DCI01_0059_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_B09.b :
DCI01_0028_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_A05.b :
OVR01_0075_C04.b : agctaxxxxxxxxxxxxxxxxxxx
OVRM1_0114_A03.b : c
OVRM1_0137_E01.b :
OVRM1_0154_B02.b :
LVRM1_0065_E11.b : xxx
OVRM1_0151_B07.b :
LVRM1_0153_B07.b :
OVRM1_0058_H04.b :
OVRM1_0126_G08.b :
OVRM1_0125_H11.b :
OVRM1_0014_A05.b : xxx
OVRM1_0050_C01.b :
OVRM1_0168_G07.b :
OVRM1_0121_B10.b :
THY01_0050_A12.b : ggccattacgtgxxxxxxxxxxxxx
DCI01_0022_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0070_B01.b : gcatcxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_G09.b : cxxx
DCI01_0033_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0024_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0071_F08.b : nnggctaggactatgac
THY01_0046_B05.b : ttttttxxxxxxxxxxxxxxxxxx
DCI01_0019_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0073_H04.b : aattngggatggac
DCI01_0014_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_D07.b : ggtggaacatatxxxxxxxxxx
OVR01_0061_B11.b : nnccggcttggactataacxx
PTG01_0021_H10.b : nngggtttn
CLNT1_0152_A01.b : nnnnnccgtcag
AMP01_0065_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_B04.b : nnnnccgttag
ITT01_0096_A11.b :
ITT01_0022_G11.b : nnnggagtaagaxxxx
PST01_0074_C01.b :
DCI01_0015_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_B07.b : agggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0055_G10.b : nnngggctnnnnnnncctccgttag
ITT01_0089_B01.b :
BKFL1_0022_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0067_D06.b :
DCI01_0005_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0086_D10.b : tttggctgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_C12.b : nnncccttttnngggnnccgtcacgc
ITT01_0053_E02.b :
MLTL1_0100_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_F12.b : gccxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0004_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0036_C07.b : nntttcgtaggacatgacx
DCI01_0095_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0037_D04.b : gggaattttggggxxxxxxxxxxxxxx
THY01_0207_G03.b : ctttttggatgxxxxxxxxxxxxx
LVR01_0099_D01.b : gggcaxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_F06.b : cxxxxxxxxxxxxxxxxxxxxxxx
THY01_0037_D02.b : tgxxxxxxxxxxxxxxxxxxx
ITT01_0001_D11.b :
UTR01_0087_C06.b : nnnggcttggactataacx
AMP01_0050_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_G11.b : cxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_D03.b : cgaaaaattgcacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0072_D05.b : axxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_D11.b :
OVRT1_0127_H05.b : nnncctatag
OVR01_0013_B02.b : gggcxxxxxxxxxxxxxxxxxxxxxx
THY01_0072_D11.b : gcattttgggtgxxxxxxxxxxxxxx
LVRM1_0081_D01.b :
OVRM1_0073_D04.b :
OVRT1_0039_G06.b : nnnnccg
PBL01_0002_E05.b : aaaaaa
THY01_0119_F11.b :
OVRM1_0210_C06.b :
LVRM1_0007_F11.b :
DCI01_0030_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0085_H09.b : nnnnggtcnnnnnngnnncctat
SPL01_0061_C04.b : nttggcttggactataac
OVRT1_0085_H04.b : nnnccctttnnnnnnnccgt
OVR01_0010_B08.b : cccctcccaaatggacanaccgggctttatgggtgcctcacg
THY01_0107_G09.b :
THY01_0119_D04.b : g
SPL01_0039_D01.b : gggggcattatggtgxxxxxx
AMP01_0037_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0120_B01.b :
LVRM1_0107_A09.b :
OVRM1_0087_F04.b :
OVRM1_0091_G01.b :
OVRM1_0100_F04.b :
OVRM1_0014_B12.b :
OVRM1_0201_C09.b :
OVRM1_0022_B03.b :
THY01_0041_G12.b : ctxxxxxxxxxxxxxxxxxx
UTR01_0009_F10.b : catttagtggactatxxxxx
PTG01_0044_B11.b :
SPL01_0009_H09.b : ttttttggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0024_G02.b : gaatacg
THY01_0062_D09.b : xxxxxxxxxxxxxxxx
OVRT1_0122_G06.b : nnnncc
OVRT1_0133_B01.b : nnnaacttactnnnnnnnncc
SPL01_0102_C09.b : nnnnggctaggacta
LVR01_0089_C08.b : cxxxxxxxxxxxxxxxxxxx
THY01_0064_F10.b : tgggggxxxxxxxxxxx
MLN01_0035_F10.b : nnggctaggac
PBL01_0081_A05.b :
LNG01_0064_A12.b : ttttggcttggactt
OVR01_0100_A02.b : nnnggcttggacta
OVRT1_0076_D12.b : nggatccg
PBL01_0066_F03.b :
THY01_0063_A06.b : actxxxxxxxxxxxxxxxx
SPLT1_0035_A10.b :
TES01_0051_B04.b :
TES01_0112_H12.b :
TES01_0016_C07.b :
TES01_0021_E09.b :
PCT01_0036_A09.b :
PST01_0062_H09.b :
PST01_0079_A05.b :
PST01_0080_E09.b :
PST01_0065_H05.b :
PST01_0095_G01.b :
KDN01_0065_B03.b :
HTMT1_0011_H05.b :
DCI01_0007_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0041_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0032_F04.b : gga
OVRT1_0018_E06.b : nnnn
ADR01_0075_B08.b :
OVRM1_0064_G04.b :
KDN01_0019_B05.b :
CLNT1_0098_E03.b : nnaatcc
KDN01_0020_D05.b :
KDN01_0025_B08.b :
PBL01_0093_B05.b :
SKNB1_0043_D07.b :
TCH01_0041_A04.b : nnnngggtagg
MLN01_0078_G08.b : nnggctag
OVR01_0087_C02.b : nnnnggcta
LVRM1_0148_A07.b :
OVRM1_0113_A12.b :
CBLT1_0012_C09.b : ttttt
SKNB1_0049_A05.b :
OVRM1_0075_A10.b :
OVRM1_0078_F07.b :
OVRM1_0101_A11.b :
BFLT1_0022_C11.b :
OVR01_0095_A09.b :
CLNT1_0070_B01.b :
ITT01_0028_H07.b :
CBLT1_0076_B05.b :
ITT01_0007_D08.b :
TES01_0099_C11.b :
BMWN1_0080_E03.b :
DCI01_0113_H11.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0134_G08.b :
OVRM1_0050_B05.b :
SPL01_0048_A11.b :
UTR01_0080_B05.b :
LNG01_0024_D11.b :
HTMT1_0002_G01.b :
ADR01_0005_B06.b :
THY01_0105_C06.b :
OVRM1_0023_E12.b :
OVR01_0082_E12.b :
AMP01_0009_F10.b :
OVRM1_0088_F07.b :
OVRM1_0207_F07.b :
THY01_0049_C02.b :
SMG01_0002_H05.b :
DCI01_0107_B01.b :
THY01_0016_H05.b :
20110601C-006970 : ..............................................CCTCTCCTTTCTCC
---------+---------+---------+---------+---------+---------+ 14
OVR01_0051_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCTCCTTTCTCC
THY01_0044_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCCTTTCTCC
BFLT1_0126_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCCTTTCTCC
DCI01_0001_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCCTTTCTCC
OVR01_0062_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTTCTCC
OVR01_0072_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTTCTCC
PST01_0041_F01.b : ttttgctcgacgttggcactggtTTTTTTTCTCC
DCI01_0034_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCTTTCTCC
OVRT1_0143_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTCTCC
OVRT1_0140_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTCTCC
TES01_0001_H09.b : tttactgctgtggctatggcTTTTTTCTCC
BFLT1_0152_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCTTTCTCC
LVRM1_0056_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTTTTTCTCC
BMWN1_0045_B10.b : ggtagacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCCTTTCTCC
LNG01_0010_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCC
PTG01_0048_D01.b : ggatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCC
OVRM1_0003_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCC
OVRM1_0014_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTTTTCTCC
UTR01_0012_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCC
OVR01_0022_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCC
TCH01_0051_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaTTTTCTCC
OVRT1_0106_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTCTCC
OVRT1_0079_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCC
OVR01_0029_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTCTCC
ITT01_0090_D05.b : aatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCC
OVR01_0035_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTCTCC
LVRM1_0098_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCTCC
OVRM1_0079_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCTCC
THY01_0007_A03.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCTCC
PST01_0003_D02.b : nttcctacgttggctatggtTTTCTCC
PST01_0057_H03.b : nntttgctgcggtggctatggTTTCTCC
OVRM1_0066_B11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTCTCC
OVR01_0083_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCC
DCI01_0018_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCC
PTG01_0041_H03.b : naatgataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTCTCC
BMWN1_0097_B06.b : gcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCC
DCI01_0021_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCC
HTMT1_0104_F03.b : gatggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCC
HTMT1_0055_A12.b : ggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCC
OVRT1_0111_H02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCC
BMWN1_0088_D07.b : nccgacggtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCC
DCI01_0024_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCC
LVRM1_0122_A06.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCC
OVRM1_0043_A12.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCC
DCI01_0022_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCC
DCI01_0022_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCC
AMP01_0101_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCC
THY01_0071_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCC
CLNT1_0115_H10.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCC
OVRM1_0154_A11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCT
OVRM1_0202_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtctggcctacTGG
OVRM1_0008_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
OVRM1_0119_A07.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
OVRT1_0063_H07.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgGCT
SPL01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
OVR01_0037_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgttaaacTGG
TES01_0006_H08.b : nctcacgttggctaTGG
CLNT1_0092_D05.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgGCT
LNG01_0013_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTGG
DCI01_0037_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
AMP01_0001_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
OVRM1_0200_C08.b : gttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxactgGG
OVRM1_0033_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
SPL01_0029_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggGG
DCI01_0025_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
DCI01_0033_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
TES01_0022_G07.b : tcgcgttggctatggcTC
DCI01_0017_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
SKNB1_0004_H11.b : nnnatcactgtggcactggaTC
SPLT1_0062_G07.b : nccgcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
ADR01_0040_F04.b : nnttgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
HTMT1_0060_C07.b : ttcgcaggtagacgccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
DCI01_0003_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggCC
ITT01_0037_D10.b : nnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
ITT01_0075_B02.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
BMWN1_0083_C07.b : aggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
ITT01_0050_G03.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
LVR01_0057_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG
THY01_0062_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
CBLT1_0079_D01.b : ttagcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCC
SPL01_0063_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGC
OVRT1_0021_C12.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
DCI01_0041_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
DCI01_0003_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC
THY01_0126_C10.b : gttgtcaaacagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
HTMT1_0124_A03.b : nnggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
BMWN1_0008_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
CBLT1_0012_C08.b : ttttagagagtacgaggcagtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVRM1_0148_F02.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtT
SPLT1_0059_E12.b : nnccgcggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
BMWN1_0061_E05.b : ggcatgagtacgaggcagntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
ILNT1_0062_E03.b : nnnccgcaggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
SPLT1_0066_G07.b : nnncgacggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
BMWN1_0030_D07.b : tttcgacagagagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
CLNT1_0133_D12.b : cgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccttG
DCI01_0041_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
HTMT1_0127_E07.b : tttttggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
AMP01_0039_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
THY01_0061_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
DCI01_0032_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
CBLT1_0062_H10.b : nnttgtccagagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
DCI01_0096_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
CBLT1_0003_C10.b : taggcaggacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
DCI01_0113_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
OVRM1_0048_C07.b : agttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0040_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0173_E03.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0118_B05.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0108_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggttggcctatggct
THY01_0118_A11.b : gttgtcaaagcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_B09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_A05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0075_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_A03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0137_E01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_B07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_B07.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_H04.b : agttgatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0126_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0125_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0050_C01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_G07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_B10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0050_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0070_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0024_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0071_F08.b : agtttgtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0046_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0073_H04.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0021_H10.b : tnntttgacgtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0152_A01.b : cgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_B04.b : cgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0096_A11.b : nnggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0022_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0074_C01.b : ntttcctgcgttggctatgg
DCI01_0015_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0055_G10.b : cgttacgatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0089_B01.b : nnggtgatagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0022_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0067_D06.b : attattggatatagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0005_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0086_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_C12.b : ggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_E02.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0004_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0036_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0037_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0207_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0037_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_D11.b : nnnnggataaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0072_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_D11.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0127_H05.b : cgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0013_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0072_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_D01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0073_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_G06.b : ttcagcgtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0002_E05.b : aaaaaaaggtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0119_F11.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0210_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0030_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0085_H09.b : agcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0061_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0085_H04.b : tcgcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0010_B08.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0107_G09.b : gttgtaaaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0119_D04.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggttgct
SPL01_0039_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0120_B01.b : gtgtcaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0087_F04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0091_G01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_F04.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0201_C09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_B03.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0041_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0009_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_B11.b : aaatnnggagtaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0009_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxttttcctcccgcgccctcccctctcctttctcc
BFLT1_0024_G02.b : ttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0062_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_G06.b : gttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0133_B01.b : gttagcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0102_C09.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0064_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0035_F10.b : ttgacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0081_A05.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0064_A12.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0100_A02.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_D12.b : ttcggcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0066_F03.b : nnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0063_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0035_A10.b : nnnggcgcgagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0051_B04.b : ntttctgcgtttg
TES01_0112_H12.b : ttttctgcgttggct
TES01_0016_C07.b : nttttcactgtggctct
TES01_0021_E09.b : gcgttggcta
PCT01_0036_A09.b : nnnngggcttataannnnncctgacggtgg
PST01_0062_H09.b : nccgctgtggctcg
PST01_0079_A05.b : nnccctgcggtggctct
PST01_0080_E09.b : ncccgctgttg
PST01_0065_H05.b : gagttggctct
PST01_0095_G01.b : nnnnaactgctgttgctat
KDN01_0065_B03.b : nnnnggctgcagtggctat
HTMT1_0011_H05.b : ncccgatacttgggatttaat
DCI01_0007_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0041_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0032_F04.b : attcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0018_E06.b : ncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0075_B08.b : aaaannaagagtaagagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_G04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0019_B05.b : nggcatgttnnnnnnnaatacgttgtgcac
CLNT1_0098_E03.b : gttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0020_D05.b : nccgttcttnnnnnnccatgcggtgtgcac
KDN01_0025_B08.b : nnncctgctgtggctat
PBL01_0093_B05.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0043_D07.b : nnnggggttnnntggggccagcgttgg
TCH01_0041_A04.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0078_G08.b : gaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0087_C02.b : ggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_A07.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0012_C09.b : agacggtacgacgcagnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
SKNB1_0049_A05.b : nncctgaggggtagggataggcaantnnnnnnnaatactnnangctgc
OVRM1_0075_A10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0078_F07.b : ccttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_A11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0022_C11.b : ggactacgttagctgtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_A09.b : nnggcttgtgacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0070_B01.b : ngtgtttnnnnnncccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0028_H07.b : nnnggagtaagaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0076_B05.b : ttttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0007_D08.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxxx
TES01_0099_C11.b :
BMWN1_0080_E03.b : tttttggatggtacgaggxxxxxxxxxxxxxx
DCI01_0113_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0134_G08.b : nagttgtcxxxxxxxxxx
OVRM1_0050_B05.b :
SPL01_0048_A11.b :
UTR01_0080_B05.b :
LNG01_0024_D11.b :
HTMT1_0002_G01.b :
ADR01_0005_B06.b :
THY01_0105_C06.b :
OVRM1_0023_E12.b :
OVR01_0082_E12.b : gctaggacttanacxxxxxxxxxxxxxxx
AMP01_0009_F10.b : tttaaag
OVRM1_0088_F07.b :
OVRM1_0207_F07.b :
THY01_0049_C02.b :
SMG01_0002_H05.b :
DCI01_0107_B01.b :
THY01_0016_H05.b :
20110601C-006970 : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
---------+---------+---------+---------+---------+---------+ 74
OVR01_0051_F02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0044_H01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BFLT1_0126_G11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0001_G08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0062_H02.b : CTCTCAGAACCTTCCTGCCGCCGTGATCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0072_D07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0041_F01.b : CTCTC*GAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0034_C03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0143_A01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0140_A08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TES01_0001_H09.b : CTCTC*GAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BFLT1_0152_F05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0056_B04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BMWN1_0045_B10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LNG01_0010_B07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PTG01_0048_D01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0003_F11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0014_B04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
UTR01_0012_F06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0022_F06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TCH01_0051_G03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0106_C11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0079_G08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0029_E11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0090_D05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0035_G06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0098_C07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0079_A03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0007_A03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0003_D02.b : CTCTC*GAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0057_H03.b : CTCTC*GAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0066_B11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0083_H11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0018_F12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PTG01_0041_H03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BMWN1_0097_B06.b : CTCTCACAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0021_E06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
HTMT1_0104_F03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
HTMT1_0055_A12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0111_H02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BMWN1_0088_D07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0024_E08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0122_A06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0043_A12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0022_H08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0022_H02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0101_H07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0071_H09.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CLNT1_0115_H10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0154_A11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0202_F04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0008_A06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0119_A07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0063_H07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPL01_0032_H03.b : CTCTCAGAACCTCCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0037_B06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGCCCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TES01_0006_H08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CLNT1_0092_D05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LNG01_0013_F07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0037_B11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0001_G04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0200_C08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0033_A07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPL01_0029_F02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0025_H08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0033_H08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TES01_0022_G07.b : CTCTC*GAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0017_G09.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SKNB1_0004_H11.b : CTCTC*GAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPLT1_0062_G07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ADR01_0040_F04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
HTMT1_0060_C07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0003_H08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0037_D10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0075_B02.b : CTCTCATAACCTTCCTGCCGACGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGACCGTC
BMWN1_0083_C07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0050_G03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVR01_0057_E10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0062_H07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CBLT1_0079_D01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPL01_0063_B06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0021_C12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0041_F08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0003_A06.b : CTCTCAGAACCTTCCTGCCGTCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0126_C10.b : CTCTCAGAACCTTCCTGCCGCCGTG*TCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
HTMT1_0124_A03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BMWN1_0008_D04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CBLT1_0012_C08.b : CTCTCAGAACCCTCTTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0148_F02.b : CTCTCAGAACCTAAATGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPLT1_0059_E12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BMWN1_0061_E05.b : CTCTCACATTCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ILNT1_0062_E03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPLT1_0066_G07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BMWN1_0030_D07.b : CTCTCAGACCTTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CLNT1_0133_D12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0041_A10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
HTMT1_0127_E07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0039_G06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0061_G10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0032_A06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CBLT1_0062_H10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0096_C03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CBLT1_0003_C10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0113_A12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0048_C07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0040_H07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0173_E03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0118_B05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0108_F04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0118_A11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0005_D07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0059_E10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0180_B09.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0028_B06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTTGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0024_A05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0075_C04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0114_A03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0137_E01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0154_B02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0065_E11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0151_B07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0153_B07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0058_H04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0126_G08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0125_H11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0014_A05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0050_C01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0168_G07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0121_B10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0050_A12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0022_H04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0070_B01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0022_G09.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGGTCCAGCCTCCGGGGCCCGTC
DCI01_0033_F09.b : CTCTCAGAACCTTCCTGCCGCCGTGCTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0019_D10.b : CTCTCAGAACCTTCCTGCCGCCGCGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0019_D02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0024_F06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0071_F08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0046_B05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0019_C11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LNG01_0073_H04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0014_C03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0031_G10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0023_F11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0099_A06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0033_C11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
UTR01_0038_D07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0061_B11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PTG01_0021_H10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CLNT1_0152_A01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0065_E02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0036_B04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0096_A11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0022_G11.b : CTCTCAAAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0074_C01.b : CTCTCA*AACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0015_E06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0005_B07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0012_G09.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0055_G10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0089_B01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BKFL1_0022_F11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SMG01_0067_D06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0005_G06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0010_B05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0086_D10.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0050_C12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0053_E02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
MLTL1_0100_H05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0001_D08.b : CTCTCAGAACCTTCCCGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
UTR01_0060_F12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0004_F03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TCH01_0036_C07.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0095_D05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGAACCTCACTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0037_D04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0207_G03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVR01_0099_D01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVR01_0058_F06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0037_D02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0001_D11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
UTR01_0087_C06.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0050_H08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPL01_0019_G11.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0072_F09.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0079_F01.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0012_D03.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGGCCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0072_D05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0064_H12.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0086_E02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0062_F08.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0061_F05.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0059_B04.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0080_D02.b : CTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0057_D11.b : xTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0127_H05.b : tTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0013_B02.b : xTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0072_D11.b : tTCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0081_D01.b : xxCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0073_D04.b : xxCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0039_G06.b : xxCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PBL01_0002_E05.b : xxCTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0119_F11.b : xxtGGAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0210_C06.b : xxxTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0007_F11.b : xtgGGAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0030_B06.b : xxxTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0085_H09.b : xxtTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPL01_0061_C04.b : xxxGGAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0085_H04.b : xxxTCAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0010_B08.b : xxcGGAGAACCTTCCCGCCGCCGTGTTCGGACCTCGCCGCTCCAGCCTCCGGGGCCCGTC
THY01_0107_G09.b : xxxxCTCAAACTTCCTGCCGCCGTG*TCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0119_D04.b : actggAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPL01_0039_D01.b : xxxxxAGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0037_G03.b : xxxxxAGAACCTTCCTGCCGCCGTGTTCGGACCTCCCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0008_E05.b : xxxxxAGAACCTTCCTGCCACCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0120_B01.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0107_A09.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0087_F04.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0091_G01.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0100_F04.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0014_B12.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0201_C09.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0022_B03.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0041_G12.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
UTR01_0009_F10.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PTG01_0044_B11.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPL01_0009_H09.b : ctctcaGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BFLT1_0024_G02.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0062_D09.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0122_G06.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0133_B01.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPL01_0102_C09.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVR01_0089_C08.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0064_F10.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
MLN01_0035_F10.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PBL01_0081_A05.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LNG01_0064_A12.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0100_A02.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0076_D12.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PBL01_0066_F03.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
THY01_0063_A06.b : xxxxxxGAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SPLT1_0035_A10.b : xxxxxxxGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TES01_0051_B04.b : ctctggaGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TES01_0112_H12.b : ctggctcGACCTTCCTGCCGCCGTGTTCGGGCCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TES01_0016_C07.b : ggctccaGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TES01_0021_E09.b : tgatccaGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PCT01_0036_A09.b : ccctctcAACCTTCCTGCCGCCNTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0062_H09.b : gcctctcGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0079_A05.b : ggctctaAACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0080_E09.b : ctatggaGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0065_H05.b : ggctctcGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PST01_0095_G01.b : ggctctcGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
KDN01_0065_B03.b : ggctctcGACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
HTMT1_0011_H05.b : gatttgagACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCTGGGGCCCGTC
DCI01_0007_G01.b : xxxxxxxxACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
AMP01_0041_D04.b : xxxxxxxxACCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BFLT1_0032_F04.b : xxxxxxxxxCCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRT1_0018_E06.b : xxxxxxxxxCCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ADR01_0075_B08.b : xxxxxxxxxCCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0064_G04.b : xxxxxxxxxxCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
KDN01_0019_B05.b : ggctctcaaaCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CLNT1_0098_E03.b : xxccttgaagCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCACCCTCCGGGGCCCGTC
KDN01_0020_D05.b : ggctctcaaaCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
KDN01_0025_B08.b : ggctctcaaaCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
PBL01_0093_B05.b : xxxxxxxxxxCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SKNB1_0043_D07.b : ctantggagaCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TCH01_0041_A04.b : xxxxxxxxxxCTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
MLN01_0078_G08.b : xxxxxxxxxxtTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0087_C02.b : xxxxxxxxxxxTTCCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
LVRM1_0148_A07.b : xxxxxxxxxxxxxxCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0113_A12.b : xxxxxxxxxxxxxxCTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CBLT1_0012_C09.b : ctcggagagccctgtTGCCGCCGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
SKNB1_0049_A05.b : gggtgctcnaacttccGCCGCCGTG*TCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0075_A10.b : xxxxxxxxxxxxxxxxxxxxxxGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0078_F07.b : xxxxxxxxxxxxxxxxxxxxxxGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0101_A11.b : xxxxxxxxxxxxxxxxxxxxxxGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BFLT1_0022_C11.b : xxxxxxxxxxxxxxxxxxxxxxGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVR01_0095_A09.b : xxxxxxxxxxxxxxxxxxxxxxGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CLNT1_0070_B01.b : xxxxxxxxxxxxxxxxxxxxxxGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0028_H07.b : xxxxxxxxxxxxxxxxxxxxxxGTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
CBLT1_0076_B05.b : xxxxxxxxxxxxxxxxxxxxxxxTGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
ITT01_0007_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxGTTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
TES01_0099_C11.b : tttttgctgcgtgtgctcgggtgTCGGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
BMWN1_0080_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
DCI01_0113_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCTCGCTGCTCCAGCCTCCGGGGCCCGTC
OVRM1_0134_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCTCCGGGGCCCGTC
OVRM1_0050_B05.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxct
SPL01_0048_A11.b : nnnnaagctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0080_B05.b : ttgggtgcactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0024_D11.b : catttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_G01.b :
ADR01_0005_B06.b : nntttatgaa
THY01_0105_C06.b : gttgtcxxxx
OVRM1_0023_E12.b : nagttgtc
OVR01_0082_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctcagaacctt
AMP01_0009_F10.b : tatcctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0088_F07.b :
OVRM1_0207_F07.b :
THY01_0049_C02.b :
SMG01_0002_H05.b :
DCI01_0107_B01.b : nnnnaaatataanaaaaagatatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_H05.b :
20110601C-006970 : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
---------+---------+---------+---------+---------+---------+ 134
OVR01_0051_F02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0044_H01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
BFLT1_0126_G11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0001_G08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0062_H02.b : CCATCCTTCCAACCGGCGACCGGGAGCAGAGAAAAACAGAATTACTTATCATTTTCTTGC
OVR01_0072_D07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PST01_0041_F01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0034_C03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRT1_0143_A01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0140_A08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
TES01_0001_H09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
BFLT1_0152_F05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LVRM1_0056_B04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
BMWN1_0045_B10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LNG01_0010_B07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
PTG01_0048_D01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0003_F11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0014_B04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
UTR01_0012_F06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAGTTACTTATCATTTTCTTGC
OVR01_0022_F06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
TCH01_0051_G03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0106_C11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0079_G08.b : CCATCCTTCCAGCCTGCGACCGTGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0029_E11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTCCTTATCATTTTCTTGC
ITT01_0090_D05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVR01_0035_G06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LVRM1_0098_C07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0079_A03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0007_A03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PST01_0003_D02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PST01_0057_H03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRM1_0066_B11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVR01_0083_H11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0018_F12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PTG01_0041_H03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
BMWN1_0097_B06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0021_E06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
HTMT1_0104_F03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
HTMT1_0055_A12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRT1_0111_H02.b : CCATCTTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
BMWN1_0088_D07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0024_E08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LVRM1_0122_A06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0043_A12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0022_H08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0022_H02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0101_H07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0071_H09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
CLNT1_0115_H10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRM1_0154_A11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0202_F04.b : CCATCCTTCCAGCCTGCGACCGGGGGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0008_A06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTGCTTATCATTTTCTTGC
OVRM1_0119_A07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0063_H07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SPL01_0032_H03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVR01_0037_B06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
TES01_0006_H08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
CLNT1_0092_D05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LNG01_0013_F07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0037_B11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0001_G04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0200_C08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0033_A07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SPL01_0029_F02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0025_H08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0033_H08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
TES01_0022_G07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0017_G09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
SKNB1_0004_H11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SPLT1_0062_G07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
ADR01_0040_F04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
HTMT1_0060_C07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0003_H08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
ITT01_0037_D10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
ITT01_0075_B02.b : CCATCCTTCCATCCTGCGACCGGGAGCACATAAAACCAAAATTACTTATCATTTTCTTGC
BMWN1_0083_C07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
