[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007008

Length: 1,367

Sequence [FASTA format sequence]
ACAACACTGA AATGGTGTGC ATTTGAAAAG TGAATAGATG CTAAGAGCGA ATGAGTCAGA
AGCACATGAG TTCTAAGTGG TTGAACTCCA GAGAGCAGAT CAAGCAATGC TGTTTAATAC
CATCACATGA TCTGCCCCGA GGCCCAGTAT TTCATTAAAA CAAGGAACAG GGCACAGCAG
AAGCCAGGAG AGCACTGTTC TTAGTGGATG GAGCCAGAAG AGTTACAAGT TAAACCTTGA
TTTCCCGGGT CTGTGAAGAT TCAGCATGGA ATGTCTCTAC TGTTTTCTGG GATTTCTGCT
TCTGGCTGCA ATATTGCCAC TTGATGCCGC CAAACGGTTT CAGGATGTGC TGAGCAATGA
AAGACCTTCC AGTTATATGA GGGAGCACAA CCAATTAAAC GGCTGGTCTT CAGATGAGAA
TGACTGGAAT GAAAAACTCT ATCCAGTTTG GAAGAGGGGA GACTCAAGGT GGAAAAACTC
TTGGAAAGGG GGCCGCGTGC GGGCAGTTCT GACCAGTGAT TCACCAGCAC TGGTGGGCTC
AACCATAACA TTCGCCGTGA ACCTGGTTTT CCCCAGATGC CAAAAGGAAG ATGCCGATGG
CAACATAGTC TATGAGAAGA ACTGCAGAAA TGATTCTGGG CCATCCCCCG ACCCATATGT
TTACAACTGG ACAGCATGGA CAGAGGACAA TGACTGGAGA GATGGCACCA GCCAAGGCCA
TCACAACGTG TTCCCTGACG GGAAGCCTTT CCCTCACCCC TGGAAACGGA ATTTCGTCTA
CGTATTCCAC ACACTTGGTC AGTATTTCCA GAAATTGGGA CGGTGTTCAG TGAGTGTTTC
TATAAACACA GCCAACGTGA CTCTTGGGCC TCAAGTCATG GAAGTGACTG TCTACAGAAG
ACACGGACGG ACGTATGTTC CCATCGCAAA AGTGAAAGAT GTCTATGTGG TAACAGACCA
GATTCCCATA TTTGTGACTA TGTCCCAGAA GAACAATCGA AATTCATCTG ATGAAATCTT
CCTCAAGGAC CTCCCCATTA TCTTCCATGT CCTGATTCAT GATCCCAGCC ACTTCCTCAT
GAGTCTGCCA TTTACTACAA GTGGAATTTG GGGGATAATA CTGGTCTGTT TGTTTCTAAC
AATCCCATTA TGAACCATAC CTATGTGCTC AATGGAACCT TCAGCTTCAA CCTCACTGTG
CAAGCTACAG TGCCTGGACT TTGTTCTTCA CCTTCACCCA GACCTCCAAA AACCACCCCT
TCTTTGTTTC TCGCTGGTGG CAAACCCCTG GAGCTGAGGG AGATTCCTGT TGAAAACTGC
AGATAACAGA TATGGCTACT TTATGGCCAC CATCACATTT GTAGCGG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGPNMBtransmembrane glycoprotein NMB isoform a precursor [Homo sapiens]. 471e-151O
Contig/Assembly ProteinGPNMBtransmembrane glycoprotein NMB isoform b precursor [Homo sapiens]. 471e-152O
Contig/Assembly ProteinPMELmelanocyte protein Pmel 17 isoform 1 precursor [Homo sapiens]. 1372e-37O
Contig/Assembly ProteinPMELmelanocyte protein PMEL isoform 3 preproprotein [Homo sapiens]. 1372e-37O
Contig/Assembly ProteinPMELmelanocyte protein PMEL isoform 2 precursor [Homo sapiens]. 1011e-26O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGpnmbtransmembrane glycoprotein NMB precursor [Mus musculus]. 411e-133O
Contig/Assembly ProteinPmelmelanocyte protein PMEL precursor [Mus musculus]. 1371e-37O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC482355PREDICTED: similar to glycoprotein (transmembrane) nmb isoform a precursor isoform 3 [Canis familiaris]. 433e-121O
Contig/Assembly ProteinLOC482355PREDICTED: similar to glycoprotein (transmembrane) nmb isoform b precursor isoform 2 [Canis familiaris]. 424e-141O
Contig/Assembly ProteinPMELmelanocyte protein Pmel 17 [Canis lupus familiaris]. 1346e-37O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGPNMBtransmembrane glycoprotein NMB [Bos taurus]. 489e-164O
Contig/Assembly ProteinPMELmelanocyte protein PMEL precursor [Bos taurus]. 1302e-35O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGPNMBtransmembrane glycoprotein NMB [Sus scrofa]. 5440.0O
Contig/Assembly ProteinLOC100626164PREDICTED: melanocyte protein PMEL-like [Sus scrofa]. 1241e-34O


Assembly Members: 405      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010002H04AMP01_0002_H04.bBW955117 
AMP010004C04AMP01_0004_C04.bBW955224 
AMP010007B06AMP01_0007_B06.bBW955451 
AMP010008D03AMP01_0008_D03.bBW955534 AK389619
AMP010009F01AMP01_0009_F01.bBW955627 
AMP010012D01AMP01_0012_D01.bBW955862 
AMP010012H09AMP01_0012_H09.bBW955904 AK230588
AMP010013C05AMP01_0013_C05.bBW955925 
AMP010013F02AMP01_0013_F02.bBW955955 
AMP010013G11AMP01_0013_G11.bBW955973 
AMP010015H11AMP01_0015_H11.bBW956133 
AMP010016C02AMP01_0016_C02.bBW956151 
AMP010016D03AMP01_0016_D03.bBW956162 
AMP010017A07AMP01_0017_A07.bBW956218 
AMP010017G10AMP01_0017_G10.bBW956283 
AMP010018C04AMP01_0018_C04.bBW956318 
AMP010018H12AMP01_0018_H12.bBW956381 
AMP010019E11AMP01_0019_E11.bBW956434 
AMP010019H09AMP01_0019_H09.bBW956464 
AMP010020B12AMP01_0020_B12.bBW956479 
AMP010023E05AMP01_0023_E05.bBW956729 
AMP010024F07AMP01_0024_F07.bBW956810 
AMP010025A12AMP01_0025_A12.bBW956837 
AMP010025F03AMP01_0025_F03.bBW956882 
AMP010026F02AMP01_0026_F02.bBW956961 
AMP010027H12AMP01_0027_H12.bBW957073 
AMP010028D11AMP01_0028_D11.bBW957111 
AMP010028G04AMP01_0028_G04.bBW957139 
AMP010033F05AMP01_0033_F05.bBW957375 
AMP010047F08AMP01_0047_F08.bBW958340 
AMP010051G04AMP01_0051_G04.bBW958640 
AMP010053A07AMP01_0053_A07.bBW958738 
AMP010054D03AMP01_0054_D03.bBW958851 
AMP010056B08AMP01_0056_B08.bBW958992 
AMP010057B04AMP01_0057_B04.bBW959071 
AMP010057C12AMP01_0057_C12.bBW959087 
AMP010057H07AMP01_0057_H07.bBW959135 
AMP010058F09AMP01_0058_F09.bBW959198 
AMP010064D07AMP01_0064_D07.bBW959635 
AMP010065A06AMP01_0065_A06.bBW959685 
AMP010070A10AMP01_0070_A10.bBW960065 
AMP010079E05AMP01_0079_E05.b  
AMP010083C10AMP01_0083_C10.bBW960997 
AMP010089A01AMP01_0089_A01.bBW961481 
AMP010089C06AMP01_0089_C06.bBW961505 
AMP010092A11AMP01_0092_A11.bBW961743 
AMP010092E04AMP01_0092_E04.bBW961776 
AMP010092H11AMP01_0092_H11.bBW961816 
AMP010093D05AMP01_0093_D05.bBW961851 
AMP010094H06AMP01_0094_H06.bBW961982 
AMP010099D03AMP01_0099_D03.bBW962383 
AMP010101C04AMP01_0101_C04.bBW962552 
DCI010001E04DCI01_0001_E04.bDB790653 
DCI010002G01DCI01_0002_G01.bDB790728 
DCI010003D06DCI01_0003_D06.bDB790775 
DCI010004H02DCI01_0004_H02.bDB790881 
DCI010005E05DCI01_0005_E05.bDB790925 
DCI010007E11DCI01_0007_E11.bDB791013 AK391210
DCI010007F05DCI01_0007_F05.bDB791018 
DCI010007G07DCI01_0007_G07.bDB791028 
DCI010008A03DCI01_0008_A03.bDB791038 
DCI010008B05DCI01_0008_B05.bDB791047 
DCI010008E08DCI01_0008_E08.bDB791074 
DCI010009A07DCI01_0009_A07.bDB791104 
DCI010009E08DCI01_0009_E08.bDB791129 
DCI010010A04DCI01_0010_A04.bDB791160 
DCI010010B02DCI01_0010_B02.bDB791170 
DCI010010C08DCI01_0010_C08.bDB791187 
DCI010010D04DCI01_0010_D04.bDB791194 
DCI010011A07DCI01_0011_A07.bDB791252 
DCI010011E05DCI01_0011_E05.bDB791293 
DCI010011E09DCI01_0011_E09.bDB791297 
DCI010011G10DCI01_0011_G10.bDB791319 
DCI010011H09DCI01_0011_H09.bDB791330 
DCI010012B11DCI01_0012_B11.bDB791350 
DCI010012C02DCI01_0012_C02.bDB791352 
DCI010012C07DCI01_0012_C07.bDB791357 
DCI010012E09DCI01_0012_E09.bDB791382 
DCI010012G03DCI01_0012_G03.bDB791397 
DCI010012G07DCI01_0012_G07.bDB791401 
DCI010012G10DCI01_0012_G10.bDB791404 
DCI010013A05DCI01_0013_A05.bDB791421 
DCI010013C11DCI01_0013_C11.bDB791450 
DCI010013D06DCI01_0013_D06.bDB791456 
DCI010013E03DCI01_0013_E03.bDB791463 
DCI010013E06DCI01_0013_E06.bDB791466 
DCI010013G03DCI01_0013_G03.bDB791484 
DCI010014A11DCI01_0014_A11.bDB791512 
DCI010014D03DCI01_0014_D03.bDB791535 
DCI010014E10DCI01_0014_E10.bDB791552 
DCI010014F11DCI01_0014_F11.bDB791565 
DCI010014H10DCI01_0014_H10.bDB791582 
DCI010015F05DCI01_0015_F05.bDB791646 
DCI010015G01DCI01_0015_G01.bDB791654 
DCI010015H03DCI01_0015_H03.bDB791668 
DCI010015H05DCI01_0015_H05.bDB791670 
DCI010015H11DCI01_0015_H11.bDB791675 
DCI010016A07DCI01_0016_A07.bDB791682 
DCI010016D04DCI01_0016_D04.bDB791714 
DCI010016D11DCI01_0016_D11.bDB791721 
DCI010016E03DCI01_0016_E03.bDB791725 
DCI010016F06DCI01_0016_F06.bDB791740 
DCI010016G07DCI01_0016_G07.bDB791752 
DCI010016G09DCI01_0016_G09.bDB791753 
DCI010017A10DCI01_0017_A10.bDB791776 
DCI010017C01DCI01_0017_C01.bDB791789 
DCI010017D07DCI01_0017_D07.bDB791806 
DCI010017E05DCI01_0017_E05.bDB791815 
DCI010017F01DCI01_0017_F01.bDB791822 
DCI010017H02DCI01_0017_H02.bDB791845 
DCI010018D09DCI01_0018_D09.bDB791897 
DCI010018G07DCI01_0018_G07.bDB791930 
DCI010018G12DCI01_0018_G12.bDB791935 
DCI010019C04DCI01_0019_C04.bDB791972 
DCI010019D05DCI01_0019_D05.bDB791985 
DCI010019E05DCI01_0019_E05.bDB791996 
DCI010019H05DCI01_0019_H05.bDB792031 
DCI010020B12DCI01_0020_B12.bDB792059 
DCI010020C10DCI01_0020_C10.bDB792069 
DCI010020D12DCI01_0020_D12.bDB792083 
DCI010021B07DCI01_0021_B07.bDB792145 
DCI010021D04DCI01_0021_D04.bDB792164 
DCI010021F12DCI01_0021_F12.bDB792195 
DCI010021G05DCI01_0021_G05.bDB792199 
DCI010022C01DCI01_0022_C01.bDB792242 
DCI010022H03DCI01_0022_H03.bDB792300 
DCI010023A12DCI01_0023_A12.bDB792320 
DCI010023B10DCI01_0023_B10.bDB792330 
DCI010023C03DCI01_0023_C03.bDB792335 
DCI010024D08DCI01_0024_D08.bDB792441 
DCI010024G06DCI01_0024_G06.bDB792470 
DCI010025A04DCI01_0025_A04.bDB792492 
DCI010025B04DCI01_0025_B04.bDB792503 
DCI010025B05DCI01_0025_B05.bDB792504 
DCI010025F09DCI01_0025_F09.bDB792553 
DCI010025G05DCI01_0025_G05.bDB792560 
DCI010026A07DCI01_0026_A07.bDB792586 
DCI010026A10DCI01_0026_A10.bDB792589 
DCI010026C08DCI01_0026_C08.bDB792609 
DCI010026D04DCI01_0026_D04.bDB792616 
DCI010026E06DCI01_0026_E06.bDB792629 
DCI010026F02DCI01_0026_F02.bDB792636 
DCI010027A12DCI01_0027_A12.bDB792681 
DCI010027B10DCI01_0027_B10.bDB792691 
DCI010027G01DCI01_0027_G01.bDB792737 
DCI010028A02DCI01_0028_A02.bDB792761 
DCI010028E07DCI01_0028_E07.bDB792797 
DCI010028F02DCI01_0028_F02.bDB792803 
DCI010028G12DCI01_0028_G12.bDB792821 
DCI010028H03DCI01_0028_H03.bDB792824 
DCI010028H06DCI01_0028_H06.bDB792827 
DCI010028H07DCI01_0028_H07.bDB792828 
DCI010029C05DCI01_0029_C05.bDB792856 
DCI010029E04DCI01_0029_E04.bDB792879 
DCI010029E05DCI01_0029_E05.bDB792880 
DCI010029H03DCI01_0029_H03.bDB792912 
DCI010030H07DCI01_0030_H07.bDB793003 
DCI010031A06DCI01_0031_A06.bDB793012 
DCI010031C04DCI01_0031_C04.bDB793034 
DCI010031D03DCI01_0031_D03.bDB793044 
DCI010031F11DCI01_0031_F11.bDB793074 
DCI010031G04DCI01_0031_G04.bDB793079 
DCI010031G12DCI01_0031_G12.bDB793086 
DCI010031H06DCI01_0031_H06.bDB793091 
DCI010031H12DCI01_0031_H12.bDB793097 
DCI010032A03DCI01_0032_A03.bDB793099 
DCI010032B07DCI01_0032_B07.bDB793115 
DCI010032D07DCI01_0032_D07.bDB793138 
DCI010032E02DCI01_0032_E02.bDB793145 
DCI010032E10DCI01_0032_E10.bDB793152 
DCI010032F03DCI01_0032_F03.bDB793157 
DCI010032F12DCI01_0032_F12.bDB793166 
DCI010033A09DCI01_0033_A09.bDB793197 
DCI010033C02DCI01_0033_C02.bDB793212 
DCI010033C10DCI01_0033_C10.bDB793220 
DCI010033H09DCI01_0033_H09.bDB793278 AK391303
DCI010034B06DCI01_0034_B06.bDB793299 
DCI010034C07DCI01_0034_C07.bDB793312 
DCI010034E12DCI01_0034_E12.bDB793341 
DCI010034G12DCI01_0034_G12.bDB793364 
DCI010035A08DCI01_0035_A08.bDB793383 
DCI010035C06DCI01_0035_C06.bDB793404 
DCI010035F09DCI01_0035_F09.bDB793440 
DCI010035H02DCI01_0035_H02.bDB793456 
DCI010036A06DCI01_0036_A06.bDB793472 
DCI010036C06DCI01_0036_C06.bDB793495 
DCI010036C08DCI01_0036_C08.bDB793497 
DCI010036C09DCI01_0036_C09.bDB793498 
DCI010036E02DCI01_0036_E02.bDB793513 
DCI010036F02DCI01_0036_F02.bDB793523 
DCI010037B03DCI01_0037_B03.bDB793570 
DCI010037C01DCI01_0037_C01.bDB793578 
DCI010037F06DCI01_0037_F06.bDB793615 
DCI010037G07DCI01_0037_G07.bDB793627 
DCI010038C05DCI01_0038_C05.bDB793669 
DCI010038G06DCI01_0038_G06.bDB793714 
DCI010039A03DCI01_0039_A03.bDB793733 
DCI010040A02DCI01_0040_A02.bDB793766 
DCI010040G11DCI01_0040_G11.bDB793795 
DCI010040H10DCI01_0040_H10.bDB793800 
DCI010041D11DCI01_0041_D11.bDB793843 
DCI010041E01DCI01_0041_E01.bDB793845 
DCI010042C02DCI01_0042_C02.bDB793911 
DCI010042F07DCI01_0042_F07.bDB793952 
DCI010043B07DCI01_0043_B07.bDB793998 
DCI010043E03DCI01_0043_E03.bDB794025 
DCI010045C01DCI01_0045_C01.bDB794185 
DCI010057B05DCI01_0057_B05.bDB794610 
DCI010057B10DCI01_0057_B10.bDB794614 
DCI010057C11DCI01_0057_C11.bDB794627 
DCI010057F03DCI01_0057_F03.bDB794654 
DCI010058B04DCI01_0058_B04.bDB794698 
DCI010058B05DCI01_0058_B05.bDB794699 
DCI010058B09DCI01_0058_B09.bDB794703 
DCI010058C03DCI01_0058_C03.bDB794709 
DCI010058C06DCI01_0058_C06.bDB794712 
DCI010058G04DCI01_0058_G04.bDB794754 
DCI010058H12DCI01_0058_H12.bDB794773 
DCI010059D12DCI01_0059_D12.bDB794816 
DCI010059F03DCI01_0059_F03.bDB794830 
DCI010061B02DCI01_0061_B02.bDB794964 
DCI010061C10DCI01_0061_C10.bDB794984 
DCI010061D08DCI01_0061_D08.bDB794994 
DCI010061E05DCI01_0061_E05.bDB795003 
DCI010062D11DCI01_0062_D11.bDB795090 
DCI010062H02DCI01_0062_H02.bDB795127 
DCI010063A11DCI01_0063_A11.bDB795147 
DCI010063B04DCI01_0063_B04.bDB795152 AK391369
DCI010063G01DCI01_0063_G01.bDB795205 
DCI010063G05DCI01_0063_G05.bDB795209 
DCI010063G06DCI01_0063_G06.bDB795210 
DCI010064C01DCI01_0064_C01.bDB795249 
DCI010064C10DCI01_0064_C10.bDB795258 
DCI010064F08DCI01_0064_F08.bDB795289 
DCI010065B05DCI01_0065_B05.bDB795332 
DCI010065C09DCI01_0065_C09.bDB795348 
DCI010065E04DCI01_0065_E04.bDB795364 
DCI010065G03DCI01_0065_G03.bDB795386 
DCI010066A07DCI01_0066_A07.bDB795411 
DCI010066B12DCI01_0066_B12.bDB795428 
DCI010066D11DCI01_0066_D11.bDB795450 
DCI010066E08DCI01_0066_E08.bDB795459 
DCI010066H06DCI01_0066_H06.bDB795491 
DCI010067E11DCI01_0067_E11.bDB795550 
DCI010067G08DCI01_0067_G08.bDB795570 
DCI010068B09DCI01_0068_B09.bDB795604 
DCI010068D09DCI01_0068_D09.bDB795627 
DCI010068E08DCI01_0068_E08.bDB795637 
DCI010068G10DCI01_0068_G10.bDB795663 
DCI010069A01DCI01_0069_A01.bDB795676 
DCI010069A07DCI01_0069_A07.bDB795681 
DCI010069D05DCI01_0069_D05.bDB795708 
DCI010069H09DCI01_0069_H09.bDB795752 
DCI010070C11DCI01_0070_C11.bDB795787 
DCI010070E07DCI01_0070_E07.bDB795806 
DCI010070G02DCI01_0070_G02.bDB795824 
DCI010070G07DCI01_0070_G07.bDB795829 
DCI010070G08DCI01_0070_G08.bDB795830 
DCI010070G09DCI01_0070_G09.bDB795831 
DCI010070G11DCI01_0070_G11.bDB795833 
DCI010071A06DCI01_0071_A06.bDB795849 
DCI010071D09DCI01_0071_D09.bDB795887 
DCI010071F05DCI01_0071_F05.bDB795905 
DCI010071H07DCI01_0071_H07.bDB795928 
DCI010073E02DCI01_0073_E02.bDB796064 
DCI010074C10DCI01_0074_C10.bDB796139 
DCI010075D06DCI01_0075_D06.bDB796231 
DCI010075H06DCI01_0075_H06.bDB796274 
DCI010076F08DCI01_0076_F08.bDB796342 
DCI010077D05DCI01_0077_D05.bDB796399 
DCI010077F03DCI01_0077_F03.bDB796419 
DCI010077F09DCI01_0077_F09.bDB796425 
DCI010077H05DCI01_0077_H05.bDB796443 
DCI010078C10DCI01_0078_C10.bDB796484 
DCI010078F01DCI01_0078_F01.bDB796509 
DCI010079E10DCI01_0079_E10.bDB796595 
DCI010079H01DCI01_0079_H01.bDB796620 
DCI010080A06DCI01_0080_A06.bDB796635 
DCI010080E08DCI01_0080_E08.bDB796678 
DCI010081D08DCI01_0081_D08.bDB796755 
DCI010081H07DCI01_0081_H07.bDB796800 
DCI010081H12DCI01_0081_H12.bDB796804 
DCI010082C06DCI01_0082_C06.bDB796832 
DCI010082C08DCI01_0082_C08.bDB796834 
DCI010082D12DCI01_0082_D12.bDB796848 
DCI010082G03DCI01_0082_G03.bDB796874 
DCI010084A01DCI01_0084_A01.bDB796978 
DCI010084C04DCI01_0084_C04.bDB797005 
DCI010084F08DCI01_0084_F08.bDB797043 
DCI010085D11DCI01_0085_D11.bDB797111 
DCI010085H02DCI01_0085_H02.bDB797148 
DCI010085H11DCI01_0085_H11.bDB797157 
DCI010086C03DCI01_0086_C03.bDB797183 
DCI010086D02DCI01_0086_D02.bDB797194 
DCI010086D12DCI01_0086_D12.bDB797204 
DCI010086E02DCI01_0086_E02.bDB797206 
DCI010086F05DCI01_0086_F05.bDB797221 
DCI010087E11DCI01_0087_E11.bDB797303 
DCI010087F08DCI01_0087_F08.bDB797311 
DCI010087F09DCI01_0087_F09.bDB797312 
DCI010087G06DCI01_0087_G06.bDB797321 
DCI010088F09DCI01_0088_F09.bDB797399 
DCI010088F11DCI01_0088_F11.bDB797400 
DCI010089B06DCI01_0089_B06.bDB797440 
DCI010090B04DCI01_0090_B04.bDB797527 
DCI010090C01DCI01_0090_C01.b  
DCI010090E12DCI01_0090_E12.bDB797567 
DCI010090F04DCI01_0090_F04.bDB797571 
DCI010091F07DCI01_0091_F07.bDB797663 
DCI010091G05DCI01_0091_G05.bDB797673 
DCI010091G06DCI01_0091_G06.bDB797674 
DCI010092B02DCI01_0092_B02.bDB797705 
DCI010092D05DCI01_0092_D05.bDB797727 
DCI010092E01DCI01_0092_E01.bDB797735 
DCI010093A02DCI01_0093_A02.bDB797783 
DCI010093B04DCI01_0093_B04.bDB797796 
DCI010093C09DCI01_0093_C09.bDB797813 
DCI010093H05DCI01_0093_H05.bDB797865 
DCI010094B06DCI01_0094_B06.bDB797889 
DCI010094C03DCI01_0094_C03.bDB797898 
DCI010094D03DCI01_0094_D03.bDB797908 
DCI010095E10DCI01_0095_E10.bDB798014 
DCI010095G02DCI01_0095_G02.bDB798029 
DCI010096C10DCI01_0096_C10.bDB798076 
DCI010096E05DCI01_0096_E05.bDB798094 
DCI010096F10DCI01_0096_F10.bDB798108 
DCI010097B08DCI01_0097_B08.bDB798150 
DCI010097C09DCI01_0097_C09.bDB798163 
DCI010097F02DCI01_0097_F02.bDB798190 
DCI010097F05DCI01_0097_F05.bDB798193 
DCI010097H05DCI01_0097_H05.bDB798217 
DCI010097H11DCI01_0097_H11.bDB798222 
DCI010098D08DCI01_0098_D08.bDB798261 
DCI010098H06DCI01_0098_H06.bDB798307 
DCI010099A11DCI01_0099_A11.bDB798324 
DCI010099C11DCI01_0099_C11.bDB798347 
DCI010099E02DCI01_0099_E02.bDB798362 
DCI010099E09DCI01_0099_E09.bDB798369 
DCI010099E12DCI01_0099_E12.bDB798372 
DCI010099F05DCI01_0099_F05.bDB798377 
DCI010100A11DCI01_0100_A11.bDB798419 
DCI010100F02DCI01_0100_F02.bDB798464 
DCI010100G04DCI01_0100_G04.bDB798477 
DCI010101C06DCI01_0101_C06.bDB798526 
DCI010101H03DCI01_0101_H03.bDB798578 
DCI010102A05DCI01_0102_A05.bDB798592 
DCI010102B11DCI01_0102_B11.bDB798607 
DCI010102G12DCI01_0102_G12.bDB798664 
DCI010102H05DCI01_0102_H05.bDB798668 
DCI010103E12DCI01_0103_E12.bDB798728 
DCI010103G02DCI01_0103_G02.bDB798740 
DCI010103G10DCI01_0103_G10.bDB798748 
DCI010103H03DCI01_0103_H03.bDB798753 
DCI010104A06DCI01_0104_A06.bDB798768 
DCI010104E11DCI01_0104_E11.bDB798816 
DCI010104F11DCI01_0104_F11.bDB798826 
DCI010104H06DCI01_0104_H06.b  
DCI010106C12DCI01_0106_C12.bDB798967 
DCI010106E05DCI01_0106_E05.bDB798983 
DCI010106F10DCI01_0106_F10.bDB798998 
DCI010106G09DCI01_0106_G09.bDB799009 
DCI010107B03DCI01_0107_B03.bDB799032 
DCI010107D05DCI01_0107_D05.bDB799051 
DCI010107E06DCI01_0107_E06.bDB799063 
DCI010108E12DCI01_0108_E12.bDB799148 
DCI010108H04DCI01_0108_H04.bDB799171 
DCI010109A09DCI01_0109_A09.bDB799186 
DCI010109B11DCI01_0109_B11.bDB799200 
DCI010109D01DCI01_0109_D01.bDB799214 
DCI010109F05DCI01_0109_F05.bDB799239 
DCI010109G01DCI01_0109_G01.bDB799247 
DCI010109G06DCI01_0109_G06.bDB799252 
DCI010110B09DCI01_0110_B09.bDB799290 
DCI010110D12DCI01_0110_D12.bDB799317 
DCI010110G05DCI01_0110_G05.bDB799343 
DCI010111C04DCI01_0111_C04.bDB799387 
DCI010111C08DCI01_0111_C08.bDB799391 
DCI010111G06DCI01_0111_G06.bDB799432 
DCI010112D01DCI01_0112_D01.bDB799483 
DCI010112E09DCI01_0112_E09.bDB799503 
DCI010112E10DCI01_0112_E10.bDB799504 
DCI010112G10DCI01_0112_G10.bDB799527 
DCI010113A06DCI01_0113_A06.bDB799546 
DCI010113F07DCI01_0113_F07.bDB799600 
DCI010113F08DCI01_0113_F08.bDB799601 
DCI010113G08DCI01_0113_G08.bDB799613 
DCI010113H09DCI01_0113_H09.bDB799625 
DCI010114D07DCI01_0114_D07.bDB799668 
DCI010114D10DCI01_0114_D10.bDB799671 
DCI010114F01DCI01_0114_F01.bDB799686 
DCI010115C02DCI01_0115_C02.bDB799744 
DCI010115D03DCI01_0115_D03.bDB799756 
DCI010115F04DCI01_0115_F04.bDB799780 
DCI010115H03DCI01_0115_H03.bDB799801 
DCI010116C10DCI01_0116_C10.bDB799842 
DCI010116H07DCI01_0116_H07.bDB799894 
DCI010117B04DCI01_0117_B04.bDB799915 
DCI010117D08DCI01_0117_D08.bDB799941 
DCI010117E04DCI01_0117_E04.bDB799949 
DCI010117E05DCI01_0117_E05.bDB799950 
DCI010117F10DCI01_0117_F10.bDB799967 
DCI010118A07DCI01_0118_A07.bDB799998 
DCI010118B09DCI01_0118_B09.bDB800011 
KDN010056D08KDN01_0056_D08.bHX234791 
OVRM10131B05OVRM1_0131_B05.bBP146649 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
596A2500.065WNAAT/N
G36010.935GAT/D
873A5200.325WNCAA/Q
C10800.675CCA/P
1141A200.333WNAAT/N
C400.667CAT/H


Alignment:      TOP

20110601C-007008 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0043_E03.b : aatctatagggctgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_F01.b : nnnnttcaatannataagtacccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E04.b : atttta
DCI01_0034_B06.b :
DCI01_0012_C02.b :
DCI01_0021_F12.b :
DCI01_0021_B07.b :
AMP01_0008_D03.b :
DCI01_0103_G02.b :
DCI01_0104_E11.b :
DCI01_0117_F10.b :
DCI01_0099_E02.b :
DCI01_0062_H02.b :
DCI01_0068_D09.b :
DCI01_0081_D08.b :
DCI01_0088_F11.b :
DCI01_0110_G05.b :
DCI01_0071_F05.b :
DCI01_0007_G07.b :
DCI01_0025_G05.b :
DCI01_0093_C09.b :
AMP01_0009_F01.b :
AMP01_0019_E11.b :
AMP01_0012_H09.b :
AMP01_0013_F02.b :
AMP01_0089_C06.b :
AMP01_0018_C04.b :
AMP01_0070_A10.b :
AMP01_0056_B08.b :
AMP01_0024_F07.b :
AMP01_0054_D03.b :
DCI01_0032_A03.b :
DCI01_0043_B07.b :
AMP01_0012_D01.b :
AMP01_0020_B12.b :
DCI01_0026_F02.b :
AMP01_0013_G11.b :
DCI01_0031_H12.b :
DCI01_0040_G11.b :
DCI01_0040_H10.b :
DCI01_0057_C11.b :
DCI01_0058_B04.b :
DCI01_0057_F03.b :
DCI01_0058_G04.b :
DCI01_0025_F09.b :
DCI01_0057_B05.b :
DCI01_0023_A12.b :
DCI01_0037_C01.b :
DCI01_0026_A07.b :
DCI01_0017_F01.b :
DCI01_0032_F03.b :
DCI01_0102_H05.b :
DCI01_0037_F06.b :
DCI01_0032_E10.b :
DCI01_0028_H06.b :
DCI01_0026_E06.b :
DCI01_0018_G12.b :
DCI01_0103_H03.b :
DCI01_0041_E01.b :
AMP01_0007_B06.b :
AMP01_0017_G10.b :
DCI01_0033_H09.b :
DCI01_0010_B02.b :
AMP01_0051_G04.b :
AMP01_0028_D11.b :
DCI01_0017_D07.b :
AMP01_0093_D05.b :
AMP01_0028_G04.b :
DCI01_0036_C06.b :
DCI01_0013_A05.b :
DCI01_0036_C08.b :
DCI01_0034_E12.b :
AMP01_0026_F02.b :
DCI01_0023_C03.b :
DCI01_0014_D03.b :
DCI01_0016_A07.b :
AMP01_0016_C02.b :
DCI01_0022_H03.b :
DCI01_0028_E07.b :
DCI01_0024_D08.b :
AMP01_0004_C04.b :
DCI01_0041_D11.b :
AMP01_0019_H09.b :
AMP01_0025_F03.b :
AMP01_0018_H12.b :
AMP01_0079_E05.b :
AMP01_0016_D03.b :
AMP01_0015_H11.b :
DCI01_0109_F05.b :
AMP01_0033_F05.b :
DCI01_0090_B04.b :
AMP01_0017_A07.b :
DCI01_0082_C06.b :
DCI01_0009_A07.b :
DCI01_0108_E12.b :
DCI01_0115_F04.b :
DCI01_0024_G06.b :
AMP01_0092_E04.b :
DCI01_0012_G10.b :
DCI01_0017_A10.b :
DCI01_0077_H05.b :
DCI01_0109_B11.b :
AMP01_0057_H07.b :
DCI01_0029_E04.b :
DCI01_0077_F03.b :
DCI01_0015_H05.b :
DCI01_0096_E05.b :
DCI01_0092_E01.b :
DCI01_0008_B05.b :
DCI01_0098_D08.b :
DCI01_0085_H11.b :
DCI01_0010_A04.b :
DCI01_0063_G06.b :
DCI01_0019_D05.b :
DCI01_0016_F06.b :
DCI01_0070_G08.b :
DCI01_0065_B05.b :
AMP01_0065_A06.b :
AMP01_0058_F09.b :
DCI01_0066_D11.b :
AMP01_0064_D07.b :
AMP01_0099_D03.b :
DCI01_0104_F11.b :
DCI01_0070_G11.b :
DCI01_0087_F08.b :
DCI01_0113_G08.b :
DCI01_0089_B06.b :
DCI01_0113_F07.b :
AMP01_0089_A01.b :
DCI01_0109_G01.b :
DCI01_0116_H07.b :
DCI01_0082_D12.b :
DCI01_0066_A07.b :
DCI01_0042_F07.b :
DCI01_0007_E11.b :
DCI01_0007_F05.b :
DCI01_0070_G09.b :
DCI01_0066_E08.b :
DCI01_0069_A07.b :
DCI01_0110_D12.b :
AMP01_0025_A12.b :
AMP01_0094_H06.b :
DCI01_0061_B02.b :
AMP01_0053_A07.b :
OVRM1_0131_B05.b :
DCI01_0040_A02.b :
DCI01_0104_H06.b :
DCI01_0059_F03.b :
DCI01_0016_D11.b :
DCI01_0118_A07.b :
DCI01_0085_H02.b :
DCI01_0108_H04.b :
AMP01_0083_C10.b :
DCI01_0070_C11.b :
DCI01_0081_H07.b :
DCI01_0087_F09.b :
DCI01_0034_C07.b :
DCI01_0088_F09.b :
DCI01_0084_A01.b :
DCI01_0036_F02.b :
DCI01_0071_H07.b :
DCI01_0118_B09.b :
DCI01_0068_E08.b :
DCI01_0112_E09.b :
DCI01_0091_F07.b :
DCI01_0070_G02.b :
DCI01_0107_D05.b :
DCI01_0013_G03.b :
DCI01_0028_A02.b :
DCI01_0028_F02.b :
DCI01_0028_H07.b :
DCI01_0058_H12.b :
DCI01_0026_A10.b :
DCI01_0038_G06.b :
DCI01_0070_E07.b :
DCI01_0028_G12.b :
DCI01_0057_B10.b :
DCI01_0058_C03.b :
DCI01_0028_H03.b :
DCI01_0058_C06.b :
DCI01_0035_F09.b :
DCI01_0058_B05.b :
DCI01_0059_D12.b :
DCI01_0032_E02.b :
DCI01_0081_H12.b :
DCI01_0058_B09.b :
DCI01_0039_A03.b :
DCI01_0033_C02.b :
DCI01_0027_A12.b :
DCI01_0035_H02.b :
DCI01_0032_F12.b :
DCI01_0036_E02.b :
DCI01_0012_B11.b :
DCI01_0032_B07.b :
DCI01_0029_H03.b :
DCI01_0033_A09.b :
DCI01_0034_G12.b :
DCI01_0032_D07.b :
DCI01_0106_C12.b :
DCI01_0023_B10.b :
DCI01_0031_G04.b :
DCI01_0027_B10.b :
DCI01_0025_B04.b :
DCI01_0030_H07.b :
DCI01_0027_G01.b :
DCI01_0026_D04.b :
DCI01_0036_C09.b :
DCI01_0017_E05.b :
DCI01_0019_E05.b :
DCI01_0031_D03.b :
DCI01_0025_B05.b :
DCI01_0035_A08.b :
DCI01_0011_H09.b :
DCI01_0026_C08.b :
DCI01_0017_C01.b :
DCI01_0031_A06.b :
DCI01_0018_D09.b :
DCI01_0025_A04.b :
DCI01_0031_H06.b :
DCI01_0036_A06.b :
DCI01_0011_G10.b :
DCI01_0020_C10.b :
DCI01_0037_G07.b :
DCI01_0017_H02.b :
DCI01_0038_C05.b :
DCI01_0029_C05.b :
DCI01_0029_E05.b :
DCI01_0066_H06.b :
DCI01_0033_C10.b :
DCI01_0013_E03.b :
DCI01_0031_C04.b :
DCI01_0037_B03.b :
DCI01_0016_G09.b :
DCI01_0008_A03.b :
DCI01_0019_C04.b :
DCI01_0106_F10.b :
DCI01_0022_C01.b :
DCI01_0009_E08.b :
DCI01_0013_E06.b :
DCI01_0090_C01.b :
DCI01_0107_B03.b :
DCI01_0107_E06.b :
DCI01_0031_G12.b :
AMP01_0047_F08.b :
DCI01_0069_A01.b :
DCI01_0012_G03.b :
DCI01_0011_E05.b :
DCI01_0035_C06.b :
AMP01_0027_H12.b :
DCI01_0117_D08.b :
DCI01_0013_C11.b :
DCI01_0117_B04.b :
DCI01_0003_D06.b :
DCI01_0082_G03.b :
DCI01_0111_C08.b :
DCI01_0115_D03.b :
DCI01_0103_G10.b :
DCI01_0020_D12.b :
DCI01_0016_G07.b :
DCI01_0064_C01.b :
DCI01_0005_E05.b :
DCI01_0101_H03.b :
DCI01_0102_A05.b :
DCI01_0021_G05.b :
DCI01_0019_H05.b :
DCI01_0097_H11.b :
DCI01_0113_A06.b :
DCI01_0114_D10.b :
DCI01_0016_D04.b :
DCI01_0117_E05.b :
DCI01_0010_D04.b :
DCI01_0014_E10.b :
DCI01_0008_E08.b :
DCI01_0014_A11.b :
DCI01_0114_D07.b :
DCI01_0109_G06.b :
DCI01_0103_E12.b :
DCI01_0075_D06.b :
DCI01_0086_E02.b :
DCI01_0018_G07.b :
DCI01_0069_D05.b :
DCI01_0091_G06.b :
DCI01_0115_H03.b :
DCI01_0076_F08.b :
DCI01_0015_H03.b :
DCI01_0020_B12.b :
DCI01_0091_G05.b :
DCI01_0099_E12.b :
DCI01_0106_G09.b :
DCI01_0011_E09.b :
DCI01_0097_F02.b :
DCI01_0086_F05.b :
DCI01_0106_E05.b :
DCI01_0095_G02.b :
DCI01_0098_H06.b :
DCI01_0117_E04.b :
DCI01_0012_G07.b :
DCI01_0016_E03.b :
DCI01_0075_H06.b :
DCI01_0063_G05.b :
DCI01_0063_A11.b :
DCI01_0096_F10.b :
DCI01_0014_F11.b :
DCI01_0015_H11.b :
DCI01_0012_E09.b :
DCI01_0065_G03.b :
DCI01_0077_F09.b :
DCI01_0092_B02.b :
DCI01_0087_G06.b :
DCI01_0097_F05.b :
DCI01_0109_D01.b :
DCI01_0084_C04.b :
DCI01_0094_C03.b :
DCI01_0097_B08.b :
DCI01_0067_G08.b :
DCI01_0102_G12.b :
DCI01_0096_C10.b :
DCI01_0099_F05.b :
DCI01_0104_A06.b :
DCI01_0063_B04.b :
DCI01_0099_A11.b :
DCI01_0068_G10.b :
DCI01_0061_C10.b :
DCI01_0079_E10.b :
DCI01_0063_G01.b :
DCI01_0092_D05.b :
DCI01_0094_D03.b :
DCI01_0010_C08.b :
DCI01_0079_H01.b :
DCI01_0116_C10.b :
DCI01_0112_G10.b :
DCI01_0070_G07.b :
DCI01_0090_F04.b :
DCI01_0102_B11.b :
DCI01_0093_B04.b :
DCI01_0086_C03.b :
DCI01_0093_H05.b :
DCI01_0111_G06.b :
DCI01_0113_F08.b :
DCI01_0112_E10.b :
DCI01_0094_B06.b :
DCI01_0095_E10.b :
DCI01_0113_H09.b :
DCI01_0115_C02.b :
DCI01_0097_H05.b :
AMP01_0023_E05.b :
DCI01_0090_E12.b :
DCI01_0110_B09.b :
DCI01_0080_E08.b :
DCI01_0100_A11.b :
DCI01_0085_D11.b :
DCI01_0084_F08.b :
DCI01_0015_F05.b :
DCI01_0112_D01.b :
DCI01_0045_C01.b :
DCI01_0100_G04.b :
DCI01_0073_E02.b :
AMP01_0101_C04.b :
DCI01_0061_E05.b :
DCI01_0011_A07.b :
DCI01_0069_H09.b :
DCI01_0077_D05.b :
DCI01_0004_H02.b :
DCI01_0093_A02.b :
DCI01_0100_F02.b :
DCI01_0014_H10.b :
DCI01_0002_G01.b :
DCI01_0086_D12.b :
DCI01_0031_F11.b :
DCI01_0061_D08.b :
DCI01_0099_E09.b :
DCI01_0099_C11.b :
DCI01_0064_C10.b :
DCI01_0062_D11.b :
DCI01_0015_G01.b :
DCI01_0074_C10.b :
DCI01_0066_B12.b :
DCI01_0087_E11.b :
DCI01_0064_F08.b :
AMP01_0057_C12.b :
DCI01_0111_C04.b :
DCI01_0080_A06.b :
DCI01_0067_E11.b :
DCI01_0021_D04.b :
AMP01_0057_B04.b :
DCI01_0013_D06.b :
AMP01_0013_C05.b :
DCI01_0101_C06.b :
DCI01_0097_C09.b :
DCI01_0078_F01.b :
DCI01_0071_A06.b :
AMP01_0092_H11.b :
KDN01_0056_D08.b :
DCI01_0071_D09.b :
DCI01_0068_B09.b :
DCI01_0065_C09.b :
DCI01_0012_C07.b :
AMP01_0002_H04.b :
DCI01_0082_C08.b :
DCI01_0109_A09.b :
DCI01_0086_D02.b :
DCI01_0078_C10.b :
DCI01_0001_E04.b :
AMP01_0092_A11.b :
DCI01_0042_C02.b :
20110601C-007008 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0043_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E04.b : ccgtaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_B06.b : nnaaacatactaaxxxxxxxx
DCI01_0012_C02.b :
DCI01_0021_F12.b :
DCI01_0021_B07.b :
AMP01_0008_D03.b :
DCI01_0103_G02.b :
DCI01_0104_E11.b :
DCI01_0117_F10.b :
DCI01_0099_E02.b :
DCI01_0062_H02.b :
DCI01_0068_D09.b :
DCI01_0081_D08.b :
DCI01_0088_F11.b :
DCI01_0110_G05.b :
DCI01_0071_F05.b :
DCI01_0007_G07.b :
DCI01_0025_G05.b :
DCI01_0093_C09.b :
AMP01_0009_F01.b :
AMP01_0019_E11.b :
AMP01_0012_H09.b :
AMP01_0013_F02.b :
AMP01_0089_C06.b :
AMP01_0018_C04.b :
AMP01_0070_A10.b :
AMP01_0056_B08.b :
AMP01_0024_F07.b :
AMP01_0054_D03.b :
DCI01_0032_A03.b :
DCI01_0043_B07.b :
AMP01_0012_D01.b :
AMP01_0020_B12.b :
DCI01_0026_F02.b :
AMP01_0013_G11.b :
DCI01_0031_H12.b :
DCI01_0040_G11.b :
DCI01_0040_H10.b :
DCI01_0057_C11.b :
DCI01_0058_B04.b :
DCI01_0057_F03.b :
DCI01_0058_G04.b :
DCI01_0025_F09.b :
DCI01_0057_B05.b :
DCI01_0023_A12.b :
DCI01_0037_C01.b :
DCI01_0026_A07.b :
DCI01_0017_F01.b :
DCI01_0032_F03.b :
DCI01_0102_H05.b :
DCI01_0037_F06.b :
DCI01_0032_E10.b :
DCI01_0028_H06.b :
DCI01_0026_E06.b :
DCI01_0018_G12.b :
DCI01_0103_H03.b :
DCI01_0041_E01.b :
AMP01_0007_B06.b :
AMP01_0017_G10.b :
DCI01_0033_H09.b :
DCI01_0010_B02.b :
AMP01_0051_G04.b :
AMP01_0028_D11.b :
DCI01_0017_D07.b :
AMP01_0093_D05.b :
AMP01_0028_G04.b :
DCI01_0036_C06.b :
DCI01_0013_A05.b :
DCI01_0036_C08.b :
DCI01_0034_E12.b :
AMP01_0026_F02.b :
DCI01_0023_C03.b :
DCI01_0014_D03.b :
DCI01_0016_A07.b :
AMP01_0016_C02.b :
DCI01_0022_H03.b :
DCI01_0028_E07.b :
DCI01_0024_D08.b :
AMP01_0004_C04.b :
DCI01_0041_D11.b :
AMP01_0019_H09.b :
AMP01_0025_F03.b :
AMP01_0018_H12.b :
AMP01_0079_E05.b :
AMP01_0016_D03.b :
AMP01_0015_H11.b :
DCI01_0109_F05.b :
AMP01_0033_F05.b :
DCI01_0090_B04.b :
AMP01_0017_A07.b :
DCI01_0082_C06.b :
DCI01_0009_A07.b :
DCI01_0108_E12.b :
DCI01_0115_F04.b :
DCI01_0024_G06.b :
AMP01_0092_E04.b :
DCI01_0012_G10.b :
DCI01_0017_A10.b :
DCI01_0077_H05.b :
DCI01_0109_B11.b :
AMP01_0057_H07.b :
DCI01_0029_E04.b :
DCI01_0077_F03.b :
DCI01_0015_H05.b :
DCI01_0096_E05.b :
DCI01_0092_E01.b :
DCI01_0008_B05.b :
DCI01_0098_D08.b :
DCI01_0085_H11.b :
DCI01_0010_A04.b :
DCI01_0063_G06.b :
DCI01_0019_D05.b :
DCI01_0016_F06.b :
DCI01_0070_G08.b :
DCI01_0065_B05.b :
AMP01_0065_A06.b :
AMP01_0058_F09.b :
DCI01_0066_D11.b :
AMP01_0064_D07.b :
AMP01_0099_D03.b :
DCI01_0104_F11.b :
DCI01_0070_G11.b :
DCI01_0087_F08.b :
DCI01_0113_G08.b :
DCI01_0089_B06.b :
DCI01_0113_F07.b :
AMP01_0089_A01.b :
DCI01_0109_G01.b :
DCI01_0116_H07.b :
DCI01_0082_D12.b :
DCI01_0066_A07.b :
DCI01_0042_F07.b :
DCI01_0007_E11.b :
DCI01_0007_F05.b :
DCI01_0070_G09.b :
DCI01_0066_E08.b :
DCI01_0069_A07.b :
DCI01_0110_D12.b :
AMP01_0025_A12.b :
AMP01_0094_H06.b :
DCI01_0061_B02.b :
AMP01_0053_A07.b :
OVRM1_0131_B05.b :
DCI01_0040_A02.b :
DCI01_0104_H06.b :
DCI01_0059_F03.b :
DCI01_0016_D11.b :
DCI01_0118_A07.b :
DCI01_0085_H02.b :
DCI01_0108_H04.b :
AMP01_0083_C10.b :
DCI01_0070_C11.b :
DCI01_0081_H07.b :
DCI01_0087_F09.b :
DCI01_0034_C07.b :
DCI01_0088_F09.b :
DCI01_0084_A01.b :
DCI01_0036_F02.b :
DCI01_0071_H07.b :
DCI01_0118_B09.b :
DCI01_0068_E08.b :
DCI01_0112_E09.b :
DCI01_0091_F07.b :
DCI01_0070_G02.b :
DCI01_0107_D05.b :
DCI01_0013_G03.b :
DCI01_0028_A02.b :
DCI01_0028_F02.b :
DCI01_0028_H07.b :
DCI01_0058_H12.b :
DCI01_0026_A10.b :
DCI01_0038_G06.b :
DCI01_0070_E07.b :
DCI01_0028_G12.b :
DCI01_0057_B10.b :
DCI01_0058_C03.b :
DCI01_0028_H03.b :
DCI01_0058_C06.b :
DCI01_0035_F09.b :
DCI01_0058_B05.b :
DCI01_0059_D12.b :
DCI01_0032_E02.b :
DCI01_0081_H12.b :
DCI01_0058_B09.b :
DCI01_0039_A03.b :
DCI01_0033_C02.b :
DCI01_0027_A12.b :
DCI01_0035_H02.b :
DCI01_0032_F12.b :
DCI01_0036_E02.b :
DCI01_0012_B11.b :
DCI01_0032_B07.b :
DCI01_0029_H03.b :
DCI01_0033_A09.b :
DCI01_0034_G12.b :
DCI01_0032_D07.b :
DCI01_0106_C12.b :
DCI01_0023_B10.b :
DCI01_0031_G04.b :
DCI01_0027_B10.b :
DCI01_0025_B04.b :
DCI01_0030_H07.b :
DCI01_0027_G01.b :
DCI01_0026_D04.b :
DCI01_0036_C09.b :
DCI01_0017_E05.b :
DCI01_0019_E05.b :
DCI01_0031_D03.b :
DCI01_0025_B05.b :
DCI01_0035_A08.b :
DCI01_0011_H09.b :
DCI01_0026_C08.b :
DCI01_0017_C01.b :
DCI01_0031_A06.b :
DCI01_0018_D09.b :
DCI01_0025_A04.b :
DCI01_0031_H06.b :
DCI01_0036_A06.b :
DCI01_0011_G10.b :
DCI01_0020_C10.b :
DCI01_0037_G07.b :
DCI01_0017_H02.b :
DCI01_0038_C05.b :
DCI01_0029_C05.b :
DCI01_0029_E05.b :
DCI01_0066_H06.b :
DCI01_0033_C10.b :
DCI01_0013_E03.b :
DCI01_0031_C04.b :
DCI01_0037_B03.b :
DCI01_0016_G09.b :
DCI01_0008_A03.b :
DCI01_0019_C04.b :
DCI01_0106_F10.b :
DCI01_0022_C01.b :
DCI01_0009_E08.b :
DCI01_0013_E06.b :
DCI01_0090_C01.b :
DCI01_0107_B03.b :
DCI01_0107_E06.b :
DCI01_0031_G12.b :
AMP01_0047_F08.b :
DCI01_0069_A01.b :
DCI01_0012_G03.b :
DCI01_0011_E05.b :
DCI01_0035_C06.b :
AMP01_0027_H12.b :
DCI01_0117_D08.b :
DCI01_0013_C11.b :
DCI01_0117_B04.b :
DCI01_0003_D06.b :
DCI01_0082_G03.b :
DCI01_0111_C08.b :
DCI01_0115_D03.b :
DCI01_0103_G10.b :
DCI01_0020_D12.b :
DCI01_0016_G07.b :
DCI01_0064_C01.b :
DCI01_0005_E05.b :
DCI01_0101_H03.b :
DCI01_0102_A05.b :
DCI01_0021_G05.b :
DCI01_0019_H05.b :
DCI01_0097_H11.b :
DCI01_0113_A06.b :
DCI01_0114_D10.b :
DCI01_0016_D04.b :
DCI01_0117_E05.b :
DCI01_0010_D04.b :
DCI01_0014_E10.b :
DCI01_0008_E08.b :
DCI01_0014_A11.b :
DCI01_0114_D07.b :
DCI01_0109_G06.b :
DCI01_0103_E12.b :
DCI01_0075_D06.b :
DCI01_0086_E02.b :
DCI01_0018_G07.b :
DCI01_0069_D05.b :
DCI01_0091_G06.b :
DCI01_0115_H03.b :
DCI01_0076_F08.b :
DCI01_0015_H03.b :
DCI01_0020_B12.b :
DCI01_0091_G05.b :
DCI01_0099_E12.b :
DCI01_0106_G09.b :
DCI01_0011_E09.b :
DCI01_0097_F02.b :
DCI01_0086_F05.b :
DCI01_0106_E05.b :
DCI01_0095_G02.b :
DCI01_0098_H06.b :
DCI01_0117_E04.b :