ITT01_0050_G03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LVR01_0057_E10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0062_H07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
CBLT1_0079_D01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
SPL01_0063_B06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0021_C12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0041_F08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0003_A06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0126_C10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
HTMT1_0124_A03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
BMWN1_0008_D04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
CBLT1_0012_C08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0148_F02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SPLT1_0059_E12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
BMWN1_0061_E05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
ILNT1_0062_E03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
SPLT1_0066_G07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
BMWN1_0030_D07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
CLNT1_0133_D12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0041_A10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
HTMT1_0127_E07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0039_G06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0061_G10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0032_A06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
CBLT1_0062_H10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0096_C03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
CBLT1_0003_C10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0113_A12.b : CCATCCTTCCAGCCTGCGTCCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRM1_0048_C07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0040_H07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0173_E03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0118_B05.b : CCATCCTTCCAGCCTGTGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0108_F04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0118_A11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LVRM1_0005_D07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0059_E10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LVRM1_0180_B09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0028_B06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LVRM1_0024_A05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVR01_0075_C04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRM1_0114_A03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0137_E01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0154_B02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LVRM1_0065_E11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0151_B07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LVRM1_0153_B07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0058_H04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0126_G08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0125_H11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0014_A05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0050_C01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0168_G07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0121_B10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0050_A12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0022_H04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0070_B01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0022_G09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0033_F09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0019_D10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0019_D02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0024_F06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0071_F08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0046_B05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0019_C11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LNG01_0073_H04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0014_C03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0031_G10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0023_F11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0099_A06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0033_C11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
UTR01_0038_D07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0061_B11.b : CCATTCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PTG01_0021_H10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
CLNT1_0152_A01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0065_E02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRT1_0036_B04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
ITT01_0096_A11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
ITT01_0022_G11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
PST01_0074_C01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0015_E06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0005_B07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0012_G09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRT1_0055_G10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
ITT01_0089_B01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
BKFL1_0022_F11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SMG01_0067_D06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0005_G06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0010_B05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0086_D10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRT1_0050_C12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
ITT01_0053_E02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
MLTL1_0100_H05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0001_D08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
UTR01_0060_F12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0004_F03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
TCH01_0036_C07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0095_D05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0037_D04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0207_G03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LVR01_0099_D01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LVR01_0058_F06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0037_D02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
ITT01_0001_D11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
UTR01_0087_C06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
AMP01_0050_H08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SPL01_0019_G11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0072_F09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTGTCATTTTCTTGC
AMP01_0079_F01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0012_D03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0072_D05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0064_H12.b : CCATCCTTCCAGCCCGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0086_E02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0062_F08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0061_F05.b : CCATCCTTCCAGCCCGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0059_B04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0080_D02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRM1_0057_D11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0127_H05.b : CCATCCTTCCAGCCTGTGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0013_B02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0072_D11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LVRM1_0081_D01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0073_D04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0039_G06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
PBL01_0002_E05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0119_F11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRM1_0210_C06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LVRM1_0007_F11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
DCI01_0030_B06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRT1_0085_H09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SPL01_0061_C04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0085_H04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVR01_0010_B08.b : CCATCCTTCCAGCCCGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTCGC
THY01_0107_G09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0119_D04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SPL01_0039_D01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0037_G03.b : CCATCCTTCCAGCCTGGGAACGGGAGCAAAAAAAACCCAAATTACTTTTCATTTTCCTGC
DCI01_0008_E05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0120_B01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LVRM1_0107_A09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0087_F04.b : CCACCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0091_G01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0100_F04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0014_B12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0201_C09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0022_B03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0041_G12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
UTR01_0009_F10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
PTG01_0044_B11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
SPL01_0009_H09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
BFLT1_0024_G02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
THY01_0062_D09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0122_G06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0133_B01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAGAACAAAATTACTTATCATTTTCTTGC
SPL01_0102_C09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
LVR01_0089_C08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0064_F10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
MLN01_0035_F10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
PBL01_0081_A05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LNG01_0064_A12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVR01_0100_A02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATCTTCTTGC
OVRT1_0076_D12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PBL01_0066_F03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
THY01_0063_A06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SPLT1_0035_A10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
TES01_0051_B04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
TES01_0112_H12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
TES01_0016_C07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
TES01_0021_E09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PCT01_0036_A09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PST01_0062_H09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PST01_0079_A05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PST01_0080_E09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PST01_0065_H05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
PST01_0095_G01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
KDN01_0065_B03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
HTMT1_0011_H05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0007_G01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
AMP01_0041_D04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
BFLT1_0032_F04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRT1_0018_E06.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
ADR01_0075_B08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0064_G04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
KDN01_0019_B05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
CLNT1_0098_E03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
KDN01_0020_D05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
KDN01_0025_B08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
PBL01_0093_B05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SKNB1_0043_D07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATCACTTATCATTTTCTTGC
TCH01_0041_A04.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
MLN01_0078_G08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVR01_0087_C02.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
LVRM1_0148_A07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0113_A12.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAGAACCAAAATTACTTATCATTTTCTTGC
CBLT1_0012_C09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
SKNB1_0049_A05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0075_A10.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0078_F07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0101_A11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
BFLT1_0022_C11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVR01_0095_A09.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
CLNT1_0070_B01.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
ITT01_0028_H07.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
CBLT1_0076_B05.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
ITT01_0007_D08.b : CCATTCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
TES01_0099_C11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
BMWN1_0080_E03.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
DCI01_0113_H11.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAAACAAAATTACTTATCATTTTCTTGC
OVRM1_0134_G08.b : CCATCCTTCCAGCCTGCGACCGGGAGCAGAGAAAACCAAAATTACTTATCATTTTCTTGC
OVRM1_0050_B05.b : ggATCCTTCCAGCCTGCGACCGGGAGCAGAGAAA*CCAAAATTACTTATCATTTTCTTGC
SPL01_0048_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCAAAATTACTTATCATTTTCTTGC
UTR01_0080_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTACTTATCATTTTCTTGC
LNG01_0024_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTACTTATCATTTTCTTGC
HTMT1_0002_G01.b : ccagatactatgggatttaatgaaTACTTATCATTTTCTTGC
ADR01_0005_B06.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATCATTTTCTTGC
THY01_0105_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATCATTTTCTTGC
OVRM1_0023_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCTTGC
OVR01_0082_E12.b : cctgccgccgtgttcggacctcgctgctccagcctccggggcccgtcccatccttccagc
AMP01_0009_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0088_F07.b : nagttgtcxxxxxxxxxxx
OVRM1_0207_F07.b : agttgtcxxxxxxxxxxxxxxxxxx
THY01_0049_C02.b : catatagatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0002_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0107_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_H05.b :
20110601C-006970 : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
---------+---------+---------+---------+---------+---------+ 193
OVR01_0051_F02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0044_H01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BFLT1_0126_G11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0001_G08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0062_H02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTACAATAAATTTTAACAATGAGGGAAAT
OVR01_0072_D07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0041_F01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0034_C03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0143_A01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0140_A08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TES01_0001_H09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BFLT1_0152_F05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0056_B04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BMWN1_0045_B10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAGGTTTAACAATGAGGGAAAT
LNG01_0010_B07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PTG01_0048_D01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0003_F11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0014_B04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
UTR01_0012_F06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0022_F06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TCH01_0051_G03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0106_C11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0079_G08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0029_E11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0090_D05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0035_G06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0098_C07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0079_A03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0007_A03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0003_D02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0057_H03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0066_B11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0083_H11.b : CCCGTACACACC*TTGAGGCGAGCCAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0018_F12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PTG01_0041_H03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BMWN1_0097_B06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0021_E06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
HTMT1_0104_F03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
HTMT1_0055_A12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0111_H02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BMWN1_0088_D07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0024_E08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0122_A06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0043_A12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0022_H08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0022_H02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0101_H07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0071_H09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CLNT1_0115_H10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0154_A11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0202_F04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0008_A06.b : CCCGTACACACC*TTGAGGCGAGCGAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0119_A07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0063_H07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0032_H03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0037_B06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TES01_0006_H08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CLNT1_0092_D05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LNG01_0013_F07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0037_B11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0001_G04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0200_C08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0033_A07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0029_F02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0025_H08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0033_H08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TES01_0022_G07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0017_G09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SKNB1_0004_H11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPLT1_0062_G07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ADR01_0040_F04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
HTMT1_0060_C07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0003_H08.b : CCCGTACACACC*TGGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0037_D10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0075_B02.b : CCCGTACACACCATTGAGGCGAGCAAAAAGATTAGAATAGATTTAAACTATGAGGGAAAT
BMWN1_0083_C07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0050_G03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVR01_0057_E10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0062_H07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CBLT1_0079_D01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0063_B06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0021_C12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0041_F08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0003_A06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0126_C10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
HTMT1_0124_A03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BMWN1_0008_D04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CBLT1_0012_C08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0148_F02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPLT1_0059_E12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BMWN1_0061_E05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ILNT1_0062_E03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPLT1_0066_G07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BMWN1_0030_D07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CLNT1_0133_D12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0041_A10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
HTMT1_0127_E07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0039_G06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0061_G10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0032_A06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CBLT1_0062_H10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0096_C03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CBLT1_0003_C10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0113_A12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0048_C07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0040_H07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0173_E03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0118_B05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0108_F04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0118_A11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0005_D07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0059_E10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0180_B09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0028_B06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0024_A05.b : CCCGTACACACC*TTGAGGCGAGCAAAAGGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0075_C04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0114_A03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0137_E01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0154_B02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0065_E11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0151_B07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0153_B07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0058_H04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0126_G08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0125_H11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0014_A05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0050_C01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0168_G07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0121_B10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0050_A12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0022_H04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0070_B01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0022_G09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0033_F09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGGAAT
DCI01_0019_D10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0019_D02.b : CCCGTACACACC*TTGAGGCGAGCAAAAGGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0024_F06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0071_F08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAGCAATGAGGGAAAT
THY01_0046_B05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0019_C11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LNG01_0073_H04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0014_C03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAC
DCI01_0031_G10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0023_F11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0099_A06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0033_C11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
UTR01_0038_D07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0061_B11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PTG01_0021_H10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CLNT1_0152_A01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0065_E02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0036_B04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0096_A11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0022_G11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0074_C01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0015_E06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0005_B07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0012_G09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0055_G10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0089_B01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BKFL1_0022_F11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SMG01_0067_D06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0005_G06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0010_B05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0086_D10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0050_C12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0053_E02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
MLTL1_0100_H05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0001_D08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
UTR01_0060_F12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0004_F03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TCH01_0036_C07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0095_D05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0037_D04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0207_G03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVR01_0099_D01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVR01_0058_F06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0037_D02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0001_D11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
UTR01_0087_C06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0050_H08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0019_G11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0072_F09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0079_F01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0012_D03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0072_D05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0064_H12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0086_E02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0062_F08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0061_F05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0059_B04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0080_D02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0057_D11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0127_H05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0013_B02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0072_D11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0081_D01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0073_D04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0039_G06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PBL01_0002_E05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0119_F11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0210_C06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0007_F11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0030_B06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0085_H09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0061_C04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0085_H04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0010_B08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0107_G09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0119_D04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0039_D01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0037_G03.b : CCCGTACACCCC*TTGGGGCGAGCAAAAAGATTAAAATTAATTTTTACCATGAGGGAAAT
DCI01_0008_E05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0120_B01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0107_A09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0087_F04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0091_G01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0100_F04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0014_B12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0201_C09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0022_B03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0041_G12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAGCAATGAGGGAAAT
UTR01_0009_F10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PTG01_0044_B11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0009_H09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BFLT1_0024_G02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0062_D09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0122_G06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0133_B01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0102_C09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVR01_0089_C08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0064_F10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
MLN01_0035_F10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PBL01_0081_A05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LNG01_0064_A12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0100_A02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0076_D12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PBL01_0066_F03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0063_A06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGGATAAATTTTAACAATGAGGGAAAT
SPLT1_0035_A10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TES01_0051_B04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TES01_0112_H12.b : CCCGTACACACC*TTGAGGCGAGCAAAAGGATTAGAATAAATTTTAACAATGAGGGAAAT
TES01_0016_C07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TES01_0021_E09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PCT01_0036_A09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0062_H09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0079_A05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0080_E09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0065_H05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PST01_0095_G01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
KDN01_0065_B03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
HTMT1_0011_H05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0007_G01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0041_D04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BFLT1_0032_F04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRT1_0018_E06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ADR01_0075_B08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0064_G04.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
KDN01_0019_B05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CLNT1_0098_E03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
KDN01_0020_D05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
KDN01_0025_B08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
PBL01_0093_B05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAGAT
SKNB1_0043_D07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TCH01_0041_A04.b : CCCGTACACACC*TTGAGGCGAGC*AAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
MLN01_0078_G08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0087_C02.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LVRM1_0148_A07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0113_A12.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CBLT1_0012_C09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SKNB1_0049_A05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0075_A10.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0078_F07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0101_A11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BFLT1_0022_C11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0095_A09.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CLNT1_0070_B01.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0028_H07.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
CBLT1_0076_B05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ITT01_0007_D08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
TES01_0099_C11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
BMWN1_0080_E03.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
DCI01_0113_H11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0134_G08.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0050_B05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
SPL01_0048_A11.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
UTR01_0080_B05.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
LNG01_0024_D11.b : CCCGTACGCACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
HTMT1_0002_G01.b : CCCGTACACACC*TTGAGGCGAGCACAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
ADR01_0005_B06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
THY01_0105_C06.b : CCCGTACACACC*TTGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0023_E12.b : CCCGTACACACC*TCGAGGCGAGCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
OVR01_0082_E12.b : ctgcgaccgggagcagagaaaacCAAAAAGATTAGAATAAATTTTAACAATGAGGGAAAT
AMP01_0009_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAATAAATTTTAACAATGAGGGAAAT
OVRM1_0088_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTAACAATGAGGGAAAT
OVRM1_0207_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTAACAATGAGGGAAAT
THY01_0049_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTAACAATGAGGGAAAT
SMG01_0002_H05.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTAACAATCAGGGAAAT
DCI01_0107_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAT
THY01_0016_H05.b :
20110601C-006970 : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
---------+---------+---------+---------+---------+---------+ 253
OVR01_0051_F02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0044_H01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BFLT1_0126_G11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0001_G08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0062_H02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0072_D07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PST01_0041_F01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0034_C03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0143_A01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0140_A08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TES01_0001_H09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BFLT1_0152_F05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0056_B04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BMWN1_0045_B10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LNG01_0010_B07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PTG01_0048_D01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0003_F11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0014_B04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
UTR01_0012_F06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0022_F06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TCH01_0051_G03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0106_C11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0079_G08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0029_E11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0090_D05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0035_G06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0098_C07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0079_A03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0007_A03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PST01_0003_D02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PST01_0057_H03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0066_B11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0083_H11.b : CGTGCATATCCAGGCCCGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0018_F12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PTG01_0041_H03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BMWN1_0097_B06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0021_E06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
HTMT1_0104_F03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
HTMT1_0055_A12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0111_H02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BMWN1_0088_D07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0024_E08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0122_A06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0043_A12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0022_H08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0022_H02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0101_H07.b : CGTGCATATTCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0071_H09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CLNT1_0115_H10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGCTCTGGGAGGTGAT
OVRM1_0154_A11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0202_F04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0008_A06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0119_A07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0063_H07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPL01_0032_H03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0037_B06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
TES01_0006_H08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CLNT1_0092_D05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LNG01_0013_F07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0037_B11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0001_G04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCCGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0200_C08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0033_A07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPL01_0029_F02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0025_H08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0033_H08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TES01_0022_G07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0017_G09.b : CGTGCATATCCAGGCCTGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SKNB1_0004_H11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
SPLT1_0062_G07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ADR01_0040_F04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
HTMT1_0060_C07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0003_H08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0037_D10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0075_B02.b : CGTGCATATCCAGTCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BMWN1_0083_C07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0050_G03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVR01_0057_E10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0062_H07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CBLT1_0079_D01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPL01_0063_B06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0021_C12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0041_F08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0003_A06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0126_C10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
HTMT1_0124_A03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BMWN1_0008_D04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CBLT1_0012_C08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0148_F02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPLT1_0059_E12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BMWN1_0061_E05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ILNT1_0062_E03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPLT1_0066_G07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BMWN1_0030_D07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CLNT1_0133_D12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0041_A10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
HTMT1_0127_E07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0039_G06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0061_G10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0032_A06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CBLT1_0062_H10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0096_C03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CBLT1_0003_C10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0113_A12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0048_C07.b : CGTGCATATCCAGGCCGGCCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0040_H07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0173_E03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0118_B05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAAGTGAT
THY01_0108_F04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0118_A11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0005_D07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0059_E10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0180_B09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0028_B06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0024_A05.b : CGTGCACATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0075_C04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0114_A03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0137_E01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0154_B02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0065_E11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0151_B07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0153_B07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0058_H04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0126_G08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0125_H11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0014_A05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0050_C01.b : CGTGCATATCCNGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0168_G07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0121_B10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0050_A12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0022_H04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0070_B01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0022_G09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0033_F09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0019_D10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0019_D02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0024_F06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0071_F08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0046_B05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0019_C11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LNG01_0073_H04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0014_C03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0031_G10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0023_F11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0099_A06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0033_C11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
UTR01_0038_D07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0061_B11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PTG01_0021_H10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAG*TCTGGGAGGTGAT
CLNT1_0152_A01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0065_E02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0036_B04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0096_A11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0022_G11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PST01_0074_C01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0015_E06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0005_B07.b : CGTGCATATCCGGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0012_G09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0055_G10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0089_B01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BKFL1_0022_F11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SMG01_0067_D06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0005_G06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0010_B05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0086_D10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0050_C12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0053_E02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
MLTL1_0100_H05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0001_D08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
UTR01_0060_F12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0004_F03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TCH01_0036_C07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0095_D05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0037_D04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
THY01_0207_G03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVR01_0099_D01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVR01_0058_F06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0037_D02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0001_D11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
UTR01_0087_C06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
AMP01_0050_H08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPL01_0019_G11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0072_F09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0079_F01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0012_D03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
THY01_0072_D05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0064_H12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0086_E02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0062_F08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0061_F05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0059_B04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0080_D02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0057_D11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0127_H05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0013_B02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
THY01_0072_D11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0081_D01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0073_D04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0039_G06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PBL01_0002_E05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0119_F11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0210_C06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0007_F11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0030_B06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0085_H09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPL01_0061_C04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0085_H04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0010_B08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0107_G09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0119_D04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAAGTGAT
SPL01_0039_D01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0037_G03.b : CCTGCCTATCCCGGCCGGTCCGTGTGGCAACCAGATCCGTGCCCAGTTCTGGGAGGTGAT
DCI01_0008_E05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0120_B01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVRM1_0107_A09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0087_F04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0091_G01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0100_F04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0014_B12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0201_C09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0022_B03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0041_G12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
UTR01_0009_F10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
PTG01_0044_B11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPL01_0009_H09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BFLT1_0024_G02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0062_D09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0122_G06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0133_B01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPL01_0102_C09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LVR01_0089_C08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0064_F10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
MLN01_0035_F10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PBL01_0081_A05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LNG01_0064_A12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0100_A02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRT1_0076_D12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PBL01_0066_F03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0063_A06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPLT1_0035_A10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TES01_0051_B04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TES01_0112_H12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TES01_0016_C07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TES01_0021_E09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PCT01_0036_A09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGATGCCAAGTTCTGGGAGGTGAT
PST01_0062_H09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PST01_0079_A05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PST01_0080_E09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PST01_0065_H05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PST01_0095_G01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
KDN01_0065_B03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
HTMT1_0011_H05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0007_G01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
AMP01_0041_D04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BFLT1_0032_F04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTCCTGGGAGGTGAT
OVRT1_0018_E06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ADR01_0075_B08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0064_G04.b : CGTGCATATCCNGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
KDN01_0019_B05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CLNT1_0098_E03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
KDN01_0020_D05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
KDN01_0025_B08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
PBL01_0093_B05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SKNB1_0043_D07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TCH01_0041_A04.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
MLN01_0078_G08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0087_C02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
LVRM1_0148_A07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0113_A12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CBLT1_0012_C09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SKNB1_0049_A05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
OVRM1_0075_A10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0078_F07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0101_A11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BFLT1_0022_C11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0095_A09.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CLNT1_0070_B01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0028_H07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
CBLT1_0076_B05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ITT01_0007_D08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
TES01_0099_C11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
BMWN1_0080_E03.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0113_H11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0134_G08.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0050_B05.b : CGTGCATATCCNGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SPL01_0048_A11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
UTR01_0080_B05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
LNG01_0024_D11.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
HTMT1_0002_G01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
ADR01_0005_B06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0105_C06.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0023_E12.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVR01_0082_E12.b : CGTGCATATGCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCTAAGTTCTGGGAGGTGAT
AMP01_0009_F10.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0088_F07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
OVRM1_0207_F07.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0049_C02.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
SMG01_0002_H05.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCACATCGGTGCCAAGTTCTGGGAGGTGAT
DCI01_0107_B01.b : CGTGCATATCCAGGCCGGTCAGTGTGGCAACCAGATCGGTGCCAAGTTCTGGGAGGTGAT
THY01_0016_H05.b :
20110601C-006970 : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
---------+---------+---------+---------+---------+---------+ 313
OVR01_0051_F02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0044_H01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BFLT1_0126_G11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0001_G08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0062_H02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0072_D07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PST01_0041_F01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0034_C03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0143_A01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCGTGGGGACAGCGACCTGCAGCT
OVRT1_0140_A08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TES01_0001_H09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BFLT1_0152_F05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0056_B04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BMWN1_0045_B10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LNG01_0010_B07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PTG01_0048_D01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0003_F11.b : CAGTGATGAACATGGCGTCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0014_B04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
UTR01_0012_F06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0022_F06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TCH01_0051_G03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0106_C11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0079_G08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0029_E11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0090_D05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0035_G06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0098_C07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0079_A03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0007_A03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCC
PST01_0003_D02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PST01_0057_H03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0066_B11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0083_H11.b : CAGTGATGAACATGGCATCCACCCCACCGGCACCTATCATGGGGACAGGCGACTGCAGCT
DCI01_0018_F12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCCGCAGCT
PTG01_0041_H03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BMWN1_0097_B06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0021_E06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
HTMT1_0104_F03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
HTMT1_0055_A12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0111_H02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BMWN1_0088_D07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0024_E08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0122_A06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0043_A12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0022_H08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0022_H02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0101_H07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0071_H09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CLNT1_0115_H10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0154_A11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0202_F04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0008_A06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0119_A07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0063_H07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0032_H03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0037_B06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TES01_0006_H08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CLNT1_0092_D05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LNG01_0013_F07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0037_B11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0001_G04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0200_C08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0033_A07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0029_F02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0025_H08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0033_H08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TES01_0022_G07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0017_G09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SKNB1_0004_H11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPLT1_0062_G07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ADR01_0040_F04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
HTMT1_0060_C07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0003_H08.b : CAGTGATGAACATGGCATCCACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0037_D10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0075_B02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BMWN1_0083_C07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0050_G03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVR01_0057_E10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0062_H07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CBLT1_0079_D01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0063_B06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0021_C12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0041_F08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0003_A06.b : CAGTGATGAACATGGCATCCACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0126_C10.b : CAGTGATGGACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
HTMT1_0124_A03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BMWN1_0008_D04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CBLT1_0012_C08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0148_F02.b : CAGTGATGAACATGGCATCTTCCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPLT1_0059_E12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BMWN1_0061_E05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ILNT1_0062_E03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPLT1_0066_G07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BMWN1_0030_D07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CLNT1_0133_D12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0041_A10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
HTMT1_0127_E07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0039_G06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0061_G10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0032_A06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CBLT1_0062_H10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0096_C03.b : CAGTGATGAACATGGCATCGACCCCACAGGCACCTATCATGGGGACAGCGACCTGCAGCT
CBLT1_0003_C10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0113_A12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0048_C07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0040_H07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0173_E03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0118_B05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0108_F04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0118_A11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0005_D07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0059_E10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0180_B09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0028_B06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0024_A05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0075_C04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0114_A03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0137_E01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0154_B02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0065_E11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0151_B07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0153_B07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0058_H04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0126_G08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0125_H11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0014_A05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0050_C01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0168_G07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0121_B10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTACCATGGGGACAGCGACCTGCAGCT
THY01_0050_A12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0022_H04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACGGCGACCTGCAGCT
THY01_0070_B01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0022_G09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0033_F09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0019_D10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0019_D02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0024_F06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0071_F08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0046_B05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0019_C11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LNG01_0073_H04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0014_C03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0031_G10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCGGCT
DCI01_0023_F11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0099_A06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0033_C11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
UTR01_0038_D07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0061_B11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PTG01_0021_H10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CLNT1_0152_A01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0065_E02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0036_B04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0096_A11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0022_G11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PST01_0074_C01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0015_E06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0005_B07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0012_G09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0055_G10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0089_B01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BKFL1_0022_F11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SMG01_0067_D06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0005_G06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0010_B05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0086_D10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0050_C12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0053_E02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
MLTL1_0100_H05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0001_D08.b : CAGTGATGAACATGGCATCCACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
UTR01_0060_F12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0004_F03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TCH01_0036_C07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0095_D05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0037_D04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0207_G03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVR01_0099_D01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVR01_0058_F06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0037_D02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0001_D11.b : CAGTGATGAACATGGCATCGACCCCACCGGCATCTATCATGGGGACAGCGACCTGCAGCT
UTR01_0087_C06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0050_H08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0019_G11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0072_F09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0079_F01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0012_D03.b : CAGTGATGAACATGGCATCGACCTCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0072_D05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0064_H12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0086_E02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0062_F08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0061_F05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0059_B04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0080_D02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0057_D11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0127_H05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0013_B02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0072_D11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0081_D01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0073_D04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0039_G06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PBL01_0002_E05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0119_F11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCACCT
OVRM1_0210_C06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0007_F11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0030_B06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0085_H09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0061_C04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0085_H04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0010_B08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0107_G09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0119_D04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0039_D01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGTAGCT
AMP01_0037_G03.b : CAGTGATGAACATGGCATCCACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0008_E05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0120_B01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0107_A09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0087_F04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0091_G01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0100_F04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0014_B12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0201_C09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0022_B03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0041_G12.b : CAGTGATGAACATGGCATCGACCCCACCGACACCTATCATGGGGACAGCGACCTGCAGCT
UTR01_0009_F10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PTG01_0044_B11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0009_H09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BFLT1_0024_G02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0062_D09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0122_G06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0133_B01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0102_C09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVR01_0089_C08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0064_F10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
MLN01_0035_F10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PBL01_0081_A05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LNG01_0064_A12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0100_A02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0076_D12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PBL01_0066_F03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0063_A06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPLT1_0035_A10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TES01_0051_B04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TES01_0112_H12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TES01_0016_C07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TES01_0021_E09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PCT01_0036_A09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PST01_0062_H09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PST01_0079_A05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PST01_0080_E09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PST01_0065_H05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PST01_0095_G01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
KDN01_0065_B03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
HTMT1_0011_H05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0007_G01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0041_D04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BFLT1_0032_F04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRT1_0018_E06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ADR01_0075_B08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0064_G04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
KDN01_0019_B05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CLNT1_0098_E03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
KDN01_0020_D05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
KDN01_0025_B08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
PBL01_0093_B05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SKNB1_0043_D07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TCH01_0041_A04.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
MLN01_0078_G08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0087_C02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LVRM1_0148_A07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0113_A12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CBLT1_0012_C09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SKNB1_0049_A05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0075_A10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0078_F07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0101_A11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BFLT1_0022_C11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0095_A09.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CLNT1_0070_B01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0028_H07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
CBLT1_0076_B05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ITT01_0007_D08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
TES01_0099_C11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
BMWN1_0080_E03.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0113_H11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0134_G08.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0050_B05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SPL01_0048_A11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
UTR01_0080_B05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
LNG01_0024_D11.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
HTMT1_0002_G01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
ADR01_0005_B06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0105_C06.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0023_E12.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVR01_0082_E12.b : CAGTGATGAACATGGCATCCACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
AMP01_0009_F10.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0088_F07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
OVRM1_0207_F07.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0049_C02.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
SMG01_0002_H05.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
DCI01_0107_B01.b : CAGTGATGAACATGGCATCGACCCCACCGGCACCTATCATGGGGACAGCGACCTGCAGCT
THY01_0016_H05.b :
20110601C-006970 : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
---------+---------+---------+---------+---------+---------+ 373
OVR01_0051_F02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0044_H01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BFLT1_0126_G11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0001_G08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0062_H02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0072_D07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0041_F01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0034_C03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0143_A01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0140_A08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TES01_0001_H09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BFLT1_0152_F05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0056_B04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BMWN1_0045_B10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LNG01_0010_B07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PTG01_0048_D01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0003_F11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0014_B04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
UTR01_0012_F06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGCGCTAT
OVR01_0022_F06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TCH01_0051_G03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0106_C11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0079_G08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0029_E11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0090_D05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0035_G06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGCTCCTCGTGCTAT
LVRM1_0098_C07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCCAT
OVRM1_0079_A03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0007_A03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0003_D02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0057_H03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0066_B11.b : GGACCGCATCTCCGTGTACTACTATGAAGCCACAGGTGGCAAATATGTTCCACGCGCTAT
OVR01_0083_H11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCCCAGGTGGCAAATATGTTCCTGGGGCTAT
DCI01_0018_F12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PTG01_0041_H03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BMWN1_0097_B06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0021_E06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
HTMT1_0104_F03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
HTMT1_0055_A12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0111_H02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BMWN1_0088_D07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0024_E08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0122_A06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0043_A12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0022_H08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0022_H02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAATTATGTTCCTCGTGCTAT
AMP01_0101_H07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0071_H09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CLNT1_0115_H10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0154_A11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0202_F04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0008_A06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0119_A07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0063_H07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0032_H03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0037_B06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TES01_0006_H08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CLNT1_0092_D05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LNG01_0013_F07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0037_B11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0001_G04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0200_C08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0033_A07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0029_F02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0025_H08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0033_H08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TES01_0022_G07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0017_G09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SKNB1_0004_H11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPLT1_0062_G07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ADR01_0040_F04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
HTMT1_0060_C07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0003_H08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0037_D10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0075_B02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACGAGTGGAAAATATGTTCCTCGTGCTAT
BMWN1_0083_C07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0050_G03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVR01_0057_E10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGATGGCAAATATGTTCCTCGTGCTAT
THY01_0062_H07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CBLT1_0079_D01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0063_B06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0021_C12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0041_F08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0003_A06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0126_C10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
HTMT1_0124_A03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BMWN1_0008_D04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CBLT1_0012_C08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0148_F02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPLT1_0059_E12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BMWN1_0061_E05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ILNT1_0062_E03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPLT1_0066_G07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BMWN1_0030_D07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CLNT1_0133_D12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0041_A10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
HTMT1_0127_E07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0039_G06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0061_G10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0032_A06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CBLT1_0062_H10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0096_C03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CBLT1_0003_C10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0113_A12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0048_C07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0040_H07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0173_E03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0118_B05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0108_F04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0118_A11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0005_D07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0059_E10.b : GGACCGCATCTCCGTGTACTACAACGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0180_B09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0028_B06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTGT
LVRM1_0024_A05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0075_C04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0114_A03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0137_E01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0154_B02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0065_E11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0151_B07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0153_B07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0058_H04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0126_G08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0125_H11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0014_A05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0050_C01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0168_G07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0121_B10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0050_A12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0022_H04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0070_B01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0022_G09.b : GGACCGCATCTCCGAGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0033_F09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0019_D10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0019_D02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0024_F06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0071_F08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0046_B05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0019_C11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LNG01_0073_H04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0014_C03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0031_G10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0023_F11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0099_A06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0033_C11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
UTR01_0038_D07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0061_B11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PTG01_0021_H10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CLNT1_0152_A01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0065_E02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0036_B04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0096_A11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0022_G11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0074_C01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0015_E06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0005_B07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0012_G09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0055_G10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0089_B01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BKFL1_0022_F11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SMG01_0067_D06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0005_G06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0010_B05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0086_D10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0050_C12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0053_E02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
MLTL1_0100_H05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0001_D08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
UTR01_0060_F12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0004_F03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TCH01_0036_C07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0095_D05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0037_D04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0207_G03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVR01_0099_D01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVR01_0058_F06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0037_D02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0001_D11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
UTR01_0087_C06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0050_H08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0019_G11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0072_F09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0079_F01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0012_D03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0072_D05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0064_H12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0086_E02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0062_F08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0061_F05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0059_B04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0080_D02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGTAAATATGTTCCTCGTGCTAT
OVRM1_0057_D11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0127_H05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0013_B02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0072_D11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0081_D01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0073_D04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0039_G06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PBL01_0002_E05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0119_F11.b : GGACCGCATCTCCGTGTACTACAATGACGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0210_C06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0007_F11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0030_B06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0085_H09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0061_C04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0085_H04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0010_B08.b : GGACCGCATCTCCGTGTACTACGATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0107_G09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0119_D04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0039_D01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0037_G03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0008_E05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0120_B01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0107_A09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0087_F04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0091_G01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0100_F04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0014_B12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0201_C09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0022_B03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0041_G12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
UTR01_0009_F10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PTG01_0044_B11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0009_H09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BFLT1_0024_G02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0062_D09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0122_G06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0133_B01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0102_C09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVR01_0089_C08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0064_F10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
MLN01_0035_F10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PBL01_0081_A05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LNG01_0064_A12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0100_A02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0076_D12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PBL01_0066_F03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0063_A06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPLT1_0035_A10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TES01_0051_B04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TES01_0112_H12.b : GGACCGCATCTCCGTGTACTACAATGGAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TES01_0016_C07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TES01_0021_E09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PCT01_0036_A09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0062_H09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0079_A05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0080_E09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0065_H05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PST01_0095_G01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
KDN01_0065_B03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
HTMT1_0011_H05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0007_G01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0041_D04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BFLT1_0032_F04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRT1_0018_E06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ADR01_0075_B08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0064_G04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
KDN01_0019_B05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CLNT1_0098_E03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
KDN01_0020_D05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
KDN01_0025_B08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
PBL01_0093_B05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SKNB1_0043_D07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TCH01_0041_A04.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
MLN01_0078_G08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0087_C02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LVRM1_0148_A07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0113_A12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CBLT1_0012_C09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SKNB1_0049_A05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0075_A10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0078_F07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0101_A11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BFLT1_0022_C11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0095_A09.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CLNT1_0070_B01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCAAT
ITT01_0028_H07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
CBLT1_0076_B05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ITT01_0007_D08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
TES01_0099_C11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
BMWN1_0080_E03.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0113_H11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0134_G08.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0050_B05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SPL01_0048_A11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
UTR01_0080_B05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
LNG01_0024_D11.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
HTMT1_0002_G01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
ADR01_0005_B06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAAGTGGCAAATATGTTCCTCGTGCTAT
THY01_0105_C06.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0023_E12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVR01_0082_E12.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
AMP01_0009_F10.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCGAATATGTTCCTCGTGCTAT
OVRM1_0088_F07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
OVRM1_0207_F07.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
THY01_0049_C02.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
SMG01_0002_H05.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGTGGCAAATATGTTCCTCGTGCTAT
DCI01_0107_B01.b : GGACCGCATCTCCGTGTACTACAATGAAGCCACAGGCGGCAAATATGTTCCTCGTGCTAT
THY01_0016_H05.b :
20110601C-006970 : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
---------+---------+---------+---------+---------+---------+ 433
OVR01_0051_F02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0044_H01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BFLT1_0126_G11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0001_G08.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0062_H02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0072_D07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0041_F01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0034_C03.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0143_A01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0140_A08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TES01_0001_H09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BFLT1_0152_F05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0056_B04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BMWN1_0045_B10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LNG01_0010_B07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PTG01_0048_D01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0003_F11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0014_B04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