DCI01_0012_G07.b :
DCI01_0016_E03.b :
DCI01_0075_H06.b :
DCI01_0063_G05.b :
DCI01_0063_A11.b :
DCI01_0096_F10.b :
DCI01_0014_F11.b :
DCI01_0015_H11.b :
DCI01_0012_E09.b :
DCI01_0065_G03.b :
DCI01_0077_F09.b :
DCI01_0092_B02.b :
DCI01_0087_G06.b :
DCI01_0097_F05.b :
DCI01_0109_D01.b :
DCI01_0084_C04.b :
DCI01_0094_C03.b :
DCI01_0097_B08.b :
DCI01_0067_G08.b :
DCI01_0102_G12.b :
DCI01_0096_C10.b :
DCI01_0099_F05.b :
DCI01_0104_A06.b :
DCI01_0063_B04.b :
DCI01_0099_A11.b :
DCI01_0068_G10.b :
DCI01_0061_C10.b :
DCI01_0079_E10.b :
DCI01_0063_G01.b :
DCI01_0092_D05.b :
DCI01_0094_D03.b :
DCI01_0010_C08.b :
DCI01_0079_H01.b :
DCI01_0116_C10.b :
DCI01_0112_G10.b :
DCI01_0070_G07.b :
DCI01_0090_F04.b :
DCI01_0102_B11.b :
DCI01_0093_B04.b :
DCI01_0086_C03.b :
DCI01_0093_H05.b :
DCI01_0111_G06.b :
DCI01_0113_F08.b :
DCI01_0112_E10.b :
DCI01_0094_B06.b :
DCI01_0095_E10.b :
DCI01_0113_H09.b :
DCI01_0115_C02.b :
DCI01_0097_H05.b :
AMP01_0023_E05.b :
DCI01_0090_E12.b :
DCI01_0110_B09.b :
DCI01_0080_E08.b :
DCI01_0100_A11.b :
DCI01_0085_D11.b :
DCI01_0084_F08.b :
DCI01_0015_F05.b :
DCI01_0112_D01.b :
DCI01_0045_C01.b :
DCI01_0100_G04.b :
DCI01_0073_E02.b :
AMP01_0101_C04.b :
DCI01_0061_E05.b :
DCI01_0011_A07.b :
DCI01_0069_H09.b :
DCI01_0077_D05.b :
DCI01_0004_H02.b :
DCI01_0093_A02.b :
DCI01_0100_F02.b :
DCI01_0014_H10.b :
DCI01_0002_G01.b :
DCI01_0086_D12.b :
DCI01_0031_F11.b :
DCI01_0061_D08.b :
DCI01_0099_E09.b :
DCI01_0099_C11.b :
DCI01_0064_C10.b :
DCI01_0062_D11.b :
DCI01_0015_G01.b :
DCI01_0074_C10.b :
DCI01_0066_B12.b :
DCI01_0087_E11.b :
DCI01_0064_F08.b :
AMP01_0057_C12.b :
DCI01_0111_C04.b :
DCI01_0080_A06.b :
DCI01_0067_E11.b :
DCI01_0021_D04.b :
AMP01_0057_B04.b :
DCI01_0013_D06.b :
AMP01_0013_C05.b :
DCI01_0101_C06.b :
DCI01_0097_C09.b :
DCI01_0078_F01.b :
DCI01_0071_A06.b :
AMP01_0092_H11.b :
KDN01_0056_D08.b :
DCI01_0071_D09.b :
DCI01_0068_B09.b :
DCI01_0065_C09.b :
DCI01_0012_C07.b :
AMP01_0002_H04.b :
DCI01_0082_C08.b :
DCI01_0109_A09.b :
DCI01_0086_D02.b :
DCI01_0078_C10.b :
DCI01_0001_E04.b :
AMP01_0092_A11.b :
DCI01_0042_C02.b :
20110601C-007008 : ..........................................ACAACACTGAAATGGTGT
---------+---------+---------+---------+---------+---------+ 18
DCI01_0043_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACACTGAAATGGTGT
DCI01_0114_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAATGGTGT
DCI01_0065_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_C02.b : nnnggatactaaxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_F12.b : naataacatactaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_B07.b : nnaaacgatacaagggctxxxxxxxxxxxxxxxxx
AMP01_0008_D03.b : tatataccgatactaaxxxxxxxxxxxxxxxxxxxxx
DCI01_0103_G02.b : nnnaatcgatatcaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_E11.b : nnaaaacgaatcctaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_F10.b : aaaatttgatactaaxxxxxxxxxxxxxxxxxxxx
DCI01_0099_E02.b : nttttaacatactaaxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0062_H02.b : nttttacgatacaagggctxxxxxxxxxxxxxxxxx
DCI01_0068_D09.b : ncaaacnnnnnnnacgatactaaxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_D08.b : ngggatcaannnnnccgatactaaxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F11.b : ncccatcaannaaaggatactaaxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_G05.b : nnngaaaaaannnnatcgaaacctaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_F05.b : nnaaaaggatactaaxxxxxxxxxxxxxxxxxxxx
DCI01_0007_G07.b : cccctttagcgatcttxxxxxxxxxxxxxxxx
DCI01_0025_G05.b : nnaagtaatcaaxxxxxxxxxxxxxx
DCI01_0093_C09.b : nnnttttatannnnngggtaccataxxxxxxxxxxxxxx
AMP01_0009_F01.b : nnaaacgtaxxxxxxxxxxxxxxxx
AMP01_0019_E11.b : nntttacaaattaxxxxxxxxxxxxx
AMP01_0012_H09.b : nntttcgtatc
AMP01_0013_F02.b : tt
AMP01_0089_C06.b : aaaaa
AMP01_0018_C04.b : nnnttgaaannnnttaag
AMP01_0070_A10.b : ngagatatatatagg
AMP01_0056_B08.b : nnggcgatatatat
AMP01_0024_F07.b : nnngggtttntttttang
AMP01_0054_D03.b : nnnggcgaaaantatag
DCI01_0032_A03.b :
DCI01_0043_B07.b : ng
AMP01_0012_D01.b :
AMP01_0020_B12.b :
DCI01_0026_F02.b :
AMP01_0013_G11.b : n
DCI01_0031_H12.b :
DCI01_0040_G11.b :
DCI01_0040_H10.b :
DCI01_0057_C11.b : atgtat
DCI01_0058_B04.b : atgat
DCI01_0057_F03.b : gatgatx
DCI01_0058_G04.b : gattgat
DCI01_0025_F09.b :
DCI01_0057_B05.b : atgat
DCI01_0023_A12.b :
DCI01_0037_C01.b :
DCI01_0026_A07.b :
DCI01_0017_F01.b :
DCI01_0032_F03.b :
DCI01_0102_H05.b : aa
DCI01_0037_F06.b :
DCI01_0032_E10.b :
DCI01_0028_H06.b :
DCI01_0026_E06.b :
DCI01_0018_G12.b :
DCI01_0103_H03.b : n
DCI01_0041_E01.b :
AMP01_0007_B06.b :
AMP01_0017_G10.b :
DCI01_0033_H09.b :
DCI01_0010_B02.b : t
AMP01_0051_G04.b : nnggagataa
AMP01_0028_D11.b :
DCI01_0017_D07.b :
AMP01_0093_D05.b : tgga
AMP01_0028_G04.b :
DCI01_0036_C06.b :
DCI01_0013_A05.b :
DCI01_0036_C08.b :
DCI01_0034_E12.b :
AMP01_0026_F02.b :
DCI01_0023_C03.b :
DCI01_0014_D03.b :
DCI01_0016_A07.b :
AMP01_0016_C02.b : n
DCI01_0022_H03.b :
DCI01_0028_E07.b :
DCI01_0024_D08.b :
AMP01_0004_C04.b : a
DCI01_0041_D11.b :
AMP01_0019_H09.b : nn
AMP01_0025_F03.b :
AMP01_0018_H12.b : ntt
AMP01_0079_E05.b : atct
AMP01_0016_D03.b : nnnnnnnn
AMP01_0015_H11.b :
DCI01_0109_F05.b : nnccggaaaann
AMP01_0033_F05.b : nnnnnnnnn
DCI01_0090_B04.b :
AMP01_0017_A07.b :
DCI01_0082_C06.b : ngggtataaa
DCI01_0009_A07.b : aact
DCI01_0108_E12.b : nnccgtaa
DCI01_0115_F04.b : nnnnnnnnnnn
DCI01_0024_G06.b :
AMP01_0092_E04.b :
DCI01_0012_G10.b :
DCI01_0017_A10.b :
DCI01_0077_H05.b :
DCI01_0109_B11.b : nnngggtaaa
AMP01_0057_H07.b : a
DCI01_0029_E04.b :
DCI01_0077_F03.b : nn
DCI01_0015_H05.b :
DCI01_0096_E05.b :
DCI01_0092_E01.b :
DCI01_0008_B05.b :
DCI01_0098_D08.b :
DCI01_0085_H11.b : nnnnnnnn
DCI01_0010_A04.b : atc
DCI01_0063_G06.b :
DCI01_0019_D05.b :
DCI01_0016_F06.b :
DCI01_0070_G08.b :
DCI01_0065_B05.b : aaa
AMP01_0065_A06.b :
AMP01_0058_F09.b : t
DCI01_0066_D11.b : nn
AMP01_0064_D07.b : nngagat
AMP01_0099_D03.b : ggggt
DCI01_0104_F11.b : n
DCI01_0070_G11.b : nnttatat
DCI01_0087_F08.b : ncccttaaa
DCI01_0113_G08.b : nnnnnnnnn
DCI01_0089_B06.b : nnggttaaan
DCI01_0113_F07.b : nnngggtcat
AMP01_0089_A01.b :
DCI01_0109_G01.b : nnncctttann
DCI01_0116_H07.b : nnnnnnnnnnn
DCI01_0082_D12.b : nngggaaa
DCI01_0066_A07.b :
DCI01_0042_F07.b :
DCI01_0007_E11.b : accc
DCI01_0007_F05.b : cc
DCI01_0070_G09.b : n
DCI01_0066_E08.b : n
DCI01_0069_A07.b :
DCI01_0110_D12.b : nnnnnnnnnn
AMP01_0025_A12.b : n
AMP01_0094_H06.b : gcgg
DCI01_0061_B02.b : nnggggttn
AMP01_0053_A07.b : nnnnccgataa
OVRM1_0131_B05.b :
DCI01_0040_A02.b :
DCI01_0104_H06.b :
DCI01_0059_F03.b : gatgat
DCI01_0016_D11.b :
DCI01_0118_A07.b :
DCI01_0085_H02.b : n
DCI01_0108_H04.b : nnnnnnnn
AMP01_0083_C10.b :
DCI01_0070_C11.b :
DCI01_0081_H07.b : nnggg
DCI01_0087_F09.b : nggcttt
DCI01_0034_C07.b :
DCI01_0088_F09.b : nggcgta
DCI01_0084_A01.b :
DCI01_0036_F02.b :
DCI01_0071_H07.b :
DCI01_0118_B09.b :
DCI01_0068_E08.b : n
DCI01_0112_E09.b : nnnccctat
DCI01_0091_F07.b :
DCI01_0070_G02.b :
DCI01_0107_D05.b : nnnngg
DCI01_0013_G03.b :
DCI01_0028_A02.b :
DCI01_0028_F02.b :
DCI01_0028_H07.b :
DCI01_0058_H12.b :
DCI01_0026_A10.b :
DCI01_0038_G06.b :
DCI01_0070_E07.b : nn
DCI01_0028_G12.b :
DCI01_0057_B10.b :
DCI01_0058_C03.b :
DCI01_0028_H03.b :
DCI01_0058_C06.b :
DCI01_0035_F09.b :
DCI01_0058_B05.b :
DCI01_0059_D12.b :
DCI01_0032_E02.b :
DCI01_0081_H12.b : n
DCI01_0058_B09.b :
DCI01_0039_A03.b : n
DCI01_0033_C02.b :
DCI01_0027_A12.b :
DCI01_0035_H02.b :
DCI01_0032_F12.b :
DCI01_0036_E02.b :
DCI01_0012_B11.b :
DCI01_0032_B07.b :
DCI01_0029_H03.b :
DCI01_0033_A09.b :
DCI01_0034_G12.b :
DCI01_0032_D07.b :
DCI01_0106_C12.b :
DCI01_0023_B10.b :
DCI01_0031_G04.b :
DCI01_0027_B10.b :
DCI01_0025_B04.b :
DCI01_0030_H07.b :
DCI01_0027_G01.b :
DCI01_0026_D04.b :
DCI01_0036_C09.b :
DCI01_0017_E05.b :
DCI01_0019_E05.b :
DCI01_0031_D03.b :
DCI01_0025_B05.b :
DCI01_0035_A08.b :
DCI01_0011_H09.b :
DCI01_0026_C08.b :
DCI01_0017_C01.b :
DCI01_0031_A06.b :
DCI01_0018_D09.b :
DCI01_0025_A04.b :
DCI01_0031_H06.b :
DCI01_0036_A06.b :
DCI01_0011_G10.b :
DCI01_0020_C10.b :
DCI01_0037_G07.b :
DCI01_0017_H02.b :
DCI01_0038_C05.b :
DCI01_0029_C05.b :
DCI01_0029_E05.b :
DCI01_0066_H06.b :
DCI01_0033_C10.b :
DCI01_0013_E03.b :
DCI01_0031_C04.b :
DCI01_0037_B03.b :
DCI01_0016_G09.b :
DCI01_0008_A03.b :
DCI01_0019_C04.b :
DCI01_0106_F10.b :
DCI01_0022_C01.b :
DCI01_0009_E08.b :
DCI01_0013_E06.b :
DCI01_0090_C01.b :
DCI01_0107_B03.b : nnnn
DCI01_0107_E06.b : nnnaa
DCI01_0031_G12.b :
AMP01_0047_F08.b : gg
DCI01_0069_A01.b :
DCI01_0012_G03.b :
DCI01_0011_E05.b :
DCI01_0035_C06.b :
AMP01_0027_H12.b :
DCI01_0117_D08.b :
DCI01_0013_C11.b :
DCI01_0117_B04.b :
DCI01_0003_D06.b :
DCI01_0082_G03.b : n
DCI01_0111_C08.b : nnc
DCI01_0115_D03.b : nnn
DCI01_0103_G10.b :
DCI01_0020_D12.b :
DCI01_0016_G07.b :
DCI01_0064_C01.b :
DCI01_0005_E05.b :
DCI01_0101_H03.b :
DCI01_0102_A05.b :
DCI01_0021_G05.b :
DCI01_0019_H05.b :
DCI01_0097_H11.b :
DCI01_0113_A06.b : nnnngc
DCI01_0114_D10.b : nnnn
DCI01_0016_D04.b :
DCI01_0117_E05.b : n
DCI01_0010_D04.b :
DCI01_0014_E10.b :
DCI01_0008_E08.b :
DCI01_0014_A11.b :
DCI01_0114_D07.b : nn
DCI01_0109_G06.b : nnnn
DCI01_0103_E12.b :
DCI01_0075_D06.b :
DCI01_0086_E02.b :
DCI01_0018_G07.b :
DCI01_0069_D05.b :
DCI01_0091_G06.b :
DCI01_0115_H03.b : nnnn
DCI01_0076_F08.b :
DCI01_0015_H03.b :
DCI01_0020_B12.b :
DCI01_0091_G05.b :
DCI01_0099_E12.b :
DCI01_0106_G09.b :
DCI01_0011_E09.b :
DCI01_0097_F02.b :
DCI01_0086_F05.b : n
DCI01_0106_E05.b :
DCI01_0095_G02.b :
DCI01_0098_H06.b :
DCI01_0117_E04.b :
DCI01_0012_G07.b :
DCI01_0016_E03.b :
DCI01_0075_H06.b :
DCI01_0063_G05.b :
DCI01_0063_A11.b :
DCI01_0096_F10.b :
DCI01_0014_F11.b :
DCI01_0015_H11.b :
DCI01_0012_E09.b :
DCI01_0065_G03.b :
DCI01_0077_F09.b :
DCI01_0092_B02.b :
DCI01_0087_G06.b :
DCI01_0097_F05.b :
DCI01_0109_D01.b :
DCI01_0084_C04.b :
DCI01_0094_C03.b :
DCI01_0097_B08.b :
DCI01_0067_G08.b :
DCI01_0102_G12.b :
DCI01_0096_C10.b :
DCI01_0099_F05.b :
DCI01_0104_A06.b :
DCI01_0063_B04.b :
DCI01_0099_A11.b :
DCI01_0068_G10.b : n
DCI01_0061_C10.b : nn
DCI01_0079_E10.b : nn
DCI01_0063_G01.b :
DCI01_0092_D05.b : nnc
DCI01_0094_D03.b :
DCI01_0010_C08.b :
DCI01_0079_H01.b :
DCI01_0116_C10.b : nnnn
DCI01_0112_G10.b : nn
DCI01_0070_G07.b : n
DCI01_0090_F04.b : n
DCI01_0102_B11.b : n
DCI01_0093_B04.b : nnc
DCI01_0086_C03.b : nn
DCI01_0093_H05.b : nn
DCI01_0111_G06.b : nn
DCI01_0113_F08.b : nnnn
DCI01_0112_E10.b : nnn
DCI01_0094_B06.b : nn
DCI01_0095_E10.b :
DCI01_0113_H09.b : nnnng
DCI01_0115_C02.b : nnngg
DCI01_0097_H05.b :
AMP01_0023_E05.b : n
DCI01_0090_E12.b :
DCI01_0110_B09.b : nncc
DCI01_0080_E08.b : nng
DCI01_0100_A11.b : nn
DCI01_0085_D11.b :
DCI01_0084_F08.b :
DCI01_0015_F05.b :
DCI01_0112_D01.b : nnn
DCI01_0045_C01.b :
DCI01_0100_G04.b :
DCI01_0073_E02.b :
AMP01_0101_C04.b :
DCI01_0061_E05.b :
DCI01_0011_A07.b :
DCI01_0069_H09.b :
DCI01_0077_D05.b :
DCI01_0004_H02.b :
DCI01_0093_A02.b :
DCI01_0100_F02.b :
DCI01_0014_H10.b :
DCI01_0002_G01.b :
DCI01_0086_D12.b : ng
DCI01_0031_F11.b :
DCI01_0061_D08.b :
DCI01_0099_E09.b :
DCI01_0099_C11.b :
DCI01_0064_C10.b : n
DCI01_0062_D11.b :
DCI01_0015_G01.b :
DCI01_0074_C10.b :
DCI01_0066_B12.b :
DCI01_0087_E11.b :
DCI01_0064_F08.b : nn
AMP01_0057_C12.b :
DCI01_0111_C04.b : n
DCI01_0080_A06.b : nnc
DCI01_0067_E11.b : n
DCI01_0021_D04.b :
AMP01_0057_B04.b :
DCI01_0013_D06.b :
AMP01_0013_C05.b :
DCI01_0101_C06.b :
DCI01_0097_C09.b :
DCI01_0078_F01.b : nn
DCI01_0071_A06.b :
AMP01_0092_H11.b :
KDN01_0056_D08.b :
DCI01_0071_D09.b :
DCI01_0068_B09.b :
DCI01_0065_C09.b :
DCI01_0012_C07.b :
AMP01_0002_H04.b :
DCI01_0082_C08.b :
DCI01_0109_A09.b :
DCI01_0086_D02.b :
DCI01_0078_C10.b :
DCI01_0001_E04.b :
AMP01_0092_A11.b :
DCI01_0042_C02.b :
20110601C-007008 : GCATTTGAAAAGTGAATAGATGCTAAGAGCGAATGAGTCAGAAGCACATGAGTTCTAAGT
---------+---------+---------+---------+---------+---------+ 78
DCI01_0043_E03.b : GCATTTGAAAAGTGAATAGATGCTAAGAGCGAATGAGTCAGAAGCACATGAGTTCTAAGT
DCI01_0114_F01.b : GCATTTGAAAAGTGAATAGATGCTAAGAGCGAATGAGTCAGAAGCACATGAGTTCTAAGT
DCI01_0065_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGAAGCACATGAGTTCTAAGT
DCI01_0034_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0008_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0103_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0062_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0019_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_H09.b : ctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_F02.b : atgatccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0089_C06.b : cgtattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0018_C04.b : aaattnttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_A10.b : gatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_B08.b : agggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0024_F07.b : gacaaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_D03.b : agatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_A03.b : nnnnccgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_B07.b : gtacattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_D01.b : nntatctaatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0020_B12.b : nnaaaatgaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_F02.b : ttaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_G11.b : tttatgatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_H12.b : aacatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0040_G11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0040_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxx
DCI01_0057_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_F09.b : nnaaactacattaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_A12.b : naaaacgtaacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_C01.b : nnnttcgtacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_A07.b : nnttacgtaactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_F01.b : nnttcgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_F03.b : nnaacgtactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_H05.b : aanaacgtaccnttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_F06.b : nnttgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_E10.b : naaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H06.b : nnnaatgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_E06.b : naatacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0018_G12.b : aaaagtaatcataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0103_H03.b : nnnaacgtatccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_E01.b : nttacgatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0007_B06.b : nttttccgaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_G10.b : nntttactaaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_H09.b : nnnaaacgtacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_B02.b : tttggcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0051_G04.b : anttagggaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_D11.b : ntttacgaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_D07.b : nnnaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D05.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_G04.b : nnnaatggactcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_C06.b : agtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_A05.b : nnnccgatacttagggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_C08.b : nggtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_E12.b : nnaaactatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_F02.b : nnaaacgtatcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_C03.b : nnnaactatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_D03.b : nnaactatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_A07.b : nnnttacgaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_C02.b : nnttactaaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_H03.b : nnttaggtactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_E07.b : nnnaatgatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0024_D08.b : nnnaactatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_C04.b : ttttccgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_D11.b : nnnccgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0019_H09.b : tttagtaatcnatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_F03.b : nnttaaggaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0018_H12.b : aaacgtatccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_E05.b : ataggggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_H11.b : nnttttggaattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_F05.b : nnnccgaaaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_F05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_B04.b : attaaaccatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_A07.b : nntttacgaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_C06.b : anaaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0009_A07.b : tatggggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_E12.b : tannaaatgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0024_G06.b : nnnaattatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_E04.b : aaaaacgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_G10.b : nnttactatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_A10.b : ntttactatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H05.b : nntttaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_B11.b : atatacgaacccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_H07.b : tcctagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_E04.b : nnnnctatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F03.b : nnaacgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H05.b : nnnttactatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0096_E05.b : nnnnncgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0092_E01.b : nnntttacgtacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_B05.b : ccctatggcgatcttggggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_D08.b : nnnnccgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_A04.b : tatggggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_G06.b : nnnnttcgatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_D05.b : nnnnccgatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_F06.b : nnnaaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G08.b : nnaaaatgatacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_B05.b : aaaccgaatctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_A06.b : atatagcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0058_F09.b : atcatagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_D11.b : naaacgtatccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0064_D07.b : antataagcgatatcttgggctgctcccgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_F11.b : nnaaaacgaaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G11.b : aataaaacgatatcttngggctgctcgcgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_F08.b : annnancgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0089_B06.b : nnnnatgatatcatngggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_F07.b : naaaaccgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0089_A01.b : natacgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_G01.b : naatacgaacccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_D12.b : nnnnaaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_A07.b : nnaaaacgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_F07.b : nnnnccgaccatgggggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_E11.b : ctttagcgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_F05.b : cttatgacgatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G09.b : nnaaaggatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_E08.b : nnnntcgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_A07.b : ntataaaggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_A12.b : nttactgaatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_H06.b : taactcnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_B02.b : nnnntttagatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_A07.b : anntaagggacccttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0131_B05.b :
DCI01_0040_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
DCI01_0104_H06.b : nnnaaacgatatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_D11.b : nnnaatcgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_A07.b : aattaaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_H02.b : nnnttacgtaacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_C10.b : naaatcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_C11.b : nnnaaaggatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_H07.b : aaannnnaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_F09.b : annnnatagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_C07.b : nnnnnggatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F09.b : tannnnnaagtacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_A01.b : nnnnaacgtaacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_F02.b : ngtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_H07.b : nnnnnnccgtacatgggggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_B09.b : aanataggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_E08.b : nnnnaacgaatccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_E09.b : ttatnnnnggatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_F07.b : nnaaatcgatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G02.b : nnnnttagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_D05.b : ttataannaaccgatatcttagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_G03.b : nnaactatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_A02.b : nnaaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_F02.b : nnaaatgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H07.b : nnnnnacatacttangggctgctcccgcgccgxxxxxxxxxxxxxxxxxxx
DCI01_0058_H12.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_A10.b : ntttctaatcataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_G06.b : ngtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_E07.b : gggtaannnnaaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_G12.b : ntttatcatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_B10.b : atgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_C03.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H03.b : nnttacgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_C06.b : atgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_F09.b : nnntttatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_B05.b : atgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_D12.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_E02.b : nttacatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_H12.b : gggggnnnaaaaacgatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_B09.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0039_A03.b : ggaaccccnnnaaagtatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_C02.b : nnnaacgtacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_A12.b : nttaacgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_H02.b : nnnatatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_F12.b : ntaactaatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_E02.b : ttacaataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_B11.b : acgtacttatgggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_B07.b : nnnaaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_H03.b : naagtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_A09.b : nnnttacgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_G12.b : naaatcatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_D07.b : nnttacgtacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_C12.b : nnnaatcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_B10.b : nnnncctatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_G04.b : nnaagtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_B10.b : nnnaacgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_B04.b : nnaacgatacttagggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxx
DCI01_0030_H07.b : nnngggatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_G01.b : nnttaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_D04.b : nnaacgtacataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_C09.b : ngggatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_E05.b : nnnaagtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_E05.b : nnnnaactatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_D03.b : nnnaactatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_B05.b : nnaactaacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_A08.b : nnngggacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_H09.b : nnnaacgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_C08.b : nnnaacgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_C01.b : nnaagtaacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_A06.b : nnaatgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0018_D09.b : nnnnaagatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_A04.b : naactaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_H06.b : nnnaactatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_A06.b : nagtataataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_G10.b : nnnttactatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_C10.b : nnttagtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_G07.b : nnnaacgtatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_H02.b : nnttagtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_C05.b : nttatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_C05.b : nnnnctatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_E05.b : nnncctatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_H06.b : nnaattacgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_C10.b : nnnttacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_E03.b : nnccatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_C04.b : nctatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_B03.b : nnnnnggatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_G09.b : nnntttcgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_A03.b : nttttggctatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_C04.b : nnnaacgaatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_F10.b : nnnaaacgtaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_C01.b : nacctaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0009_E08.b : aactcttatgcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_E06.b : naaacgtacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_C01.b : nnnnnaacatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_B03.b : ttataaannnnaaagtatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_E06.b : ggtatannaaaggatatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_G12.b : nnaaaagatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0047_F08.b : gtacccttatgagatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_A01.b : nttctatnggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_G03.b : tatttaagtaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_E05.b : nnngggtactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_C06.b : nnnaaggataataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0027_H12.b : ntttttggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_D08.b : aaaaaaacgtacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_C11.b : nnaaagatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_B04.b : aaaanatcgtacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0003_D06.b : tactctatggcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_G03.b : tattaaannnnatcgatactatngggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_C08.b : ccgaaaaatannnggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0103_G10.b : nnnaaacgaaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_D12.b : nnaaaagatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_G07.b : nnnaaacgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_C01.b : aaaanaacatacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0005_E05.b : nnnggtatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_H03.b : nnnnnccgtatccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_A05.b : aaaaaacgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_G05.b : nnaaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_H05.b : nnnaaacgtactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_H11.b : nnaaacgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_A06.b : tacaaaaanatcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0016_D04.b : nnnnaagatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_E05.b : ngggtataaaaaaaggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_D04.b : ntctaagagtatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_E10.b : nnttactaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_E08.b : cacctttaggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_A11.b : nnnaactaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D07.b : nngtctaaaananatgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0103_E12.b : nnntttacgtatccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_D06.b : nnaaacgtatcctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_E02.b : nnnnaaaccatacatgggggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxx
DCI01_0018_G07.b : nnnaaagatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_D05.b : aaaaaaccgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_G06.b : nnnnnnggatacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_H03.b : cccgtannnaaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_F08.b : nnnnccgtaatcttagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H03.b : nnttactatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_B12.b : nnttaagatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_G05.b : nnnaaaaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_E12.b : nnnttatgataactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_G09.b : nnaaaaacgatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_E09.b : nnnnccgtacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_F02.b : nnnccgtaactaangggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_F05.b : naagtttannnaaatgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_E05.b : aaaaaacgatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_G02.b : nnnnccgatacttangggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_H06.b : nnnaacgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_E04.b : aaaaacccgtacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_G07.b : nnnttacgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_E03.b : nnnnnccgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_H06.b : nnnnccgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_G05.b : nnnnaatcgtacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_A11.b : nnnnnaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0096_F10.b : nnnaaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_F11.b : nnnccggtactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H11.b : nnaatacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_E09.b : nnnnnccgtacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_G03.b : nnnnaacgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F09.b : nnnnaacgaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0092_B02.b : nnnnnaagatacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_G06.b : aaaaaccgatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_F05.b : nnnnccgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_D01.b : nnnntttagtaatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_C04.b : nnnaaacgtaacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C03.b : nnnnaatgatacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_B08.b : nnnaaagataccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_G08.b : nnnnnccgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_G12.b : nttaatcgtaacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0096_C10.b : nnnttacgatacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_F05.b : nnnnttactaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_A06.b : nnnaatcgaatccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_B04.b : aaaaaacctaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_A11.b : nnnaaagatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_G10.b : cctattannnnaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0079_E10.b : ccgaaanntttatcgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_G01.b : nnttttagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0092_D05.b : tcgaaannnnnnnggatatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0010_C08.b : aactcatggggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0079_H01.b : ntttatacgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0112_G10.b : nccgatttactnaaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G07.b : ngggttaannnaaacgatacttgggggctgctcccgcaccgxxxxxxxxxxxxxxxxxxx