UTR01_0012_F06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0022_F06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TCH01_0051_G03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0106_C11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0079_G08.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0029_E11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0090_D05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0035_G06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0098_C07.b : CTTGTTGGATCTAGAACCCAGGACTAAGGACTCTGTGCGCTCAGGTCCTTTCtgactgat
OVRM1_0079_A03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0007_A03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0003_D02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0057_H03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0066_B11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCCGATCGCGCAGGTCCTCTCGGACAGAT
OVR01_0083_H11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCCGTCCGAT
DCI01_0018_F12.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PTG01_0041_H03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BMWN1_0097_B06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0021_E06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
HTMT1_0104_F03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
HTMT1_0055_A12.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0111_H02.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BMWN1_0088_D07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0024_E08.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0122_A06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0043_A12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0022_H08.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0022_H02.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0101_H07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0071_H09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CLNT1_0115_H10.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0154_A11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0202_F04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0008_A06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0119_A07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0063_H07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0032_H03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0037_B06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TES01_0006_H08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CLNT1_0092_D05.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LNG01_0013_F07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0037_B11.b : CTTGGTGGATCTAGAACCTGNGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0001_G04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0200_C08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0033_A07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0029_F02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0025_H08.b : CTTGGTGGATCTAGAACCTGGGACTACGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0033_H08.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TES01_0022_G07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0017_G09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SKNB1_0004_H11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPLT1_0062_G07.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ADR01_0040_F04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
HTMT1_0060_C07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0003_H08.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0037_D10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0075_B02.b : CTTGATGAATCTAAAAACCAGGACTATGGACTCTGTTCGCTCAAGTCCTTTCCGTCATAT
BMWN1_0083_C07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0050_G03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVR01_0057_E10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0062_H07.b : CTTGGTAGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CBLT1_0079_D01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0063_B06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0021_C12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0041_F08.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0003_A06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0126_C10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
HTMT1_0124_A03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BMWN1_0008_D04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CBLT1_0012_C08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0148_F02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPLT1_0059_E12.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BMWN1_0061_E05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ILNT1_0062_E03.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPLT1_0066_G07.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BMWN1_0030_D07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CLNT1_0133_D12.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0041_A10.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
HTMT1_0127_E07.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0039_G06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0061_G10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0032_A06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CBLT1_0062_H10.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0096_C03.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CBLT1_0003_C10.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0113_A12.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0048_C07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0040_H07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0173_E03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0118_B05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0108_F04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0118_A11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0005_D07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAAGTCCTTTCGGTCAGAT
DCI01_0059_E10.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0180_B09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0028_B06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCNGTCAGAT
LVRM1_0024_A05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0075_C04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0114_A03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0137_E01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0154_B02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0065_E11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0151_B07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0153_B07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0058_H04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0126_G08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0125_H11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0014_A05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0050_C01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0168_G07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0121_B10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0050_A12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0022_H04.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0070_B01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0022_G09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0033_F09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCCTTCGGTCAGAT
DCI01_0019_D10.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0019_D02.b : CTTGGTCGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0024_F06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0071_F08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0046_B05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0019_C11.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LNG01_0073_H04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0014_C03.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0031_G10.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0023_F11.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0099_A06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0033_C11.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
UTR01_0038_D07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0061_B11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PTG01_0021_H10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CLNT1_0152_A01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0065_E02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0036_B04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0096_A11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0022_G11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0074_C01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0015_E06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0005_B07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0012_G09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0055_G10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0089_B01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BKFL1_0022_F11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SMG01_0067_D06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0005_G06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0010_B05.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0086_D10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0050_C12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0053_E02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
MLTL1_0100_H05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0001_D08.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
UTR01_0060_F12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACCCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0004_F03.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TCH01_0036_C07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0095_D05.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0037_D04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0207_G03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVR01_0099_D01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVR01_0058_F06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0037_D02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0001_D11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
UTR01_0087_C06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0050_H08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0019_G11.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0072_F09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0079_F01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0012_D03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0072_D05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0064_H12.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0086_E02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0062_F08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0061_F05.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0059_B04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0080_D02.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0057_D11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0127_H05.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCCGGTCCTTTCGGTCAGAT
OVR01_0013_B02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0072_D11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0081_D01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0073_D04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0039_G06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PBL01_0002_E05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0119_F11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0210_C06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0007_F11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0030_B06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0085_H09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0061_C04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0085_H04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0010_B08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0107_G09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0119_D04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0039_D01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0037_G03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCANGTCCTTTCGGTCAGAT
DCI01_0008_E05.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0120_B01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0107_A09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0087_F04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0091_G01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0100_F04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0014_B12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0201_C09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0022_B03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0041_G12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
UTR01_0009_F10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PTG01_0044_B11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0009_H09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BFLT1_0024_G02.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0062_D09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0122_G06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0133_B01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0102_C09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVR01_0089_C08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0064_F10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
MLN01_0035_F10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PBL01_0081_A05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LNG01_0064_A12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0100_A02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0076_D12.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PBL01_0066_F03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0063_A06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPLT1_0035_A10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TES01_0051_B04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TES01_0112_H12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TES01_0016_C07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TES01_0021_E09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PCT01_0036_A09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0062_H09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0079_A05.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0080_E09.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0065_H05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PST01_0095_G01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
KDN01_0065_B03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
HTMT1_0011_H05.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0007_G01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0041_D04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BFLT1_0032_F04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRT1_0018_E06.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ADR01_0075_B08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0064_G04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
KDN01_0019_B05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CLNT1_0098_E03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
KDN01_0020_D05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
KDN01_0025_B08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
PBL01_0093_B05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SKNB1_0043_D07.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TCH01_0041_A04.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
MLN01_0078_G08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0087_C02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LVRM1_0148_A07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0113_A12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CBLT1_0012_C09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SKNB1_0049_A05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0075_A10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0078_F07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0101_A11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BFLT1_0022_C11.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0095_A09.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCT*TCAGAT
CLNT1_0070_B01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0028_H07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
CBLT1_0076_B05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ITT01_0007_D08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
TES01_0099_C11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
BMWN1_0080_E03.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0113_H11.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0134_G08.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0050_B05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SPL01_0048_A11.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTTTGTTCGCTCAGGTCCTTTCGGTCAGAT
UTR01_0080_B05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
LNG01_0024_D11.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
HTMT1_0002_G01.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
ADR01_0005_B06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0105_C06.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0023_E12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVR01_0082_E12.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
AMP01_0009_F10.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCTTTTCGGTCAGAT
OVRM1_0088_F07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
OVRM1_0207_F07.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0049_C02.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
SMG01_0002_H05.b : CTTGGTGGATCTAGAACCCGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
DCI01_0107_B01.b : CTTGGTGGATCTAGAACCTGGGACTATGGACTCTGTTCGCTCAGGTCCTTTCGGTCAGAT
THY01_0016_H05.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-006970 : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
---------+---------+---------+---------+---------+---------+ 490
OVR01_0051_F02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0044_H01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BFLT1_0126_G11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0001_G08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0062_H02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0072_D07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0041_F01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0034_C03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0143_A01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0140_A08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TES01_0001_H09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BFLT1_0152_F05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0056_B04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BMWN1_0045_B10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LNG01_0010_B07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PTG01_0048_D01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAAACACTGGGGCCA
OVRM1_0003_F11.b : CTTCAGACCATGACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0014_B04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
UTR01_0012_F06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0022_F06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TCH01_0051_G03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0106_C11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCGGGGGCAGGCAACAACTGGGCCAA
OVRT1_0079_G08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0029_E11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0090_D05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0035_G06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0098_C07.b : caactgaccccataaatttggatacaatcggtcccaggtaagacacatacgacccgaaga
OVRM1_0079_A03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0007_A03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0003_D02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0057_H03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0066_B11.b : CATTAGATCA*GACAACT*TTGatattattatacactgcagcagctatcgcgaggaccga
OVR01_0083_H11.b : CTTCCGACCA*GAACACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGGCAA
DCI01_0018_F12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGTCAA
PTG01_0041_H03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BMWN1_0097_B06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0021_E06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
HTMT1_0104_F03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
HTMT1_0055_A12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0111_H02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BMWN1_0088_D07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0024_E08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0122_A06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCCA
OVRM1_0043_A12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0022_H08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0022_H02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0101_H07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0071_H09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CLNT1_0115_H10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0154_A11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0202_F04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0008_A06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0119_A07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0063_H07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPL01_0032_H03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0037_B06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TES01_0006_H08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CLNT1_0092_D05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LNG01_0013_F07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0037_B11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCCACAACTGGGCCCA
AMP01_0001_G04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0200_C08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0033_A07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPL01_0029_F02.b : CTTCAGACCA*GACCACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0025_H08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0033_H08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TES01_0022_G07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0017_G09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SKNB1_0004_H11.b : CTTCACACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPLT1_0062_G07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ADR01_0040_F04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
HTMT1_0060_C07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0003_H08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0037_D10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0075_B02.b : CTTCAGACCA*GACTACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACACCTGGGCCAA
BMWN1_0083_C07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0050_G03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVR01_0057_E10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0062_H07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CBLT1_0079_D01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPL01_0063_B06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0021_C12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0041_F08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0003_A06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0126_C10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
HTMT1_0124_A03.b : CTTCAGACCA*GACAACT*TTGTTTTTTGGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BMWN1_0008_D04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGGCAGGCACAACTGGGCCAA
CBLT1_0012_C08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0148_F02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPLT1_0059_E12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BMWN1_0061_E05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ILNT1_0062_E03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPLT1_0066_G07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BMWN1_0030_D07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CLNT1_0133_D12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0041_A10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
HTMT1_0127_E07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0039_G06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0061_G10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0032_A06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CBLT1_0062_H10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0096_C03.b : CTTCCGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CBLT1_0003_C10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0113_A12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCGGGCAACAACTGGGCCAA
OVRM1_0048_C07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACCGAGCCAA
OVRM1_0040_H07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0173_E03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAAGCAACAACTGGGCCAA
THY01_0118_B05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0108_F04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0118_A11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0005_D07.b : CTTCAGACCA*GACAACT*TTGGTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0059_E10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0180_B09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0028_B06.b : CTTCAGACCA*GACAACTTTTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGGCCA
LVRM1_0024_A05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0075_C04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0114_A03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0137_E01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGGCACAACTGGGCCAA
OVRM1_0154_B02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0065_E11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0151_B07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0153_B07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0058_H04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0126_G08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0125_H11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGCCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0014_A05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0050_C01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0168_G07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0121_B10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0050_A12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0022_H04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0070_B01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0022_G09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0033_F09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0019_D10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0019_D02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0024_F06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0071_F08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0046_B05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0019_C11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LNG01_0073_H04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0014_C03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0031_G10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0023_F11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0099_A06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0033_C11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAGCTGGGCCAA
UTR01_0038_D07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0061_B11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PTG01_0021_H10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CLNT1_0152_A01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0065_E02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0036_B04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0096_A11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0022_G11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0074_C01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0015_E06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0005_B07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0012_G09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0055_G10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0089_B01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BKFL1_0022_F11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SMG01_0067_D06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0005_G06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0010_B05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAATTGGGCCAA
THY01_0086_D10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0050_C12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACGACTGGGCCAA
ITT01_0053_E02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
MLTL1_0100_H05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0001_D08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
UTR01_0060_F12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0004_F03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TCH01_0036_C07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0095_D05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0037_D04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0207_G03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVR01_0099_D01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVR01_0058_F06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0037_D02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0001_D11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
UTR01_0087_C06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0050_H08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPL01_0019_G11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0072_F09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0079_F01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0012_D03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0072_D05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0064_H12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0086_E02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0062_F08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0061_F05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0059_B04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0080_D02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0057_D11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0127_H05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0013_B02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0072_D11.b : CTTCAGACCA*GACAAC**TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0081_D01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0073_D04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0039_G06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PBL01_0002_E05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0119_F11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0210_C06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0007_F11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0030_B06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCNNACACTGGGCCNA
OVRT1_0085_H09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPL01_0061_C04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0085_H04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0010_B08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0107_G09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0119_D04.b : CTTCAGACCA*CACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPL01_0039_D01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0037_G03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0008_E05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0120_B01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0107_A09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0087_F04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0091_G01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0100_F04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0014_B12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0201_C09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0022_B03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0041_G12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
UTR01_0009_F10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PTG01_0044_B11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPL01_0009_H09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BFLT1_0024_G02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0062_D09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0122_G06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0133_B01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAG**********GCAACAACTGGGCCAA
SPL01_0102_C09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVR01_0089_C08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0064_F10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
MLN01_0035_F10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PBL01_0081_A05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LNG01_0064_A12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0100_A02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0076_D12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PBL01_0066_F03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0063_A06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPLT1_0035_A10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TES01_0051_B04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TES01_0112_H12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TES01_0016_C07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TES01_0021_E09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PCT01_0036_A09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0062_H09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0079_A05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0080_E09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0065_H05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PST01_0095_G01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
KDN01_0065_B03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
HTMT1_0011_H05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0007_G01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0041_D04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BFLT1_0032_F04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRT1_0018_E06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAGCAACTGGGCCAA
ADR01_0075_B08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0064_G04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
KDN01_0019_B05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CLNT1_0098_E03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
KDN01_0020_D05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
KDN01_0025_B08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
PBL01_0093_B05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SKNB1_0043_D07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TCH01_0041_A04.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
MLN01_0078_G08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0087_C02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
LVRM1_0148_A07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0113_A12.b : CTTCAGACCA*GACAGCT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CBLT1_0012_C09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SKNB1_0049_A05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0075_A10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0078_F07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0101_A11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BFLT1_0022_C11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0095_A09.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CLNT1_0070_B01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0028_H07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
CBLT1_0076_B05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ITT01_0007_D08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
TES01_0099_C11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
BMWN1_0080_E03.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0113_H11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0134_G08.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0050_B05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SPL01_0048_A11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
UTR01_0080_B05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACAGGGCCAA
LNG01_0024_D11.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
HTMT1_0002_G01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
ADR01_0005_B06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0105_C06.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0023_E12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVR01_0082_E12.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGGCTGGGGCAGGCAACAACTGGGCCAA
AMP01_0009_F10.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0088_F07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
OVRM1_0207_F07.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0049_C02.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
SMG01_0002_H05.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
DCI01_0107_B01.b : CTTCAGACCA*GACAACT*TTGTTTTT*GGTCAGTCTGGGGCAGGCAACAACTGGGCCAA
THY01_0016_H05.b : xxxxxxxxxxxxxxxxxxxTTGTTTTT*GGTCAGTCTGGGGTAGGCAACAACTGGGCCAA
20110601C-006970 : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
---------+---------+---------+---------+---------+---------+ 550
OVR01_0051_F02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0044_H01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BFLT1_0126_G11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0001_G08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0062_H02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0072_D07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PST01_0041_F01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0034_C03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTTCGAAAGA
OVRT1_0143_A01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0140_A08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TES01_0001_H09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BFLT1_0152_F05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0056_B04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BMWN1_0045_B10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LNG01_0010_B07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PTG01_0048_D01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGNTGACTCAGTCCTGGATGTGGGTCGGA*GGA
OVRM1_0003_F11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0014_B04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
UTR01_0012_F06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0022_F06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TCH01_0051_G03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0106_C11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0079_G08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0029_E11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0090_D05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0035_G06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0098_C07.b : accgcatatacacacgcggctataattgcggacccaccaacaggagaagatcaaatagta
OVRM1_0079_A03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0007_A03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGCTGACTCAGTCCTGGATGTGGTTCGGAACGA
PST01_0003_D02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PST01_0057_H03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0066_B11.b : cggaaattaccatacaacacctgagttcggattaatcacgtccgtaaccccacttcgcct
OVR01_0083_H11.b : GGGCCACTATACAAAAGGGGCTGAACTGGTTGACTCACTCCCGGATGTGGGTCCGAAGGA
DCI01_0018_F12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PTG01_0041_H03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BMWN1_0097_B06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0021_E06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
HTMT1_0104_F03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
HTMT1_0055_A12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0111_H02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BMWN1_0088_D07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0024_E08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAAGA
LVRM1_0122_A06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0043_A12.b : GAGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0022_H08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0022_H02.b : GGGCCACTATTCAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAANGA
AMP01_0101_H07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0071_H09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CLNT1_0115_H10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0154_A11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0202_F04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0008_A06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0119_A07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0063_H07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPL01_0032_H03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0037_B06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TES01_0006_H08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGACGTGGTTCGGAAGGA
CLNT1_0092_D05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LNG01_0013_F07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0037_B11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCANTCCTGGATGTGGTTCGGAAGGA
AMP01_0001_G04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0200_C08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0033_A07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPL01_0029_F02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0025_H08.b : GGGGCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAANG
DCI01_0033_H08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTTCGAAAGA
TES01_0022_G07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0017_G09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SKNB1_0004_H11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPLT1_0062_G07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ADR01_0040_F04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
HTMT1_0060_C07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0003_H08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0037_D10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0075_B02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BMWN1_0083_C07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0050_G03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVR01_0057_E10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0062_H07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CBLT1_0079_D01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPL01_0063_B06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0021_C12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0041_F08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGCTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0003_A06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0126_C10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
HTMT1_0124_A03.b : AGGCCACTATACAAAAAGGGCTGACCTGGTTGACTCANTCCTGGATGTGGTTCGGAAGGA
BMWN1_0008_D04.b : *GGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCANTCCTGGATGTGGTTCGGAAAGG
CBLT1_0012_C08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0148_F02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPLT1_0059_E12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BMWN1_0061_E05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ILNT1_0062_E03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPLT1_0066_G07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BMWN1_0030_D07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CLNT1_0133_D12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0041_A10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
HTMT1_0127_E07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0039_G06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0061_G10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0032_A06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CBLT1_0062_H10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0096_C03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CBLT1_0003_C10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0113_A12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0048_C07.b : GGGCCCCTATACAAAAGGGGCTGAACTGGTTGAATCACTGCTGGAagcggctcggcacga
OVRM1_0040_H07.b : AGGCCACTATACAGAAAGGGCTGAACTGGTTGACTCATCCCTGGATGTGGGTCGGAAGaa
OVRM1_0173_E03.b : GGGCCACTATACAGAAGGGGCTGACCTGGTTGACTTAGTCCAGGATGTGTCTCGGAGGGA
THY01_0118_B05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCACTCCTGGATGTGGTTCGGAAGGA
THY01_0108_F04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0118_A11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0005_D07.b : GGGCCACTATACAGAAAGGGCTGAGCTGGTTGACTCAATCCTGGATGTGGTTCGGAAGGA
DCI01_0059_E10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0180_B09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0028_B06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGGTGACTCAGTCTTGGATGTGGTCCGGAAGGA
LVRM1_0024_A05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0075_C04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0114_A03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0137_E01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0154_B02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0065_E11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0151_B07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0153_B07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0058_H04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0126_G08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0125_H11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0014_A05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0050_C01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0168_G07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0121_B10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0050_A12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0022_H04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0070_B01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0022_G09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0033_F09.b : GGGCCACTATACAGAAAGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGGTTCGAAAGA
DCI01_0019_D10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0019_D02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0024_F06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0071_F08.b : GGGCCACTATACAGAAGGGGCTGAACTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0046_B05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0019_C11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LNG01_0073_H04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0014_C03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0031_G10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAAGA
DCI01_0023_F11.b : GGGCCACTATACAGAAGGCGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0099_A06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0033_C11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
UTR01_0038_D07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0061_B11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PTG01_0021_H10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CLNT1_0152_A01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0065_E02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0036_B04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0096_A11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0022_G11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PST01_0074_C01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0015_E06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0005_B07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0012_G09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0055_G10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0089_B01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BKFL1_0022_F11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SMG01_0067_D06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0005_G06.b : GGGCCACTATACAGAAGGGGCTGAGTTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0010_B05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0086_D10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0050_C12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0053_E02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
MLTL1_0100_H05.b : GGGCCACTATACAGAGGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0001_D08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
UTR01_0060_F12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0004_F03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TCH01_0036_C07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0095_D05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0037_D04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0207_G03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVR01_0099_D01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVR01_0058_F06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0037_D02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0001_D11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
UTR01_0087_C06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0050_H08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPL01_0019_G11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0072_F09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0079_F01.b : TGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0012_D03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0072_D05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0064_H12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0086_E02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0062_F08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0061_F05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0059_B04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0080_D02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0057_D11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0127_H05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0013_B02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0072_D11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0081_D01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0073_D04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0039_G06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PBL01_0002_E05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0119_F11.b : GGGCCACTATACAGAAGGGGCTGGGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0210_C06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0007_F11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0030_B06.b : GGGCCACTATACAGAAAGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0085_H09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPL01_0061_C04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0085_H04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0010_B08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0107_G09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0119_D04.b : GGGCCACTATACAGAACGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAACGA
SPL01_0039_D01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0037_G03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCANTCCTGGATGTGGTTCGGAAGGA
DCI01_0008_E05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0120_B01.b : GGGCCACTATACAGAAGGGGCTGAGCTGATTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0107_A09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0087_F04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0091_G01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0100_F04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0014_B12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0201_C09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0022_B03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0041_G12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
UTR01_0009_F10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PTG01_0044_B11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPL01_0009_H09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BFLT1_0024_G02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0062_D09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0122_G06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0133_B01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPL01_0102_C09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGAGGTTCGGAAGGA
LVR01_0089_C08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0064_F10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
MLN01_0035_F10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PBL01_0081_A05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LNG01_0064_A12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0100_A02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0076_D12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PBL01_0066_F03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0063_A06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPLT1_0035_A10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TES01_0051_B04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TES01_0112_H12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TES01_0016_C07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TES01_0021_E09.b : GGGCCACTATACAGGAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PCT01_0036_A09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PST01_0062_H09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PST01_0079_A05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PST01_0080_E09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PST01_0065_H05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PST01_0095_G01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
KDN01_0065_B03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
HTMT1_0011_H05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0007_G01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0041_D04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BFLT1_0032_F04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRT1_0018_E06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ADR01_0075_B08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0064_G04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
KDN01_0019_B05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CLNT1_0098_E03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
KDN01_0020_D05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
KDN01_0025_B08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
PBL01_0093_B05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SKNB1_0043_D07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TCH01_0041_A04.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
MLN01_0078_G08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0087_C02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LVRM1_0148_A07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0113_A12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CBLT1_0012_C09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SKNB1_0049_A05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0075_A10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0078_F07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0101_A11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BFLT1_0022_C11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0095_A09.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CLNT1_0070_B01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0028_H07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
CBLT1_0076_B05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ITT01_0007_D08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
TES01_0099_C11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
BMWN1_0080_E03.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0113_H11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0134_G08.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0050_B05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SPL01_0048_A11.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
UTR01_0080_B05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
LNG01_0024_D11.b : GGGCCACTATACAGAGGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
HTMT1_0002_G01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
ADR01_0005_B06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0105_C06.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0023_E12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVR01_0082_E12.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
AMP01_0009_F10.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0088_F07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
OVRM1_0207_F07.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0049_C02.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
SMG01_0002_H05.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
DCI01_0107_B01.b : GGGCCACTATACAGAAGGGGCTGAGCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
THY01_0016_H05.b : GGGCCACTATACAGAAGGGGCTGACCTGGTTGACTCAGTCCTGGATGTGGTTCGGAAGGA
20110601C-006970 : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
---------+---------+---------+---------+---------+---------+ 607
OVR01_0051_F02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0044_H01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BFLT1_0126_G11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0001_G08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0062_H02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0072_D07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PST01_0041_F01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0034_C03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGAACCACTCGCTGGGC*GGTGG
OVRT1_0143_A01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0140_A08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
TES01_0001_H09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BFLT1_0152_F05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0056_B04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BMWN1_0045_B10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LNG01_0010_B07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PTG01_0048_D01.b : GGCTGAAA*GCTGTGACTGCCTTCAGGGCT*TC*AGCTGAACCACTCCCTGGcgggggac
OVRM1_0003_F11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0014_B04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
UTR01_0012_F06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0022_F06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
TCH01_0051_G03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0106_C11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0079_G08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0029_E11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0090_D05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0035_G06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0098_C07.b : gcgcgtatacgatacatacccgcgcgagaagaatcatgagataggtaaacaatgaaatac
OVRM1_0079_A03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0007_A03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGATCCACTCGCTGGGC*GGTGG
PST01_0003_D02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PST01_0057_H03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0066_B11.b : gaggacgacacgttctcgctgtaagcatgtccaacaattaccactaacaactggcgatac
OVR01_0083_H11.b : GGCTGAGA*GCTTTGACTGCCTTCAGGGGT*TCCCGCTGACCCCCTCCCTGGGC*GGTGG
DCI01_0018_F12.b : GGCTGAAA*GCTGTGACTGCCTTCANGGCT*TCCAGCTGANCCACTCGCTGGGC*GGTGG
PTG01_0041_H03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BMWN1_0097_B06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0021_E06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGNCT*T*CAGCTGACCCACTCGCTGGGC*GGTGG
HTMT1_0104_F03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
HTMT1_0055_A12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0111_H02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BMWN1_0088_D07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0024_E08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0122_A06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0043_A12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0022_H08.b : GGCTGAGA*GCTGTGACTGCCTTCAAGGCTTTCAAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0022_H02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0101_H07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0071_H09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CLNT1_0115_H10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0154_A11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0202_F04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0008_A06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0119_A07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0063_H07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPL01_0032_H03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0037_B06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
TES01_0006_H08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CLNT1_0092_D05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LNG01_0013_F07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0037_B11.b : AGCTGAAA*GCTGTGACTGCCTTCAGGGCT*TC*AGCTGACCAACTCGCTGGGC*GGTGG
AMP01_0001_G04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0200_C08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0033_A07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPL01_0029_F02.b : GGCTGAGA*GCTGTGACTGCCTTCAAGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0025_H08.b : AGCTGAGA*GCTGTGACTGCCTTCAGGNCT*TCCAGCTGACCCACTCGCTGGGG*CGTGG
DCI01_0033_H08.b : GGCTGGNA*GCTGTGACTGCCTTCANGGCT*TCCAGCTGACCCACTCGCTGGGG*CGTGG
TES01_0022_G07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0017_G09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGAACCACTCGCTGGGC*GGTGG
SKNB1_0004_H11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPLT1_0062_G07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ADR01_0040_F04.b : GGCTGAGA*GCTGTGACCGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
HTMT1_0060_C07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0003_H08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0037_D10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0075_B02.b : GGCTGACA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BMWN1_0083_C07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0050_G03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVR01_0057_E10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0062_H07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CBLT1_0079_D01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPL01_0063_B06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0021_C12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0041_F08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0003_A06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0126_C10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGGC*TTCAGCTGAACCACTCCCTGGGC*CGNGG
HTMT1_0124_A03.b : NGCTGANA*ACCTGTACTGCCTTCAAGGCT*TTCAGCTGACCCACTCGCTTGGG*GGTGG
BMWN1_0008_D04.b : AGCTGAAA*ACTGTGACTGCCTTCAGGCCT*TCAA*CTGACCCAATCGCTGGGC*GGTGc
CBLT1_0012_C08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0148_F02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPLT1_0059_E12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BMWN1_0061_E05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ILNT1_0062_E03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPLT1_0066_G07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BMWN1_0030_D07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CLNT1_0133_D12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0041_A10.b : GGCTGAGA*GCTGTGACTGCCTTCANGGCT*TCCAGCTGACCCACTCGCTAGGC*GGTGG
HTMT1_0127_E07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0039_G06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0061_G10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0032_A06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CBLT1_0062_H10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0096_C03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CBLT1_0003_C10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0113_A12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0048_C07.b : tgatgacccacggaactgcttacaaggcatacggtgtcccgcctgagcggaagcgtcgcg
OVRM1_0040_H07.b : gccgagaactgtgactgcccttcgggcttcctactgaaccctccctgggctgtgccaaag
OVRM1_0173_E03.b : GGCagcggcacgaggttaattaaagtgcggtacgggagtaagaagtggacgggagtgaga
THY01_0118_B05.b : GGCTGAGA*GCTGTGAACTGCTTCAGGGCT*TTCAGCctgacccacctgctgggccgggg
THY01_0108_F04.b : GGCTGAGAAGCTGTGACTGCCTTTTGGGCT*TCCccctaacccctcccgggg
THY01_0118_A11.b : GGCTGAAA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0005_D07.b : GGCTGAGA*GCTGTGACTGGCTTCAGGGCT*TGCAGCTGACCCAATCGCTGGGC*GGTGG
DCI01_0059_E10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGn
LVRM1_0180_B09.b : CGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0028_B06.b : AGCTGAAA*GCTGTGACTGCTTTCAGGGGC*TCCAGCTGACCCACTCGCTGGGC*GTTGG
LVRM1_0024_A05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0075_C04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0114_A03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGCTGGTGG
OVRM1_0137_E01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0154_B02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0065_E11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TGCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0151_B07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0153_B07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0058_H04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0126_G08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0125_H11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0014_A05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0050_C01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCCGACCCACTCGCTGGGC*GGTGG
OVRM1_0168_G07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0121_B10.b : GGCTGAGC*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0050_A12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0022_H04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGNCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0070_B01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0022_G09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0033_F09.b : NGCTGAAA*GCTGTGACTGCCTTCAGGNCT*TCCAGCTGANCCACTCGCTGGGG*CGTGG
DCI01_0019_D10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGNC*TTCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0019_D02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGNCTTNCAAGCTGACC*ACTCGCTGGGC*GGTGG
DCI01_0024_F06.b : NGCTGAGA*GCTGTGACTGCCTTCAGGGCT**CCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0071_F08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0046_B05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0019_C11.b : GGCTGAGA*GCTGTGGCTGCCTTCAGGNCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LNG01_0073_H04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0014_C03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0031_G10.b : GGCTGAAA*GCTGTGACTGCCTTCAGGNCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0023_F11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0099_A06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0033_C11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
UTR01_0038_D07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0061_B11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGCGG
PTG01_0021_H10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGCGG
CLNT1_0152_A01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0065_E02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0036_B04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0096_A11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0022_G11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PST01_0074_C01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0015_E06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0005_B07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0012_G09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0055_G10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0089_B01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BKFL1_0022_F11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SMG01_0067_D06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0005_G06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0010_B05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0086_D10.b : GGCTGAGA*GCTGAGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0050_C12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0053_E02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
MLTL1_0100_H05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0001_D08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
UTR01_0060_F12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0004_F03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
TCH01_0036_C07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0095_D05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0037_D04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0207_G03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVR01_0099_D01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVR01_0058_F06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0037_D02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0001_D11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
UTR01_0087_C06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0050_H08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPL01_0019_G11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0072_F09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0079_F01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0012_D03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0072_D05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0064_H12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0086_E02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0062_F08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0061_F05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0059_B04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0080_D02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0057_D11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0127_H05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0013_B02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0072_D11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0081_D01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0073_D04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0039_G06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PBL01_0002_E05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0119_F11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGG*GGNTG
OVRM1_0210_C06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0007_F11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0030_B06.b : *GCTGAAA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0085_H09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPL01_0061_C04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCTCTCGCTGGGC*GGTGG
OVRT1_0085_H04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0010_B08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGCGG
THY01_0107_G09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCCACTGACCCA*TCGCTGGGC*GGTGG
THY01_0119_D04.b : GGCTGAGA*GCTGTGACTGCCTTCCGGGCT*TCCACCTGACCCACTCCCTGGGC*GGTGG
SPL01_0039_D01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0037_G03.b : AGCTGAAA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0008_E05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0120_B01.b : GGCTGGGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0107_A09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0087_F04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0091_G01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0100_F04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0014_B12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0201_C09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0022_B03.b : GGCTGAGA*GCTGAGACTGCCTTCAGGGCT*TCCAGCTGACCCACTTGCTGGGC*GGTGG
THY01_0041_G12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
UTR01_0009_F10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PTG01_0044_B11.b : GGCTGAGA*GCCGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPL01_0009_H09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BFLT1_0024_G02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0062_D09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0122_G06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0133_B01.b : GGCTGAGA*GCTGTGACTGCCTCCAGGGCT*TCCAGCTGACCCACTCTCTGGGC*GGTGG
SPL01_0102_C09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVR01_0089_C08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0064_F10.b : GGCTGAGA*GCTGTGACTGCCTTCAGAGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
MLN01_0035_F10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PBL01_0081_A05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LNG01_0064_A12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0100_A02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0076_D12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PBL01_0066_F03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0063_A06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPLT1_0035_A10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGAACCACTCGCTGGGC*GGTGG
TES01_0051_B04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
TES01_0112_H12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
TES01_0016_C07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGGCCCACTCGCTGGGC*GGTGG
TES01_0021_E09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PCT01_0036_A09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PST01_0062_H09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PST01_0079_A05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PST01_0080_E09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PST01_0065_H05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PST01_0095_G01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
KDN01_0065_B03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
HTMT1_0011_H05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0007_G01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0041_D04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BFLT1_0032_F04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRT1_0018_E06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ADR01_0075_B08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0064_G04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
KDN01_0019_B05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CLNT1_0098_E03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
KDN01_0020_D05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
KDN01_0025_B08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
PBL01_0093_B05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SKNB1_0043_D07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
TCH01_0041_A04.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
MLN01_0078_G08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0087_C02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LVRM1_0148_A07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0113_A12.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CBLT1_0012_C09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SKNB1_0049_A05.b : NGCTGAGA*GCTGTGACTGCCTTCAGGNCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0075_A10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TGCAGCTGACCCACTCACTGGGC*GGTGG
OVRM1_0078_F07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0101_A11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BFLT1_0022_C11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0095_A09.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CLNT1_0070_B01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0028_H07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
CBLT1_0076_B05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ITT01_0007_D08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
TES01_0099_C11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
BMWN1_0080_E03.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0113_H11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0134_G08.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0050_B05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SPL01_0048_A11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
UTR01_0080_B05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
LNG01_0024_D11.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
HTMT1_0002_G01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
ADR01_0005_B06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0105_C06.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0023_E12.b : GGCTGAGA*GCTGTGACTGCCCTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVR01_0082_E12.b : GGCTGAAA*GCTGTGACTGCCTTCCGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
AMP01_0009_F10.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0088_F07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
OVRM1_0207_F07.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0049_C02.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
SMG01_0002_H05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
DCI01_0107_B01.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
THY01_0016_H05.b : GGCTGAGA*GCTGTGACTGCCTTCAGGGCT*TCCAGCTGACCCACTCGCTGGGC*GGTGG
20110601C-006970 : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
---------+---------+---------+---------+---------+---------+ 664
OVR01_0051_F02.b : CACATGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0044_H01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BFLT1_0126_G11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0001_G08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0062_H02.b : CACATGCTCTGGAAT*GGGCACTTTGCTCATCANCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0072_D07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PST01_0041_F01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0034_C03.b : CACAAGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0143_A01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0140_A08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TES01_0001_H09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BFLT1_0152_F05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVRM1_0056_B04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BMWN1_0045_B10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LNG01_0010_B07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PTG01_0048_D01.b : cggctcggaaggggcatttctcatcagcagaatcgggaagatttccggacgcacctgaat
OVRM1_0003_F11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*GGATCCGGGAAGAATA*TCCCGA
OVRM1_0014_B04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
UTR01_0012_F06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0022_F06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TCH01_0051_G03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0106_C11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0079_G08.b : CACAGGCTCCGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0029_E11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0090_D05.b : CACGGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0035_G06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVRM1_0098_C07.b : aaacatgcgagaatatactacaccgccacgcaaaaacacacactagtagaagatgcacga
OVRM1_0079_A03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCTCGA
THY01_0007_A03.b : CACAGGCTCTGGCAT*GGGCACTCTGCTCATCAGCA*AGATCCGTGGAGGATA*TCCCGA
PST01_0003_D02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PST01_0057_H03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0066_B11.b : tcacacaattaccaattgtctattacctacccctcactccatcagctatcagtaatacca
OVR01_0083_H11.b : CCCACGCTCTGGAAA*GGGGACTTTGgctcctcaccagatccgtgaaaaatatccccaac
DCI01_0018_F12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGNC*AGATCCGTGAAGAATA*TCCCCG
PTG01_0041_H03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BMWN1_0097_B06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0021_E06.b : CACANGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
HTMT1_0104_F03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
HTMT1_0055_A12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0111_H02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BMWN1_0088_D07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0024_E08.b : CACCGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAAAT*ATCCGA
LVRM1_0122_A06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0043_A12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0022_H08.b : CACAGGCTCTGGAATGGGGCACTTTGCTCTTCAACA*AGATCCGTGAAAAATA*TCCCGA
DCI01_0022_H02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0101_H07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0071_H09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CLNT1_0115_H10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0154_A11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0202_F04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0008_A06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0119_A07.b : CACAGGCTCTGGGAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0063_H07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPL01_0032_H03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0037_B06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TES01_0006_H08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CLNT1_0092_D05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LNG01_0013_F07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0037_B11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCtcaacaagattctggaaaatatcccgacggc
AMP01_0001_G04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAG
OVRM1_0200_C08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0033_A07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPL01_0029_F02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAAAATAATCCCGA
DCI01_0025_H08.b : CACAGGCTCTGGGAATGGGCACTTTGCTCATCAGCC*AGATCCGTGAA*AATA*ATCCGA
DCI01_0033_H08.b : CACANGCTCTGGAAT*GGGCACTTTGCTCATCAGCC*AGATCCGTGAAAGATA*TCCCGA
TES01_0022_G07.b : CACAAGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0017_G09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAAAT*ATCCGA
SKNB1_0004_H11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPLT1_0062_G07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ADR01_0040_F04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
HTMT1_0060_C07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0003_H08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0037_D10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0075_B02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCACCA*AGATCCGTGAAGAATA*TCCCGA
BMWN1_0083_C07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0050_G03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVR01_0057_E10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0062_H07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CBLT1_0079_D01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPL01_0063_B06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0021_C12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0041_F08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGCGAAGAATA*TCCCGA
DCI01_0003_A06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATTAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0126_C10.b : GACAGGCTCTGGAAT*GGGCACTTgctc
HTMT1_0124_A03.b : CAacagcgtctggaatggcacttttctcatccccaagatccgtgaaaatatcccgaacgc
BMWN1_0008_D04.b : ccaggctcgggatgggccttttctcatcaccaaattcgtgaaaaataccccacccttcat
CBLT1_0012_C08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAACA*AGATCCGTGAAAAAAA**CCCGA
OVRM1_0148_F02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPLT1_0059_E12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BMWN1_0061_E05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ILNT1_0062_E03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPLT1_0066_G07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BMWN1_0030_D07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CLNT1_0133_D12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0041_A10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
HTMT1_0127_E07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0039_G06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0061_G10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0032_A06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAAAT*ATCCGA
CBLT1_0062_H10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0096_C03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CBLT1_0003_C10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0113_A12.b : CACAGGCTCTGGAAC*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0048_C07.b : ataaggcgcggatacgacgtgctcatacagtcacctgaagcggagcgagtgggcaaaacg
OVRM1_0040_H07.b : ctttggaagggccatttgcccatcagcatatcgtgcagatatcccaccccacatgaaacc
OVRM1_0173_E03.b : taaaggaacctgcgagctcggcgttttccagactccgtatactactagatgtagaaacct
THY01_0118_B05.b : gaaaggctctggaatgggccctt
THY01_0108_F04.b :
THY01_0118_A11.b : C*CACGCTCTGGAAT*GGGCACTTgctcatcacaagatccggaagatatccgan
LVRM1_0005_D07.b : CACAGGCTCTCGAAT*GGGCctttgcttatcactagattccggctgaatattctgattgg
DCI01_0059_E10.b :
LVRM1_0180_B09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCANCA*ACAATCGTGAAGAATA*TCCCGA
DCI01_0028_B06.b : CACAGGTTCTGAAAT*GGGCctttgttcatcagcagattcgtggaaaattatccgacggc
LVRM1_0024_A05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCT*AGATCCGTGAAGAATA*TCCCGA
OVR01_0075_C04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0114_A03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCAAAGATCCGTGAATAAAT*TCCCGA
OVRM1_0137_E01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGG
OVRM1_0154_B02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVRM1_0065_E11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATGCGTGAAGAATA*TTCCGA
OVRM1_0151_B07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVRM1_0153_B07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0058_H04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0126_G08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0125_H11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0014_A05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0050_C01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0168_G07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0121_B10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0050_A12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0022_H04.b : CACAGGCTCTGGGAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0070_B01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0022_G09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0033_F09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCC*AGAATCGTGAAAGATA*TCCCGA
DCI01_0019_D10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0019_D02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCC*AGATCCGTGAAGGATA*TCCCGA
DCI01_0024_F06.b : TACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0071_F08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0046_B05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0019_C11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LNG01_0073_H04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0014_C03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGNC*AGATCCGTGAAGAATA*TCCCGA
DCI01_0031_G10.b : CACAGGCTCTGGAAA*TGGCACTTTGCTCATCAGCAAGATCCCGTGAAGAATA*TCCCGA
DCI01_0023_F11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0099_A06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0033_C11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
UTR01_0038_D07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0061_B11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PTG01_0021_H10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CLNT1_0152_A01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0065_E02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0036_B04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0096_A11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0022_G11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PST01_0074_C01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0015_E06.b : CACAGACTCTGGAAT*GGGCACTTTGCTCATCAGCN*AGATCCGTGAAGAATA*TCCCGA
OVR01_0005_B07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0012_G09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0055_G10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0089_B01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BKFL1_0022_F11.b : CACANGCTCTGGAAT*GGGCACTTTGCTTATCAGNC*AGATCCGTGAAAGATA*TCCCGA
SMG01_0067_D06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0005_G06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0010_B05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0086_D10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0050_C12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0053_E02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
MLTL1_0100_H05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGNC*AGATCCGTGAAGAATA*TCCCGA
DCI01_0001_D08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
UTR01_0060_F12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0004_F03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TCH01_0036_C07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0095_D05.b : CACAGGCTCTGGAAT*GGGCACTTTACTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0037_D04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0207_G03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVR01_0099_D01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVR01_0058_F06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0037_D02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0001_D11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
UTR01_0087_C06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0050_H08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPL01_0019_G11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0072_F09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0079_F01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0012_D03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0072_D05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0064_H12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0086_E02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0062_F08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCGGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0061_F05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0059_B04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0080_D02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0057_D11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0127_H05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0013_B02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0072_D11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVRM1_0081_D01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0073_D04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0039_G06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PBL01_0002_E05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0119_F11.b : CACAGGCTCTGGATT*GGcaacttgctatcacaagatcggtaaaatatccgacgc
OVRM1_0210_C06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVRM1_0007_F11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TGCCGA
DCI01_0030_B06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGGTGAAAATA*TCCCCG
OVRT1_0085_H09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPL01_0061_C04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0085_H04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0010_B08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0107_G09.b : CAan
THY01_0119_D04.b : CACACGCTCTGGATT*GGGCNCTTggtccatagcaagatcgtaa
SPL01_0039_D01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0037_G03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCCTCACCA*AGATCCGTGAAAAATA*TTCCGA
DCI01_0008_E05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0120_B01.b : CACAGctctggaatggcactttgcttatcgcaagatcgtgaagaattc
LVRM1_0107_A09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0087_F04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0091_G01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0100_F04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0014_B12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0201_C09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0022_B03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCT*AGATCCGTGAAGAATA*TCC*GA
THY01_0041_G12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
UTR01_0009_F10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PTG01_0044_B11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPL01_0009_H09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BFLT1_0024_G02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0062_D09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0122_G06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0133_B01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPL01_0102_C09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVR01_0089_C08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0064_F10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