DCI01_0090_F04.b : ccttattnnnnnnggatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_B11.b : gggtatatatatccataccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_B04.b : cgaaannnnnanaagatacttangggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_C03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
DCI01_0093_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0111_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0113_F08.b : ggttaaannnaatcgatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_E10.b : gggttttatnnnnagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_B06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
DCI01_0095_E10.b : nnaaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_H09.b : gtcaaaananaacgtaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_C02.b : ctatannnnnncgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_H05.b : nnnaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_E05.b : nggtgttttttataggacatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_E12.b : nnnntttaggtaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_B09.b : tttaannnnnccgaaccnttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_E08.b : gcgtaannnnnaacgatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_A11.b : nttattaatataanccgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_D11.b : nnnaaacgaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_F08.b : nnnnnccgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_F05.b : nnnnacgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_D01.b : ggggttttaannaatgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0045_C01.b : nnnaacgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_G04.b : nnnttaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_E02.b : nntttcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_C04.b : gggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_E05.b : nnnntttgtaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_A07.b : nnaaactatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_H09.b : naaaaacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_D05.b : nnnnnccgtaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0004_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0093_A02.b : nnnnaatgatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_F02.b : nnnnaacgtacatggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_H10.b : nnaaaggtatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0002_G01.b : gaatcttttagggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_D12.b : ggagttaannaaaagatatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_F11.b : nnaaacgtacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_D08.b : ncccgtaatnnnnnggatacatangggctgctcccgcaccgxxxxxxxxxxxxxxxxxxx
DCI01_0099_E09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0099_C11.b : nnnnnnggtaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0062_D11.b : nnnnaatgatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_G01.b : ntttaacgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_C10.b : nnnttacatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_B12.b : nnnaaaacgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E11.b : nnnttttccgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_F08.b : ggggataannnanccgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_C12.b : tatagccgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_C04.b : nccggattaaannccgatacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_A06.b : cgtaannnnnaatgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_E11.b : ccaaaaannnnnacgaatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_D04.b : tttaactatctaggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_B04.b : aattctagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_D06.b : nnncctatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_C05.b : nnntttcgatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_C06.b : aaaaaccgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_C09.b : nnnnncgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
DCI01_0071_A06.b : nnnaattctaccttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_H11.b : aaaatcgtatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0056_D08.b :
DCI01_0071_D09.b : nnnnnnagatatctaagggctxxxxxxxxxxxxxxxxxxxx
DCI01_0068_B09.b : nnnnaacgaatcctaaxxxxxxxxxxxxxxxxxxx
DCI01_0065_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0012_C07.b :
AMP01_0002_H04.b :
DCI01_0082_C08.b :
DCI01_0109_A09.b :
DCI01_0086_D02.b :
DCI01_0078_C10.b :
DCI01_0001_E04.b :
AMP01_0092_A11.b :
DCI01_0042_C02.b :
20110601C-007008 : GGTTGAACTCCAGAGAGCAGATCAAGCAATGCTGTTTAATACCATCACATGATCTGCCCC
---------+---------+---------+---------+---------+---------+ 138
DCI01_0043_E03.b : GGTTGAACTCCAGAGAGCAGATCAAGCAATGCTGTTTAATACCATCACATGATCTGCCCC
DCI01_0114_F01.b : GGTTGAACTCCAGAGAGCAGATCAAGCAATGCTGTTTAATACCATCACATGATCTGCCCC
DCI01_0065_E04.b : GGTTGAACTCCAGAGAGCAGATCAAGCAATGCTGTTTAATACCATCACATGATCTGCCCC
DCI01_0034_B06.b : xxxxxxxxxxxxxxxxxxAGATCAAGCAATGCTGTTTAATACCATCACATGATCTGCCCC
DCI01_0012_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0008_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0103_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0062_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0019_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0089_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0018_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0024_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0020_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0040_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0040_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0018_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0103_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0007_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0051_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0024_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0019_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0018_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0009_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0024_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0096_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0092_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0058_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0064_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0089_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0089_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0131_B05.b : tcagtgtcxxxxxxxxxxxx
DCI01_0040_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0039_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0030_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0018_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0017_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0009_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0047_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0027_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0003_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0103_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0005_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0008_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0103_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0018_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0096_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0092_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0096_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0079_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0092_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0079_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0045_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0004_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0014_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0002_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0062_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0056_D08.b :
DCI01_0071_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_C09.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_C07.b : nnnnnccatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0002_H04.b : tatgtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_C08.b :
DCI01_0109_A09.b :
DCI01_0086_D02.b :
DCI01_0078_C10.b :
DCI01_0001_E04.b :
AMP01_0092_A11.b :
DCI01_0042_C02.b :
20110601C-007008 : GAGGCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
---------+---------+---------+---------+---------+---------+ 198
DCI01_0043_E03.b : GAGGCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0114_F01.b : GAGGCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0065_E04.b : GAGGCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0034_B06.b : GAGGCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGC
DCI01_0012_C02.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0021_F12.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0021_B07.b : xxxxCCCAGTATTTCATTAAAACAAGGAGCAGGGCACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0008_D03.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0103_G02.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0104_E11.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0117_F10.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0099_E02.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGTACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0062_H02.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0068_D09.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0081_D08.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0088_F11.b : xxxxCCCAGTATTTCATTAAAACAAGGTACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0110_G05.b : xxxxCCCAGTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0071_F05.b : xxxxxxCAGTATTTCATTAAAACAAGAAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0007_G07.b : xxxxxxxxxTATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0025_G05.b : xxxxxxxxxxATTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0093_C09.b : xxxxxxxxxxxaTTCATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0009_F01.b : xxxxxxxxxxxxxxxATTAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0019_E11.b : xxxxxxxxxxxxxxxaaaAAAACAAGGAACAGGGCACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0012_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0013_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0089_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0018_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0070_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0056_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0024_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGCAGAAGCCAGGAGAGCACTGT
AMP01_0054_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGCAGAAGCCAGGAGAGCACTGT
DCI01_0032_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCAGAAGCCAGGAGAGCACTGT
DCI01_0043_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagaAGCAGAAGCCAGGAGAGCACTGT
AMP01_0012_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0020_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0026_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0013_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0031_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0040_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0040_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCCGGAGAGCACTGT
DCI01_0057_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0058_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0057_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0058_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0025_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0057_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0023_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0037_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0026_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0017_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAACACTGT
DCI01_0032_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0102_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGGCCAGGAGAGCACTGT
DCI01_0037_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0032_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0026_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0018_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0103_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0041_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0007_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0017_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0033_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0010_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0051_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0028_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0017_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0093_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0028_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0036_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0013_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0036_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0034_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0026_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0023_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0014_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0016_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0016_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0022_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0028_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0024_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0004_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0041_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0019_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0025_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0018_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0079_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAACCCAGCACAGCACTGT
AMP01_0016_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0015_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0109_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0033_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0090_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0017_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0082_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0009_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0108_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0115_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0024_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0092_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0012_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0017_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0077_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0109_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0057_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0029_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0077_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0015_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0096_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0092_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0008_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0085_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0010_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0063_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0016_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0070_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0065_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0065_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0058_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0066_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0064_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0099_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0104_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0070_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0087_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0113_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0089_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0113_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0089_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0109_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0116_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGGGAGCACTGT
DCI01_0082_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0066_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0042_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0007_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0007_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0070_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0066_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0069_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0110_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0025_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0094_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
DCI01_0061_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
AMP01_0053_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGCCAGGAGAGCACTGT
OVRM1_0131_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGCCAGGAGAGCACTGT
DCI01_0040_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCCGGAGAGCACTGT
DCI01_0104_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0059_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0016_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0118_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0085_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0108_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
AMP01_0083_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0070_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0081_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0087_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0034_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0088_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0084_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCAGGAGAGCACTGT
DCI01_0036_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCAGGAGAGCACTGT
DCI01_0071_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCAGGAGAGCACTGC
DCI01_0118_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCAGGAGAGCACTGT
DCI01_0068_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCAGGAGAGCACTGT
DCI01_0112_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCAGGAGAGCACTGT
DCI01_0091_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCAGGAGAGCACTGT
DCI01_0070_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCAGGAGAGCACTGT
DCI01_0107_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGGAGAGCACTGT
DCI01_0013_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggCAGGAGAGCACTGT
DCI01_0028_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0028_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0028_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0058_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0026_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0038_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0070_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0028_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAAAGCACTGT
DCI01_0057_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0058_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0028_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0058_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0035_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0058_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0059_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0032_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0081_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0058_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0039_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0033_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0027_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0035_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0032_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0036_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0012_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0032_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0029_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0033_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0034_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0032_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0106_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0023_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0031_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0027_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0025_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0030_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACCGT
DCI01_0027_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0026_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0036_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0017_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0019_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0031_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0035_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0011_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0026_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0017_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0031_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0018_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0025_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0031_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0036_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0011_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0020_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0037_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0017_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0038_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0029_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0029_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0066_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0033_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0013_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0031_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0037_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0016_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0008_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0019_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0106_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0022_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0009_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0013_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0090_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0107_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0107_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0031_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
AMP01_0047_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0069_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0012_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0011_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0035_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
AMP01_0027_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0117_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0013_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0117_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0003_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0082_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0111_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0115_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0103_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0020_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0016_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0064_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0005_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0101_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0102_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0021_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0019_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0097_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0113_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0114_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0016_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0117_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0010_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0014_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0008_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0014_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0114_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0109_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0103_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0075_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0086_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0018_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0069_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0091_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0115_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0076_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0015_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0020_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0091_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0099_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0106_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0011_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0097_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0086_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0106_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0095_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0098_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0117_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0012_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0016_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0075_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0063_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0063_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0096_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0014_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0015_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0012_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0065_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0077_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0092_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0087_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0097_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0109_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0084_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0094_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0097_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0067_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0102_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0096_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0099_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0104_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0063_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0099_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0068_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0061_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0079_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0063_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0092_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0094_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0010_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0079_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0116_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0112_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0070_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0090_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0102_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0093_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0086_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0093_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0111_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0113_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0112_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0094_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0095_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0113_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0115_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0097_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
AMP01_0023_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0090_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0110_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0080_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0100_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0085_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0084_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0015_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0112_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0045_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0100_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0073_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
AMP01_0101_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0061_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0011_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0069_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0077_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0004_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0093_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0100_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0014_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0002_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0086_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0031_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0061_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0099_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0099_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0064_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0062_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0015_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0074_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0066_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0087_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0064_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
AMP01_0057_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0111_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0080_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGTACTGT
DCI01_0067_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
DCI01_0021_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAGAGCACTGT
AMP01_0057_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGAGAGCACTGT
DCI01_0013_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCACTGT
AMP01_0013_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCACTGT
DCI01_0101_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCACTGT
DCI01_0097_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCACTGT
DCI01_0078_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCACTGT
DCI01_0071_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCACTGT
AMP01_0092_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTGT
KDN01_0056_D08.b : ntctgctgtggctctggagagccggagagACTGT
DCI01_0071_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
DCI01_0068_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0002_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_C08.b :
DCI01_0109_A09.b :
DCI01_0086_D02.b :
DCI01_0078_C10.b :
DCI01_0001_E04.b :
AMP01_0092_A11.b :
DCI01_0042_C02.b :
20110601C-007008 : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
---------+---------+---------+---------+---------+---------+ 258
DCI01_0043_E03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0114_F01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0065_E04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0034_B06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0012_C02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0021_F12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0021_B07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0008_D03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0103_G02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0104_E11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0117_F10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0099_E02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0062_H02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0068_D09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0081_D08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0088_F11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0110_G05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0071_F05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0007_G07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0025_G05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0093_C09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0009_F01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0019_E11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0012_H09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0013_F02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0089_C06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0018_C04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0070_A10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0056_B08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0024_F07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0054_D03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0032_A03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0043_B07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0012_D01.b : TCTTAGTGGATGGAGCCAGAAGAGCTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0020_B12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0026_F02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0013_G11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0031_H12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0040_G11.b : TCTTAGTGGATGGAGCCCGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0040_H10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0057_C11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0058_B04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0057_F03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0058_G04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0025_F09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0057_B05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0023_A12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0037_C01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0026_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0017_F01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0032_F03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0102_H05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0037_F06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0032_E10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0028_H06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0026_E06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0018_G12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0103_H03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0041_E01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0007_B06.b : TCTTAGTGGATGGAGCCAGAAGAGTTATAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0017_G10.b : TCTTAGTGGATGGAGCCAGGAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGCGAAG
DCI01_0033_H09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0010_B02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0051_G04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0028_D11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0017_D07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0093_D05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0028_G04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0036_C06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0013_A05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0036_C08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0034_E12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0026_F02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0023_C03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0014_D03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0016_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0016_C02.b : TCTTAGTGGATGGAGCCAGAAGAGCTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0022_H03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0028_E07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0024_D08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0004_C04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0041_D11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0019_H09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0025_F03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0018_H12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0079_E05.b : TCTTAGTGGATGGAGCCAGAGGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0016_D03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0015_H11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0109_F05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0033_F05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0090_B04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0017_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0082_C06.b : TCTCAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0009_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0108_E12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0115_F04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0024_G06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0092_E04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0012_G10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0017_A10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0077_H05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0109_B11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0057_H07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0029_E04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0077_F03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0015_H05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0096_E05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0092_E01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0008_B05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0098_D08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0085_H11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0010_A04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0063_G06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0019_D05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0016_F06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0070_G08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0065_B05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0065_A06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0058_F09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0066_D11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0064_D07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0099_D03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0104_F11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0070_G11.b : TCTTAGTAGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0087_F08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0113_G08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0089_B06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0113_F07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0089_A01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0109_G01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0116_H07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0082_D12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAGGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0066_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0042_F07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0007_E11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0007_F05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCTGGGTCTGTGAAG
DCI01_0070_G09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0066_E08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0069_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0110_D12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0025_A12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0094_H06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0061_B02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0053_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
OVRM1_0131_B05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0040_A02.b : TCTTAGTGGATGGAGCCCGAAGAGTTACAAGTTAAACCTTGATTTCTCGGGTCTGTGAAG
DCI01_0104_H06.b : TCTTAATGGATGGAACCCTAACAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0059_F03.b : TCTTAGTGGATGGAGTCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0016_D11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0118_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0085_H02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0108_H04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0083_C10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0070_C11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCT*TGAAG
DCI01_0081_H07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0087_F09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0034_C07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0088_F09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0084_A01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTCGATTTCCCGGGTCTGTGAAG
DCI01_0036_F02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0071_H07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0118_B09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0068_E08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTAATTTCCCGGGTCTGTGAAG
DCI01_0112_E09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0091_F07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0070_G02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0107_D05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0013_G03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0028_A02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0028_F02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0028_H07.b : TCTTAGTGGATGGAGCCAGAAGACTGACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAC
DCI01_0058_H12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0026_A10.b : TCTTAGTGGATGGAGCCAGAAGAGTCACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0038_G06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0070_E07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0028_G12.b : TCTTAGTGGATGGAGCCAAAACAGTTACAAGTTAAACCTTGATTTCGCGGGTCTGTGAAG
DCI01_0057_B10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0058_C03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0028_H03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0058_C06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0035_F09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0058_B05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0059_D12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0032_E02.b : TCTTAGTGGATGGAGCCAGGAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0081_H12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0058_B09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0039_A03.b : TCCTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0033_C02.b : TCTTAGTGGATGGAGCCAGAGGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0027_A12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0035_H02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0032_F12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAGACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0036_E02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0012_B11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0032_B07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0029_H03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0033_A09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0034_G12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0032_D07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0106_C12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0023_B10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0031_G04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0027_B10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0025_B04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0030_H07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0027_G01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0026_D04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0036_C09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0017_E05.b : TCTTGGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0019_E05.b : TCTTAGTGGATGGAGCCAGAGGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0031_D03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0025_B05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0035_A08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0011_H09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0026_C08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0017_C01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0031_A06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0018_D09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0025_A04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0031_H06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0036_A06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0011_G10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0020_C10.b : TCTTAGTGGATGGAGCCAGAAGAGTTCCAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0037_G07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0017_H02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0038_C05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0029_C05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0029_E05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0066_H06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0033_C10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0013_E03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0031_C04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0037_B03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0016_G09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0008_A03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0019_C04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0106_F10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0022_C01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0009_E08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0013_E06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0090_C01.b : TCTTATTGGATGGAGCCTCAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0107_B03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGGAG
DCI01_0107_E06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0031_G12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0047_F08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0069_A01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0012_G03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0011_E05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0035_C06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0027_H12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0117_D08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0013_C11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0117_B04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0003_D06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0082_G03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0111_C08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0115_D03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0103_G10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0020_D12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0016_G07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0064_C01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0005_E05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGATG
DCI01_0101_H03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0102_A05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0021_G05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0019_H05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0097_H11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0113_A06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0114_D10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0016_D04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0117_E05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0010_D04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0014_E10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0008_E08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0014_A11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0114_D07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0109_G06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0103_E12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0075_D06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0086_E02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0018_G07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0069_D05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0091_G06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0115_H03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0076_F08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0015_H03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0020_B12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0091_G05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0099_E12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0106_G09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0011_E09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0097_F02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0086_F05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0106_E05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0095_G02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0098_H06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0117_E04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0012_G07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0016_E03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0075_H06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0063_G05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0063_A11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0096_F10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0014_F11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0015_H11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0012_E09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0065_G03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0077_F09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0092_B02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0087_G06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0097_F05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0109_D01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0084_C04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0094_C03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0097_B08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0067_G08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0102_G12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0096_C10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0099_F05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0104_A06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0063_B04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0099_A11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0068_G10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0061_C10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0079_E10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0063_G01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0092_D05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0094_D03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCCGGTCTGTGAAG
DCI01_0010_C08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0079_H01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0116_C10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0112_G10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0070_G07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0090_F04.b : TCCTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0102_B11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0093_B04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0086_C03.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0093_H05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0111_G06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0113_F08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0112_E10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0094_B06.b : TCTTAGTGGATGGAGCCAGAGGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0095_E10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0113_H09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0115_C02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0097_H05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0023_E05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0090_E12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0110_B09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0080_E08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTAAAG
DCI01_0100_A11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0085_D11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0084_F08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0015_F05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0112_D01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0045_C01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0100_G04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0073_E02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0101_C04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0061_E05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0011_A07.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0069_H09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0077_D05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0004_H02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0093_A02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0100_F02.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0014_H10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0002_G01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0086_D12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0031_F11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0061_D08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0099_E09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0099_C11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0064_C10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0062_D11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0015_G01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0074_C10.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0066_B12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0087_E11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0064_F08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0057_C12.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0111_C04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0080_A06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0067_E11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0021_D04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0057_B04.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0013_D06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0013_C05.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0101_C06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCATGATTTCCCGGGTCTGTGAAG
DCI01_0097_C09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0078_F01.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0071_A06.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
AMP01_0092_H11.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
KDN01_0056_D08.b : TCTTAGTGGATGGAGCCAGAAGAGTTACA*GTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0071_D09.b : TCTTAGTGGATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0068_B09.b : xxxxxxxxxATGGAGCCAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0065_C09.b : xxxxxxxxxxxxxxxxxAGAAGAGTTACAAGTTAAACCTTGATTTCCCGGGTCTGTGAAG
DCI01_0012_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAAG
AMP01_0002_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAG
DCI01_0082_C08.b : nggttaaann
DCI01_0109_A09.b : nngggttaatt
DCI01_0086_D02.b :
DCI01_0078_C10.b :
DCI01_0001_E04.b :
AMP01_0092_A11.b :
DCI01_0042_C02.b :
20110601C-007008 : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
---------+---------+---------+---------+---------+---------+ 317
DCI01_0043_E03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0114_F01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0065_E04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0034_B06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0012_C02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0021_F12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0021_B07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0008_D03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0103_G02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0104_E11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0117_F10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0099_E02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0062_H02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0068_D09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0081_D08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0088_F11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0110_G05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0071_F05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0007_G07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0025_G05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0093_C09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0009_F01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0019_E11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0012_H09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0013_F02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0089_C06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0018_C04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0070_A10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0056_B08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0024_F07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0054_D03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0032_A03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0043_B07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0012_D01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0020_B12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0026_F02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0013_G11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0031_H12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0040_G11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0040_H10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0057_C11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0058_B04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0057_F03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0058_G04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0025_F09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0057_B05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0023_A12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0037_C01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0026_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0017_F01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0032_F03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0102_H05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0037_F06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0032_E10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0028_H06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0026_E06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0018_G12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0103_H03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0041_E01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0007_B06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0017_G10.b : ATTCAGCATGGAATATCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0033_H09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0010_B02.b : ATTCAGCATGGAACGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0051_G04.b : ATTCAGCATGGAATGTCTCCTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0028_D11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0017_D07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0093_D05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0028_G04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0036_C06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0013_A05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0036_C08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0034_E12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0026_F02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0023_C03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0014_D03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0016_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0016_C02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0022_H03.b : ATTCAGCATGGAATGTCT*CTACTGTCTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0028_E07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0024_D08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0004_C04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0041_D11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0019_H09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0025_F03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCCGCAATATTGC
AMP01_0018_H12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0079_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCGATATTGC
AMP01_0016_D03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0015_H11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0109_F05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0033_F05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0090_B04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0017_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0082_C06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0009_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0108_E12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0115_F04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0024_G06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0092_E04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0012_G10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0017_A10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0077_H05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0109_B11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0057_H07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0029_E04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0077_F03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0015_H05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGG*ATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0096_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0092_E01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0008_B05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0098_D08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0085_H11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGTTGCAATATTGC
DCI01_0010_A04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0063_G06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0019_D05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0016_F06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0070_G08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0065_B05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCCGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0065_A06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0058_F09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0066_D11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0064_D07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0099_D03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0104_F11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0070_G11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0087_F08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0113_G08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0089_B06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0113_F07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0089_A01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0109_G01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0116_H07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0082_D12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0066_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0042_F07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0007_E11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0007_F05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0070_G09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0066_E08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0069_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0110_D12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0025_A12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0094_H06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0061_B02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCT*GGATTTCTGCTTCTGGCTGCAATATCGC
AMP01_0053_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
OVRM1_0131_B05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0040_A02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0104_H06.b : ATTCACCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0059_F03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0016_D11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0118_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0085_H02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0108_H04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0083_C10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0070_C11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0081_H07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0087_F09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0034_C07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0088_F09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0084_A01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0036_F02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0071_H07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0118_B09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0068_E08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0112_E09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0091_F07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0070_G02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0107_D05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0013_G03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0028_A02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0028_F02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0028_H07.b : ATTCAGCATGCAATGTCT*CAACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0058_H12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0026_A10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0038_G06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0070_E07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0028_G12.b : ATTCATCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGGTGCAATATTGC
DCI01_0057_B10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0058_C03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0028_H03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0058_C06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0035_F09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0058_B05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0059_D12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0032_E02.b : ATTCAGCATGGAATGTCT*CTGCTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0081_H12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0058_B09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0039_A03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0033_C02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0027_A12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0035_H02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0032_F12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0036_E02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0012_B11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0032_B07.b : ATTCGGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0029_H03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0033_A09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0034_G12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0032_D07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0106_C12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0023_B10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0031_G04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0027_B10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0025_B04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0030_H07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0027_G01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0026_D04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0036_C09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0017_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGGTTTCTGCTTCTGGCTGCAATATTGC
DCI01_0019_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0031_D03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0025_B05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0035_A08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0011_H09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0026_C08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0017_C01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0031_A06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0018_D09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0025_A04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0031_H06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0036_A06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0011_G10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0020_C10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0037_G07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0017_H02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0038_C05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0029_C05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0029_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTTTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0066_H06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCCGCTTCTGGCTGCAATATTGC
DCI01_0033_C10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0013_E03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0031_C04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0037_B03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0016_G09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0008_A03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0019_C04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0106_F10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0022_C01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0009_E08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0013_E06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0090_C01.b : ATTCATCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCGATATTGC
DCI01_0107_B03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0107_E06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0031_G12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0047_F08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0069_A01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0012_G03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0011_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0035_C06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0027_H12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0117_D08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0013_C11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0117_B04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0003_D06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0082_G03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0111_C08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0115_D03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0103_G10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0020_D12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0016_G07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0064_C01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0005_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0101_H03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0102_A05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0021_G05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0019_H05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0097_H11.b : ATTTAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0113_A06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0114_D10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0016_D04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0117_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0010_D04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0014_E10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0008_E08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0014_A11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0114_D07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0109_G06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0103_E12.b : ATTCGGCATGGAATGTCT*CTACTGTTTTCTGGGACTTCTGCTTCTGGCTGCAATATTGC
DCI01_0075_D06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0086_E02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0018_G07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0069_D05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0091_G06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0115_H03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0076_F08.b : ATTCAGCATGGAATGCCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0015_H03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0020_B12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0091_G05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0099_E12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0106_G09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0011_E09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0097_F02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATCTTGC
DCI01_0086_F05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0106_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0095_G02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0098_H06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0117_E04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0012_G07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0016_E03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0075_H06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0063_G05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0063_A11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0096_F10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0014_F11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0015_H11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0012_E09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0065_G03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0077_F09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0092_B02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0087_G06.b : GTTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0097_F05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0109_D01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0084_C04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0094_C03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0097_B08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0067_G08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0102_G12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0096_C10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0099_F05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATACTGC
DCI01_0104_A06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0063_B04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0099_A11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0068_G10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0061_C10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0079_E10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0063_G01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0092_D05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0094_D03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0010_C08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0079_H01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0116_C10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0112_G10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0070_G07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0090_F04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0102_B11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0093_B04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATCTTGC
DCI01_0086_C03.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0093_H05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0111_G06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0113_F08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0112_E10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0094_B06.b : ATTCGGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0095_E10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0113_H09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0115_C02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0097_H05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0023_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0090_E12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0110_B09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0080_E08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0100_A11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0085_D11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0084_F08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0015_F05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0112_D01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCCGGGATTTCTGCCTCTGGCTGCAATATTGC
DCI01_0045_C01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0100_G04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0073_E02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0101_C04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTCCTGCTTCTGGCTGCAATATTGC
DCI01_0061_E05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0011_A07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0069_H09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0077_D05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0004_H02.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0093_A02.b : ATTCGGCATGGAATGTCT*CTACTGTTTTCTGGGACTTCTGCTTCTGGCTGCAATATTGC
DCI01_0100_F02.b : ATTCGGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0014_H10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0002_G01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0086_D12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0031_F11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0061_D08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0099_E09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0099_C11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0064_C10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0062_D11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0015_G01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0074_C10.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0066_B12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0087_E11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0064_F08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0057_C12.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0111_C04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0080_A06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0067_E11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0021_D04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0057_B04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0013_D06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0013_C05.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0101_C06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATCGC
DCI01_0097_C09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0078_F01.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0071_A06.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0092_H11.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
KDN01_0056_D08.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0071_D09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0068_B09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0065_C09.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0012_C07.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
AMP01_0002_H04.b : ATTCAGCATGGAATGTCT*CTACTGTTTTCTGGGATTTCTGCTTCTGGCTGCAATATTGC
DCI01_0082_C08.b : nnaaacgatactatagggctgctcccgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_A09.b : aatacgaacccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_D02.b : nnnnttacgtacttgggggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_C10.b : nnnnaacgatacta
DCI01_0001_E04.b : tgatctcttatgggat
AMP01_0092_A11.b : aaaaa
DCI01_0042_C02.b :
20110601C-007008 : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
---------+---------+---------+---------+---------+---------+ 377
DCI01_0043_E03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAGGACCTTCCAGTTATA
DCI01_0114_F01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAACGAAAGACCTTCCAGTTATA
DCI01_0065_E04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0034_B06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0012_C02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0021_F12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0021_B07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0008_D03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGCTATA
DCI01_0103_G02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0104_E11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0117_F10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0099_E02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0062_H02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0068_D09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0081_D08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0088_F11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0110_G05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAACGAAAGACCTTCCAGTTATA
DCI01_0071_F05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0007_G07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0025_G05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0093_C09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0009_F01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0019_E11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0012_H09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0013_F02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0089_C06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0018_C04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0070_A10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGGCCTTCCAGTTATA
AMP01_0056_B08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0024_F07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0054_D03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0032_A03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0043_B07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0012_D01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0020_B12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0026_F02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0013_G11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0031_H12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0040_G11.b : CACTTGATGCCGCCCAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0040_H10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0057_C11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0058_B04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0057_F03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0058_G04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0025_F09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0057_B05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0023_A12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0037_C01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0026_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0017_F01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0032_F03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0102_H05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0037_F06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0032_E10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0028_H06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0026_E06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0018_G12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0103_H03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0041_E01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0007_B06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0017_G10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0033_H09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0010_B02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0051_G04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0028_D11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0017_D07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0093_D05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0028_G04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0036_C06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0013_A05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0036_C08.b : CTCTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0034_E12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0026_F02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0023_C03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0014_D03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0016_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0016_C02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0022_H03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0028_E07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0024_D08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTCATA
AMP01_0004_C04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0041_D11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0019_H09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0025_F03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0018_H12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0079_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGACCAATGAAAGACCTTCCAGTTATA
AMP01_0016_D03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0015_H11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0109_F05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0033_F05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0090_B04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0017_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0082_C06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0009_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0108_E12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0115_F04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0024_G06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0092_E04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0012_G10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0017_A10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0077_H05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0109_B11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0057_H07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0029_E04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0077_F03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0015_H05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0096_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0092_E01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0008_B05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0098_D08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0085_H11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGCTATA
DCI01_0010_A04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0063_G06.b : CACTTGATGCTGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0019_D05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0016_F06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0070_G08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0065_B05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0065_A06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0058_F09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0066_D11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0064_D07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0099_D03.b : CACTTGATGCCGCCTAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0104_F11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0070_G11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0087_F08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0113_G08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0089_B06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0113_F07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0089_A01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0109_G01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0116_H07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0082_D12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0066_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0042_F07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTGTA
DCI01_0007_E11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0007_F05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0070_G09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0066_E08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0069_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0110_D12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0025_A12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0094_H06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0061_B02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0053_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
OVRM1_0131_B05.b : CACTTGATGCCGCCAAGCGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0040_A02.b : CACTTGATGCCCGCCAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0104_H06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0059_F03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0016_D11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0118_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0085_H02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0108_H04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0083_C10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0070_C11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGGAAGACCTTCCAGTTATA
DCI01_0081_H07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0087_F09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0034_C07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0088_F09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0084_A01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0036_F02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0071_H07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGATGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0118_B09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAACGAAAGACCTTCCAGTTATA
DCI01_0068_E08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0112_E09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAACGAAAGACCTTCCAGTTATA
DCI01_0091_F07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAACGAAAGACCTTCCAGTTATA
DCI01_0070_G02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAACGAAAGACCTTCCAGTTATA
DCI01_0107_D05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0013_G03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0028_A02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0028_F02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0028_H07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0058_H12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0026_A10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0038_G06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0070_E07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAA*GACCTTCCAGTTATA
DCI01_0028_G12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGACCAATGAAAGACCTTCCAGTTATA
DCI01_0057_B10.b : CACTTGATGCCGCCAAACGGTTTCAGGACGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0058_C03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0028_H03.b : CACTTGGTGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0058_C06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0035_F09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0058_B05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTGTA
DCI01_0059_D12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0032_E02.b : CACTTGATGCTGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0081_H12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0058_B09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0039_A03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0033_C02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0027_A12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0035_H02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0032_F12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0036_E02.b : CACCTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0012_B11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGCTATA
DCI01_0032_B07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0029_H03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0033_A09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0034_G12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0032_D07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0106_C12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0023_B10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0031_G04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0027_B10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0025_B04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0030_H07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0027_G01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0026_D04.b : CACTTGATGCCGCCGAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0036_C09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0017_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0019_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0031_D03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0025_B05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0035_A08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0011_H09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0026_C08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0017_C01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0031_A06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0018_D09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGC*ATGAAAGACCTTCCAGTTATA
DCI01_0025_A04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0031_H06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0036_A06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0011_G10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0020_C10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0037_G07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0017_H02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0038_C05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0029_C05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0029_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0066_H06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0033_C10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0013_E03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0031_C04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0037_B03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0016_G09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0008_A03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0019_C04.b : CACTTGATGCCGCCAAACGGTTTCGGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0106_F10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0022_C01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0009_E08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0013_E06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0090_C01.b : CACTTGATGCCGCCTAACGGTTTCGCGATGTGCTGAACAATGAAAGACCTTCCAGTTATA
DCI01_0107_B03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0107_E06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0031_G12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0047_F08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0069_A01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0012_G03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0011_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0035_C06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0027_H12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0117_D08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0013_C11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0117_B04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0003_D06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0082_G03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0111_C08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0115_D03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0103_G10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGTAATGAAAGACCTTCCAGTTATA
DCI01_0020_D12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0016_G07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0064_C01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0005_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0101_H03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0102_A05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0021_G05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0019_H05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0097_H11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0113_A06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0114_D10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0016_D04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0117_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0010_D04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0014_E10.b : CACTTGATGCCGCCAAACGGTTTCGGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0008_E08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0014_A11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATG
DCI01_0114_D07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0109_G06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAACGAAAGACCTTCCAGTTATA
DCI01_0103_E12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCGGTTATA
DCI01_0075_D06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0086_E02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0018_G07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0069_D05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0091_G06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0115_H03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0076_F08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0015_H03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0020_B12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0091_G05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0099_E12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0106_G09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0011_E09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0097_F02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0086_F05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0106_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0095_G02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0098_H06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0117_E04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0012_G07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0016_E03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0075_H06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0063_G05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0063_A11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0096_F10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0014_F11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0015_H11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0012_E09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0065_G03.b : CACTTGATGCCGCCGAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0077_F09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0092_B02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0087_G06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0097_F05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0109_D01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0084_C04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0094_C03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0097_B08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0067_G08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0102_G12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0096_C10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0099_F05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0104_A06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0063_B04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0099_A11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0068_G10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0061_C10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0079_E10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0063_G01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0092_D05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTCCCAGTTATA
DCI01_0094_D03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0010_C08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0079_H01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0116_C10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0112_G10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0070_G07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0090_F04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0102_B11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACTTTCCAGTTATA
DCI01_0093_B04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0086_C03.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0093_H05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0111_G06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0113_F08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0112_E10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0094_B06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0095_E10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0113_H09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0115_C02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0097_H05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0023_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0090_E12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0110_B09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0080_E08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0100_A11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0085_D11.b : CACTTGACGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0084_F08.b : CACTTGATGCCGCCAAACGGTTTCAGGACGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0015_F05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0112_D01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0045_C01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0100_G04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0073_E02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0101_C04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0061_E05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0011_A07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0069_H09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0077_D05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0004_H02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0093_A02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCGGTTATA
DCI01_0100_F02.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0014_H10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0002_G01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0086_D12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTCCCAGTTATA
DCI01_0031_F11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0061_D08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0099_E09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0099_C11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0064_C10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0062_D11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0015_G01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0074_C10.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0066_B12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0087_E11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0064_F08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0057_C12.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0111_C04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0080_A06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0067_E11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0021_D04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0057_B04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0013_D06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0013_C05.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0101_C06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0097_C09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0078_F01.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0071_A06.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0092_H11.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
KDN01_0056_D08.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0071_D09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0068_B09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0065_C09.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0012_C07.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
AMP01_0002_H04.b : CACTTGATGCCGCCAAACGGTTTCAGGATGTGCTGAGCAATGAAAGACCTTCCAGTTATA
DCI01_0082_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0086_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_C10.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0001_E04.b : acttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_A11.b : cgatatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_C02.b :
20110601C-007008 : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
---------+---------+---------+---------+---------+---------+ 437
DCI01_0043_E03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0114_F01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0065_E04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0034_B06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0012_C02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0021_F12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0021_B07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0008_D03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0103_G02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0104_E11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0117_F10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0099_E02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGGAAAAC
DCI01_0062_H02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0068_D09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0081_D08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0088_F11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0110_G05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0071_F05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0007_G07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAGTGAAAAAC
DCI01_0025_G05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0093_C09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0009_F01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0019_E11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0012_H09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0013_F02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0089_C06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0018_C04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0070_A10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0056_B08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0024_F07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0054_D03.b : TGAGGGAGCACAACCAATTAAGCGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0032_A03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0043_B07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0012_D01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0020_B12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0026_F02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0013_G11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0031_H12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0040_G11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0040_H10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0057_C11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0058_B04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0057_F03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0058_G04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0025_F09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0057_B05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0023_A12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0037_C01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0026_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0017_F01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0032_F03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0102_H05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0037_F06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0032_E10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0028_H06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0026_E06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0018_G12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0103_H03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0041_E01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0007_B06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0017_G10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0033_H09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0010_B02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0051_G04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0028_D11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0017_D07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0093_D05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0028_G04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0036_C06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0013_A05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0036_C08.b : TGAGGAAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0034_E12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0026_F02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0023_C03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0014_D03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0016_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0016_C02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0022_H03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0028_E07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCGGATGAGAATGACTGGAATGAAAAAC
DCI01_0024_D08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0004_C04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0041_D11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0019_H09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0025_F03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0018_H12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0079_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCATATGAGAATGACTGGAATGAAAAAC
AMP01_0016_D03.b : TGAGGGAGCACAACCAATTAAACAGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0015_H11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0109_F05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0033_F05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0090_B04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0017_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0082_C06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0009_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0108_E12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0115_F04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0024_G06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAAATGAGAATGACTGGAATGAAAAAC
AMP01_0092_E04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0012_G10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAGC
DCI01_0017_A10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0077_H05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0109_B11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0057_H07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0029_E04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0077_F03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0015_H05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0096_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0092_E01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0008_B05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0098_D08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0085_H11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0010_A04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0063_G06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0019_D05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0016_F06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0070_G08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0065_B05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0065_A06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0058_F09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0066_D11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0064_D07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0099_D03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0104_F11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0070_G11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0087_F08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0113_G08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0089_B06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0113_F07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0089_A01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0109_G01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0116_H07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0082_D12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0066_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0042_F07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0007_E11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0007_F05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0070_G09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0066_E08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0069_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0110_D12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0025_A12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0094_H06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0061_B02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0053_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
OVRM1_0131_B05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0040_A02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0104_H06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCACATGAGAATGACTGGAATGAAAAAC
DCI01_0059_F03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0016_D11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0118_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0085_H02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0108_H04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0083_C10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0070_C11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0081_H07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0087_F09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0034_C07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0088_F09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0084_A01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0036_F02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0071_H07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAGAC
DCI01_0118_B09.b : TGAGGGAGCACACCCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0068_E08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0112_E09.b : TGAGGGAGCACACCCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0091_F07.b : TGAGGGAGCACACCCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0070_G02.b : TGAGGGAGCACACCCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0107_D05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0013_G03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0028_A02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0028_F02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0028_H07.b : TGAGGGAGCACAAACAATTAAACGGTTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0058_H12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0026_A10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACCGGAATGAAAAAC
DCI01_0038_G06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0070_E07.b : TGAGGGAGCACAACCCATTTAACGGCTGGGTCTCAGATGAGAATGACTGGAATGGAAAAC
DCI01_0028_G12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0057_B10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0058_C03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0028_H03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0058_C06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0035_F09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0058_B05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0059_D12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0032_E02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0081_H12.b : TGAGGGAGCACAACCAGTTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0058_B09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0039_A03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0033_C02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0027_A12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0035_H02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0032_F12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0036_E02.b : TGAGGGAGCACAACCAATTAAACGGCAGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0012_B11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0032_B07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0029_H03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGACGAGAATGACTGGAATGAAAAAC
DCI01_0033_A09.b : TGAGGGAGTACAACCAATTAAACGGCTGGTCTTCGGATGAGAATGACTGGAATGAAAAAC
DCI01_0034_G12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0032_D07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0106_C12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0023_B10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0031_G04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0027_B10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0025_B04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0030_H07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0027_G01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0026_D04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0036_C09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0017_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0019_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0031_D03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0025_B05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0035_A08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0011_H09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0026_C08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0017_C01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0031_A06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0018_D09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0025_A04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0031_H06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0036_A06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0011_G10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0020_C10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0037_G07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0017_H02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0038_C05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0029_C05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0029_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0066_H06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0033_C10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0013_E03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0031_C04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0037_B03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0016_G09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGGAAAAC
DCI01_0008_A03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0019_C04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0106_F10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGGGAATGACTGGAATGAAAAAC
DCI01_0022_C01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0009_E08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0013_E06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0090_C01.b : TGAGGGAGCGCAACCAATTACACGGCTGGTCTTCAAATGACAATGACTGGAATGAAAAAC
DCI01_0107_B03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0107_E06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0031_G12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0047_F08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0069_A01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0012_G03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAGAAAC
DCI01_0011_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0035_C06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0027_H12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0117_D08.b : TGAGGGAGCACAACCAATTGAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0013_C11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGGATGACTGGAATGAAAAAC
DCI01_0117_B04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0003_D06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0082_G03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0111_C08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0115_D03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGATTGGAATGAAAAAC
DCI01_0103_G10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0020_D12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0016_G07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0064_C01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0005_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0101_H03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0102_A05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0021_G05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0019_H05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0097_H11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0113_A06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0114_D10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0016_D04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0117_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0010_D04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0014_E10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0008_E08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0014_A11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0114_D07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0109_G06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0103_E12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0075_D06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0086_E02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0018_G07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0069_D05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0091_G06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0115_H03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0076_F08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0015_H03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0020_B12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0091_G05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0099_E12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0106_G09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0011_E09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0097_F02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0086_F05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0106_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0095_G02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0098_H06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0117_E04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAGTGACTGGAATGAAAAAC
DCI01_0012_G07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0016_E03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0075_H06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0063_G05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0063_A11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0096_F10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0014_F11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0015_H11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0012_E09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0065_G03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGTCTGGAATGAAAAAC
DCI01_0077_F09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCATATGAGAATGACTGGAATGAAAAAC