MLN01_0035_F10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PBL01_0081_A05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LNG01_0064_A12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0100_A02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0076_D12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PBL01_0066_F03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0063_A06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPLT1_0035_A10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCANCA*AGATCCGTGAAGAATA*TCCCGA
TES01_0051_B04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TES01_0112_H12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TES01_0016_C07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TES01_0021_E09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PCT01_0036_A09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PST01_0062_H09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PST01_0079_A05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PST01_0080_E09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PST01_0065_H05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PST01_0095_G01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
KDN01_0065_B03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
HTMT1_0011_H05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0007_G01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0041_D04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BFLT1_0032_F04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRT1_0018_E06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ADR01_0075_B08.b : CACAGGCTCTGGAAT*GGGCACTCTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0064_G04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
KDN01_0019_B05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CLNT1_0098_E03.b : CACAGGCTCTGGAAT*GGGCACTTTGCCCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
KDN01_0020_D05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
KDN01_0025_B08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
PBL01_0093_B05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SKNB1_0043_D07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TCH01_0041_A04.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
MLN01_0078_G08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0087_C02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LVRM1_0148_A07.b : CACAGGCTCTGGGAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0113_A12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CBLT1_0012_C09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SKNB1_0049_A05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0075_A10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAAAA*TAACGG
OVRM1_0078_F07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0101_A11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BFLT1_0022_C11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0095_A09.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CLNT1_0070_B01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0028_H07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
CBLT1_0076_B05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ITT01_0007_D08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
TES01_0099_C11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
BMWN1_0080_E03.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0113_H11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0134_G08.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0050_B05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SPL01_0048_A11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
UTR01_0080_B05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
LNG01_0024_D11.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
HTMT1_0002_G01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
ADR01_0005_B06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0105_C06.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0023_E12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVR01_0082_E12.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
AMP01_0009_F10.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0088_F07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
OVRM1_0207_F07.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0049_C02.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
SMG01_0002_H05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
DCI01_0107_B01.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
THY01_0016_H05.b : CACAGGCTCTGGAAT*GGGCACTTTGCTCATCAGCA*AGATCCGTGAAGAATA*TCCCGA
20110601C-006970 : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
---------+---------+---------+---------+---------+---------+ 719
OVR01_0051_F02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGAAAC*CGTG
THY01_0044_H01.b : CCGCAT*CATGAATACCCTTTCAGTGTCGTGCCCTCACCC*AAAGGGTCTGACAC*Ccgt
BFLT1_0126_G11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCTCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0001_G08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0062_H02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0072_D07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*TAAGTGTCTGACAC*CGTG
PST01_0041_F01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0034_C03.b : ACGCAT*CATGGATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACCA*CGTG
OVRT1_0143_A01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCCGACAC*CGTG
OVRT1_0140_A08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC**AAGTGTCTGACAC*CGTG
TES01_0001_H09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BFLT1_0152_F05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LVRM1_0056_B04.b : CCGCAT*CATGAATACC**TTCAGTGCCGTGCCCTCACCC**AAGTGTCTGACAC*CGTG
BMWN1_0045_B10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LNG01_0010_B07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PTG01_0048_D01.b : accttcagggccggccctccccaaaaggccgaaacctggttgaacctaaaacgccccctt
OVRM1_0003_F11.b : CCGCAT*CATGAATACC**TTCAGTGCCGGGCCCTCCCCC**AAGTGTGTGACACCCGTG
OVRM1_0014_B04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
UTR01_0012_F06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0022_F06.b : CCGCATCCATGAATACC**TTCAGTGTCGTGCCCTCACCCCAAAGTGTCTGACAC*CGTG
TCH01_0051_G03.b : CCGCAT*CATGAATACC**TTCAGTGCCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0106_C11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0079_G08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0029_E11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0090_D05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0035_G06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LVRM1_0098_C07.b : cgaagaattagctgttacgcctgcaaacttgtatgccctaacaataatagagtttccaca
OVRM1_0079_A03.b : CCGCAT*CATGAATACT**TCCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0007_A03.b : CCGCAT*CATGATTACC**TTCAGTGGCGTGCCCTCAC*C*AAAGTGTCTGACAC*CGTG
PST01_0003_D02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PST01_0057_H03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0066_B11.b : ttcccgcaatcgatcttcctttacatctccctcgcctagtctcgtctctcagtgccgtac
OVR01_0083_H11.b : ccccttatgaaataccttcagggggcggggccccccccccaagggttttgaaaccccggg
DCI01_0018_F12.b : ACGCAC*CATGAATACC**CTCAGTGTCGTGCCCTCACCC*AA*GTGTCTGACAC*C*TG
PTG01_0041_H03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BMWN1_0097_B06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC**AAGTGTCTGACAC*CGTG
DCI01_0021_E06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC**AAGTGTCTGACAC*C*TG
HTMT1_0104_F03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
HTMT1_0055_A12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0111_H02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BMWN1_0088_D07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0024_E08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCAC*C*AAAGTGTCTGACAC*CGTG
LVRM1_0122_A06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0043_A12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0022_H08.b : CCGCAT*CATGAATACC**CTTCATGTCCTGCCCTCCCCC*AAAATGTCTGAaaacggtg
DCI01_0022_H02.b : CCGCAT*CATGATTACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
AMP01_0101_H07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCAC*C*AAAGTGTCTGACAC*CGTG
THY01_0071_H09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CLNT1_0115_H10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0154_A11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0202_F04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0008_A06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0119_A07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC**AAGTGTCTGACAC*CGTG
OVRT1_0063_H07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPL01_0032_H03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACC**AAAGTGTCTGACAC*CGTG
OVR01_0037_B06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
TES01_0006_H08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CLNT1_0092_D05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LNG01_0013_F07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0037_B11.b : atcagaataccttcaaggtctggccctcacccaaaaggctggaacccggggttaacccca
AMP01_0001_G04.b :
OVRM1_0200_C08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0033_A07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPL01_0029_F02.b : CCGCAT*CATGAATACC**TTCAGTGTCCTGCCTCCACCC*AAAGGGCCTGAACA*CGTG
DCI01_0025_H08.b : CCGCAT*CATGAATACC**TTCCATGTCTTGCCCTCCCCC*AAAG*GTCTGAAAA*CGTG
DCI01_0033_H08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAATGTCTGGCAACCGTG
TES01_0022_G07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0017_G09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SKNB1_0004_H11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPLT1_0062_G07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ADR01_0040_F04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCGCCC*AAAGTGTCTGACAC*CGTG
HTMT1_0060_C07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0003_H08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACAC*CGTG
ITT01_0037_D10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0075_B02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BMWN1_0083_C07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0050_G03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LVR01_0057_E10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0062_H07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CBLT1_0079_D01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPL01_0063_B06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0021_C12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0041_F08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0003_A06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0126_C10.b :
HTMT1_0124_A03.b : atcatgataccttcattggcgtggcccccccaaagtgtctgacaccgtgggtgaccccta
BMWN1_0008_D04.b : gaaaaccttcttgcctggcccccccaaatttttgaacccgggtttgacccaaaaagcccc
CBLT1_0012_C08.b : CCGCAC*CATGAATACC**CTTAGTGTCTTGCCCTCACCC*CAAGatgtctacagcgtgg
OVRM1_0148_F02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAATGTCTGACAC*CGTG
SPLT1_0059_E12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BMWN1_0061_E05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ILNT1_0062_E03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPLT1_0066_G07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BMWN1_0030_D07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CLNT1_0133_D12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0041_A10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
HTMT1_0127_E07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
AMP01_0039_G06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0061_G10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0032_A06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCN*AAAGTGTCTGACAC*CGTG
CBLT1_0062_H10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0096_C03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CBLT1_0003_C10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0113_A12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0048_C07.b : aacgggcagcagcgtacgagtgaacgcacctatcgcgacgtggccgagacccaggacaaa
OVRM1_0040_H07.b : ttcatgtctgcctccccaagtgccgaaaaccgctgaccctaaaaacacctcccgtgagan
OVRM1_0173_E03.b : acggtaacgtggttttataagcgggggcggagaggacgtaccccgtggggatagccacaa
THY01_0118_B05.b :
THY01_0108_F04.b :
THY01_0118_A11.b :
LVRM1_0005_D07.b : tttttgatatcttttatgtcgttccccgttccgatgtgccgtccacgggtctgttactta
DCI01_0059_E10.b :
LVRM1_0180_B09.b : CCCCAT*CATGGAATAC**TTCAGTGTCGTGCCCTCAGCC*TAAGTGCCTGAaccgtggc
DCI01_0028_B06.b : acatgaataccttcagtgctggccctcaccaaagtgccgaaacgtgggttagcctaaaag
LVRM1_0024_A05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0075_C04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAa
OVRM1_0114_A03.b : CCGCAT*CATGAAAAC***TTCCTTGTCGGGCCCTCACCC*AA*GTGTCTGAAAC*CGGG
OVRM1_0137_E01.b : ACGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACACCGTGG
OVRM1_0154_B02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*NAAGTGTCTGACAC*CGTG
LVRM1_0065_E11.b : CCGCAT*GATGAATACC**TTCAGTGGCGTGCCCTCACCC*AAAGTGTCTGACAC*CGAG
OVRM1_0151_B07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTNCACC*CAAGTGTCTGACAC*CGTG
LVRM1_0153_B07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0058_H04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0126_G08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AA*GTGTCTGACAC*CGTG
OVRM1_0125_H11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCNT*CAC*CAAGTGTCTGACAC*CGTG
OVRM1_0014_A05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0050_C01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0168_G07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0121_B10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCNACC*CAAGTGTCTGACAC*CGTG
THY01_0050_A12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0022_H04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AA*GTGTCTGACAC*CGTG
THY01_0070_B01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0022_G09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0033_F09.b : ACGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACCC*CGTG
DCI01_0019_D10.b : CCGCAT*CATGAATAAC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACA**CGTG
DCI01_0019_D02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCTCCACCC**AAGTGTCTGACAC*CGT*
DCI01_0024_F06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCA*AAAGTGTCTGACAC*CGTG
OVR01_0071_F08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0046_B05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0019_C11.b : ACGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGAACACGTGG
LNG01_0073_H04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0014_C03.b : CCGCAT*CATNGATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAA*CGTG
DCI01_0031_G10.b : CCGCAT*CATGAATACC**TTCAATGTCGTGCCTTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0023_F11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACC**AAAGTGTCTGGCAC*CGTG
AMP01_0099_A06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*A*AGTGTCTGACAC*CGTG
DCI01_0033_C11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*A*AGTGTCTGACAC*CGTG
UTR01_0038_D07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0061_B11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PTG01_0021_H10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CLNT1_0152_A01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
AMP01_0065_E02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACAC*CGTG
OVRT1_0036_B04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0096_A11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0022_G11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PST01_0074_C01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0015_E06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCANNC*CAAGTGTCTGACAC*CGTG
OVR01_0005_B07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0012_G09.b : CCGCAT*CATGAATACT**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0055_G10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0089_B01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BKFL1_0022_F11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AA*GTGTCTGACAC*CGTG
SMG01_0067_D06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0005_G06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACAC*CGTG
DCI01_0010_B05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AA*GTGTCTGACAC*CGTG
THY01_0086_D10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0050_C12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0053_E02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
MLTL1_0100_H05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0001_D08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
UTR01_0060_F12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0004_F03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGCGTCTGACAC*CGTG
TCH01_0036_C07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0095_D05.b : CCGCAT*CATGAATACC**GTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0037_D04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0207_G03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LVR01_0099_D01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LVR01_0058_F06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0037_D02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0001_D11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
UTR01_0087_C06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
AMP01_0050_H08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPL01_0019_G11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0072_F09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*NAAGTGTCTGACAC*CGTG
AMP01_0079_F01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0012_D03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0072_D05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0064_H12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
AMP01_0086_E02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
AMP01_0062_F08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0061_F05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
AMP01_0059_B04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACGC*CGTG
DCI01_0080_D02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0057_D11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACAC*CGTG
OVRT1_0127_H05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0013_B02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0072_D11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LVRM1_0081_D01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0073_D04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*ANAGTGTCTGACAC*CGTG
OVRT1_0039_G06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PBL01_0002_E05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0119_F11.b :
OVRM1_0210_C06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACC**AAAGTGTCTGACAC*CGTG
LVRM1_0007_F11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACGC*CAAGTGTCTGACAC*CGTG
DCI01_0030_B06.b : ACGCAT*CATGAATACC**TTCANGGTCGGGCCCTCCCCC*AAATGGTCTGACACggggt
OVRT1_0085_H09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPL01_0061_C04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0085_H04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0010_B08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACACCNGTG
THY01_0107_G09.b :
THY01_0119_D04.b :
SPL01_0039_D01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
AMP01_0037_G03.b : CCGCAT*CATGAATAACT*TTCAGTGTGTGCCCTCCCCCC*AAATGTCTGGACAC*CGTG
DCI01_0008_E05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0120_B01.b :
LVRM1_0107_A09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACAC*CGTG
OVRM1_0087_F04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0091_G01.b : CCGCAT*CATGNATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0100_F04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCCACC*A*AGTGTCTGACCA*CGTG
OVRM1_0014_B12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0201_C09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*ATAGTGTCTGACAC*CGTG
OVRM1_0022_B03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCATCC*AAAGTGCTTGACAC*CGTG
THY01_0041_G12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCCCAAAGTGTCTGACAC*CGGG
UTR01_0009_F10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PTG01_0044_B11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPL01_0009_H09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BFLT1_0024_G02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0062_D09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0122_G06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0133_B01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPL01_0102_C09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LVR01_0089_C08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0064_F10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
MLN01_0035_F10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PBL01_0081_A05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LNG01_0064_A12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0100_A02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0076_D12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PBL01_0066_F03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0063_A06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPLT1_0035_A10.b : CCGCAT*CATGAATACC**CTCAGTGTCGTGCCCTCACCC*A*AGTGTCTGACAC*CGTG
TES01_0051_B04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
TES01_0112_H12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
TES01_0016_C07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
TES01_0021_E09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PCT01_0036_A09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PST01_0062_H09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PST01_0079_A05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PST01_0080_E09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PST01_0065_H05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PST01_0095_G01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
KDN01_0065_B03.b : CCGCAT*CATGAATACC**CTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
HTMT1_0011_H05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0007_G01.b : CCGCAT*CATGAATACC**TTCAGTGCCGTGCCCTCACCC*CAAGTGTCTGACAC*CGTG
AMP01_0041_D04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BFLT1_0032_F04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRT1_0018_E06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ADR01_0075_B08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0064_G04.b : CCGCAT*CATGAATACC**CTCAGTGTCGTGGCCCTCACC*CAAGTGTCTGACAC*CGTG
KDN01_0019_B05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CLNT1_0098_E03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
KDN01_0020_D05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
KDN01_0025_B08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
PBL01_0093_B05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SKNB1_0043_D07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
TCH01_0041_A04.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
MLN01_0078_G08.b : CCGCAT*CATGAATACC**TCCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0087_C02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LVRM1_0148_A07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACAA*CGTG
OVRM1_0113_A12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CBLT1_0012_C09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCCCCC*AAAGTGTCTGACAC*CGTG
SKNB1_0049_A05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*CAAGTGTCTGACACCCGTG
OVRM1_0075_A10.b : CCGCGT*CATGAATACC**TTCAATGTAATGCCCTCACCAgaaaatctgaccgaaagaat
OVRM1_0078_F07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0101_A11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BFLT1_0022_C11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0095_A09.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CLNT1_0070_B01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0028_H07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
CBLT1_0076_B05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ITT01_0007_D08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
TES01_0099_C11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
BMWN1_0080_E03.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC**AAGTGTCTGACAC*CGTG
DCI01_0113_H11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0134_G08.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCCTCACC*CAAGTGTCTGACAC*CGTG
OVRM1_0050_B05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SPL01_0048_A11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
UTR01_0080_B05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
LNG01_0024_D11.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
HTMT1_0002_G01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
ADR01_0005_B06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACC**AAAGTGTCTGACAC*CGTG
THY01_0105_C06.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC**AAGTGTTTGACNC*CGTG
OVRM1_0023_E12.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVR01_0082_E12.b : CCGCAT*CATGAATACC**TTCCGTGGCGTGCCCCTCCCC*AAAGTGTCTGACAC*CGTG
AMP01_0009_F10.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0088_F07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
OVRM1_0207_F07.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0049_C02.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
SMG01_0002_H05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
DCI01_0107_B01.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
THY01_0016_H05.b : CCGCAT*CATGAATACC**TTCAGTGTCGTGCCCTCACCC*AAAGTGTCTGACAC*CGTG
20110601C-006970 : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
---------+---------+---------+---------+---------+---------+ 775
OVR01_0051_F02.b : GTTGAGCCCT*AAAAAGCCA*CCCctctttgtccatcaatttgtggaaaaaaatgatgag
THY01_0044_H01.b : ggtttgagccctacaacgccacccctcctctggccatcagttgggggaaaaaactgagga
BFLT1_0126_G11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0001_G08.b : GGTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0062_H02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*AACATGAAGA
OVR01_0072_D07.b : GTTGAGCCCT*ACAACGCCA*CCCTCNTCTGTCATCAGTT*GGTGGAGA*ACACTGATGA
PST01_0041_F01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0034_C03.b : GTTGAGCCCT*ACNNACGCC*CCCTTTCTGGTCATCAGTT*GGTGGAAA*ACACTGATGA
OVRT1_0143_A01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCCATCAGT*GGTGGAGA**CACTGATGA
OVRT1_0140_A08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GTGGGAGA**CACTGGTGA
TES01_0001_H09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
BFLT1_0152_F05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LVRM1_0056_B04.b : GTTGAGCCCT*ACAACGtc
BMWN1_0045_B10.b : GGTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LNG01_0010_B07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PTG01_0048_D01.b : ttggccataattgggggaaaaccttgggaaacctcgggcctccaagaggggcttttaaaa
OVRM1_0003_F11.b : GCTGAGCCCT*Aaacgccaccctctctgtctatagttggtggacaacactttttcatact
OVRM1_0014_B04.b : GTTGAGCCCT*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGACn
UTR01_0012_F06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0022_F06.b : GTTGAGCCCT*ACAACGCCACCCCTCTCTGTCCATCAGTT*GGTGGAGAAACACTGATGA
TCH01_0051_G03.b : GGTGACCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAA*ACACTGATGA
OVRT1_0106_C11.b : GTTGAAAGCC*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0079_G08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0029_E11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0090_D05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0035_G06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LVRM1_0098_C07.b : ataagtttgcaacccctta
OVRM1_0079_A03.b : GTTGAGCCCT*ACCACGCCA*CCCTCTCTGTCCATCAGTT*GGCGGAGAn
THY01_0007_A03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACCCTGATGA
PST01_0003_D02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PST01_0057_H03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0066_B11.b : ttgcattgtagttgctcaaccagtacaccccccacctgcacagatattatctacaccaaa
OVR01_0083_H11.b : tttaagcccctaaaacccccccccctccctgggtccctcaagttggggggggaaaacctg
DCI01_0018_F12.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTTCATCAGTT*GGTGGAG**ACACTGATGA
PTG01_0041_H03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGGGGAGA*ACACTGATGA
BMWN1_0097_B06.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA**CACTGATGA
DCI01_0021_E06.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTCAATCAGTT*GGTGGAG**ACACTGATGA
HTMT1_0104_F03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
HTMT1_0055_A12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0111_H02.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*ACACTGATGA
BMWN1_0088_D07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0024_E08.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAG**ACACTGATGA
LVRM1_0122_A06.b : TGTGAGCCCT*TACACGCCA*CCCTCTCTGTACATCA
OVRM1_0043_A12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0022_H08.b : tttgagcctacaacccccccttcttctgtcatcattggggggagaaccctgatgaaacct
DCI01_0022_H02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTTCATCAGTT*GGTGGGAGAACCTTGATGA
AMP01_0101_H07.b : GTTGAGCCCT*ACAACGCCA*C*CTCTCTGTCCATCAGTT*GGTGGAG**ACACTGATGA
THY01_0071_H09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
CLNT1_0115_H10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0154_A11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGG
OVRM1_0202_F04.b : GTTGAAGCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAA
OVRM1_0008_A06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0119_A07.b : GTTGAAGCCC*TACACGCCC*ACCTCTCTGTCCATCANTT*GGTGGAGA*ACACTGATGA
OVRT1_0063_H07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SPL01_0032_H03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0037_B06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
TES01_0006_H08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
CLNT1_0092_D05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LNG01_0013_F07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0037_B11.b : aaaggcacctttctgtccttaattgggggagaaaaccggataaaacctctgggtcccaaa
AMP01_0001_G04.b :
OVRM1_0200_C08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGT
OVRM1_0033_A07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGAC
SPL01_0029_F02.b : GTTGGAGCCCTAAAACCCCA*CCCTCCCTGTCCATCAGTT*GGGGGAAaaaccggagaaa
DCI01_0025_H08.b : GTTtgagcctaaaaccgccccctttctggccatcaggttggggaaaaaacctgataaacc
DCI01_0033_H08.b : GTTGAagcctaaaacgccacccttctctgttcatcagtttggtggaagaccctgatgaac
TES01_0022_G07.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0017_G09.b : GTTGAGCCCT*AC*ACGCCC*ACCTCTCTGTCCATCAGTT*GGTG*AGG*ACACTGATGA
SKNB1_0004_H11.b : GGTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SPLT1_0062_G07.b : GTTGAAAGCC*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ADR01_0040_F04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
HTMT1_0060_C07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0003_H08.b : GTTGACCCCT*ACAACGCCA*CCCTCTCTGNTCATCGGGT*GGTGGAAG*ACACTGATGA
ITT01_0037_D10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0075_B02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
BMWN1_0083_C07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0050_G03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LVR01_0057_E10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0062_H07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
CBLT1_0079_D01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SPL01_0063_B06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0021_C12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0041_F08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0003_A06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGNTCATCAGTT*GGTGGAAG*ACACTGATGA
THY01_0126_C10.b :
HTMT1_0124_A03.b : aacgccacctctctgttcattattggtggaaaacccgataagaccactgcatcgacatga
BMWN1_0008_D04.b : ccttttttcttctttggtggaaactcaggaaaacccccgctcccaaaagggccctttaaa
CBLT1_0012_C08.b : ttgatccctacgacacctcactccacgtcatcagttggtggaaaaaaatgaccagacaca
OVRM1_0148_F02.b : Agttgaaccctacaacgcca
SPLT1_0059_E12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTG*GGTGGAGA*ACACTGATGA
BMWN1_0061_E05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ILNT1_0062_E03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SPLT1_0066_G07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
BMWN1_0030_D07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTTCATCAGTT*GGTGGGAG*ACACTGATGA
CLNT1_0133_D12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0041_A10.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTCCATCAATTTGGTGGAGA*ACACTGATGA
HTMT1_0127_E07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
AMP01_0039_G06.b : GTTGAGCCCT*AC*ACGCCA*CCCTCTCTGNTCATCAGTT*GGTGGAGA**CACTGATGA
THY01_0061_G10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0032_A06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGNT*GGTGGAAG*ACACTGATGA
CBLT1_0062_H10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0096_C03.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
CBLT1_0003_C10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0113_A12.b : GTTGAGCCCT*ANCACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0048_C07.b : gtgtcacagaggaaccgccactgggagctactcgacaaagcgaaac
OVRM1_0040_H07.b : nnnggn
OVRM1_0173_E03.b : acacccatagcggtccgaagaaagcgataga
THY01_0118_B05.b :
THY01_0108_F04.b :
THY01_0118_A11.b :
LVRM1_0005_D07.b : ttacatatcactttcgatttatgtggtagagaaactcgtatttatccctccagtcccctt
DCI01_0059_E10.b :
LVRM1_0180_B09.b : ttaaccttaaaacgccccctctatgtccacagttggg
DCI01_0028_B06.b : gccaccttcttgccataattgggggaaaacttgaataaaccttggccttcaaatgagccc
LVRM1_0024_A05.b : GTTGAGCCCT*ACA
OVR01_0075_C04.b :
OVRM1_0114_A03.b : GTTGAGTCCT*Anacggccccctctcggtcatcagtttgtggaagaacatgatgagactc
OVRM1_0137_E01.b : GTTGAGCCCT*ACCACGCCc
OVRM1_0154_B02.b : GTTGAGCCCT*ACAACGCCA*CCCa
LVRM1_0065_E11.b : GGTGAGCCCT*ACACACCAC*CCTgtctggcatgagtgagggagaagactggtgaagact
OVRM1_0151_B07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCC
LVRM1_0153_B07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGGAG*ACACTGAT
OVRM1_0058_H04.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0126_G08.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0125_H11.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGNAG*ACACTGATGA
OVRM1_0014_A05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCANTT*GGTGGAGA*ACACTGATNA
OVRM1_0050_C01.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCANTT*GGTGGAGA*ACACTGATGA
OVRM1_0168_G07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0121_B10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGGAG*ACACTGATGA
THY01_0050_A12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0022_H04.b : GTTGAACCCT*Aacaacgcaccttctctgccatcagttggtggaaaccctgatgaaccta
THY01_0070_B01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0022_G09.b : GTTGAGCCCT*AC*ACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0033_F09.b : GTTGAACCTT*AAAACGCCA*CCtcttcggtcatcagttggggaaaaacatgatggaaac
DCI01_0019_D10.b : GTTGAGCCCC*TACACGGCA*CCCTCTCgttcattaattggtgaagaccctgatgagact
DCI01_0019_D02.b : GTTGAGCCCT*ACAACGCCA*CCCTCCTGGTCCATCAGTggtgaaaaacatgatgaacct
DCI01_0024_F06.b : GTTGAAGCCT*ACNACGNCA*CCCTCTCTGTCCATCAGTT*GGGTGaaaaacactgatga
OVR01_0071_F08.b : GTTGAGCCCC*TAAACGGCACCCCTCTCTGTCCCTCAGTT*GGTGGGAGAACACTGATGA
THY01_0046_B05.b : GTTGAGCCCT*ACCACGCCA*CCCTCTCTGTCCATCAGTTGGTTGGAAA*ACACTGATGA
DCI01_0019_C11.b : GTTGAGCCCT*ACAACCGCC*ACCTCTCTGTCCATCATTT*GGTGGA*A*ACACTGATGG
LNG01_0073_H04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0014_C03.b : GTTGAGCCCT*ACCACGCCA*CCCTCTCTGTCCATCAGTT*GGGTGAAG*ACACTGATGA
DCI01_0031_G10.b : GTTGAACCCTTACAACGCCA*CCCTCTCTGGTAATCAGTT*GGGTGAAA*ACCCTGGTGA
DCI01_0023_F11.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTCCAATCAGT*GGTGGAGA*ACACTGATGA
AMP01_0099_A06.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGAAGA**CACTGATGA
DCI01_0033_C11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCANTT*GGTGGA*A*ACACTGATGA
UTR01_0038_D07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0061_B11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PTG01_0021_H10.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
CLNT1_0152_A01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
AMP01_0065_E02.b : GTTGAGCCCT*ANCACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*ACACTGATGA
OVRT1_0036_B04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0096_A11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0022_G11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PST01_0074_C01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0015_E06.b : GTTGAGC*CT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA**CACTGATGA
OVR01_0005_B07.b : GTTGAGCCCT*ACCACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0012_G09.b : GGTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0055_G10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0089_B01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
BKFL1_0022_F11.b : GGTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*ACACTGATGA
SMG01_0067_D06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0005_G06.b : GTTGAGCCCT*ACAACGCCA*CCTTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0010_B05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA**CACTGATGA
THY01_0086_D10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0050_C12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0053_E02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
MLTL1_0100_H05.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*ACACTGATGA
DCI01_0001_D08.b : GTTGAACCCC*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
UTR01_0060_F12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0004_F03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCNGTT*GGGTGGAG*ACACTGATGA
TCH01_0036_C07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0095_D05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0037_D04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0207_G03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCCTCAGTT*GGTGGAGA*ACACTGATGA
LVR01_0099_D01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LVR01_0058_F06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0037_D02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0001_D11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
UTR01_0087_C06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
AMP01_0050_H08.b : GTTGAGCCCT*ACAACGC*A*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SPL01_0019_G11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0072_F09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
AMP01_0079_F01.b : GTTGAGCCCN*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGGAG*ACACTGATGA
OVR01_0012_D03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0072_D05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0064_H12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*ACACTGATGA
AMP01_0086_E02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
AMP01_0062_F08.b : GTTGAGCCCT*ANCACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0061_F05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
AMP01_0059_B04.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0080_D02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0057_D11.b : GGTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0127_H05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0013_B02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0072_D11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LVRM1_0081_D01.b : GTTGAGCCCT*ACAACGCCA*CCCn
OVRM1_0073_D04.b : GTTGAGCCCT*AC*ACGCCA*CCCTCTCTGn
OVRT1_0039_G06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PBL01_0002_E05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0119_F11.b :
OVRM1_0210_C06.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LVRM1_0007_F11.b : AATGAGCCCT*ACGACGCCG*CCCTCTGTGGGCATCAGTG*TGGTGAGA*ACACTGATGA
DCI01_0030_B06.b : tgacccctaaaaccccccccttctcgtccatccattgggggaaaacctgatgaaacctac
OVRT1_0085_H09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SPL01_0061_C04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0085_H04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0010_B08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0107_G09.b :
THY01_0119_D04.b :
SPL01_0039_D01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
AMP01_0037_G03.b : GTTGAACCCT*ACAACGCCC*CCCTCTCTGTCCTTCCGTT*GGTGGAAA*ACACTGATGA
DCI01_0008_E05.b : GTTGAGCCCT*ACAACGCCC*CCCTCTCTGTCCCTCAGTT*GGTGGAGA*GCACTGATGA
THY01_0120_B01.b :
LVRM1_0107_A09.b : GTTGAGCCCT*A*AACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA**CACTGATG
OVRM1_0087_F04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0091_G01.b : GTTGAGCCCT*ACAACGC*A*CCCTCTCTGTCCATCAGTT*GGTGGAGA**CACTGATGA
OVRM1_0100_F04.b : GTTGAGCCCT*ATA*CGCCA*CCCTCTCTGTCCATCAGCT*GGTGGAAG*ACACTGATGA
OVRM1_0014_B12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCANTT*GGTGGAGA*ACACTGATGA
OVRM1_0201_C09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0022_B03.b : GTTGAACCCT*ACAACGCCA*TCCTATCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0041_G12.b : GTTGAGCCCCTACAACGCCCCCCCTCTCTGTCCATCAGTG*GGTGGAAA*ACACTGATGA
UTR01_0009_F10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PTG01_0044_B11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*ACACTGATGA
SPL01_0009_H09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
BFLT1_0024_G02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0062_D09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0122_G06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0133_B01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*ACACTGATGA
SPL01_0102_C09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LVR01_0089_C08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0064_F10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGG*ACACTGATGA
MLN01_0035_F10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PBL01_0081_A05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LNG01_0064_A12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0100_A02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0076_D12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PBL01_0066_F03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0063_A06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SPLT1_0035_A10.b : GTTGAGCCCT*ACAACGC*A*CCCTCTCGGTCCATCAGTT*GGTGAA*A*ACACTGATGA
TES01_0051_B04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
TES01_0112_H12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
TES01_0016_C07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
TES01_0021_E09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PCT01_0036_A09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PST01_0062_H09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PST01_0079_A05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PST01_0080_E09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PST01_0065_H05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PST01_0095_G01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
KDN01_0065_B03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
HTMT1_0011_H05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0007_G01.b : GTTTGACCCT*ACAACGCCC*CCCTCTCTGTTCCTCAGTT*GGTGGAGA*ACACTGATGA
AMP01_0041_D04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
BFLT1_0032_F04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRT1_0018_E06.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ADR01_0075_B08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0064_G04.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
KDN01_0019_B05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
CLNT1_0098_E03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
KDN01_0020_D05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
KDN01_0025_B08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
PBL01_0093_B05.b : GTTGGGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SKNB1_0043_D07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
TCH01_0041_A04.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
MLN01_0078_G08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0087_C02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LVRM1_0148_A07.b : GGTGAGCCCT*ACTACGGCA*ACCTCTCTGTCCATCAGTT*GGTGGGAG*ACACTGATGA
OVRM1_0113_A12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCCGTCCATCAGCT*GGTGGAGA*ACACTGATGA
CBLT1_0012_C09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SKNB1_0049_A05.b : GTTGAAGCCT*ACAACGGCC*CCCTCTCTGTCCATCAATT*GGTGGAAA*ACACTGATGA
OVRM1_0075_A10.b : gagcctacgaaaagacactttctgtccatgagttgaaggagacactgatgacacaacaaa
OVRM1_0078_F07.b : GTTGAGCTCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAG**ACACTGATGA
OVRM1_0101_A11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
BFLT1_0022_C11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0095_A09.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
CLNT1_0070_B01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0028_H07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
CBLT1_0076_B05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ITT01_0007_D08.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
TES01_0099_C11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
BMWN1_0080_E03.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA**CACTGATGA
DCI01_0113_H11.b : GTTGAGCCCT*ACAACGTCA*CCCTCTCTGTCCATCAGTT*GGTGGAAG*ACACTGATGA
OVRM1_0134_G08.b : GTTGAGCCCT*ACNACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0050_B05.b : GTTGAGCCCT*ACNACGCCN*CCCTCTCTGTCCATCNATT*GGTGGAGA*ACACTGATGA
SPL01_0048_A11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
UTR01_0080_B05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
LNG01_0024_D11.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
HTMT1_0002_G01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
ADR01_0005_B06.b : GTTGAGCCCC*TACACGCCA*CCCTCTCTGTCCATCATTG*GGTGGA*A*ACACTGATGA
THY01_0105_C06.b : ttggacn
OVRM1_0023_E12.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVR01_0082_E12.b : GTTGAGCCCT*ACAACGCCC*CCCctctctgtccatcaagtggggggagaacactgatgg
AMP01_0009_F10.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0088_F07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
OVRM1_0207_F07.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
THY01_0049_C02.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
SMG01_0002_H05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGA
DCI01_0107_B01.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGTGGAGA*ACACTGATGG
THY01_0016_H05.b : GTTGAGCCCT*ACAACGCCA*CCCTCTCTGTCCATCAGTT*GGCGGAGA*ACACTGATGA
20110601C-006970 : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
---------+---------+---------+---------+---------+---------+ 830
OVR01_0051_F02.b : aactaactgcaatcacaaagagggccctttaagaaatttggcttcccgcattctcaagct
THY01_0044_H01.b : aacctacttggcatccacaaatgaaggccctttccaacttctgcttcccgacttctcagt
BFLT1_0126_G11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCNGCACTCTC*AAG
DCI01_0001_G08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AGG
OVR01_0062_H02.b : GACC*TACTGCATC*CAAAAT*GAGGCCCTTTACGACATCTGCCTTCCGCAATCTC*AAG
OVR01_0072_D07.b : GACC*TACTGCATC*GACCAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PST01_0041_F01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0034_C03.b : AACC*TACTGCATC*GACAAT*GAAGGCCTTTACAAATTCTGCTTCgcattcctaagctg
OVRT1_0143_A01.b : GACC*TACTGCCTC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRT1_0140_A08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTAAGACATCTGC*TTCCGCACTCTC*AAG
TES01_0001_H09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
BFLT1_0152_F05.b : GACC*TACTGCATN*CGACAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LVRM1_0056_B04.b :
BMWN1_0045_B10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LNG01_0010_B07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
PTG01_0048_D01.b : attggtttcccatcccaagggtaacccccccacttgggggcaaaaacccttgttctcccc
OVRM1_0003_F11.b : actgcttgcactatgagg
OVRM1_0014_B04.b :
UTR01_0012_F06.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCAC
OVR01_0022_F06.b : GACCCTACTGCATC*GACAATTGAGGCCCTTTACGACTTCTGC*TTCCGCACTCTCCAAG
TCH01_0051_G03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGCCTTCCGCATTCTC*AAG
OVRT1_0106_C11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*CTCCGCACTCTC*AAG
OVRT1_0079_G08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
OVR01_0029_E11.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ITT01_0090_D05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVR01_0035_G06.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
LVRM1_0098_C07.b :
OVRM1_0079_A03.b :
THY01_0007_A03.b : AAAC*TACTGCCTC*AACAAT*GATGCCCTTTACGACATCTGA*TTCCGCAC
PST01_0003_D02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PST01_0057_H03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRM1_0066_B11.b : ccacgttaacgaac
OVR01_0083_H11.b : gatgtaaacccttttggcctccgacacatgtgggggccccctttaaaaaaaatttggttt
DCI01_0018_F12.b : GACC*TACTGCATC*GAACAT*GAAGCCTTTTAgacatctgcttccgcaatctcagctga
PTG01_0041_H03.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
BMWN1_0097_B06.b : GACC*TACTGCATC*GGACAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0021_E06.b : AACC*TACTGCATC*GACAAT*GGAGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
HTMT1_0104_F03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
HTMT1_0055_A12.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*NTCCGCACTCTC*AAG
OVRT1_0111_H02.b : GACC*TACTGCATC*GACCAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
BMWN1_0088_D07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
DCI01_0024_E08.b : GACC*TACTGCATC*GACAAT*GAGGCC*TTTACGACATCTGC*TTTCGCACTCTC*AAG
LVRM1_0122_A06.b :
OVRM1_0043_A12.b : GACC*T
DCI01_0022_H08.b : actggctccaacaagtaggccctttaaaaatttggttccgcccttttaagttgaaccccc
DCI01_0022_H02.b : AACC*TACTGCATC*GACAAT*GAAGCCCTTTAAAAAATCTGC*TTCgcattctcaacct
AMP01_0101_H07.b : GACC*TACTGCATC*GACCAT*GAGGCCTTTTACGACATCTGC*TTCCGCACTCTN*CAG
THY01_0071_H09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
CLNT1_0115_H10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRM1_0154_A11.b :
OVRM1_0202_F04.b :
OVRM1_0008_A06.b : GACC*TACTGCnatcgacat
OVRM1_0119_A07.b : GACC*TACTGCTTC*GACNAT*GAGGC
OVRT1_0063_H07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SPL01_0032_H03.b : AACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*ATG
OVR01_0037_B06.b : GACC*TACTGCATC*GACAAT*GAAGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
TES01_0006_H08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
CLNT1_0092_D05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LNG01_0013_F07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0037_B11.b : ggagggcctttaaaaatattggtttccccttttcagttgaaacagccaaccttggggaac
AMP01_0001_G04.b :
OVRM1_0200_C08.b :
OVRM1_0033_A07.b :
SPL01_0029_F02.b : acctacgtgctcgacaatgaaggccttttagaaatttgtttcccgaatcctaaaggggac
DCI01_0025_H08.b : cactgcatccacaagaagccctttagaaatttgctttcgcattttaagcgagacccccca
DCI01_0033_H08.b : actacttgcttcaacatggaggccttttaggaatttgctttcgccattctaagcttgacc
TES01_0022_G07.b : GACC*TACTGCATC*GACAAT*GAAGCCCTTTACAACATCTGC*TTCCGCACTCTC*CAG
DCI01_0017_G09.b : GAAC*TACTGCATC*GACAAT*GAAGCCTTTTACGACATCTGC*TTCgcaatctaagctg
SKNB1_0004_H11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SPLT1_0062_G07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ADR01_0040_F04.b : GACC*TACTGCATCGGACATG*AAGGCCCTTTACGACATCTGC*TTNCGCACTCTN*CAG
HTMT1_0060_C07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
DCI01_0003_H08.b : GACC*TACTGCATC*GTCAAT*GATGCCCTTTACGACATCTGC*CTCCGCACTCTC*AAG
ITT01_0037_D10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
ITT01_0075_B02.b : TACC*TACTGCATC*TACAAT*GAGGCCCTTTACAACATCTGC*TTCCGCACTCTC*AAG
BMWN1_0083_C07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
ITT01_0050_G03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LVR01_0057_E10.b : GACC*TACTGCATC*GACAAT*GAGGCCCCTTACGACATCTGC*TTCCCCACTCTC*AAG
THY01_0062_H07.b : GACC*TACCGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCTGCACTCTC*AAG
CBLT1_0079_D01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SPL01_0063_B06.b : AACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAA
OVRT1_0021_C12.b : GACC*TACTGCATC*GACAAT*GAGGCCCCTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0041_F08.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
DCI01_0003_A06.b : GACC*TACTGCATC*GACGAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0126_C10.b :
HTMT1_0124_A03.b : ggccttttcaaatctgcttccccactccagcttacccccccaccttggggacctaaacac
BMWN1_0008_D04.b : aatggtctcccccttctaaagtaccccccaactttgggggactaaacccctttttctccc
CBLT1_0012_C08.b : tggatctaaatagaggctcttaagaaatctggctcctgcactctgatatggaagagcaaa
OVRM1_0148_F02.b :
SPLT1_0059_E12.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
BMWN1_0061_E05.b : AACC*TACTGCATC*GACAAT*GAAGCCCTTTACGACATCTGC*T*CCGCACTTTC*CAG
ILNT1_0062_E03.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SPLT1_0066_G07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTNCGCACTCTC*AAG
BMWN1_0030_D07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTTAGAATTCTGC*TTTCGCACTCTC*AAG
CLNT1_0133_D12.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0041_A10.b : GACC*TACTGCATC*GAACAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*CAG
HTMT1_0127_E07.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
AMP01_0039_G06.b : GACC*TACTGCATC*GANCAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0061_G10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0032_A06.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
CBLT1_0062_H10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0096_C03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
CBLT1_0003_C10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0113_A12.b : GACC*TACTGCATC*GACAAT*GAGGCCTTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRM1_0048_C07.b :
OVRM1_0040_H07.b :
OVRM1_0173_E03.b :
THY01_0118_B05.b :
THY01_0108_F04.b :
THY01_0118_A11.b :
LVRM1_0005_D07.b : cgt
DCI01_0059_E10.b :
LVRM1_0180_B09.b :
DCI01_0028_B06.b : tttaaaatttggtttcccccttaaattaaccagccaacatggggcaccgaaccctttgtc
LVRM1_0024_A05.b :
OVR01_0075_C04.b :
OVRM1_0114_A03.b :
OVRM1_0137_E01.b :
OVRM1_0154_B02.b :
LVRM1_0065_E11.b : g
OVRM1_0151_B07.b :
LVRM1_0153_B07.b :
OVRM1_0058_H04.b : GAC
OVRM1_0126_G08.b : GACC*TACg
OVRM1_0125_H11.b : GACC
OVRM1_0014_A05.b : GAC
OVRM1_0050_C01.b : GACC*TACTGCAc
OVRM1_0168_G07.b : GACC*TACTGCATC*GA
OVRM1_0121_B10.b : GACC*TACTGCATC*GACA
THY01_0050_A12.b : G
DCI01_0022_H04.b : ctgcatcaacatgaagccctttagaaatctgcttcgcattctcagctgaccagccaacta
THY01_0070_B01.b : GACC*TACTGCATC*GACAAT*GAGG
OVRM1_0022_G09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCC
DCI01_0033_F09.b : tactgcatcgacaatgaggcccttttggaatttggtttccgaatcctaagctgaaccgcc
DCI01_0019_D10.b : actgcatcgacatgaggcctttaagaatctgcttcgccatctcaactgacacgccaactt
DCI01_0019_D02.b : actgcttccacaatgagccctttagaaattggcttcgcatttcaagctgaccagccaacc
DCI01_0024_F06.b : agacctactgcatcgacaaagaaggccttttacgaatctgctttcgcattctcagctgaa
OVR01_0071_F08.b : GACC*CACTGCATC*GACAAT*GAGGCCCTTTAAGACATCTGG*TTCCGCACTCTC*AAG
THY01_0046_B05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTAAAACATCTTGCTTCCGCACTCTC*AAG
DCI01_0019_C11.b : AAAC*TACTGCATC*CACAAT*GAAGGCCTTTACGAC*TCTGC*TTTCGCACTCTC*AAA
LNG01_0073_H04.b : GACC*TACTGGATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCGGCACTCTC*AAG
DCI01_0014_C03.b : GACC*TACTGCATC*GACCAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTT*CAG
DCI01_0031_G10.b : GACC*TACTGCATC*GACAAT*GAGGGCCCTTACGAAATCTGC*TTCGCCACTCTC*AAG
DCI01_0023_F11.b : GACC*TACTGCCTC*GACAAT*GAAGCCCTTTACGACATCTGC*TTTCGCACTCTA*AA*
AMP01_0099_A06.b : GACC*TACTGCATC*GACAAT*GAGGGCCTTTACGACATCTGC*CTTCGCCATCCT*CAG
DCI01_0033_C11.b : GACC*TACTGCATC*GANCAT*GAAGCCCTTTACGACATCTGC*TTCCGCACTCTT*CAG
UTR01_0038_D07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVR01_0061_B11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
PTG01_0021_H10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCGGCACTCTC*AAG
CLNT1_0152_A01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
AMP01_0065_E02.b : GACC*TACTGCATC*GACGAT*GAGGCCCTTTA*GACATCTGN*CTTCGCACTCTC*AAG
OVRT1_0036_B04.b : GACC*TACTGCATC*GACAAT*GAAGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ITT01_0096_A11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ITT01_0022_G11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PST01_0074_C01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0015_E06.b : GACC*TACTGCATC*GAACAT*GAGGCCCTTTA*GAAATCTGC*TTC*GCACTCTC*AAG
OVR01_0005_B07.b : GACC*TACTGCATC*GACCAT*GAGGCCCTTTACGACATCTGC*TTCCCCACTCTC*AAG
DCI01_0012_G09.b : GACC*TACTGCATC*GACAAC*GAGGCCCTTTA*GACATCTGC*TTTCGCATTCTC*AAG
OVRT1_0055_G10.b : GACC*TACTGCATC*GACAAT*GANGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ITT01_0089_B01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
BKFL1_0022_F11.b : GACC*TACTGCATC*GANCAT*GAGGGCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SMG01_0067_D06.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0005_G06.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0010_B05.b : GACC*TACTGCATC*GACAAT*GATGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
THY01_0086_D10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRT1_0050_C12.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTN*CAG
ITT01_0053_E02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
MLTL1_0100_H05.b : GACC*TACTGCATC*GANCAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
DCI01_0001_D08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
UTR01_0060_F12.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0004_F03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
TCH01_0036_C07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
DCI01_0095_D05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
OVR01_0037_D04.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0207_G03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LVR01_0099_D01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LVR01_0058_F06.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0037_D02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ITT01_0001_D11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
UTR01_0087_C06.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
AMP01_0050_H08.b : GACC*TACTGCATC*GACGAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SPL01_0019_G11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0072_F09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
AMP01_0079_F01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVR01_0012_D03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0072_D05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0064_H12.b : GACC*TACTGCATC*GACAAT*GAGGCCCCTTACGACATCTGC*TTCCGCACTCTC*AAG
AMP01_0086_E02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
AMP01_0062_F08.b : GACC*TACTGCATC*NGACAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
DCI01_0061_F05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
AMP01_0059_B04.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
DCI01_0080_D02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
OVRM1_0057_D11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTn
OVRT1_0127_H05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVR01_0013_B02.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0072_D11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LVRM1_0081_D01.b :
OVRM1_0073_D04.b :
OVRT1_0039_G06.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
PBL01_0002_E05.b : GACC*TACTGCATC*GACAAT*GAGGTCCTTTACGACATCTGC*TTCCGCACTACT*CAG
THY01_0119_F11.b :
OVRM1_0210_C06.b : GACC*TACTGCn
LVRM1_0007_F11.b : GACC*TACTG
DCI01_0030_B06.b : gggatcgaacaagaggccctttaaaaaatcggttcccccattctaagttaaaccccccac
OVRT1_0085_H09.b : GACC*TACTGCATC*GACAAT*GAAGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SPL01_0061_C04.b : GACC*TACTGCATC*GACAAT*GAAGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
OVRT1_0085_H04.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVR01_0010_B08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0107_G09.b :
THY01_0119_D04.b :
SPL01_0039_D01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
AMP01_0037_G03.b : aaaccttctgcatctacaaaggaggccccttatgaatttggctttcccccccccaagctg
DCI01_0008_E05.b : AACC*TACTGCATC*GACAAT*GAGGCCCCTTTCGACTTCTGC*TTCC*CACTCTC*AAG
THY01_0120_B01.b :
LVRM1_0107_A09.b :
OVRM1_0087_F04.b : GAn
OVRM1_0091_G01.b : GACC*TACTGC
OVRM1_0100_F04.b : GACC*TACTGCA
OVRM1_0014_B12.b : GACC*TACTGCATC*GACNAT*GA
OVRM1_0201_C09.b : GACC*TACTGCATC*GACAAT*GAGGCn
OVRM1_0022_B03.b : GACC*TACTGCATC*GACAAT*GAAGCCttt
THY01_0041_G12.b : GACC*TATGGCTTC*GACAAT*Ggaggccctttaagacttttggctttccgcactctcaa
UTR01_0009_F10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PTG01_0044_B11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SPL01_0009_H09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACTACATCTGC*TTCCGCACTCTT*CAG
BFLT1_0024_G02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0062_D09.b : GACC*TACTGCATCCGACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRT1_0122_G06.b : GACC*TACTGCATC*GNACAT*GAGGGCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRT1_0133_B01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTACGCACTCTC*AAG
SPL01_0102_C09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LVR01_0089_C08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0064_F10.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
MLN01_0035_F10.b : GACC*TACTGCATC*GACAAT*GANGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PBL01_0081_A05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
LNG01_0064_A12.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVR01_0100_A02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRT1_0076_D12.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PBL01_0066_F03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0063_A06.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SPLT1_0035_A10.b : AACC*TACTGGATC*GACAAG*GAAGCCCTTTAgaaattctgctccgcattcccaagcta
TES01_0051_B04.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
TES01_0112_H12.b : GACC*TACTGCATC*GANCAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
TES01_0016_C07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
TES01_0021_E09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PCT01_0036_A09.b : GACC*TACTGCATC*GACAAT*GAAGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
PST01_0062_H09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PST01_0079_A05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PST01_0080_E09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PST01_0065_H05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PST01_0095_G01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
KDN01_0065_B03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
HTMT1_0011_H05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0007_G01.b : GACC*TCCTGCATC*GACAAT*GAGGGCCTTTACGACATCTGC*CTCCGCACTCTA*AAG
AMP01_0041_D04.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
BFLT1_0032_F04.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRT1_0018_E06.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ADR01_0075_B08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRM1_0064_G04.b : GA
KDN01_0019_B05.b : GACC*TACTGCATC*GACAAT*GAAGCCCTTTACGACATCTGC*TTTCGCACTCTN*CAG
CLNT1_0098_E03.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
KDN01_0020_D05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTTCGCACTCTC*AAG
KDN01_0025_B08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
PBL01_0093_B05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SKNB1_0043_D07.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
TCH01_0041_A04.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
MLN01_0078_G08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVR01_0087_C02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
LVRM1_0148_A07.b : GACC*TACTGCATC*GACAAG*GAGGCCC
OVRM1_0113_A12.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTG
CBLT1_0012_C09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTAAGACATCCGC*TTCCGCACTCTC*CAG
SKNB1_0049_A05.b : GACC*TACTGCACC*GACCATGAAGGCCCTTTACGACTTCTGC*TTCCcgcaatcctcag
OVRM1_0075_A10.b : t
OVRM1_0078_F07.b : GACC*TACTGCATC*GACnnatgagccctttn
OVRM1_0101_A11.b : GACC*TACTGCATC*GACNAT*GAGGCTCTTTACGACATCTGC*TTCCGCAn
BFLT1_0022_C11.b : GACC*TACTGCATC*GANCAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVR01_0095_A09.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
CLNT1_0070_B01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ITT01_0028_H07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
CBLT1_0076_B05.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ITT01_0007_D08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
TES01_0099_C11.b : GACC*TACTGCATC*GACAAT*GAGGCCCCTTACGACATCTGC*TTCCGCACTCTC*AAG
BMWN1_0080_E03.b : GAAC*TACTGCATC*GACAAT*GAGGCCCTT*AAGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0113_H11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
OVRM1_0134_G08.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGAC
OVRM1_0050_B05.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
SPL01_0048_A11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
UTR01_0080_B05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
LNG01_0024_D11.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
HTMT1_0002_G01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
ADR01_0005_B06.b : GACC*TACTGCATC*GACNAT*GAAGGCCTTTACGACATCTGC*TTTCGCAATTCT*CAG
THY01_0105_C06.b :
OVRM1_0023_E12.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
OVR01_0082_E12.b : agacctacctggatccaccaaggaggccccctttacgacatctggctttccccacttcct
AMP01_0009_F10.b : GACC*TACTGCATC*GACNAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRM1_0088_F07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
OVRM1_0207_F07.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
THY01_0049_C02.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
SMG01_0002_H05.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTC*AAG
DCI01_0107_B01.b : GACC*TACTGCATC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACTCTN*CAG
THY01_0016_H05.b : GACC*TACTGCCTC*GACAAT*GAGGCCCTTTACGACATCTGC*TTCCGCACCCTC*AAG
20110601C-006970 : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
---------+---------+---------+---------+---------+---------+ 884
OVR01_0051_F02.b : taacaaggcccaacctatgggggaccttaacccacttgtttttctccacccatgaggggg
THY01_0044_H01.b : tgaccccgccaacctagggggaacctaaaccacctttttccctgcccccctaaaaggggg
BFLT1_0126_G11.b : CTGA*CCAC*CC*AACCTATGGGGGACCTGAC*CCA*CNTTGTCTC*TGCCACCATGAGT
DCI01_0001_G08.b : CTGA*CCACGCC*TACCTATG*GGGACCTGAA*CCA*CC*TGTCTC*TGCCA*CATGAGT
OVR01_0062_H02.b : CTGA*CCACGGC*CAaccaaaggggaactggaacccccttggtctctgccacatggaagt
OVR01_0072_D07.b : CTGA*CCACGCC*AACCTATGGGGAACCTGAA*CCA*CCCTGTCTC*TGCCACCATGAGT
PST01_0041_F01.b : CTGA*ACACGCC*AACCTATGGGG*ACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0034_C03.b : aacacgccaaccttggggaacttgaaccacttgtcctgcccctggaaggggtgccccact
OVRT1_0143_A01.b : CTGA*CCACGCC*AACCTA*GGGGGACCTGAA*CC**CCCTGTCCC*TGCCCCCATGAGT
OVRT1_0140_A08.b : CTGA*CCACGCA*AACCTAGGGGGACC**GAA*CCC*CCTTGTCTC*TGCCACCAAGAGT
TES01_0001_H09.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
BFLT1_0152_F05.b : CTGA*CCACGCC*NAACTAT*GGGGACCTGAA*CAA*CCTTGTCTC*CTGCACATTGAGG
LVRM1_0056_B04.b :
BMWN1_0045_B10.b : CTGA*CCAC*CC*CACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGGCACCATGAGT
LNG01_0010_B07.b : CTGA*CCACGCC*AACCTAATGGGGACCTGAA*CCACCTTTGTCTC*TGCCACCATGAGT
PTG01_0048_D01.b : aaaagggggggccaccggccccctttcggggggaaaaatggaaccccccaggggggaaaa
OVRM1_0003_F11.b :
OVRM1_0014_B04.b :
UTR01_0012_F06.b :
OVR01_0022_F06.b : CTGA*CCACGCC*ACCCT*TGGGGGACCTGAA*ACA*CCCTGgtccctgccaccctgagt
TCH01_0051_G03.b : CTGA*ACACGCC*AACCTTATGGGGACCTGAA*ACCACCTTGTCTC*TGCCCACATtgag
OVRT1_0106_C11.b : CTGA*CAACGCC*AAACTAT*GGGGACCTGAA*ACA*CCCTGTCTC*TGCCACCATGAAT
OVRT1_0079_G08.b : CTGA*CCACGCC*AACCTATGGGGACCTGGAA*CA**CCTTGTCTC*TGCAACCATGAGT
OVR01_0029_E11.b : CTGA*CCACGCC*CACCTATGGGGGACCTGAA*CCACCTTTGTCTC*TGCCACCATGAGT
ITT01_0090_D05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVR01_0035_G06.b : CTGA*CCACGCC*AACCTAC*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGATT
LVRM1_0098_C07.b :
OVRM1_0079_A03.b :
THY01_0007_A03.b :
PST01_0003_D02.b : CTGA*ACACGCC*AAACTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCA*CATGAGT
PST01_0057_H03.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVRM1_0066_B11.b :
OVR01_0083_H11.b : tccccccctcttccaagctggaaacccccccccacccctatggggggaacccctaacccc
DCI01_0018_F12.b : ccacgccacctatggggactgaaccccttgtctcctgcaccatgaatggggccccacctg
PTG01_0041_H03.b : CTGA*CCACGC***AACCTATGGGGACCTGAA*CCA*CCTTGTCTC*TGCCCCCA*GAAT
BMWN1_0097_B06.b : CTGA*CCACGCC*NAACTAT*GGGGACCTGGA*CCA*CCTTGTCTC*TGCCAACATGATG
DCI01_0021_E06.b : CTGA*CCACGCC**ACCTATGGGGACttgaccacttgtctctgccacatgagtgggtcac
HTMT1_0104_F03.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCAACCATGAGT
HTMT1_0055_A12.b : CTGA*ACACGCC*AACCTATGGGGAACTGAAA*ACA**CTTGTCTC*TGCCCACATGAGT
OVRT1_0111_H02.b : CTGA*ACACGCC*AACCTATGGGGGACCTGAA*NNC*ACTTGTCTC*TGCCACCATGAGT
BMWN1_0088_D07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*ACA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0024_E08.b : CTGA*CCACGCC**ACCTAT*GGGGACCTGAC*CA**CCTTGTCTC*TGCAA*CATGAAT
LVRM1_0122_A06.b :
OVRM1_0043_A12.b :
DCI01_0022_H08.b : caaccttggggaccggaacccctttgtctcgcccccagagggggttcacccctggcctcc
DCI01_0022_H02.b : gacccccccacctttggggaactgaaccaccttgttcctgcccccatgaggggggtccca
AMP01_0101_H07.b : CTGA*CACGCCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAAT
THY01_0071_H09.b : CTGA*CCACGCC*AAACTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
CLNT1_0115_H10.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCC*ACTTGTCTC*TGCCACCATGAAT
OVRM1_0154_A11.b :
OVRM1_0202_F04.b :
OVRM1_0008_A06.b :
OVRM1_0119_A07.b :
OVRT1_0063_H07.b : CTGA*ACACGCC*AACCTATGGGGGAC*TGAA*CCA**CTTGTCTC*TGCCA*CATGAAT
SPL01_0032_H03.b : CTGA*CCACGCC*CACCTAT*GGGGAACTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVR01_0037_B06.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAAT
TES01_0006_H08.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*ACA*CCTTGTCTC*TGCCACCATGAGT
CLNT1_0092_D05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TNGCCACATGAGT
LNG01_0013_F07.b : CTGA*CCACGCC*AACCTATGGGGGACCTGAAACCCACCTTGTCTCCTGCCACCATGAGT
DCI01_0037_B11.b : ggaaccccctttgtcctgcccccgaaaggggggtacaaccgggcttcccttttctgggga
AMP01_0001_G04.b :
OVRM1_0200_C08.b :
OVRM1_0033_A07.b :
SPL01_0029_F02.b : cacccaaacctttggggaactgaaccccctttgtcttgtccacaggaaggggggtcccaa
DCI01_0025_H08.b : acttgggggacctgaaccccctttccctggccccagggagggggtcccccctgcccccct
DCI01_0033_H08.b : agcccaacctaggggaaccgaaccaactttgctctgccaccataaagggggtcacacttg
TES01_0022_G07.b : CTGA*CCACGCC*AAACTATTGGGGACTGAAA*CC**CCTTGTCTC*TGCCACCATGAAT
DCI01_0017_G09.b : accagcccaactatggggacctgaccaccttgtccctgcacatgattgggtcacactggc
SKNB1_0004_H11.b : CTGA*ACACGCC*ACCCTAT*GGGGAACTGAA*CCA*CTTTGTCTC*TGCCACCATGAGT
SPLT1_0062_G07.b : CTGA*CCACGCC*AAANTATGGGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
ADR01_0040_F04.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCANCATGAGG
HTMT1_0060_C07.b : CTGA*CCACGCC*NAACTAT*GGGGACCTGAA*ACA**CTTGTCTC*TGCCCACATGAGT
DCI01_0003_H08.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAC*Caccctgtctctgcggcgtgagtggtg
ITT01_0037_D10.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
ITT01_0075_B02.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAT*CCA*ACTTGTCTC*TGCCACCATGAGT
BMWN1_0083_C07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCC*ACTTGTCTC*TGCAACCATGAGT
ITT01_0050_G03.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
LVR01_0057_E10.b : CTGA*CCACGCC*AACCTATGGGGGACTTAAA*CCA*CCTTGTCTC*TGCCACCATGAGT
THY01_0062_H07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
CBLT1_0079_D01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAAACCA**CTTGTCTC*TGCCCACATGAGT
SPL01_0063_B06.b : CTGA*ACACGCC*CACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVRT1_0021_C12.b : CTGA*ACACGCC*AACCTAT*GGGGAACTGAA*CCA*CTTTGTCTC*TGCCANCATGAGT
DCI01_0041_F08.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CA**CCTTGTCCC*TGCCACCATGAGT
DCI01_0003_A06.b : CTGA*ACACGCC*AACTTAT*GGGGACCTGAT*ACA*CCTTGTCTC*TGCCANCATGAGT
THY01_0126_C10.b :
HTMT1_0124_A03.b : ctttttttgcccccatgatggtgtcccacctgcctcgcttcccggccatccaaaggtaac
BMWN1_0008_D04.b : ccaaaggggggttccaccccctcccttcctgggaaataaggtacacccccaggggggaga
CBLT1_0012_C08.b : cagagtacgacctgaatcattttgcttttgcccacaggagcggtattgaagatttatcag
OVRM1_0148_F02.b :
SPLT1_0059_E12.b : CTGA*CCACGCC*AAACCTATGGGGACCTGAA*CCAACCTTGTCTC*TGCCcacaagaat
BMWN1_0061_E05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTTCC*TGCCAACATGAtg
ILNT1_0062_E03.b : CTGA*CAACGCC*AACCTAT*GGGGACCTGAA*ACA**CTTGTCTC*TGCCA*CATGAGT
SPLT1_0066_G07.b : CTGA*ACACGCC*AACCCTATGGGGACCTGAA*CCA*CTTTGTCTC*TGCCCACATGAGT
BMWN1_0030_D07.b : CTGA*ACACGCC*AACCTTTGGGGGACCTGAA*CCA*CTTTGTCTC*TGCCACCATGAGT
CLNT1_0133_D12.b : CTGA*ACAACGC*AACCCTATGGGGACCTGAA*CCA*CCTTGTCTC*TGCCA*CATGAAT
DCI01_0041_A10.b : CTGA*ACACGCC*CACCTAT*GGGGACCTGAA*NCAACCTGTCctcggccacctgattgg
HTMT1_0127_E07.b : CTGA*ACACGCC*NAACTAT*GGGGACCTGAA*NCC*ACTTGTCTC*TGCCNACATGAGT
AMP01_0039_G06.b : CTGA*CCACGC**AACCTAT*GGGGACCTGAA*CC**CCTTGTCTC*CGCCACatgggtg
THY01_0061_G10.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTGGTCTC*TGCCACCATGAGT
DCI01_0032_A06.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*ACA*CCTTGTCTC*TGCCACCATGAGT
CBLT1_0062_H10.b : CTGA*CCACGCC*CACCTAT*GGGGACCTGAA*CCC*ACTTGTCTC*TGCCACCATGAGT
DCI01_0096_C03.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCCACCT*GTCTC*TGCCACCATGAGT
CBLT1_0003_C10.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0113_A12.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVRM1_0048_C07.b :
OVRM1_0040_H07.b :
OVRM1_0173_E03.b :
THY01_0118_B05.b :
THY01_0108_F04.b :
THY01_0118_A11.b :
LVRM1_0005_D07.b :
DCI01_0059_E10.b :
LVRM1_0180_B09.b :
DCI01_0028_B06.b : ggcccccggagggggccaccgggcccccttccgggccattaagggaaactcgaaagggaa
LVRM1_0024_A05.b :
OVR01_0075_C04.b :
OVRM1_0114_A03.b :
OVRM1_0137_E01.b :
OVRM1_0154_B02.b :
LVRM1_0065_E11.b :
OVRM1_0151_B07.b :
LVRM1_0153_B07.b :
OVRM1_0058_H04.b :
OVRM1_0126_G08.b :
OVRM1_0125_H11.b :
OVRM1_0014_A05.b :
OVRM1_0050_C01.b :
OVRM1_0168_G07.b :
OVRM1_0121_B10.b :
THY01_0050_A12.b :
DCI01_0022_H04.b : tgggaactgaaccccttggccctgccacctaatggggtcccccctgcctcggttccttgg
THY01_0070_B01.b :
OVRM1_0022_G09.b :
DCI01_0033_F09.b : caacctgggggacctaaacccctgtgccttgcccccaggagggggtaccaccgtgcctcc
DCI01_0019_D10.b : aggggacctgaacacttggcccgccacctgagtggggtacaacttggctcgtttcctggc
DCI01_0019_D02.b : taggggactgaacccctttgttcgcccccagaatggggttcccctgccctccctcctggg
DCI01_0024_F06.b : cccgccaactttggggaactgaacaacctgttcctgcaacatggatgggtgtcaccactg
OVR01_0071_F08.b : CTGA*ACCCCCC*CACCTATGGGGGACCTGAA*ACACCTTGgtccttccccccctgaaag
THY01_0046_B05.b : TTGA*CCCCGGC*AAACTATGGGGGACCTGAA*CCcccctggcccttgccaccatgaagg
DCI01_0019_C11.b : CTGA*Cacggccaactatggggacctggacaccttgactctgcccccatgatggggtaac
LNG01_0073_H04.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCCTGTCTC*TGC*AACATGAAT
DCI01_0014_C03.b : CTGA*CCACGCC*ACCCTAGGGGaactgaacaacttggtccctgcaccatgaatggtggt
DCI01_0031_G10.b : CTGA*ACCCGCC*ACCTATGGGGgaccgaaccaccttgtccttgcaccctgaagggggtc
DCI01_0023_F11.b : CTGA*CCAC*CC*AACCTATGGGGacctgaaccacctgtctctgccacaggattggtgtt
AMP01_0099_A06.b : CTGA*CCACGCCCAACCTATGGGGacctggaccacccttgcccctgcccccatgaagtgg
DCI01_0033_C11.b : CTGA*CCACGCC*CACCCATGGGGACTGGAACaccttgtctctgccccctgaatggtgtc
UTR01_0038_D07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCCACATGAGT
OVR01_0061_B11.b : CTGA*CCACGCC*AACCTATGGGGACCTTGAA*CCA*CCTTGTCTC*TGCCAACATGAGT
PTG01_0021_H10.b : CTGA*ACACGCC*CACCCTATGGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCGGGAGT
CLNT1_0152_A01.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
AMP01_0065_E02.b : CTGA*ACACGNC*CAGCTATGGGGACCTGGAA*CACCTTGGCTCctgcaccaggagtgtg
OVRT1_0036_B04.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCANCATGAGT
ITT01_0096_A11.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
ITT01_0022_G11.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
PST01_0074_C01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0015_E06.b : CTGA*CCACGCC*AACTAT**GGGGACCTGAA*CCACCTGTCTCTG*Ccaccatgatgtg
OVR01_0005_B07.b : CTGA*CCACCCC*CACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0012_G09.b : CTGA*CCACGCC**ACCTAT*GGGGAACTGAA*CCA*CCTTGTCTC*TGCACCcatgatt
OVRT1_0055_G10.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*NNC*ACTTGTCTC*TGCCNACATGAGT
ITT01_0089_B01.b : CTGA*CCACGCC*AACCTAT*GCGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
BKFL1_0022_F11.b : CTGA*CCACGCC*AAC*TATGGGGAACTGGAA*CCA**CTTGTCTC*TGCaccatgagtg
SMG01_0067_D06.b : CTGA*CCACGCC*AACCTATGGGGGACCTGAA*CA**CCTTGTCTC*TGCCACCATGAAT
DCI01_0005_G06.b : CTGA*ACACGGC*CACCTATGGGGACCTGAAC*CCA**CTTGTCCC*TGCCACCATGAGT
DCI01_0010_B05.b : CTGA*CCACGCC*AGCTAT**GGGGACCTGAA*TCA*CCTTGTCTC*TGCCA*CATGAGT
THY01_0086_D10.b : CTGA*CCACGCC*AACCTATGGGGACCTGAAT*CCA**CTTGTCTC*TGCCGCCATGAGT
OVRT1_0050_C12.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
ITT01_0053_E02.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
MLTL1_0100_H05.b : CTGA*CCACGC**AACCTAT*GGGGACCTGAA*CCA**CCTGTCCC*TGCCCACATGAGT
DCI01_0001_D08.b : CTGA*CCACGCC*A*CCTAT*GGGGAACTGAA*CCA*CCCTGTCTC*TGCCACCA*GAGT
UTR01_0060_F12.b : CTGA*CCACGCC*AACCTAT*GGGGACTTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0004_F03.b : CTGA*CCACCCC*AACTTAT*GGGGACCTGAT*CCA*CCTTGTCTC*TGCCACCATGAGT
TCH01_0036_C07.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0095_D05.b : CTGA*CCACGCC*AACCTAT*GGGGACTGGAA*CA**CCNTGTCTC*TGCCACCATGAGT
OVR01_0037_D04.b : CTGA*CCACGCC*CACCTAATGGGGACCTGAA*ACACCTTTGTCTC*TGCCACCATGAGT
THY01_0207_G03.b : CTGA*CCACGCC*CACCTATTGGGGACCTGAA*CCACCTTTGTCTC*TGCCACCATGAGT
LVR01_0099_D01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
LVR01_0058_F06.b : CTGA*CCACGCC*AACCTAT*GGGGAACTGAA*CCA*ACTTGTCTC*TGCCA*CATGAGT
THY01_0037_D02.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTCGTCTC*TGCCACCATGAGT
ITT01_0001_D11.b : CTGA*CCACGCC*ACCCTAT*GGGGACCTGAA*CCA**CTTGTCTC*TGCCACCATGAGT
UTR01_0087_C06.b : CTGA*ACACGCC*CACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
AMP01_0050_H08.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCCTGTCTC*TGCCACCATGAGT
SPL01_0019_G11.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0072_F09.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAC*CCA**CCTGTCTC*TGCCACCATGAGT
AMP01_0079_F01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCNACATGAGT
OVR01_0012_D03.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
THY01_0072_D05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0064_H12.b : CTGA*CCACGCC*AACCTATGGGGGACCCGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
AMP01_0086_E02.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCC*ACTTGTCTC*TGCCCACATGAGT
AMP01_0062_F08.b : CTGA*CCACGCC*NACCTAT*GGGGACCTGAA*NCA*CCTAGTCTC*TGCCACCATGAGT
DCI01_0061_F05.b : CTGA*CCACGCC*AACCTATGGGGGACCGAAC*CAC***NTGTCTC*TGCCCACATGAGT
AMP01_0059_B04.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCCACATGAGT
DCI01_0080_D02.b : CTGA*ACACGCC*AACCTATGGGGACCCTGAA*NCA**CCTGTCTC*TGCCCACATGAGT
OVRM1_0057_D11.b :
OVRT1_0127_H05.b : CTGA*CCACGCC*AACCTAT*GGGGACTTGAA*CCA**CCTGTCTC*TGCCACCATGAGT
OVR01_0013_B02.b : CTGA*CCACGCC*NACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
THY01_0072_D11.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
LVRM1_0081_D01.b :
OVRM1_0073_D04.b :
OVRT1_0039_G06.b : CTGA*ACACGCC*AACCTATGGNNGACTGAAN*C**ACCTTGTCTC*TGCCA*CATGAGT
PBL01_0002_E05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*TCTTGTCTC*TGCCACCATGAGT
THY01_0119_F11.b :
OVRM1_0210_C06.b :
LVRM1_0007_F11.b :
DCI01_0030_B06.b : ctatggggaactgaacccccttggtcttgcccccaaaggggtgtcccactggctcccttt
OVRT1_0085_H09.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
SPL01_0061_C04.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCCACATGAGT
OVRT1_0085_H04.b : CTGA*ACACGCC*AACCTATGGGGACCTGAAN*CCA**CTTGTCTC*TGCCACCATGAGT
OVR01_0010_B08.b : CTGA*CCACGCC*AACCTATGGGGATCTNNGA*ACA**CTTGTCTC*TNGCACAATGAGT
THY01_0107_G09.b :
THY01_0119_D04.b :
SPL01_0039_D01.b : CTGA*CCACGCC*AAACctatgggggaccctgaaccacctttggtctcctgccacccatg
AMP01_0037_G03.b : aaaccccaacctatgggggaacggaacccccttgttcctctcccccaggagggggtggta
DCI01_0008_E05.b : CTGA*CCACCGC*AACCTAT*GGGGACCTGAC*CA**CCTTGTCTC*TGCCACCATGAGT
THY01_0120_B01.b :
LVRM1_0107_A09.b :
OVRM1_0087_F04.b :
OVRM1_0091_G01.b :
OVRM1_0100_F04.b :
OVRM1_0014_B12.b :
OVRM1_0201_C09.b :
OVRM1_0022_B03.b :
THY01_0041_G12.b : actgaacaccgccaacctatgggggacctgaaaccccccttgccctggccaccatggagg
UTR01_0009_F10.b : CTGG*CCACGC
PTG01_0044_B11.b : CTGA*CCACGCC*AACCT*TGGGGGACCTGAA*CCC*NCTTGTCTC*TGCCACCATGAAG
SPL01_0009_H09.b : CTGA*CCACGCC*AACCTATGGGG*ACCTGAA*CCACCTTTGTCTC*TGCCACCATGgag
BFLT1_0024_G02.b : CTGA*CCACGCC*AACCTATGGGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
THY01_0062_D09.b : CTGA*CCACGCC*AACCTATGGGGGAC*TGAA*CCACTTTGTCCTC*TGCCACCATGAGT
OVRT1_0122_G06.b : CTGA*CCACGCC*AACTTA**GGGGACCTGAA*CCA**CTTGTCTC*TGC*ACCATGAGT
OVRT1_0133_B01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGGA*GCAACCTGTCCTC*TGCCA*CATGAGT
SPL01_0102_C09.b : CTGAACCACGCC*AACCTAT*GGGGACCTGAA*CCAACTTTGTCTC*TGCCAACATGAGT
LVR01_0089_C08.b : CTGA*CCACGCCCAACCTATGGGGGACTTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
THY01_0064_F10.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
MLN01_0035_F10.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*NCC*ACCTGTCTC*TGCCACCATGAGT
PBL01_0081_A05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCC*ACTTGTCTC*TGCCA*CATGAGT
LNG01_0064_A12.b : CTGA*CCACGCC*CACCTATGGGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVR01_0100_A02.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVRT1_0076_D12.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*ACTTGTCTC*TGCCCACATGAGT
PBL01_0066_F03.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGC*ACCATGAGT
THY01_0063_A06.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
SPLT1_0035_A10.b : acacgccaaccttgggggactgaacccccttggccctgccacatgaaggggttccaacct
TES01_0051_B04.b : CTGA*CCACGCC*AACCTATGGGGGACCTGAA*CCA*CCTTGTCTCggcaccctggatgg
TES01_0112_H12.b : CTGA*CCACGCC*AACTTAT*GGGGACCTGAA*CCACCTTTGTCTCTGCCACCCAGGAGT
TES01_0016_C07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
TES01_0021_E09.b : CTGA*CCACGCC*NACCTAT*GGGGAACTGAC*CCA**CTTGTCTC*TGCCACCATGAGT
PCT01_0036_A09.b : CTGA*ACACGCCAACCCTAT**GGGACCTGAA*NCC*ACTTGTCTC*TGCCACCATGAGT
PST01_0062_H09.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
PST01_0079_A05.b : CTGA*CCACGCC*AACCTAT*GGNGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
PST01_0080_E09.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
PST01_0065_H05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
PST01_0095_G01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
KDN01_0065_B03.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
HTMT1_0011_H05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAC*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0007_G01.b : CTGA*ACACGCC*AACCTATGGGGAACCTGAA*ACCCCTTGGTCCC*TGCCACGAGGAGT
AMP01_0041_D04.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCCACATGAGT
BFLT1_0032_F04.b : CTGA*ACACGCC*AAACTAT*GGGGACCTGAA*ACA*CCTTGTCTC*TGCCACCATGAGT
OVRT1_0018_E06.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
ADR01_0075_B08.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVRM1_0064_G04.b :
KDN01_0019_B05.b : CTGA*CCACGCC*CACCTATGGGGACCCTGAC*CA**CCTTGTCTC*TGCCAACATGAGT
CLNT1_0098_E03.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCC*ACTTGTCTC*TGCCACCATGAGT
KDN01_0020_D05.b : CTGA*CCACGCC*AACCTATGGGGAACCTGAA*ACA**CTTGTCTC*TGCCCACATGAGT
KDN01_0025_B08.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
PBL01_0093_B05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCCACC*TGTCTC*TGCCA*CATGAGT
SKNB1_0043_D07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTCTGCCCACCATGAGT
TCH01_0041_A04.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*ACA*CCTTGTCTC*TGCCACCATGAGT
MLN01_0078_G08.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAC*CCA*CCTTGTCTC*TGCCA*CATGAGT
OVR01_0087_C02.b : CTGA*ACACGCC*AACCTAT*GGGGAACTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
LVRM1_0148_A07.b :
OVRM1_0113_A12.b :
CBLT1_0012_C09.b : CTGA*CCACGCC*CACCTATGGGGAACTGGAC*CA**CCTTGTCTC*TGCCCCCATGAAT
SKNB1_0049_A05.b : ctgaacaagcccaacctatgggggacttggaaccccctggtccctgccacccccgaaggg
OVRM1_0075_A10.b :
OVRM1_0078_F07.b :
OVRM1_0101_A11.b :
BFLT1_0022_C11.b : CTGACCCACGCC*AACCTAT*GGGGACCTGAA*CCC*ACTTGTCTC*TGCCACCATGAGT
OVR01_0095_A09.b : CTGA*CCACGCC*CACCTAT*GGGGACCTGAC*CCA*CCTTGTCTC*TGCCACCCAGAGT
CLNT1_0070_B01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCCACATGAGT
ITT01_0028_H07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*ACA*CCTTGTCTC*TGCCACCATGAGT
CBLT1_0076_B05.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
ITT01_0007_D08.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
TES01_0099_C11.b : CTGA*CCACGGCAACCCTATTGGGAACTTGAA*CA**CCTTGTCTC*TGCCACCATGAGT
BMWN1_0080_E03.b : CTGA*CCACGCC*ACCTAT**GGGGGACTGAA*CAACCTGTCTCTGCaacatgagtggtg
DCI01_0113_H11.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVRM1_0134_G08.b :
OVRM1_0050_B05.b : CTGA*CCACG
SPL01_0048_A11.b : CTGA*CCACGCC*CACCTATGGGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
UTR01_0080_B05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
LNG01_0024_D11.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
HTMT1_0002_G01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
ADR01_0005_B06.b : CTGA*ACACGCC*CACCTTATGGGGAACTGAA*CAA*CCTTGTCTC*TGCAA*CATGGGG
THY01_0105_C06.b :
OVRM1_0023_E12.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA**CTTGTCTC*TGCCACCATGAGT
OVR01_0082_E12.b : caggctgaaccccgcccaaccccatggggggacccgaaacccccttttgttccctgcccc
AMP01_0009_F10.b : CTGA*ACACGCC*AACCTAT*GGGGACCTGAN*CCA*CCTTGTCTC*TGCCACCATGAAT
OVRM1_0088_F07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
OVRM1_0207_F07.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
THY01_0049_C02.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
SMG01_0002_H05.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGAA*CCA*CCTTGTCTC*TGCCACCATGAGT
DCI01_0107_B01.b : CTGA*CCACGCC*AACCTAT*GGGGACCTGNA*CCA*CCTTGTCTC*TGCCNACATGAGT
THY01_0016_H05.b : CTGA*CCACGCC*AACCTAT*GGGGACCCGAA*CCA*CCTTGTCTT*TGCCACCATGAGT
20110601C-006970 : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
---------+---------+---------+---------+---------+---------+ 941
OVR01_0051_F02.b : ggcaacaacttgcctcccgctttcctgggcaggtttaagggtgtaactccccaaagctgg
THY01_0044_H01.b : gcccccccctgccccccctttccctgggccacctcaaggttgaaccccccccaaaggggg
BFLT1_0126_G11.b : GG*TGTCACAA*CCTGGCCTCGCTTTCCTGGCCAGCTCAATGCTGA*CCTCGcaagctgg
DCI01_0001_G08.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGG*CAGCTCAAgctgacctcgcaagctggaa
OVR01_0062_H02.b : ggggtcaccaacaggctttcggaattcctggtccgcttaaatggtgaacccccgcaagcc
OVR01_0072_D07.b : GGgtgtcaccacctggcctccgcttccctgggccagctcaatgctgacctccgccagcct
PST01_0041_F01.b : GG*TGTCACCA*CCTGCCTCCGCTTTCCCTGGCAGCTCAATGCTGA*ACTCCGCAAGCTG
DCI01_0034_C03.b : ggctccctttcctggcaattaatggtaactccaaagcgtggatcaataggggcctttcca
OVRT1_0143_A01.b : GG*TGTtcacacttgcctccctttcctggcagctaatgctgactcccgcagctggcaatc
OVRT1_0140_A08.b : GG*TGcaccacttgcctcgcttccctggcaagtaagggtaactcccaagcgggaatcaat
TES01_0001_H09.b : GG*TGTCACCACCTGCCTCCGCTTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
BFLT1_0152_F05.b : TG*GGTCACCA*ACTGGCTCCGCTTCCCTGGGCAGCTCAATGGTGA*Cttcggcagctgc
LVRM1_0056_B04.b :
BMWN1_0045_B10.b : GG*TGTCACCA*CTTGCCTTCGCTTCCCTGGGCAGCTCAAGGCTGA*CCTCCGC*AGCTG
LNG01_0010_B07.b : GG*TGTCACCACCTGCCCTCGCCTTCCCTGGCCAGCTCAAGGCTAA*CCTCCGCAAGCTG
PTG01_0048_D01.b : aaggggcgcccccccccccctttttttggggggtgtcccccaaaaccgggggaaaaaaaa
OVRM1_0003_F11.b :
OVRM1_0014_B04.b :
UTR01_0012_F06.b :
OVR01_0022_F06.b : ggcgtccccccccctgcctccgcttccctggccagttcatggctgaccccccccaacctg
TCH01_0051_G03.b : tggtggtcacacctggcctcgctttccctggccggctcattgctgacccattaatagaat
OVRT1_0106_C11.b : GG*TGTCACCACCTTGCTTCCGCTT*CCTGGGCAGCTCAATGCTGA*CCTCgcaagctgg
OVRT1_0079_G08.b : GG*TGTCACCA*CCTGCCTC*GCTTCCCTGGGCAGCTCAATGTTGA*CCTCgcaagctgg
OVR01_0029_E11.b : GG*TGTCACCACCCTGCTCCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCct
ITT01_0090_D05.b : GG*TGTCANN*CACTGCCTCCGCTT*CCTGGCCAGCTCAATGCTGA*CCCTCGC*AGCTG
OVR01_0035_G06.b : GG*GGTCACCACCCTGCCTCCGCTTCCCTGGCCcacttcattggtgacctcccccagcct
LVRM1_0098_C07.b :
OVRM1_0079_A03.b :
THY01_0007_A03.b :
PST01_0003_D02.b : GG*TGTCACCA*CCTGCtccgctcccctggcagttcatgctgacctcccaagctggagtc
PST01_0057_H03.b : GG*TGTCACCA*CCTNGCTCCGCTTCCCTGGCCAGCTCAATGCTGA*ACTCCGCAAGCTG
OVRM1_0066_B11.b :
OVR01_0083_H11.b : acctttgttctccttccccccccagggaggggggtgggaccccaaccttgggcccccccc
DCI01_0018_F12.b : cctccgctccctggcagctaatgctgacctcgcagctggcatcaaatggggccttcccgt
PTG01_0041_H03.b : GG*TGTCACCA*CCTGCCTCGGCTTCCTTGGCaggttaatggtgaactccgaagctgggg
BMWN1_0097_B06.b : GG*TGTC**CACACTGCCTCCGCTT*CCTGGGCAGCTCAtgctgacttcgcaagctggca
DCI01_0021_E06.b : acctgccttcgcttcctggcagctcatgctgactccgcagctgcagtcatatggtgcctt
HTMT1_0104_F03.b : GG*TGTCACCACNTGGCTTCCGCTT*CCTGGCCAGCTCATTGCTGA*CCTCCCC*AGCTG
HTMT1_0055_A12.b : GG*TGTCACCANC*TGCCTCCGCTTCCNTGGGCAGCTCAATGCTGA*CCTCGGC*AGCTG
OVRT1_0111_H02.b : GG*TGTCNACA*CCTGCCTCCGCTTCCCCTGGCAGCTCAATGCTGA*CCTCCGC*AGCTG
BMWN1_0088_D07.b : GG*TGTCNN*ACACTGCCCTCGCTTCCCCTGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
DCI01_0024_E08.b : GG*TGTCACAACCTGCttcgctttcctggcagctcatgctgacctccgcagctggcatca
LVRM1_0122_A06.b :
OVRM1_0043_A12.b :
DCI01_0022_H08.b : ttttctgggcagttaatggtaacctccaaagggggaaacaaaagggggccttccccattt
DCI01_0022_H02.b : ccgtgcttccttccctgggcagttcaggggaactccccaaatgggagtcaaaagggggct
AMP01_0101_H07.b : TGGTGTCACCACCTGCCctccgcctccccggccacctcaatgctgaccttccgcagctgg
THY01_0071_H09.b : GG*TGGTCACCACCTGCCTCCGCTTTCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
CLNT1_0115_H10.b : GT*TGTCCACA*CCTGCCTCCGCTTCCCTGGGCAGCTAAATGCTGA*CTTCGGCAAGCTG
OVRM1_0154_A11.b :
OVRM1_0202_F04.b :
OVRM1_0008_A06.b :
OVRM1_0119_A07.b :
OVRT1_0063_H07.b : GG*TGgtcacactgcctccgcttcctgggcagctcatgctgaacctcgcagctggagtca
SPL01_0032_H03.b : GG*TGTACCA**CCTGCCTCC*CTTTCCTGGCCAGCTCAATGCTGA*CCTCC*CAAGCTG
OVR01_0037_B06.b : GG*TGTCACCACCTG**CCTCGCTTTCCTGGCCCACTCAATGCTGA*CCTCCGCAAGTTG
TES01_0006_H08.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
CLNT1_0092_D05.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
LNG01_0013_F07.b : GG*TGTCACCA*CCTGCCTCCCGCTTCCTGGGCCGCTTAATGCTGA*CCTCCGAAAGTTG
DCI01_0037_B11.b : gattatggtgagaccccccaagtggggaaccaaaaaggggcctttcccacgttcccattt
AMP01_0001_G04.b :
OVRM1_0200_C08.b :
OVRM1_0033_A07.b :
SPL01_0029_F02.b : cctggctcccgtttcctggggaagttaaatgtgtaacccccgaaagtgggaaaataaaaa
DCI01_0025_H08.b : tccttggcaagttaaggttaaccccaaaagtggaaacaaataggggcctttcacgttccc
DCI01_0033_H08.b : gctcccctttcctgggcagttcagggtaactccccaagtgggaatcaaaaaggggccttt
TES01_0022_G07.b : GGGTGTCACCACCGGCCTCCGCTTCCCCTGGGCAGCTCAATGCTGA*CCTTCGCAAGgct
DCI01_0017_G09.b : ctcgcttcctggcagctcatgctgacctcgcagctgcagtcatatgggcctttccagttc
SKNB1_0004_H11.b : GT*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCAGGTCAATGCTGAACCTCCGCAAGCTG
SPLT1_0062_G07.b : GG*TGTCAACA*CCTGCCTCCGCTTCCCT*GCCAGCTCAATGGTGA*ACTCCCCAGCtgg
ADR01_0040_F04.b : GG*TGTCACCA**CTGGCCTCGCTTCCCTGGGCAGCTCAATGCTGA*ACTCCGC*AGCTG
HTMT1_0060_C07.b : GGGTGTCACACCNNTGC**TCGCTTCCNTGGGCAGCTCAATGCTGA*CCCTCGC*AGCTG
DCI01_0003_H08.b : tcaccactgcctccgctcccgggcagttaatgctgacctccgcagctgaaagttatatgg
ITT01_0037_D10.b : GG*TGTCACCA*CCTGCCCTCGGCTCCCTGGCCAGCTCAATGCTGA*CCCTCGCAAGCTG
ITT01_0075_B02.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCGGTTTCATGCTGA*CCTCCGCAAGCTG
BMWN1_0083_C07.b : GG*TGTCACC*CACTGCCTCCCGCTCCCTGGNCAGCTCAATGCTGA*CCTCCGCAAGCTG
ITT01_0050_G03.b : GG*TGTCNACACCTGCCCTCGC**TTCCTGGNCAGCTCAATGCTGA*CCTCCGC*AGCTG
LVR01_0057_E10.b : GG*TGTCCCCC*CCTGGCCCCCCTTCCCTGGCCAGCTTAATGCTAA*CCTCCGCAAGCTG
THY01_0062_H07.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCCGCAGCTG
CBLT1_0079_D01.b : GG*TGTCNA*ACACTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGC*AGCTG
SPL01_0063_B06.b : GG*TGTCACCA*CCTGGCTCCGCTTCCCTGGCCAACTCAATGCTAA*ACTCCGCAAGCTG
OVRT1_0021_C12.b : GG*TGTCACCACCTGGCCTCGCTTCCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
DCI01_0041_F08.b : GT*TGTCACCA**CTGCCTCCGCTTTCCTGGCCAGCTCAATGCTGA*CTTCCGC*AGCTG
DCI01_0003_A06.b : GG*TGTCACA**CCCTGCTCCGCTTCCCTGGACAGCTCAATGCTGA*CCTCCGCAGGCTG
THY01_0126_C10.b :
HTMT1_0124_A03.b : tcccaaccggcgattataggtggcctccccgtccccattttttggccggtttgcccctga
BMWN1_0008_D04.b : aaaggggggcctccccccccccttttttggcgggttttccccccaaaaagggggaaaaaa
CBLT1_0012_C08.b : ttgcataaaataatagaagatgagtccatagcttagaaatccataaaaggcaacaaggtt
OVRM1_0148_F02.b :
SPLT1_0059_E12.b : ggttggtcaccactggcttccgctttccctgggcagctcaaggctgaacctccgcagctt
BMWN1_0061_E05.b : ggggtaacacctgccttcgctttcccggccagttaaaggttgacctcgcaagctggcagt
ILNT1_0062_E03.b : GG*TGTCACAACCTGCttcgcttccctggcagctcatgctgacctccgcagctggcaatc
SPLT1_0066_G07.b : GG*TGTCNNAC*ACTGCtccgctttcctgggcagcttattgctgacttcgcaagctggag
BMWN1_0030_D07.b : GG*TGTCACCACCTGCCTTCGCTTCTCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCcg
CLNT1_0133_D12.b : GG*GGGCACCA*CTTGCCTCCGCTTTCCCGGGCAGCTTAATGCTGA*CCTCGGCAAGCTG
DCI01_0041_A10.b : tgtccacacctgccttcggcttcctgggccagctcaaggctaacctccgaagctggaagt
HTMT1_0127_E07.b : GG*TGTCACNANNCTGCNT*CGCTTCCNTGGNCAGCTCAATGCTGA*CCTCCNGCAGCTG
AMP01_0039_G06.b : gtgtcacaccctgcctcgctccctggccagctcatgcttacctccgcagctggaattaat
THY01_0061_G10.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCCACTCAATGGTGA*ACCCCCCAAGCTG
DCI01_0032_A06.b : GGGTGTCACA**CCTGCCTTCGCTTTCCTGGNCAGCTNCATGCTGA*CCCTCgcagctgg
CBLT1_0062_H10.b : GG*TGTCACCA*CTTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
DCI01_0096_C03.b : GG*TGTCACCCACTGNCCT*CGCTTNCCCTGGCAGCTCNATGCTGA*CCTCCGC*AGCTG
CBLT1_0003_C10.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
DCI01_0113_A12.b : GT*TGTCACNCCCTGCCCTCGGCTTCCCTGGGCAGCTCAATGCTGA*CCTTCGCAAGCTG
OVRM1_0048_C07.b :
OVRM1_0040_H07.b :
OVRM1_0173_E03.b :
THY01_0118_B05.b :
THY01_0108_F04.b :
THY01_0118_A11.b :
LVRM1_0005_D07.b :
DCI01_0059_E10.b :
LVRM1_0180_B09.b :
DCI01_0028_B06.b : taaaaaggggcctcccagtcccctttttaggccggtttcccctttacaacctggaaccaa
LVRM1_0024_A05.b :
OVR01_0075_C04.b :
OVRM1_0114_A03.b :
OVRM1_0137_E01.b :
OVRM1_0154_B02.b :
LVRM1_0065_E11.b :
OVRM1_0151_B07.b :
LVRM1_0153_B07.b :
OVRM1_0058_H04.b :
OVRM1_0126_G08.b :
OVRM1_0125_H11.b :
OVRM1_0014_A05.b :
OVRM1_0050_C01.b :
OVRM1_0168_G07.b :
OVRM1_0121_B10.b :
THY01_0050_A12.b :
DCI01_0022_H04.b : cagctcaagctgacctccccagctggagtcaaaagttgcctttccaggtctcactcttat
THY01_0070_B01.b :
OVRM1_0022_G09.b :
DCI01_0033_F09.b : ctttctgggcaagttaaggggaaaccccaaagtgggaaaaaaagggggcctttccaagtt
DCI01_0019_D10.b : aggtcctgctgacttcgcagctggagtcaatatgtgcccttcacgtctcacttctcaggc
DCI01_0019_D02.b : cagtaaggttgactcgcagctggatcaatggggccttcccagtctccttctatgccggtt
DCI01_0024_F06.b : cctcgcttccctggcagcttaagctgacctcgcaactggagtcatatgtgccttcccagt
OVR01_0071_F08.b : ggggtaacccacctggcctccgccttccctggggcagcttcaatgctgaaccccccccaa
THY01_0046_B05.b : ggggcaccaccctgcccccctttccctgggcagttcaatggttgacctccccaaaggtgg
DCI01_0019_C11.b : acctggctccctttcctggcagctaaaggtgaactcccaagctggaatcaattggggcct
LNG01_0073_H04.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGttaatggtgacctccccagcttggc
DCI01_0014_C03.b : cacaactggctccgctcccttggcagctcaagctgacttcccaagctgcaatcaaaaggg
DCI01_0031_G10.b : accccttgcttcggtttccggggcagttctaaggtgaactccccaaggtaacaataaata
DCI01_0023_F11.b : accacctgcctccctttcctgggcaattcatggtgacctccccagctggaatcaaaaggg
AMP01_0099_A06.b : ggccacccccggcctcccgcttccctggcagcttaatggcgaacccccccaagctggaag
DCI01_0033_C11.b : accactggcttcgcttcctgggccactcaatgtgaactccccaagcgtggatcaaaaggg
UTR01_0038_D07.b : GG*TGTCACC*CACTGGCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCT
OVR01_0061_B11.b : GG*GGTCACCACCTGGCCTCCGCTTCCCTGGCCCGCTCAAGGCTGA*CCTCCGCAAagcg
PTG01_0021_H10.b : GG*TGTCACCA*ACTGCCTTCGCTTTCCTGGGCAGCCTCATGCTGA*CCTTCGCAAGCTG
CLNT1_0152_A01.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGC*AGCTG
AMP01_0065_E02.b : gtcacacctgcctccgcttcntgggcagctcatgctgacctcgcagctgaagtcatatgg
OVRT1_0036_B04.b : GG*TGTCACCA*CCTGCCTCCCGCTTCCTGGGCAGCTCAATGCTGA*CNTCCCGCAGCTG
ITT01_0096_A11.b : GGGTGTCACA**CCTGCCCTCGCTTTCCTGGNCCAGCTCATGCTGA*CCTCCCGCAGCTG
ITT01_0022_G11.b : GT*TGTCGCCACTTGCCCTCCGCTT*CCTGGCCAGCTCAATGCTGA*CCT*CGCAAGCTG
PST01_0074_C01.b : GG*TGTCACCA*CTTGCCTCCGCTTTCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
DCI01_0015_E06.b : tcaccactgcctccgctccctggcagctatgctgacttcgcagctgcagtcatatgtgcc
OVR01_0005_B07.b : GG*TGTCACC**CCTGCCTCCCCTTCCCTGCCCACCTCAATGCTGA*CCTCCCCcaacct
DCI01_0012_G09.b : ggggtaacacctggctccgcttcctgggcagttcatggtgacttcgacagctggagtcaa
OVRT1_0055_G10.b : GG*TGTCNN*ACACTGCCTCCGCTTCC*TGGGCAGCTCAATGCTGA*CCTCCGC*AGCTG
ITT01_0089_B01.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGTTCNATGCTGA*CCTCGGCAAGCTG
BKFL1_0022_F11.b : tggtccactgcctccgcttccctggcaggctcatgctgacctccccaggctgcagtcaaa
SMG01_0067_D06.b : GG*TGTCAACACCTGGCCTCCGCTTCC*TGGGCAGCTCAATGCTGA*ACCTCCCAAGCTG
DCI01_0005_G06.b : GG*TGTCAACACTggctccgctttcctggcagctcatgctgacctcggcagctgggagtc
DCI01_0010_B05.b : GG*TGTCACacctgcctcccttccctggcagcttatgctgactccgcagctggaataaaa
THY01_0086_D10.b : GG*TGTCACCACCCTGC*TCCGCTTCCNTGGCCAGCTNCATGCTGA*CCTCCGCAAGCTG
OVRT1_0050_C12.b : GG*TGTCACCA*ACTGCTTCCGCTTC*TTGGGCAGCTCAATGCTGA*CCTC*GCAAGCTT
ITT01_0053_E02.b : GG*TGTCNACC*ACTGCCCTCGCTTTCCTGGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
MLTL1_0100_H05.b : GG*GGTCACacctgcttcggcttccctggcagttcaagctgactccgcagctgggaagca
DCI01_0001_D08.b : GG*TGTCACCA**CTGCCTCCGCTTCCCTGccagctcatgctgacctccgaagctggaaa
UTR01_0060_F12.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
DCI01_0004_F03.b : GT*TGTCACCA*CCTGCCTCCGCTTTCCTGGCCAGttaaagctgacctccgcagcttgca
TCH01_0036_C07.b : GGTGGTCACAC**NTGCCTCCGCTTCCCTGGGCAGCTCAATGCTGA*ACTCCGCAAGCTG
DCI01_0095_D05.b : GG*TGTCACCA**CTGCCCTCGCTTCCNTGG*CAGCTCAtgctgacctccgcagctgcag
OVR01_0037_D04.b : GG*GGGCACCA*CCTGCCTTCGCTTCCCTGGCCAGCTCATGGCTGA*CCTCCGCAAGCTG
THY01_0207_G03.b : GG*TGTCACCA*CCTGCCTCCGCTT*CCTGGCCAGTTTAATGCTGA*CCTCCCGCAGGCG
LVR01_0099_D01.b : GG*TGTCACCA*CCTGCCTCCGCTTTCCCTGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
LVR01_0058_F06.b : GG*TGTCACCACCTGCCTCGGCTTTCCCTGGCCAGCTCAATGCTGAACCTCCCCAAGCTG
THY01_0037_D02.b : GG*TGTCACCA*CCTGCCCTCGCTTCCCTGGCCAGCTCAATGCTGA*ACTCCGCAAGCTG
ITT01_0001_D11.b : GG*TGTCACCA*CCTGCCTCCCGCTCCCTGGCCAGCTNCATGCTGA*CCTTCGCAAGCTG
UTR01_0087_C06.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCAGCTCAATGCTGA*CCTCCGC*AGCTG
AMP01_0050_H08.b : GG*TGTCACA**CCTGCCTCCGCTTCCCCTGGCAGCTNAATGCTGA*CCTCCGCAgcccg
SPL01_0019_G11.b : GG*TGTCACCA*CCTGCCTCCGCTTTCCCTGGCAGCTCAATGCTGA*CCTCCNGCAGCTG
DCI01_0072_F09.b : GG*TGTCACCACCTGCCCTCGC**TTCCTGGCCAGCTCAATGCTGA*CCTCCGC*AGCTG
AMP01_0079_F01.b : GG*TGTCANN*CACTGCCTCCGCTTCCCTG*CCAGCTC*ATGCTGA*CCTCCGC*AGCTG
OVR01_0012_D03.b : GG*TGTCACCA*CCTGCCTCCGCTTNCCTGGCCAGCTCAATGCTGC*CCTCCGCAAGCTG
THY01_0072_D05.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGNCAGCTNCATGCTGA*CCTCCCGCAGCTG
DCI01_0064_H12.b : GT*TGTCACCACCTGCCTTCCGCTTCT*TGGGCAGCTCAATGCTGAACTTCGCCAAGCTG
AMP01_0086_E02.b : GG*TGTCACA**CCCTGCTCCGCTTCCCTGGNCAGCTCNATGCCGA*CCTCCGC*AGCTG
AMP01_0062_F08.b : GG*TGTCACAA*CCTGCCNTCGCTTCCCTGGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
DCI01_0061_F05.b : GGNTGTCACA**CCTGCCCTCGCTTTCCTGGNCAGCTTCATGCTGA*CCTCCNGCAGCTG
AMP01_0059_B04.b : GGNTGTCACA**CCTGCCTCCGCTTTCCTGGNCAGCTCAATGCTGA*CCTCCCGCAGCTG
DCI01_0080_D02.b : GG*TGTCNN*ACACTGCCTTCGCTTTCCTGGNCAGCTCNATGCTGA*CCTCCCGCAGCTG
OVRM1_0057_D11.b :
OVRT1_0127_H05.b : GG*TGTCACC**CCTTGCTCCGCCTCCCTGGCCAGCTC*ATGCTGA*CCTCCGCAAGCTG
OVR01_0013_B02.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGACCTCCCGCAAGCTG
THY01_0072_D11.b : GG*TGTCACCACCTGCCTCCCGCTTTCCTGG*CAGCTCAATGCTGA*CCTCCGCAAGCTG
LVRM1_0081_D01.b :
OVRM1_0073_D04.b :
OVRT1_0039_G06.b : GG*TGTCNACA*CCTGCCTCCGCTTCCCTGGNNCAGCTCATGCTGA*ACNTCGCAAGCTG
PBL01_0002_E05.b : GG*TGTCACCA*CCTGCCCTCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCCGCAGCTG
THY01_0119_F11.b :
OVRM1_0210_C06.b :
LVRM1_0007_F11.b :
DCI01_0030_B06.b : cctggcagtctaaggtaaactccgcaagggaagaaatgggggccttccaagttccatttt
OVRT1_0085_H09.b : GG*TGTCCACA*CCTGCCTCCGCTcctgggcagctcatgctgacctcgcaagctggcagt
SPL01_0061_C04.b : GG*TGTCACCACCTGCCTCCGGCTTCCCTGGCCAGCTCAAGGCTGA*ACTCCGCCAGCTG
OVRT1_0085_H04.b : GG*TGTCNACA*ACTGCCCTCGCTTCCCTGG*CAGCTCAATGCTGA*CCTCCGGCAGCTG
OVR01_0010_B08.b : GG*TGTCATCACCNTAGCT*CGCTTCCCTGGGCAGCTTCATGCTGA*CNNNTCGCAGCTG
THY01_0107_G09.b :
THY01_0119_D04.b :
SPL01_0039_D01.b : aagtggtgtcaacaccctgccttcgctttcccttgggccagcttcaatgcttgacttccg
AMP01_0037_G03.b : ccacctggcttcccctttccttgggaggtttaatgttaaacccccccaagtgggaagaaa
DCI01_0008_E05.b : Gtgtcacacctgcctccgcttccctggcagcttaatgctgacctggcaagctgaaaataa
THY01_0120_B01.b :
LVRM1_0107_A09.b :
OVRM1_0087_F04.b :
OVRM1_0091_G01.b :
OVRM1_0100_F04.b :
OVRM1_0014_B12.b :
OVRM1_0201_C09.b :
OVRM1_0022_B03.b :
THY01_0041_G12.b : ggggggtccccccttgccctccccttttccctgggcaagttaaaatggtgacctcccgga
UTR01_0009_F10.b :
PTG01_0044_B11.b : GGTGGTCACA**CCTGCCTCCGCTT*CCTGGGCAGCTCAATGGTGA*ACTCCGCAAGCTG
SPL01_0009_H09.b : tggtgttacccccctgccttccgctttcctgggccagcttcaatggttgaccttccccca
BFLT1_0024_G02.b : GG*TGTCACCA*ACTGCCTCCGCTTCCCTGGGCAGCTCAATGCTGA*CCTCCCCAGCTtg
THY01_0062_D09.b : GA*TGTCACCCCTTGCCTTCGCTTTCCTGGCCCAGCTCAATGTTGA*CCTCCCGCAGCTT
OVRT1_0122_G06.b : GG*TGTCACCA*CCTGCCTCCGCTCCCCTGGGCAGCTCAATGCTGA*CCTCCGGCAGCTG
OVRT1_0133_B01.b : GG*TGTCACCA*CGTGCCTCCGCTTCCCTTGGCAGCTCAATGCTGA*ACTACGCAAGCTG
SPL01_0102_C09.b : GG*TGTTCACACCTGGCTCCGCTTTCCCTGGCAAGCTACATGGTGA*ACTTCGCAAGCTG
LVR01_0089_C08.b : GG*TGTCACCACCTGCCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
THY01_0064_F10.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAAGGCTGA*CCTCGCCAAGCTG
MLN01_0035_F10.b : GG*TGTCACCA*CCTGCCTCCGCT*CCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
PBL01_0081_A05.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGNCAGCTNCATGCTGA*CCTCCGCAAGCTG
LNG01_0064_A12.b : GG*TGTCACCACCTGCCTCCGCTTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
OVR01_0100_A02.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCCAGCTG
OVRT1_0076_D12.b : GG*TGTCACCACCTGGCCTC*GCTTCCCTGGCCAGCTCAATGCTGA*ACTCCGCAAGCTG
PBL01_0066_F03.b : GG*TGTCACCA**CTGCCTCCCGCTCCCCTGGCAGCTCAATGCTGA*CCTCCCGCAGCTG
THY01_0063_A06.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
SPLT1_0035_A10.b : ggccccccttccctgggcgcttaatggtaaacccccaaagtgggaataaaaagggggcct
TES01_0051_B04.b : ggtcaccacctgccttccctttccttggcaagctcaatgctgaccctcgcaaagcttggc
TES01_0112_H12.b : GG*TGTCACCA*CCTGCCTCCGCTTTCCTTGGCcggttcaaggctgaccttcgcaggctg
TES01_0016_C07.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCCGCAGCTG
TES01_0021_E09.b : GG*TGTCACCA*CCTGCCTTCGCTTCC*TGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
PCT01_0036_A09.b : GG*TGTCACCACCTGCCCTCGCTTCCNNTGGCAAGCTC*ATGCTGA*CCTCCCGCAGCTG
PST01_0062_H09.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
PST01_0079_A05.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
PST01_0080_E09.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
PST01_0065_H05.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGNCAGCTCAATGCTGA*CCTCCGCAAGCTG
PST01_0095_G01.b : GG*TGTCACCA*CCTGCCTCCGCTTTTCCTGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
KDN01_0065_B03.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCCGCAGCTG
HTMT1_0011_H05.b : GG*TGTCAACA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCT*A*ACTCCGCAAGCTG
DCI01_0007_G01.b : GGGGGTCCCC**CCTGCCTCCGCTTCCCGGACAAGCTCAATGCTGA*CCTCCGCCAGCTG
AMP01_0041_D04.b : GG*TGTCNACA*CCTGCCTCCGCTTCCCNTGGCAGCTCAATGCTGA*CCTCCGCAGGCTG
BFLT1_0032_F04.b : GG*TGTCACCA*CCTGCCTTCGCTTCCCTGGGCAGCTCAATGCTGA*CTTCCGCAAGCTG
OVRT1_0018_E06.b : GG*TGTCNN*ACACTGCCTCCGCTTCCCTGGNCAGCTCAATGCTGA*CCTCCGCAAGCTG
ADR01_0075_B08.b : GG*TGTCNN*ACACTGCCTCCGCTTCCCTGGCCAGCTNCATGCTGA*CCCTCCGCAGCTG
OVRM1_0064_G04.b :
KDN01_0019_B05.b : GG*TGTCANC*CACTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
CLNT1_0098_E03.b : GG*TGTCACCACCTGCCT**CGCTTCCCTGGCCAGCTCAATGCTGA*ACTCGcaagctgg
KDN01_0020_D05.b : GG*TGTCAACA*CCTGCCTCCGCTTCCCTGGGCAGCTCAATGCTGA*ACTTCCGCAGCTG
KDN01_0025_B08.b : GG*TGTCACCA*CCTGCCTCCGCTTTCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
PBL01_0093_B05.b : GG*TGTCNN*ACACTGCCCTCGCTTTCCTGGNCAGCTCAATGCTGA*CCTCCGCAAGCTG
SKNB1_0043_D07.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCCGCAGCTG
TCH01_0041_A04.b : GG*TGTCACCA*CCTGCCCTCGCTTCCCTGGGCAGCTTCATGCTGA*CCTCCGCAAGCTG
MLN01_0078_G08.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
OVR01_0087_C02.b : GG*TGTCNN*ACACTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCCGCAGCTG
LVRM1_0148_A07.b :
OVRM1_0113_A12.b :
CBLT1_0012_C09.b : GG*TGTCACAcctgcctccgctccctggcaagctaaggtgacctcccaagctggagtcaa
SKNB1_0049_A05.b : gggcccccccctggcccccctttccctggccagtctaaatgctgacccccccaaagcttg
OVRM1_0075_A10.b :
OVRM1_0078_F07.b :
OVRM1_0101_A11.b :
BFLT1_0022_C11.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
OVR01_0095_A09.b : GG*TGTCAACACCTGGCCTCCGCTTCC*TGGGCAGCTCAATGCTGA*CCTCCCCAAGCTG
CLNT1_0070_B01.b : GG*TGTCACCA*CCTGCCCTCGCTTCCCTGGGCAGCTNCATGCTGA*CCTCCCGCAGCTG
ITT01_0028_H07.b : GG*TGTCNN*ACACTGCCTCCGCTTCCCTGGNCAGCTCAATGCTGA*CCTCCCGCAGCTG
CBLT1_0076_B05.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCAGCTC*ATGCTGA*CCTC*GCAAGCTG
ITT01_0007_D08.b : GG*TGTCACCA*CCTGCCTCCCCGCTTCCTGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
TES01_0099_C11.b : GG*TGTCACCA*CCTGCCTCCGCCTCCCTGGGCAGCTCATTGCTGA*CCTCCGCAAGCTG
BMWN1_0080_E03.b : tcacaactggctcccgtttcttgggcagttaatggtgacctccgaagctgcaattaatag
DCI01_0113_H11.b : GG*TGTCACCA*CCTGCCNTCGCTTCCCTGGNCAGACTCATGCTGA*CCCTCGCCAGCTG
OVRM1_0134_G08.b :
OVRM1_0050_B05.b :
SPL01_0048_A11.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
UTR01_0080_B05.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
LNG01_0024_D11.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*ACTCCGCAAGCTG
HTMT1_0002_G01.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCGCAAGCTG
ADR01_0005_B06.b : TG*TGTCACAA*CCTGCCTCGGCTTCCttggcagctaaaggtgacttccgcaagtgccag
THY01_0105_C06.b :
OVRM1_0023_E12.b : GG*TGTCACCCACTGCtccgcttccn
OVR01_0082_E12.b : ccctggaggggggggtgcccccccctgggcttcccgcctttctctgtggcccggtttcaa
AMP01_0009_F10.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGG*CAGCTCAATGCTGA*CCTCCGCAAGCTG
OVRM1_0088_F07.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCG
OVRM1_0207_F07.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCAGCTCAATGCTGA*ACTCCGC
THY01_0049_C02.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGCCAGCTCAATGCTGA*CCTCCCCGCAGCT
SMG01_0002_H05.b : GG*TGTCACCA*CCTGCCTCCGCTTCCCTGGGCAGCTCAATGCTGA*CCTCCGCAAGCTG
DCI01_0107_B01.b : GG*TGTCACAA**CTGGCTCCGCTTCCCTGG*CAGCTCAtgctgacctccgcagctggca
THY01_0016_H05.b : GG*TGTCACCCCCCGCCTCCGCTTCCCCTGGCCAGCTCCATGCTGA*CCCCCCCCAGCTG
20110601C-006970 : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGCCCGG*CTTTGCCCC
---------+---------+---------+---------+---------+---------+ 997
OVR01_0051_F02.b : gaagttaaaaatgggggccctttcccaaccgtctccactttatcataaggcccgggtttt
THY01_0044_H01.b : aaaaaaataagggggcccctttccccccctctcccccctttttttttttgcccgggtttt
BFLT1_0126_G11.b : gaatcatatggtggccttcccaggtctccttttttcaggcccgggttgcccctttgaccg
DCI01_0001_G08.b : tcaaatgttgccctcccagttctcccttctcatgcccggtttgccccccgaccaacgtgg
OVR01_0062_H02.b : tgggacttccaaaaggggcccctttccaaggtccccccattttacatgcccggtcttgga
OVR01_0072_D07.b : ggcaatcaaaatgggggcccttcccaagttccccccttctttaggcccggcttttgcccc
PST01_0041_F01.b : G*CAGTCAATATGGTG*CCCTTTCCACGTCTTCACTT*CTTCATGCCCGG*CTTTGCCCC
DCI01_0034_C03.b : ttttccttttttggccggtttgccctttaaacancgtgaaaccacattccggcccctcgt
OVRT1_0143_A01.b : aaaaggtgcccttcaacgtcccaattttttggccgggtttgccttctgaaaaccggggaa
OVRT1_0140_A08.b : aggggccttcccagttcccattttttaggccgggtttcccccttgaacgccggggaaaca
TES01_0001_H09.b : G*CAGTCAATATGGTG*CCCCTCCCCaagtctccactttcttcatgcccgggcttttccc
BFLT1_0152_F05.b : cattcaaattggggccttccacgtctccatttttcttgccgggttgcccctctgacaacg
LVRM1_0056_B04.b :
BMWN1_0045_B10.b : G*CAATCAATAGGGTG*CCCTTCCacgtctccacttcttaagcccggtttgcccctctga
LNG01_0010_B07.b : G*GAATCAATATGGGGGCCCTTCCCACGTCTCCCCTT*CTTCATGCCCCG*GCTTTtccc
PTG01_0048_D01.b : aggcgcccttggggtggaaccccccaagttttttttaaaaaaaaataggggtgtggcccc
OVRM1_0003_F11.b :
OVRM1_0014_B04.b :
UTR01_0012_F06.b :
OVR01_0022_F06.b : gcagcccatttgggggcccctcccacctctccccttttttctgccccggttttcccccct
TCH01_0051_G03.b : tcgccaaattccggggaaaagggtgttttccttttgactgggtcaatatcttaaaagcca
OVRT1_0106_C11.b : catcaatatggtgccttcccagttctccacttctcatgcccggttttcccttctgacagc
OVRT1_0079_G08.b : cagtcaataggtggcctttccacgtttccattcttatgcccggtttgcccctttgaacag
OVR01_0029_E11.b : ggcagtcaataatggtgcccttccccacgtctcccactttcttcatgccccgggctttgc
ITT01_0090_D05.b : G*CAGTNCATATGGTG**CCTTCCCACGTCTCCACTT*CTcatgccggctttgccctctg
OVR01_0035_G06.b : ggaagtcaaaatgggggccccttcccccgtctccccctttcttcttggcccggctttgcc
LVRM1_0098_C07.b :
OVRM1_0079_A03.b :
THY01_0007_A03.b :
PST01_0003_D02.b : aatatggggccttcccacgtctccctttctctggcccggtttgcccctttgacaaccggg
PST01_0057_H03.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*TCTCATGCCCGG*CTTTGCCCC
OVRM1_0066_B11.b :
OVR01_0083_H11.b : ttttttccccgggcccgggtctccaaaggggggaacccccccccccaaggacgtggggag
DCI01_0018_F12.b : ttcactttttatgccggctttgcctttaacaaccgggaacccacttaccggcccttctgg
PTG01_0041_H03.b : atcaaaaagggggccctttccaagtctcaatttttttggcccggtttgccccttgaacaa
BMWN1_0097_B06.b : gtcaatatgtggccttccacgtctcaatttctctgccgggcttgccctctgacagcgggg
DCI01_0021_E06.b : cccacatccactcttctgccggtttgccctctgacaacttgaaaccacattacgggctcc
HTMT1_0104_F03.b : G*CAttcatatgggggccttcccacgtctccatttttcatgccgggtttgccctcgacca
HTMT1_0055_A12.b : G*CAGTCAATATGGTGCCTTTCCacgtcttcactcttcatgccgggcntgcccctctgac
OVRT1_0111_H02.b : G*CAGTCCATATGGTGCCCTcccacgtctcaacttctcacgccgggtttgcccctctgac
BMWN1_0088_D07.b : G*CAGTCAATATGGTG**CCCTCCCACGTCTCCACTcttcatgcccggttttgccctctg
DCI01_0024_E08.b : atatggtgccttccaggtctcaattcttatgccggctttgcccttgacagncgtgaaaca
LVRM1_0122_A06.b :
OVRM1_0043_A12.b :
DCI01_0022_H08.b : cccttttttggcgcgggttgccccctaaaaaaccgggaaacaaaaaacgggccccccgtg
DCI01_0022_H02.b : tccccagttccccttcttaggccgggttttgccccttaacaaccgggaaaccaccatacc
AMP01_0101_H07.b : gcagtcataatggtgccccttcccacttctccccttccttatggcccggctttgcccctc
THY01_0071_H09.b : G*CAGTCAATATtggggcccttc
CLNT1_0115_H10.b : G*CAGTCATTATGGTG*CCCTTCCCAATTCTTCACTT*CTTTCAGGCCGG*GTTTGCCCC
OVRM1_0154_A11.b :
OVRM1_0202_F04.b :
OVRM1_0008_A06.b :
OVRM1_0119_A07.b :
OVRT1_0063_H07.b : aatggtgcctttccagtctcacttctcatgccgggtttgcccctcgaccagcgggaaacc
SPL01_0032_H03.b : G*CAtcaatatggggcctttccacgtctcactttctcatgccccgctttgccctctctac
OVR01_0037_B06.b : G*CAATCAATATGGTGGCCCTTCCcccgtccccccttctttaaggcccgggttttccccc
TES01_0006_H08.b : G*CAGTCAATAGGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGGCCCG*CTTTGCCCC
CLNT1_0092_D05.b : G*CAGTCAATATGGGTGCCCTTCCCACAGTCTCAACT*CTTCATGCCCcgcttttgccct
LNG01_0013_F07.b : G*AAGTCAATATGGGG*CCCTTCCCACGTCTCCACTT*CTTCTGGCCCGGGCTTtgcccc
DCI01_0037_B11.b : ttatggccggttttttccctcaacaaccgggaaaacaaaaaaaagggcccccgtggtctg
AMP01_0001_G04.b :
OVRM1_0200_C08.b :
OVRM1_0033_A07.b :
SPL01_0029_F02.b : gggggccttccccaagtttcccatttttttaggccggggttttgcccccctttaaaccgc
DCI01_0025_H08.b : tttttatggccgggtttcccctttaaaacacgtggaaccaaanaacagggccctcctgtg
DCI01_0033_H08.b : ccaggttcccattctttagccgggtttgcccttgaacagccgggaagcaccattaccggc
TES01_0022_G07.b : gggagtcaataatggggcccttcccaagtctcccctttctttatggccggggtttgcccc
DCI01_0017_G09.b : tcactcttatgccggttttgcctctgacagcgtggaacaccatacggggcctctgtgctg
SKNB1_0004_H11.b : G*GCGTCAATATGGTG*CCCTTCCCACGTCTCCcacttcttcaggcccgggttttgcccc
SPLT1_0062_G07.b : cattcaaaaggtggccttcccaagtctccactttttaggcccgggtttgcccctctgaac
ADR01_0040_F04.b : G*CAGccaataggggcccttcccagtctctcttcctcatgcccggtttgccctctgaaca
HTMT1_0060_C07.b : G*CAGTCAtatggtgcccttcccacgtctcaactcttcatgccgggtttgcccctctgac
DCI01_0003_H08.b : tgcccttcccagtcttctcttcttatgcccgggtttgccctctgacgagcgtggaaccaa
ITT01_0037_D10.b : G*CAGTCAATATGGTGCCCCTCCCAgtctccacttctcatgcccggcttgcccctcgacc
ITT01_0075_B02.b : G*CAATCATTATGTTGCCTTTCCCAagttccacttctttctgcgaggtttagcccctcta
BMWN1_0083_C07.b : G*CAGTCATatggtgccctccnacgtnctcacttctcatgccgggctttgccctctgacc
ITT01_0050_G03.b : G*CAGTC*ATATGGTG**CCCTCCCACGTCTCCACTT*CTcatgcccggcttgccctctg
LVR01_0057_E10.b : G*GCAGTCAAAATGGGGCCCTTCCCACTTCTCaattttttatgcccgggctttccccctc
THY01_0062_H07.b : G*CAGTCAATATGGGGGCCTTTCCCACGTCTCccctttctcatggcccggctttgcccct
CBLT1_0079_D01.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACT**CTTCATGCCCGGCTTTGCCCtc
SPL01_0063_B06.b : G*CAGTCTATATGGTGGCCCTTtccacgtttccacttttttatggccgggtttgccccct
OVRT1_0021_C12.b : G*CAATCAAAATGGTGCCCCTTCCAACGTCTCCATTT*CTTAATGCCGGG*GTTTGCCCC
DCI01_0041_F08.b : G*CAGTCaaaaggtgcccttcccagtctcacttctcatgcccgctttgccctctgacaac
DCI01_0003_A06.b : G*AAGT*TATATGGTG*CCCTTCCNACGTCTCCACTT*CTTCATGCCCGG*CTTTGGCCN
THY01_0126_C10.b :
HTMT1_0124_A03.b : cgcgctgaacaagaatacgggccanacttgcgaacaccgngggttcngtccaaaaagggt
BMWN1_0008_D04.b : aataggggcctctttttgataaccccaaagtttttataaaaaaaaatgggtggtgttccc
CBLT1_0012_C08.b : ccgtgaatcaccgaccaatatttccatctgcaaagacatcaagtgtgatgtatagaacaa
OVRM1_0148_F02.b :
SPLT1_0059_E12.b : ggaatcaaaaagggggccctttcaacgtttcccttttttagggcccggttttcccctttg
BMWN1_0061_E05.b : caaaatggggcccttccagtttcccatttttacgggccgggttgtccccctgacctgccg
ILNT1_0062_E03.b : aataggggcccttcccagtctcacttcttatgcccggttttgccctctgacaaccgtgaa
SPLT1_0066_G07.b : tcaatatggggccctcccaagtctcaattcttatgcccggtttgccctttgaccaccggg
BMWN1_0030_D07.b : ggcattcaaatggggcccttcccaagtttccccttttttaggcccggttttgccccttta
CLNT1_0133_D12.b : G*CATTCAAatggggcccttccaagtctccattttttagggccggttttgccccttggac
DCI01_0041_A10.b : caaaaagggggcctttcccacgtctcaccttcttcaggccgggttttgccctcggacaac
HTMT1_0127_E07.b : G*CAGTCAATATGGTG*CCCTTCCNACGTCTCacttctcatgcccggctttgccctctga
AMP01_0039_G06.b : atggtgccctcccagtttccatttctaaggccggcttgcccctcgacagccgtgaaaccc
THY01_0061_G10.b : G*CAGTCAATATAGGGGCCCTTCCCACGTCTCCACTT*CTTCcttgcccgggttttgccc
DCI01_0032_A06.b : cagtcatatggtgcctttccacgtcttcacttctcatgcccggcttgccctctgacagcc
CBLT1_0062_H10.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGCCCGG*CTTTGCCCC
DCI01_0096_C03.b : G*CAGTCAATGTGGTGCCttcccaccgtctcactttctcatgccgggtttgcccnntctg
CBLT1_0003_C10.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACCT*CTTCATGCCCGGGCTTTGCCCT
DCI01_0113_A12.b : G*CAGTCAATATGGTGGCCTTTCCcagtttccactccttaggcccgggtttgcccccttg
OVRM1_0048_C07.b :
OVRM1_0040_H07.b :
OVRM1_0173_E03.b :
THY01_0118_B05.b :
THY01_0108_F04.b :
THY01_0118_A11.b :
LVRM1_0005_D07.b :
DCI01_0059_E10.b :
LVRM1_0180_B09.b :
DCI01_0028_B06.b : atacggggcctcgtggcgaaatccccaaggtttaatccaaaaaaagggccgggacccccg
LVRM1_0024_A05.b :
OVR01_0075_C04.b :
OVRM1_0114_A03.b :
OVRM1_0137_E01.b :
OVRM1_0154_B02.b :
LVRM1_0065_E11.b :
OVRM1_0151_B07.b :
LVRM1_0153_B07.b :
OVRM1_0058_H04.b :
OVRM1_0126_G08.b :
OVRM1_0125_H11.b :
OVRM1_0014_A05.b :
OVRM1_0050_C01.b :
OVRM1_0168_G07.b :
OVRM1_0121_B10.b :
THY01_0050_A12.b :
DCI01_0022_H04.b : gccggctttgccctttgaacaccgtggagcagcattacggcccttctgtgcctgacttcc
THY01_0070_B01.b :
OVRM1_0022_G09.b :
DCI01_0033_F09.b : cccttttttaggccgggtttccccttaaccaacgtggaaaccaaaaaccgggcccccggg
DCI01_0019_D10.b : cgggtttccctctgacaccgggaagcacaatacgggcctatggtccgactaccacagtct
DCI01_0019_D02.b : tgcctttgacagcggggaccacatacgggcctcctggctagtcacccaagtcttagccaa
DCI01_0024_F06.b : ctcactcttatgccggtttgcccttgacagcgtgaagcagaatacgggcctcttggctga
OVR01_0071_F08.b : agctggggagggcaaaatgggggccccttcccaccattttccccttctttttgtggccgg
THY01_0046_B05.b : aaaaaaaaaaagggggccttttcccccttccccctttttttttgcccgggttttgccccc
DCI01_0019_C11.b : ttccagtctccattcttatgccggttttcccttgacaacccggaaaccaaaatccggccc
LNG01_0073_H04.b : atccatatggtgccttcccacgttccaattttttaggcgggttttgccctctgacaaccg
DCI01_0014_C03.b : gcctttcccagtctcatttcttatgccggntttgccctcgacagcgtggagccagcatac
DCI01_0031_G10.b : tggggcctttcccagtttccattcttttgcccgggtttcccctctgaccaccgggaaccc
DCI01_0023_F11.b : ggctttcccagtctcacttcttttgcccgctttcccctctgacaacctgaaaccaacgta
AMP01_0099_A06.b : tcaatttggtgccctttcccccgtcccccccttccttcctgcccggcttttcccccctcg
DCI01_0033_C11.b : ggccttccacgtttcaatttcttagccgggtttgccctttgaacaccgtggaaaccaaaa
UTR01_0038_D07.b :
OVR01_0061_B11.b : ggcagtcaataaggggccccttccacgtttcccctttctttatggcccggctttgccccc
PTG01_0021_H10.b : G*AAGTCAAatggggcccttccacgttccacttcttcaggcccgatttgccccttggaac
CLNT1_0152_A01.b : G*GAGTCaaaatgtggcctttccaagttctcacttcttcatgcccggttttgccctttga
AMP01_0065_E02.b : tgccttccnagtttccatttctctgccggctttgccctctgacagccntggagcaacgta
OVRT1_0036_B04.b : G*CAGTCATatggtggcccttccaggtctccacttctcatgccggctttgcccctctgac
ITT01_0096_A11.b : G*CAGTCAATATGGTGGCCCTTCCACcgtctcacttctcatgccgggcttgcccctctga
ITT01_0022_G11.b : G*CAGTCatatggtgcccttccacgtctccactcttcatgcccgctttgccctctgaaca
PST01_0074_C01.b : G*CAATCAATATGGTG*CCCTTTCCACGTCTCAACT**CTTCATGCCCGG*TTTTGCCCT
DCI01_0015_E06.b : ttcccagtctcactcttctgccggcttgcccttgacagcgtgaaccagcatacggncctc
OVR01_0005_B07.b : ggcagtcaatatggtgcccctccccccccctccccttcttcctgcccccgctttcccccc
DCI01_0012_G09.b : atggtgccttccaagtttcactcttcatgccgggtttccccttgaccaccttgaagccag
OVRT1_0055_G10.b : G*CAGTCatatggtgcctttccacgtctcacttcttcatgcccggtttgccctctgaaca
ITT01_0089_B01.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTCAtgcccggcttgcccctct
BKFL1_0022_F11.b : agggggcctttccaagttcccctttttaatgccgggtttcccccttaacacccgggaaac
SMG01_0067_D06.b : G*GAGTCAATATGGTGCCCCTTCCAA*GTCTTCACTT*CTTCATGGCCGGgttgcccctt
DCI01_0005_G06.b : aaatggtgccttcccacgttccacttcttaggcccggctttcccctcgaaagccgtggaa
DCI01_0010_B05.b : ttgtgcccttccccttctcactcttcagccggcttgccctttgaccgccggaaaccgcgt
THY01_0086_D10.b : GGCAGTCAATATGGTGCCCTTCCC
OVRT1_0050_C12.b : G*GAATCAATATGGTG*CCCTTCCCACGTCTCCAttcctcatggccgggtttgcccttct
ITT01_0053_E02.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*TCTCATGCCCGG*CTTTGCCCC
MLTL1_0100_H05.b : ataggggccttcccacgttccccttttaatgcccgggttgccctctaacagcgggaaaac
DCI01_0001_D08.b : tcatatggtgccctccccgtctccattctcaggccggccttgccctccgaccgccgtgaa
UTR01_0060_F12.b : G*CAGTCAATATGGGG*CCCTTCCCCCGTCTCCACCT*CCTTATGCCCCGggtttgcccc
DCI01_0004_F03.b : aatcatatggtgcctctcccacgtttctcttctgatggccggctttgcccccctgacagc
TCH01_0036_C07.b : G*CAGTCAATATGGTG*CCCTTTCCACGTCTCCACTT*TCTCATGCCGGG*CTTTGCCCt
DCI01_0095_D05.b : tcatatggtgccttccacgtctcacttctcatgccggntttgccctcntgacagcgtgaa
OVR01_0037_D04.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCCCTT*CTTCATGCCCGG*GTTTTGCCC
THY01_0207_G03.b : G*GAGTCAATATGGTGCCCTTTCCAA*GTCTCCCCTT*TCTCATGCCCGG*GTTTGCCCC
LVR01_0099_D01.b : G*CAGTCAATATGGTG*CCCTTTCCACGTCTCCACTTTCCTCATGCCCGGGCTTTGCCCC
LVR01_0058_F06.b : G*GCATCAATAATGTGCCCCTTCC*ACGTCCCCCCTT*CTTCATGCCCGG*CTTTGCCCC
THY01_0037_D02.b : G*GCAGCAATATGGGGCCCCTTCCC*CGTCCCCACTTCTTCATGGCCCGG*TTTTGCCCC
ITT01_0001_D11.b : G*CAGTCAATATGGTG*CCCCTCCCACGTCTCCACTT*CTTCATGGCCGG*CTTTGCCCC
UTR01_0087_C06.b : G*CAGTCAATATGGTG*GCCTTCCCACGTCTCCACTT*CTTCAGGCCCGG*CTTGGCCCT
AMP01_0050_H08.b : gaagtaatatgtgcccttccacctctcacttctcatgcccggcttgcccctctgacgccg
SPL01_0019_G11.b : G*CAGTCAATATGGTG*TCTTTTCCACGTCTCCACTT*CTTCATGCCCGG*CTTTGCCCC
DCI01_0072_F09.b : G*CAGTCAtatggtgccttcccacgtctccacttctcatgcccgggttgccctctgaaca
AMP01_0079_F01.b : G*CAGTCatatggtgcctttccacgtctccacttctcatgccnggctttgccctctgaca
OVR01_0012_D03.b : G*CAGTCAATATGGTNGCCCT*CCCACGTCTCCCCTT*CTTCATGCCCCG*CTTTGCCCC
THY01_0072_D05.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGGCCGGCTTTTGCCCT
DCI01_0064_H12.b : G*CAATCAATAGGGTGCCCTTCCCcagttctccctttttcaaggcccggctttgcccctt
AMP01_0086_E02.b : G*CAGTCAATATGGTGCCCT**CCNACGTCTCCACTTctcatgcccggcttgcccctctg
AMP01_0062_F08.b : G*CAGTCAATATGGTGCCCTTCCCCgtctccacttctcatggccggcttgcccctcggaa
DCI01_0061_F05.b : G*CAGGTCATATGGTG*CCCTTCCAACGTCTCCACTcttcatgcccggttttgccctctg
AMP01_0059_B04.b : G*CAGTCAATATNT**GCCCTTCCCACGTCT*CACTT*TCTCATGCCCGG*CTTTGCCtt
DCI01_0080_D02.b : G*CAGTNCATATGGTG*CCCTTTCCACGTCTCCCACT*TCTTATGCCCGG*TTTNGCCCC
OVRM1_0057_D11.b :
OVRT1_0127_H05.b : caattcatatggggcccttccaagttcccacttttttaggccgggttttcccctctgaca
OVR01_0013_B02.b : G*CAGTCAATATGGGTGCCCTtccccacgttctcaacttcttcatgcccggcttttgccc
THY01_0072_D11.b : G*CAGTCAATATGGTG*CCCTTCCNACGTCTCCACTT*CTCAtgcccggc
LVRM1_0081_D01.b :
OVRM1_0073_D04.b :
OVRT1_0039_G06.b : G*CAGTCAATATGTG**CCCCTCCCACGTCTCCACTT*CTcatgcccggtttgcccctct
PBL01_0002_E05.b : G*CAGTCAATATGGTGCCCTTCCCCACGTCTCCACTTNCTNCATGCCGGG*CTTTGCCCC
THY01_0119_F11.b :
OVRM1_0210_C06.b :
LVRM1_0007_F11.b :
DCI01_0030_B06.b : ttaggccggtttgcccttgacaacgggaaaccacataacgggcccctgggcgtactccca
OVRT1_0085_H09.b : catatggtgccctccaagtctccattcttcatgcccgctttgccctctgaacagcgtgaa
SPL01_0061_C04.b : Ggaagtcaatatggtggcctttcccacattttccctttcttcatggccgcggtttggccc
OVRT1_0085_H04.b : G*CAGTNCATATGGTGCCttccnacgtctcactttcttcatgccggctttgccctctgac
OVR01_0010_B08.b : G*CAGTCAATATGGTGGCCCTTCCCACGTCTNCCACTTCTTCATGCCCgggttttggccc
THY01_0107_G09.b :
THY01_0119_D04.b :
SPL01_0039_D01.b : caagctgggaagtcaaaatgggtgccctttcccccgtctcccacttcttcatggcccggg
AMP01_0037_G03.b : aaaaggggggcccttccccattcctactttttttgggcgcggtttcccccctttaacaac
DCI01_0008_E05.b : attggtgcccttccccgtttccttttctcaggccgggtttgccctctgacgagcgtgaag
THY01_0120_B01.b :
LVRM1_0107_A09.b :
OVRM1_0087_F04.b :
OVRM1_0091_G01.b :
OVRM1_0100_F04.b :
OVRM1_0014_B12.b :
OVRM1_0201_C09.b :
OVRM1_0022_B03.b :
THY01_0041_G12.b : aaattgggaagaaaaaaaaggggggccttttccaagtttttcccctttttttttgtgccc
UTR01_0009_F10.b :
PTG01_0044_B11.b : Gaatcaaaaagggggccttcccaagtctccattctttatgcccggttttgccccttgaca
SPL01_0009_H09.b : agcttgggcaatccaatatggggggccctttcccacgttttccacctttctttcaggccc
BFLT1_0024_G02.b : gaagtcatatggggcccttccacgtctccatttctcatgcccggttttcccctctgaaca
THY01_0062_D09.b : G*CAATCCATATGGgggcccttcccccgtttccccttttttctgcccgggttttgccccc
OVRT1_0122_G06.b : G*CAGTCAATATGGGTGCCCTCCCAggtcccacttcttcatgcccgctttgcccctcgaa
OVRT1_0133_B01.b : G*CAGTCAATAggtgccctttccaggtctccattttttctgccgggtttgcccctctaac
SPL01_0102_C09.b : G*GCGTCAATATGGGG*CCCTTTCCACGTTTCCcttttttatgcccgggtttgccccctt
LVR01_0089_C08.b : G*CAGTCAATATGGTGCCCTTTCCCCCGTCTCcccttcttcttgccccggttttgccccc
THY01_0064_F10.b : G*GAGTCAATATGGGGGCCCTTTCCACGTCTCCACTT*TTTCATGCCCcggtttttcccc
MLN01_0035_F10.b : G*CAGTCATTATGGTG*CCCTTCCCACGTCTCC*CTT*CTTCATGCCCGG*CTTTGCCCC
PBL01_0081_A05.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGCCCGGGCTTGCCCCC
LNG01_0064_A12.b : G*CAGTCAATATGGTGCCCCTCCCCACGTCTCCACTT*CTTTATGCCCGGGCTTTGCCCC
OVR01_0100_A02.b : G*CAATCAATATGGTG*CCCTTCCCACGTCTCCACTTTCTTCAGGCCCGG*CTTTGCCCT
OVRT1_0076_D12.b : G*CAATCAAAATGGTG*CCCTTCCCACGTCTTCCCTT*CTTCATGCCCG**CTTTGCCCC
PBL01_0066_F03.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGCCCCGCTTTGNCCCC
THY01_0063_A06.b : G*CAGTCAATATGGTG*CCCTTCCCCCGTCTCCCCTT*CTTCATGCCCCGGCTTTGCCCC
SPLT1_0035_A10.b : tcccaattcccattttttaggcccggttttccccctgaaaaaccgtgggaaacaaaaatc
TES01_0051_B04.b : agtcaaatggtgcccttcccccgttctccacttttttcatgccccggttttgccccttta
TES01_0112_H12.b : gcaattcaatatgggggcccttcccaggttttcccttttttcatggcccgggtttgcccc
TES01_0016_C07.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTTTC*TCATGCCCGGCTTTGCCCtc
TES01_0021_E09.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCGCCT*CTTCATGCCCGGGTTTGGCCCC
PCT01_0036_A09.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGCCgggcntgcccctc
PST01_0062_H09.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACT**CTTCATGCCCGG**TTTGCCCC
PST01_0079_A05.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTTCTTCAATGCCGGG**CTTTGCCC
PST01_0080_E09.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTTTCTTCATGCCGGG**CTTGCCCC
PST01_0065_H05.b : G*CAGTCAATATGGTGCCCCTTCC*ACGTCTCCACTT*CTTCATGCCCGG*GTTTGCCCT
PST01_0095_G01.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCAATGCCGG*CTTTGCCCC
KDN01_0065_B03.b : G*CAGTCAATATGGTG*CCCTTTCCACGTCTCCACTT*CTTCATGCCCGGGCT*TGCCCC
HTMT1_0011_H05.b : G*GCATCATTATGGGG*CCTTTCCCAAGTCTTCCCTTTCTTCATGCCCGG*TTTTGCCCC
DCI01_0007_G01.b : Gaaacaattgggtgcctttccccctcttcactttttcaggcccgggttttcccccctgac
AMP01_0041_D04.b : G*CAGTCAATATGGTG*CCCTCCANACGTCTCacttctcatggccggcttgccccntctg
BFLT1_0032_F04.b : G*CAGTCAATAGGGTGCCCTcccaagtctcacattttcaggcccggctttcccctctgac
OVRT1_0018_E06.b : G*CAGTCAATATGGTGCCCCTTCC*ACGTCTCCACTT*CTcatgccccgctttgcccttt
ADR01_0075_B08.b : G*CAGTCAATATGGTG*CCCTTTCCACGTCTCCACTT*CTTCATGCCCGG*CTTTTGCCC
OVRM1_0064_G04.b :
KDN01_0019_B05.b : G*AAGTCAAAATGGTGCCTTTCCaagttttccactcttcatgcccggttttgcccttcta
CLNT1_0098_E03.b : gagtcatatggtgcccttccacgtctccactcttcatgccggctttgccccttgacaacc
KDN01_0020_D05.b : G*CAAGCAATATGGTG*CCTTTCCCACGTCT*CACTT*CTTCATGCCCGG*TTTTGCCCC
KDN01_0025_B08.b : G*CAGTCAATATGGTGCCCTTTTCCACGTCTCACTT**CTTCATGCCCGGCTTTTGCCC*
PBL01_0093_B05.b : G*CAGTCAATATGGTGCCCCT*CCNACGTCTCCACTT*CTTCATGCCGG**CTTTNGCCC
SKNB1_0043_D07.b : G*GCAGTCATATGGTG*CCCTTCCCACGTCTCCACTT*CTCATGCCCCG**CTTTGCCCC
TCH01_0041_A04.b : G*CAGTCAATATGGGTGCCCTTTCCACGTCTCAACTT*CTTCATGCCCGG*GTTTTCCCC
MLN01_0078_G08.b : G*CAATCCATATGGGTGCCCT*CCCACGTCTCCACTT**CTCATGCCCGG*CTTTGCCCT
OVR01_0087_C02.b : G*CAGTCAATAGGTG**CCCTTTCCACGTCTCACTT**CTTCATGCCCGG*CTTTTGCCC
LVRM1_0148_A07.b :
OVRM1_0113_A12.b :
CBLT1_0012_C09.b : atggtgcctttcaagttcccatttctcaggccgggtttcccccttaacacccgggaatcc
SKNB1_0049_A05.b : ggagctcaaaaagggggcc
OVRM1_0075_A10.b :
OVRM1_0078_F07.b :
OVRM1_0101_A11.b :
BFLT1_0022_C11.b : G*CAGTCCATAGGGTG*CCCCTCCCAAGTCTCAATTT**CTTATGCCCGG*TTTTGCCCC
OVR01_0095_A09.b : G*CAGTCAATATGGGGGCCTTTCCCAGTTTCCC**TTTCTTCATGCCGGG*CTTTGCCCC
CLNT1_0070_B01.b : G*NCAGTCATATGGTG*GCCTTCCCACGTCTCCACTT*CTTCATGCCNGG*CTTTGCCCC
ITT01_0028_H07.b : G*CAGTCAATATGGGTGCCCT*CCNACGTCTCCACTT*CTTCATGGCCGG*CTTTGCCCC
CBLT1_0076_B05.b : G*GCAGTCATATGGTG*CCCTTCCCACGTCTCCACTT**CTCATGCCCGGCTTTGCCCtc
ITT01_0007_D08.b : G*CAGTNCATATGGTGCCCTTCCCCACGTCTCACTT**CTTCATGCCCGG*CTTTNGCCC
TES01_0099_C11.b : G*CAtcaatttggtgccttccccaggtttcccttcttcatggccggcttttcccccttta
BMWN1_0080_E03.b : ggggcctttcccagttcccattcttaaggccgggtttgccctttgaaaagcggggaaccc
DCI01_0113_H11.b : G*CAGTCAATATGGTGCCCTTCCacgtctccacttctcatgcccgcttgcccctctgaca
OVRM1_0134_G08.b :
OVRM1_0050_B05.b :
SPL01_0048_A11.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCCACTTCTTCATGCCCGGTTTTTGCCC*
UTR01_0080_B05.b : G*CAATCCATAATGGTGCCCTTCCCACGTCTCCACTTCTTCCATGgcccggctttgcccc
LNG01_0024_D11.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCCCTTTCTTCATGCCccggcttttgccc
HTMT1_0002_G01.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGCCCGG*CTTTGCCCC
ADR01_0005_B06.b : tcaaaatggggcccttccaagtttccatttcttcaggcccggtttgccccctgaacaacc
THY01_0105_C06.b :
OVRM1_0023_E12.b :
OVR01_0082_E12.b : agggcgtgaccctccccccaaggcttgggccaagtacaaaaatggggggggccctttctc
AMP01_0009_F10.b : G*CCGCCAATATGGGGCCCCTTCCAA*GTCTTCACCT*CTTTCTGCCCGGGCTTtgcccc
OVRM1_0088_F07.b :
OVRM1_0207_F07.b :
THY01_0049_C02.b : G*CAGTCAATATGGTG*CCCTTCCCACGTCTCCACTT*CTTCATGCCCGG*CTTTGCCCC
SMG01_0002_H05.b : G*CAGTCAATATGGTG*CCCTTTCCACGTCTCCACTT*CTTCATGCCCGG*CTTTTGCCC
DCI01_0107_B01.b : gtcaataggtgcccttcccagtctcacttctcatggccggtttgcccctcgaccaccctg
THY01_0016_H05.b : G*CAGTCAATATGGTGCCCCTTCCCCCGTCTCCTCTT*CTTCATGCCCCGGTTTTGCCCC
20110601C-006970 : TCTGACCAGCCGTGGAAGCCAGCAGTACCGGGCCCTCACTGTG*CCTGAGCTCACCCAGC
---------+---------+---------+---------+---------+---------+ 1056
OVR01_0051_F02.b : ttcccctctcgaaacaagccgggggaaaaccaaacatatccaggggcccc
THY01_0044_H01.b : ttccccctttaaacaaacccgggggaaaaacccaaaaataaagcggggccccccccctgt
BFLT1_0126_G11.b : ccgtggaaaccaacaataaccgggcctcattggcctggactccccaaagggctttcaggc
DCI01_0001_G08.b : aaccagcggtcccggtcttcctgtgcctgactcccctcaggtctcaatccaaaaatgatg
OVR01_0062_H02.b : ccctccgaacaagtcggggaaagcccccaattcccgggcccctcccggggcctgaaaact
OVR01_0072_D07.b : cctgaaccacccggggaaggcccaccgtaaccgggcccttccctgtggccggaactcacc
PST01_0041_F01.b : TCTGACCAGCCGTGGAAGCCAGCAGT*ACGGGCCCTCACTGTG*CCTGAGCTCcccagca
DCI01_0034_C03.b : gtgcgaccccccaaaggttttgtgcaaaaaaaagggtccggacccccctggccggactcc
OVRT1_0143_A01.b : accaaataccgggccccactgtggcgaactccccaaggggcttaaacaaaaaaaggaggg
OVRT1_0140_A08.b : aatttaggggccctccgtggggtagaccccccagaggttttaggccaaaaaagatgggtg
TES01_0001_H09.b : cctctgacccacccgtgaaaagccagcaattaccgggcccctcactggtgcctgagcttc
BFLT1_0152_F05.b : gggagaccaaaataccgggccctattgtgctaaacccaccccaggtcttcatgcaaaaaa
LVRM1_0056_B04.b :
BMWN1_0045_B10.b : ccaccgtggaagccaccataccgggccctcctggtgctgaactcccccacaggtttcaat
LNG01_0010_B07.b : cctctgaacagcccgggaaaaccaacaagtacccggggcccctccccggggccctgaact
PTG01_0048_D01.b : cccgcgggggaacttttgtgggttttttttcgggggccccccccggagggggaaaaaacc
OVRM1_0003_F11.b :
OVRM1_0014_B04.b :
UTR01_0012_F06.b :
OVR01_0022_F06.b : ctacccccccccgggaaccccacccaacaccccgccccctcctggttcccccaccctccc
TCH01_0051_G03.b : ccttccattcttccttctttaaattgtgctacactttaaagtcaataggcatacctccta
OVRT1_0106_C11.b : cggggaagcaacaatacgggccctcctgtgctgacctccccacaggtcttaatgccaaaa
OVRT1_0079_G08.b : ccgggagccagaataccgggccccatggtgctgaaccacccagaggttttcaagccaaaa
OVR01_0029_E11.b : cccctctggaccagcccgtggaaagccaaccagttacccgggccccttcactggtggcct
ITT01_0090_D05.b : acagccgtgaagcagcagtacggggcctcctgtgctgagctcaccgcaggtctcgatgcc
OVR01_0035_G06.b : ccctctgaacaaccccgggcaaacccaaccaataaccggggcccctcacttggggccctg
LVRM1_0098_C07.b :
OVRM1_0079_A03.b :
THY01_0007_A03.b :
PST01_0003_D02.b : gaacccacaataacgggcctcccggggccgggactcccccacagggcttccatgcaagaa
PST01_0057_H03.b : TCTGAACAGCCGTGGAGCCAGCAGTA*CCGGGCCCTCACTGTG*CCTGAGCTCCCC*AGC
OVRM1_0066_B11.b :
OVR01_0083_H11.b : gcctaaacattggggggggcctccttcctccccgatgtcttcccccttttctcttcaggg
DCI01_0018_F12.b : gcgtaatcccccaggtcttcatgcaaaaagaagggtgcttaaccccccggccggggctcc
PTG01_0041_H03.b : ccggggaaaccacataacgggccctccgtggccggaaccccccagagggcttcagcgcaa
BMWN1_0097_B06.b : aaccagcatacgggcctccggtgctaaccccccagaggctccagccaaactggaggtgcg
DCI01_0021_E06.b : gggcctacttccaacagtttcaagccaaaaagatggggcgtaacccccaggccgaacctc
HTMT1_0104_F03.b : gcctggacccaacattccgggccctccagtggccgactcaccagcgggtttcaagccaaa
HTMT1_0055_A12.b : cagccgtggaagcagcattacggggcctcaaggggccgagctcccccgcaggtcttcaag
OVRT1_0111_H02.b : caccgtgaaaacaacaataccggcctcacgtggctgacttacccagaggcttccatccaa
BMWN1_0088_D07.b : accagcgtgggaaacagcaataccgggcctcattgtggctgagctcaccagcaggtcttc
DCI01_0024_E08.b : gcataccgnccctcccgggctgactcaccagaggtcttcatgcaaaatgnaggctgccgg
LVRM1_0122_A06.b :
OVRM1_0043_A12.b :
DCI01_0022_H08.b : gcggaaaccccccaagggttctatcaaaaaaatagggtgccgggaccccccaggggggaa
DCI01_0022_H02.b : ggccctctgtgtcctaaccccccaagagctctaagcacaaaaatatgggggctgtgaccc
AMP01_0101_H07.b : ctgacccgcccggggaaaccaaccataccgggggccctcctcgggccctgaactcccccc
THY01_0071_H09.b :
CLNT1_0115_H10.b : TTTGAacaccgggggaagccacaatacggggccccattggcctgaacctccccaacgggg
OVRM1_0154_A11.b :
OVRM1_0202_F04.b :
OVRM1_0008_A06.b :
OVRM1_0119_A07.b :
OVRT1_0063_H07.b : acagtacggggcctccgggcctgagctccccacaggtctccaagccaaaacagatggcgc
SPL01_0032_H03.b : acacctggaaccaaccataccggcccctcttgtgcctgaccccccaaacaggtctccatg
OVR01_0037_B06.b : cttgaacaacccggggaaaccaacaaaaaccgggccccccctggggcccggaatttcccc
TES01_0006_H08.b : TCGAACCACCCGTGGAACCCCGCAATACCGGGCCCTCcactgggcctgaactcacccagc
CLNT1_0092_D05.b : ttgaccagccgtggaaccagccataaccgggcctcactggggctgagctccccaacaagt
LNG01_0013_F07.b : tcggaccaaccctgggaaacccagcaatacccgggcccccccatggtccctgaaactccc
DCI01_0037_B11.b : aattccccccaggtttctttccaaaaaaaatggtggcgggaaccccccctggcgggaccc
AMP01_0001_G04.b :
OVRM1_0200_C08.b :
OVRM1_0033_A07.b :
SPL01_0029_F02.b : ggggaaaacccaaataaacgggggcccccctggtggcgagaacccccccctgggggtttc
DCI01_0025_H08.b : gctgaaccccccaaggttttaatgccaaaaaaaagtggctttgaaccccccggccgggcc
DCI01_0033_H08.b : cccacgtggccgaccccccaaaggtttcaagccaaaatgaaggtgcctgaacccccctgg
TES01_0022_G07.b : ctcttaaccaacccgtggaaaccaacaaataacgggggccccccctgggccctgagcccc
DCI01_0017_G09.b : actcaccacagtttccagcaaaaataggggctggacccccgggcggacctctgggtgctt
SKNB1_0004_H11.b : tctgaacaacccgggaaagccaacaatacccgggccctcactggtgcctggacttcaccc
SPLT1_0062_G07.b : acccgtgaaaccaacattacggggccctcattgggctgaactcaccaagaggtcttccat
ADR01_0040_F04.b : cccgtgaaacccgcaatccgggccttactgggctggaatcacccacgagtcttcaagcca
HTMT1_0060_C07.b : agccgtggaagccaacataccgggcctcatggtgctgagctacccagcaggcctccaatg
DCI01_0003_H08.b : cgttcccggccccccttgggcctgaccccaccgcagtcttcaatacaaaaaatgtgggtg
ITT01_0037_D10.b : accgtggaagcagcagtaccgggcctcactgtgctgagctcacccagcagtctcgatgcc
ITT01_0075_B02.b : acagccgggggagccagcaaaaccgggccctcactgtgctgagctacccaaaaaggcttt
BMWN1_0083_C07.b : agcgtggaagcagcaataccgggcctcattggtgctaaccccaccagcaggtttcccatg
ITT01_0050_G03.b : acagccgtggaagcagcagtaccggncctcactgtgctgagctccccagcaggtctcgat
LVR01_0057_E10.b : ttaccagcccgggaaacccaaaaataccgggcccccccctggtgcctgaactccccccac
THY01_0062_H07.b : ctgaacagccggtggagcccacaagtac
CBLT1_0079_D01.b : tgaacagccggggaagcagcagtaccgggcctccatgtgcctgaccacccagaagttctt
SPL01_0063_B06.b : tgaaacaccctgaaaaccaccatacccgggcctt
OVRT1_0021_C12.b : TCTGAaccaccttgaaacccacataaccgggccctacctgggcttgacccacccaaaggt
DCI01_0041_F08.b : gtgaaaacagcattacggccttcatgggctgaactctcacaggcttcatgcaaaaataag
DCI01_0003_A06.b : TCTGANCAGGCGGGGAAACCAANAGT*CCCGGGCCCTCctgtgcctgaacccacccgcag
THY01_0126_C10.b :
HTMT1_0124_A03.b : cctgaacccccaagggacccaagaggcgtcctgggcnctcaggggagganntctcacnaa
BMWN1_0008_D04.b : ccccccggggacacacttgtggtgttttttgggggggtttttagggggggggaaaaactc
CBLT1_0012_C08.b : cccgacactactatccgactcccctgcgtaatgacgtttaaagatgcccacccacccacc
OVRM1_0148_F02.b :
SPLT1_0059_E12.b : gaacaccgtggaaaacaaaaataaccgggccttcctgggccttaacctccccccagggct
BMWN1_0061_E05.b : ggaaacaaaaaaacccggccctcccgagccgtacccccccacaggcttcttagccaaaaa
ILNT1_0062_E03.b : accaacattacgggccctccggggctgaactaccaacaggtctccatgccaaaaatgatg
SPLT1_0066_G07.b : aaaccacaatacgggccccccggtgctgacctanccacaggcttcaagccaaaaaagagg
BMWN1_0030_D07.b : acaagcgtggaaacccaaattaccgggcccttcttgggccgaaacctccccgcaggtttt
CLNT1_0133_D12.b : aaccggggaacccacaattccgggcctccctgtggcgaactccccacagggttttaagcc
DCI01_0041_A10.b : cctgaaaaccacantaccggccctttaggggcctgaacttccccacaggtcttccaagcc
HTMT1_0127_E07.b : cagccgtggaagcagcagtaccgggcctcactgtgctgactcaccagcaggtctcatgca
AMP01_0039_G06.b : gcggtcccggcccctcctggcctgacctcaccagcggtctcaagccaaaaatgatggctc
THY01_0061_G10.b : ctctgaacaagcgggggaaaccagcaaataccggggccctccctggg
DCI01_0032_A06.b : ntggagccacantacgggccctcctgggctgacctacccacaggctccatgccaaaaatg
CBLT1_0062_H10.b : TCTGACAACCCGTG*AAGCCAGCAGTACGGGGCCCTCTATGTG*CCTGggcctcacccac
DCI01_0096_C03.b : acagncgtggaaccagcagtacggggccctcctgtgcctgacctccccagcagtcttcaa
CBLT1_0003_C10.b : TCTGACCAGCCGGGAAAGCCAGCAGTACCGGGCCCTCACTGTG*CCTGAGCTCACCagca
DCI01_0113_A12.b : accaccggggaaaccaacataaccgggcctccctgggccggaactcccccccggggtttc
OVRM1_0048_C07.b :
OVRM1_0040_H07.b :
OVRM1_0173_E03.b :
THY01_0118_B05.b :
THY01_0108_F04.b :
THY01_0118_A11.b :
LVRM1_0005_D07.b :
DCI01_0059_E10.b :
LVRM1_0180_B09.b :
DCI01_0028_B06.b : gcggaaccctggggggtgctcctgggctgtttaagaggggaaaaaactccctgaaaaaaa
LVRM1_0024_A05.b :
OVR01_0075_C04.b :
OVRM1_0114_A03.b :
OVRM1_0137_E01.b :
OVRM1_0154_B02.b :
LVRM1_0065_E11.b :
OVRM1_0151_B07.b :
LVRM1_0153_B07.b :
OVRM1_0058_H04.b :
OVRM1_0126_G08.b :
OVRM1_0125_H11.b :
OVRM1_0014_A05.b :
OVRM1_0050_C01.b :
OVRM1_0168_G07.b :
OVRM1_0121_B10.b :
THY01_0050_A12.b :
DCI01_0022_H04.b : cacagttctcaagcaaaaaagatggtgcggtaccccccaggccgtactcctgggggcgtt
THY01_0070_B01.b :
OVRM1_0022_G09.b :
DCI01_0033_F09.b : ccggacccccccaaggtctcaatccaaaaataaggggcttggaccccccgggggggaccc
DCI01_0019_D10.b : catgcaaaataaggtgcgtgaccccctgccgtacccggggggtgttccgggcctccctaa
DCI01_0019_D02.b : aatatggtgctgaccccctgccggaccagggtgcgttccgggccttcttagaggggtaaa
DCI01_0024_F06.b : ctcccacaggtttcagcaaaaatgaggtgcttgacccccagggcggcctcagtgcccgtt
OVR01_0071_F08.b : gggttttcccccccctaaccaacccccggaaaaacccaccaataataccggcgccccctc
THY01_0046_B05.b : cttaaaacccccgggaaaaacaaaaaaaaacgggggcccccctttggggcctgaatctcc
DCI01_0019_C11.b : tctgggccgaatttccgcaggtttcatccaaaaatgaggttctgtaacccccggcgggac
LNG01_0073_H04.b : ggaaaccacaataacgggccccctgggcccgacctccccaaaggtttcaatgcaaaacag
DCI01_0014_C03.b : cggcctcatgtgctgacctcacaccagtcttcaagcaaaaagtaggctgctggaacccgc
DCI01_0031_G10.b : acaaaacgggcctcccggtgctaaatcccccccaggttttcatgcaaaaataagggtgcc
DCI01_0023_F11.b : ccgggcttcttggctgaactcccaaaaggcttcattcaaaaatgagggtgccggtacccc
AMP01_0099_A06.b : aacccacccggggaaaccacaccattccccgggccccccctggggcctgaacctccccca
DCI01_0033_C11.b : taccgggcccccctgggctaacctcccaccaggtttctattccaaaaatgaggcggcctg
UTR01_0038_D07.b :
OVR01_0061_B11.b : tctgaaccaacccgtggaaaaccccaccaataaccggggcccttacttgggcccggaacc
PTG01_0021_H10.b : accgtggaaaccaacaatacggggcctcatggggccgaactcaccaaaagtcttcgtgca
CLNT1_0152_A01.b : ccaccgtgggaacccaccaatacgggcctccttggcctgaacccaccagcagtctttatg
AMP01_0065_E02.b : cgggccctcctgggccgacctcacaagagcttcaagccaaaatgaatgttgcggtgaccc
OVRT1_0036_B04.b : cggcgtgaaagcaggaataccgggcctcactgggcctgactaccagcaggtcttcatgca
ITT01_0096_A11.b : acagcgtggaagcagcagtacgggccctcactgtgctgagctcaccagcaggtctcgatg
ITT01_0022_G11.b : ccgggaaagccacagtaccggccctcctggtgctgaactcacccagaagtcttcatgcca
PST01_0074_C01.b : CTGaccagccgtggaacccgcaataccggcccctcctgtgcccgagctcaccaaccaggt
DCI01_0015_E06.b : ctgtgcgactccccacagtctcatgcaaaataggctgcgggaccccctgcggacctatgg
OVR01_0005_B07.b : ctgacccccccccggaaaaccccccaataacccgccccctcccttgttccttaacctccc
DCI01_0012_G09.b : cataccggccctcctggcctgagctccccccggtcttctatgcaaaaagaggctgcctgg
OVRT1_0055_G10.b : ccgtggaagcagacatacgggccctcactgtgctgaactccccaccagtcttcaagccaa
ITT01_0089_B01.b : gacagccgtgaaagcagcagtaccgggccctcctgtgccgacctcacccagcagtctcga
BKFL1_0022_F11.b : ccaataccggcgccccggggctaaatccccccggggttttatgcccaaaaagagggggcc
SMG01_0067_D06.b : cgaccaccctggaaacccacattaccgggccctcccgggcccgaaccacccccaagtttt
DCI01_0005_G06.b : ccagcatacgggcctcctgtgtggactccccagcagcttccagcccaaaatgatgcggct
DCI01_0010_B05.b : accggcctcctgtgctaacccccctaggtctcaagcaaaaatgtgggtgccggaccccca
THY01_0086_D10.b :
OVRT1_0050_C12.b : aacaagccggaagccaacattacgggccctcaacggtcctgacctcccccagcaggtctc
ITT01_0053_E02.b : TCTGACagcgtggaagcagcagtaccgggcctcactgtgctgagctcaccagcaggtctt
MLTL1_0100_H05.b : cacataccggccctcctgtggcgaactcccaaggtttttaaccaaaaaaaaggggccgga
DCI01_0001_D08.b : agccgagtaccggccctcctgtgccgaactccccacaggtctccatgcaagacatgatgt
UTR01_0060_F12.b : tctgaacagcccgggaaacccagcagttaccgggccctccctggtgcctgaacctcaccc
DCI01_0004_F03.b : cggggaagccaaggtaccggggccccctggggctgaccccccacctggtctctaaacaaa
TCH01_0036_C07.b : ctgaccagccgtgaaagccacagtaccggggcctcacggggccggacctcaccaccaggg
DCI01_0095_D05.b : gcaacataccgggcctcatgggctgactcacccacagcttcaatgcaaaactatgctggc
OVR01_0037_D04.b : Ttctaacaacccgggaaacccaacaaaaccggggccctccctgtggcctgaacttccccc
THY01_0207_G03.b : TCTGAaccaccctggaaaccaacaaatacccggcccccccttgggccctaaactcccccc
LVR01_0099_D01.b : TCTGACCAgccggtggaagccagcagtacccgggccctccactgtgcctgagctcaaccc
LVR01_0058_F06.b : TCTGAACAGCCcgggaaacccagaattaccgggcccctcccctgtgccgaaacccccccc
THY01_0037_D02.b : TCTGACCACCCGTGGAAacccagcaaaaccggggccctccctggggcctgaacctccccc
ITT01_0001_D11.b : TCTGACCAGCCGTGGA*GCCAGCAGTACCGGGCCCTCACTGTGgcctgagctcacccagc
UTR01_0087_C06.b : TCTGAACAACCGTGGAAGACAGCcattccggggccctccctgggcctgaacctcccccac
AMP01_0050_H08.b : tggagccaccgtacgggatgcaccgaaaaaagtagagatttcgtgagaagccaaaaagag
SPL01_0019_G11.b : TCTGACCAGCCGTGGAAAGCAGC
DCI01_0072_F09.b : gcgtgaagccagcatacggggcctcatgggctgacctcaccacagggctccatgccaaaa
AMP01_0079_F01.b : gncggggaacccacagtgcgggccctcctggggctgaactccccagcagtcttcaatgcc
OVR01_0012_D03.b : TCTGACCAGCCcgtggaagccagcagtactggggccctccctgtggcttgagctcaccca
THY01_0072_D05.b : CTGACCAGCCCGTGAAAGCCAGCAGTACCGGGCCCTC
DCI01_0064_H12.b : tgaacaaccgtgggagccaaacaatactgggccctctcgtggcccggagccccccccaca
AMP01_0086_E02.b : acaaccgtggaaccgcagtacgggccctcccgtggctgactccccccccagtttcnaggc
AMP01_0062_F08.b : caacgagaaagcaacaatacgggggctccctggcctaacctcaccacaggcttctagcca
DCI01_0061_F05.b : accancgtgaaaccagcaatactggccctcttgggctgagccaccaacaggcctccatgc
AMP01_0059_B04.b : ctgacagncgtggaagcagcagtacgggccctcctgggctgacctccccaacagttcttc
DCI01_0080_D02.b : TCTGACaancgtggaacccagcatacgggccctcattgggccgacctccccaacaggtct
OVRM1_0057_D11.b :
OVRT1_0127_H05.b : gccgtggaaacagcattccgggccctactgggccgaaccacccaagaggtttaagccaaa
OVR01_0013_B02.b : cctctgaccagcccctgggaagccaacaagtacccggggccctccctgtggcctggaact
THY01_0072_D11.b :
LVRM1_0081_D01.b :
OVRM1_0073_D04.b :
OVRT1_0039_G06.b : gacagcgttgaaccagcattacgggcctcactgtgctgactcaccagcagtctccatgca
PBL01_0002_E05.b : TCTGACCAGCCcgtggaaagccagcagtaacggggcccctccctgtgccctgagctcccc
THY01_0119_F11.b :
OVRM1_0210_C06.b :
LVRM1_0007_F11.b :
DCI01_0030_B06.b : ccgggtttcatccaaaaaatggggccgggaccccccggccggactcctggggtggtttcc
OVRT1_0085_H09.b : accagcataccggcctcatgggctgactcaccagcagtctcaatgcaaaactgatggtgc
SPL01_0061_C04.b : ctctgaacaacccgggggaaaacccacgcattacccgggcccccccaatggggccctgaa
OVRT1_0085_H04.b : cagcgtggaagcagcagtaccggccctcacgtggctgacctcaccagcaggtctccatgc
OVR01_0010_B08.b : cttggacagccgtgggaaagcagcaagtacggggccctttcctggtggctgagtttcccc
THY01_0107_G09.b :
THY01_0119_D04.b :
SPL01_0039_D01.b : ttttggcccctctgaaccaacccggggaaaccccagcaaaaaccggggcccctccattgg
AMP01_0037_G03.b : cgggaaaaaccaagataccgggcccccctggttcctaaactccccccccgggttttcaaa
DCI01_0008_E05.b : ccagagatccggcctccttggcctaacccccagcggtctcaatacaaaaatgtggttgcg
THY01_0120_B01.b :
LVRM1_0107_A09.b :
OVRM1_0087_F04.b :
OVRM1_0091_G01.b :
OVRM1_0100_F04.b :
OVRM1_0014_B12.b :
OVRM1_0201_C09.b :
OVRM1_0022_B03.b :
THY01_0041_G12.b : gggttttggcccccttggaaacaacccggggagaaccaaacaaaaccccccggccccccc
UTR01_0009_F10.b :
PTG01_0044_B11.b : accgtgaaaccacaattccgggcccccctgggcctgaatcacccgaaggcttcatgcaaa
SPL01_0009_H09.b : cggggttttgcccccttctaaacaacccctgggaaaactcct
BFLT1_0024_G02.b : cccgggaaacccccaataccgggccctcccgggcctgagcctccccacaaggcttccatg
THY01_0062_D09.b : ccgacagccctggaaacccagaataacccgggcccttccctgtgcctgaatttcc
OVRT1_0122_G06.b : caagcctggagccagcaataacgggccctcatgggctgagctccccagaaggctttcaag
OVRT1_0133_B01.b : ccccctgaaaccacgagtacgggccctcctggcctggactccccagaggtcttcaaggca
SPL01_0102_C09.b : gaacagccctgggaaccaacagtaccggccctccctggtcctggaactcccccgaaggtc
LVR01_0089_C08.b : tctgacccgccctgggaaacccagcaatacccgggccccctcacttgggcccctaaaccc
THY01_0064_F10.b : tctgaccaaccgctggaaaccaccaaaacccgggccc
MLN01_0035_F10.b : TCTGACagccgtggaaaccaacataccgggccctcctgtgcctgacctcaccaccaggtc
PBL01_0081_A05.b : TCTGAC*AGCCGTGGAAAGCAGCAGCACCGGGCctcactgtgcctgagctccccagcagg
LNG01_0064_A12.b : TCTGACCAGCCGGGGAAacccaacagtaccgggccctccactgtgccctgagctcaccca
OVR01_0100_A02.b : TCTGAACAGCCCTGGAAGCCAagcataaccgggcccctcacggtgccctggacttccccc
OVRT1_0076_D12.b : TCTGAACANCCGGGAAACCAAGCAATACCGGGCCCctccggggcccgaacctccccacag
PBL01_0066_F03.b : TCTGAC*AGCCGTGGAAGCCAGCAGTACCCGGGCCTCACTGTG*CCTGAGCTCACCagca
THY01_0063_A06.b : TCTGACCAGCCGGGGAAGCCAGCAGTACCcgggccctccctga
SPLT1_0035_A10.b : cgggcccctctgggctgaaaccaccccaggggtttttaagcaaaaaaaaaagggggccgg
TES01_0051_B04.b : aacagcccgggaaaccacaaaataccgggccccctcatgggcccgaagcctccccagcag
TES01_0112_H12.b : ctttgaacaacccgggaaacccaaccaataccgggcccctcccggggccgaaaccccccc
TES01_0016_C07.b : tgaccagccgtgaaaccagccatacgggccctcactgtgctgagctccccagcaagtcct
TES01_0021_E09.b : TCTGACaacccggggaaacaagcaattcccgggccttccctgggcctggagcctacccca
PCT01_0036_A09.b : tgaccaccgtggaagcagcagtacggggcctcactgggctgaactcaccgcaggtcttca
PST01_0062_H09.b : TCTGACaancgtggagccaacagtaccgggccctcctgggcctgaactcaccagcaggtc
PST01_0079_A05.b : TCTGAACAGCCGTGGAAAGCcagcata