DCI01_0092_B02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0087_G06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0097_F05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0109_D01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0084_C04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0094_C03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0097_B08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0067_G08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0102_G12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0096_C10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0099_F05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0104_A06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0063_B04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0099_A11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0068_G10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAGC
DCI01_0061_C10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0079_E10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0063_G01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0092_D05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0094_D03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0010_C08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0079_H01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0116_C10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0112_G10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0070_G07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0090_F04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0102_B11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0093_B04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0086_C03.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0093_H05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0111_G06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0113_F08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0112_E10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0094_B06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0095_E10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0113_H09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0115_C02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0097_H05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0023_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0090_E12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAGC
DCI01_0110_B09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0080_E08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0100_A11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0085_D11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0084_F08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0015_F05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0112_D01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0045_C01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0100_G04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0073_E02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0101_C04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0061_E05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0011_A07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAACGAAAAAC
DCI01_0069_H09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0077_D05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0004_H02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0093_A02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0100_F02.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0014_H10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0002_G01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0086_D12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0031_F11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0061_D08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0099_E09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0099_C11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0064_C10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0062_D11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0015_G01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0074_C10.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0066_B12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0087_E11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0064_F08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0057_C12.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0111_C04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0080_A06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0067_E11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0021_D04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0057_B04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0013_D06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0013_C05.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0101_C06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0097_C09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0078_F01.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0071_A06.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0092_H11.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
KDN01_0056_D08.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0071_D09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0068_B09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0065_C09.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0012_C07.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
AMP01_0002_H04.b : TGAGGGAGCACAACCAATTAAACGGCTGGTCTTCAGATGAGAATGACTGGAATGAAAAAC
DCI01_0082_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGAATGACTGGAATGAAAAAC
DCI01_0109_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAATGACTGGAATGAAAAAC
DCI01_0086_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAATGACTGGAATGAAAAAC
DCI01_0078_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_C02.b : nnnnngatacaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007008 : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
---------+---------+---------+---------+---------+---------+ 495
DCI01_0043_E03.b : T*CTATCCATGACTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0114_F01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0065_E04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0034_B06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0012_C02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0021_F12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0021_B07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0008_D03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0103_G02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0104_E11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0117_F10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0099_E02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACCCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0062_H02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0068_D09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0081_D08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0088_F11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0110_G05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0071_F05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0007_G07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0025_G05.b : C*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0093_C09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0009_F01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0019_E11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0012_H09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0013_F02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0089_C06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0018_C04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0070_A10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0056_B08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0024_F07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0054_D03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0032_A03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0043_B07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0012_D01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0020_B12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0026_F02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0013_G11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0031_H12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0040_G11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0040_H10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0057_C11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0058_B04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0057_F03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0058_G04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0025_F09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0057_B05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0023_A12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0037_C01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0026_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0017_F01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0032_F03.b : T*CTATCCA*GTTTGGAAGAGAGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0102_H05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0037_F06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0032_E10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0028_H06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0026_E06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0018_G12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0103_H03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0041_E01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0007_B06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0017_G10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0033_H09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0010_B02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0051_G04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0028_D11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0017_D07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGGAAAACTCTTGGAAAGGGGGCCG
AMP01_0093_D05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0028_G04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0036_C06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0013_A05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0036_C08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0034_E12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0026_F02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0023_C03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0014_D03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0016_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0016_C02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0022_H03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0028_E07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0024_D08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0004_C04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0041_D11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0019_H09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0025_F03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0018_H12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0079_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAATGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0016_D03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0015_H11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0109_F05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0033_F05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0090_B04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0017_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0082_C06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0009_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0108_E12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0115_F04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0024_G06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0092_E04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0012_G10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0017_A10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0077_H05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0109_B11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0057_H07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0029_E04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0077_F03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0015_H05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0096_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0092_E01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0008_B05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0098_D08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0085_H11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0010_A04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0063_G06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0019_D05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0016_F06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0070_G08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0065_B05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0065_A06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0058_F09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0066_D11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0064_D07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0099_D03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0104_F11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCCTGGAAAGGGGGCCG
DCI01_0070_G11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0087_F08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0113_G08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0089_B06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0113_F07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0089_A01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0109_G01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0116_H07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0082_D12.b : T*CTATCCA*GTTTGGAAGAGGGGAGGCTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0066_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0042_F07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0007_E11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAA*GGGGGCCG
DCI01_0007_F05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0070_G09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0066_E08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0069_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0110_D12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0025_A12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0094_H06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0061_B02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0053_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
OVRM1_0131_B05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGAGGCCG
DCI01_0040_A02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0104_H06.b : T*CTATCCA*GTTTGGAACAGGGGAGACTCAGGGTGGAAAAACTCTTGGAAAGGGAGCCG
DCI01_0059_F03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0016_D11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0118_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0085_H02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0108_H04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0083_C10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0070_C11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGATAGGGGGCCG
DCI01_0081_H07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0087_F09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0034_C07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0088_F09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0084_A01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0036_F02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0071_H07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0118_B09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0068_E08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0112_E09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0091_F07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0070_G02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0107_D05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0013_G03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0028_A02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0028_F02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0028_H07.b : T*CTATCCA*CTTTGGAAGATGGGAGACTCAAGGTGGAAAAACTCTTGAAAAGGGGGCCG
DCI01_0058_H12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0026_A10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0038_G06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0070_E07.b : TTCTATCCA*GTTTGGAAGAAGGGAAACTCAAGGGGGAAAAACTCCTGGAAAGGGGGCCG
DCI01_0028_G12.b : T*CTATCCA*CTTTGGAAGACGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0057_B10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGG*GCCG
DCI01_0058_C03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0028_H03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0058_C06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0035_F09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0058_B05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0059_D12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0032_E02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0081_H12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0058_B09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0039_A03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0033_C02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0027_A12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0035_H02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0032_F12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0036_E02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0012_B11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0032_B07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0029_H03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0033_A09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0034_G12.b : T*CTATCCA*GTTTGGGAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0032_D07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0106_C12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0023_B10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0031_G04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0027_B10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0025_B04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0030_H07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0027_G01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0026_D04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0036_C09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0017_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0019_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAGACTCTTGGAAAGGGGGCCG
DCI01_0031_D03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0025_B05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0035_A08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0011_H09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0026_C08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0017_C01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0031_A06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0018_D09.b : T*CTATCCA*GTTTGGAGGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0025_A04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0031_H06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0036_A06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0011_G10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0020_C10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0037_G07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0017_H02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0038_C05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0029_C05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0029_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0066_H06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0033_C10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0013_E03.b : T*CTATCCA*GTTTGGAGGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0031_C04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0037_B03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0016_G09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0008_A03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0019_C04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0106_F10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0022_C01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0009_E08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0013_E06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0090_C01.b : T*CTATCCA*GTTTGGAAGAAGGGAGACTCATGGTGGAAAAACTCTTGAAAAGGGGGCCG
DCI01_0107_B03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0107_E06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0031_G12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0047_F08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0069_A01.b : T*CTATCCA*GTTTGGAAGAAGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0012_G03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0011_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0035_C06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0027_H12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0117_D08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0013_C11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0117_B04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0003_D06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0082_G03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0111_C08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0115_D03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0103_G10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0020_D12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0016_G07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0064_C01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0005_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0101_H03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0102_A05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0021_G05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0019_H05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0097_H11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0113_A06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0114_D10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0016_D04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0117_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0010_D04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0014_E10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0008_E08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0014_A11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0114_D07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0109_G06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0103_E12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0075_D06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0086_E02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0018_G07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0069_D05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0091_G06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGATGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0115_H03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0076_F08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0015_H03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0020_B12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0091_G05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0099_E12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0106_G09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0011_E09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0097_F02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0086_F05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0106_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0095_G02.b : T*CTATCCG*GTTTGGAAGAAGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0098_H06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0117_E04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0012_G07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0016_E03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGGAAGGGGGCCG
DCI01_0075_H06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0063_G05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0063_A11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0096_F10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0014_F11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0015_H11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0012_E09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0065_G03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0077_F09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0092_B02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0087_G06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0097_F05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0109_D01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0084_C04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0094_C03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0097_B08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0067_G08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0102_G12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0096_C10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0099_F05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0104_A06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0063_B04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0099_A11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0068_G10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCT*GGAAAGGGGGCCG
DCI01_0061_C10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0079_E10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0063_G01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0092_D05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0094_D03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0010_C08.b : T*CTATCCA*GTTTGGAGGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0079_H01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0116_C10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0112_G10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0070_G07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0090_F04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0102_B11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0093_B04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0086_C03.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0093_H05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0111_G06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0113_F08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0112_E10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0094_B06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0095_E10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0113_H09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0115_C02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0097_H05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0023_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0090_E12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTC*TGGAAAGGGGGCCG
DCI01_0110_B09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0080_E08.b : T*CTACCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0100_A11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACGTTTGGAGAGGGGGCCG
DCI01_0085_D11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0084_F08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGG*CCG
DCI01_0015_F05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0112_D01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0045_C01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0100_G04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0073_E02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0101_C04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0061_E05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0011_A07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0069_H09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0077_D05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0004_H02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAATCTCTTGGAAAGGGGGCCG
DCI01_0093_A02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0100_F02.b : T*CTATCCA*GTTTGGAGGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0014_H10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0002_G01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0086_D12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0031_F11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0061_D08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0099_E09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0099_C11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0064_C10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0062_D11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0015_G01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0074_C10.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0066_B12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCGAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0087_E11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0064_F08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0057_C12.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0111_C04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0080_A06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0067_E11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0021_D04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0057_B04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0013_D06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0013_C05.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0101_C06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0097_C09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0078_F01.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0071_A06.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0092_H11.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
KDN01_0056_D08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0071_D09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0068_B09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0065_C09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0012_C07.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0002_H04.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0082_C08.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0109_A09.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0086_D02.b : T*CTATCCA*GTTTGGAAGAGGGGAGACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0078_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxACTCAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGGTGGAAAAACTCTTGGAAAGGGGGCCG
AMP01_0092_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAAAAACTCTTGGAAAGGGGGCCG
DCI01_0042_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007008 : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
---------+---------+---------+---------+---------+---------+ 555
DCI01_0043_E03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0114_F01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0065_E04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0034_B06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0012_C02.b : CGTGCGGGCAGTTTTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0021_F12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0021_B07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0008_D03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0103_G02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0104_E11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0117_F10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0099_E02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0062_H02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0068_D09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0081_D08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0088_F11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0110_G05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0071_F05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0007_G07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCGGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0025_G05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0093_C09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0009_F01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0019_E11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0012_H09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAAACATAACATTCGC
AMP01_0013_F02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0089_C06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0018_C04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0070_A10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0056_B08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0024_F07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0054_D03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0032_A03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0043_B07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0012_D01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0020_B12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0026_F02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0013_G11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0031_H12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0040_G11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCCTAACATTCGC
DCI01_0040_H10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0057_C11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTNCACCATAACATTCGC
DCI01_0058_B04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0057_F03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0058_G04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0025_F09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0057_B05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0023_A12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTNCACCATAACATTCGC
DCI01_0037_C01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0026_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0017_F01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0032_F03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0102_H05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0037_F06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0032_E10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0028_H06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0026_E06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0018_G12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0103_H03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0041_E01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0007_B06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0017_G10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0033_H09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0010_B02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0051_G04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0028_D11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0017_D07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0093_D05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0028_G04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0036_C06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0013_A05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0036_C08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0034_E12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0026_F02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0023_C03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0014_D03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0016_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0016_C02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0022_H03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0028_E07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0024_D08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0004_C04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0041_D11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0019_H09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0025_F03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0018_H12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0079_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCGCTGGTGGGCTCAACCATAACATTCGC
AMP01_0016_D03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0015_H11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0109_F05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0033_F05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0090_B04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0017_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0082_C06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0009_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0108_E12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0115_F04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0024_G06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0092_E04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0012_G10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0017_A10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0077_H05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0109_B11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0057_H07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0029_E04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0077_F03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0015_H05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0096_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0092_E01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0008_B05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATGACATTCGC
DCI01_0098_D08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCGCTGGTGGGCTCAACCATAACATTCGC
DCI01_0085_H11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0010_A04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0063_G06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0019_D05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0016_F06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0070_G08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0065_B05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0065_A06.b : CGTGCGGGCAGTTCCGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0058_F09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0066_D11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0064_D07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0099_D03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0104_F11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0070_G11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0087_F08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0113_G08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0089_B06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCAC
DCI01_0113_F07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0089_A01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0109_G01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0116_H07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0082_D12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0066_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0042_F07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0007_E11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0007_F05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0070_G09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0066_E08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0069_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0110_D12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0025_A12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0094_H06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0061_B02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0053_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
OVRM1_0131_B05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0040_A02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0104_H06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCGACCGTAACATTCGC
DCI01_0059_F03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0016_D11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0118_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0085_H02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0108_H04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0083_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0070_C11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0081_H07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCGACCATAACATTCGC
DCI01_0087_F09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0034_C07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0088_F09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0084_A01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0036_F02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0071_H07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0118_B09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0068_E08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0112_E09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0091_F07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0070_G02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0107_D05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0013_G03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0028_A02.b : CGTGCGGGCAGTCCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0028_F02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0028_H07.b : CGTGCCGGCAGTTCTGACCACTGATTCACCAGCACTGGTGGGTTCAACCATAACATTCAC
DCI01_0058_H12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0026_A10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0038_G06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0070_E07.b : CGTGCCGGCCATTCTGAACAGTGATTCACCCACACTGGTGGGCTCCACCATAACATTCGC
DCI01_0028_G12.b : CGTGCGAGCAGTTCTGATCAGTGATTCACCAACACTGGTGGGCACAACCATAACATTCTC
DCI01_0057_B10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0058_C03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0028_H03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0058_C06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0035_F09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0058_B05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0059_D12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0032_E02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0081_H12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0058_B09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0039_A03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0033_C02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0027_A12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0035_H02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0032_F12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0036_E02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0012_B11.b : CGTGCGGGCAGTTCCGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0032_B07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0029_H03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0033_A09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0034_G12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0032_D07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0106_C12.b : CGTGCGGGCAGTTCTGACCAGTGGTTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0023_B10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0031_G04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0027_B10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0025_B04.b : CGTGCGGGCAGTTCTGACCAGTGATGCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0030_H07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0027_G01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0026_D04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0036_C09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0017_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0019_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0031_D03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0025_B05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0035_A08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0011_H09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0026_C08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0017_C01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0031_A06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0018_D09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0025_A04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0031_H06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0036_A06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0011_G10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCGACCATAACATTCGC
DCI01_0020_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0037_G07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0017_H02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0038_C05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0029_C05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0029_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0066_H06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0033_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0013_E03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACTATAACATTCGC
DCI01_0031_C04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0037_B03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0016_G09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0008_A03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0019_C04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0106_F10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0022_C01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0009_E08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0013_E06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0090_C01.b : CGTGCGGGCACTTCTGACCAGTGATTCGCCAGCACTGATGGGCTCAACCATAACATTCGC
DCI01_0107_B03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0107_E06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0031_G12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0047_F08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0069_A01.b : CGTGCCGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0012_G03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0011_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0035_C06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0027_H12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATGGCATTCGC
DCI01_0117_D08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0013_C11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0117_B04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0003_D06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0082_G03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0111_C08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0115_D03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0103_G10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0020_D12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0016_G07.b : CGTGCGGGCAGTTCTGACCAGTGATTCGCCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0064_C01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0005_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0101_H03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0102_A05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0021_G05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0019_H05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0097_H11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGTACTGGTGGGCTCAACCATAACATTCGC
DCI01_0113_A06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0114_D10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0016_D04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0117_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0010_D04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0014_E10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0008_E08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0014_A11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0114_D07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0109_G06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0103_E12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0075_D06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0086_E02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0018_G07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0069_D05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0091_G06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0115_H03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0076_F08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0015_H03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0020_B12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0091_G05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0099_E12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0106_G09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0011_E09.b : CGCGCGGGCAGTTCTGACCAGTGGTTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0097_F02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0086_F05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0106_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0095_G02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0098_H06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0117_E04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0012_G07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0016_E03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0075_H06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0063_G05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0063_A11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0096_F10.b : CGTGCAGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0014_F11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0015_H11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0012_E09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0065_G03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0077_F09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0092_B02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0087_G06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0097_F05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0109_D01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0084_C04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0094_C03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0097_B08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0067_G08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0102_G12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0096_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0099_F05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0104_A06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0063_B04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0099_A11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0068_G10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCGTAACATTCGC
DCI01_0061_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0079_E10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0063_G01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0092_D05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0094_D03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0010_C08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACTATAACATTCGC
DCI01_0079_H01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAGCATTCGC
DCI01_0116_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0112_G10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0070_G07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0090_F04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0102_B11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0093_B04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0086_C03.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0093_H05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0111_G06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0113_F08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0112_E10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0094_B06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0095_E10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0113_H09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0115_C02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0097_H05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0023_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0090_E12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCGTAACATTCGC
DCI01_0110_B09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0080_E08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0100_A11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0085_D11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0084_F08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0015_F05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0112_D01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0045_C01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0100_G04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0073_E02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0101_C04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0061_E05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0011_A07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0069_H09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0077_D05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0004_H02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0093_A02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0100_F02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0014_H10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0002_G01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0086_D12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0031_F11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0061_D08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0099_E09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0099_C11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0064_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0062_D11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0015_G01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0074_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0066_B12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0087_E11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACTAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0064_F08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0057_C12.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0111_C04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0080_A06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0067_E11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0021_D04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0057_B04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0013_D06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0013_C05.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0101_C06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0097_C09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0078_F01.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0071_A06.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0092_H11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
KDN01_0056_D08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0071_D09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0068_B09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACTAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0065_C09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0012_C07.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0002_H04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0082_C08.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0109_A09.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0086_D02.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0078_C10.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0001_E04.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
AMP01_0092_A11.b : CGTGCGGGCAGTTCTGACCAGTGATTCACCAGCACTGGTGGGCTCAACCATAACATTCGC
DCI01_0042_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAACCATAACATTCGC
20110601C-007008 : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
---------+---------+---------+---------+---------+---------+ 614
DCI01_0043_E03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0114_F01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0065_E04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATG*GTCTATG
DCI01_0034_B06.b : CGTGAACCTGGTTTTCCCCAGATGCCAA*AGGGAGATGCCGATGGC*ACATA*GTCTATG
DCI01_0012_C02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0021_F12.b : CGTGAACCTGGTTTTCCCCAAATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0021_B07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0008_D03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0103_G02.b : CGTGAACCTGGTTTTCCCCAGGTGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0104_E11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGGCACATA*GTCTATG
DCI01_0117_F10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0099_E02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0062_H02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0068_D09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0081_D08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0088_F11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0110_G05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0071_F05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0007_G07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0025_G05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0093_C09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0009_F01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0019_E11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0012_H09.b : CGTGAACCTGGTTTTCCCCACATGCCAATAGGACTATGCCAATtggccccatattctctt
AMP01_0013_F02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0089_C06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0018_C04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0070_A10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0056_B08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0024_F07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0054_D03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0032_A03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0043_B07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0012_D01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAATATGCCGATGGCAACATA*GTCTATG
AMP01_0020_B12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0026_F02.b : CGTGAACCTGGTTTTTCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0013_G11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0031_H12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCGACATA*GTCTATG
DCI01_0040_G11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCCACATA*GTCTATG
DCI01_0040_H10.b : CGTGAATCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0057_C11.b : CGTGAACCTGGTTTTCCCCAGATGCCCAAAGGAAGATGCCGATGGNCACATA*GTCTATG
DCI01_0058_B04.b : CGTGAACCTGGTTTTCCCCAGATGTCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0057_F03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0058_G04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0025_F09.b : CGTGAACCTGGTTTTCCCCAGATGCCCAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0057_B05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0023_A12.b : CGTGAACCTGGTTTTCCCCAGATGCCCAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0037_C01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0026_A07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0017_F01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0032_F03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0102_H05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0037_F06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0032_E10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0028_H06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0026_E06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0018_G12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0103_H03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0041_E01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0007_B06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0017_G10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0033_H09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0010_B02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0051_G04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0028_D11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0017_D07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0093_D05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0028_G04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0036_C06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0013_A05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0036_C08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0034_E12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0026_F02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0023_C03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0014_D03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0016_A07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0016_C02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0022_H03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0028_E07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0024_D08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0004_C04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0041_D11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0019_H09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0025_F03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0018_H12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0079_E05.b : CGTGAACCTGGTTTTCCCCATATGCCAAAAGGAACATGCCGATGGCAACATA*CTCTATG
AMP01_0016_D03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0015_H11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0109_F05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0033_F05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0090_B04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0017_A07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0082_C06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0009_A07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0108_E12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0115_F04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0024_G06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0092_E04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0012_G10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0017_A10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0077_H05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0109_B11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0057_H07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGGTGCCGATGGCAACATA*GTCTATG
DCI01_0029_E04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0077_F03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0015_H05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0096_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0092_E01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0008_B05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0098_D08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0085_H11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0010_A04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0063_G06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0019_D05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0016_F06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0070_G08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0065_B05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0065_A06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0058_F09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0066_D11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0064_D07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
AMP01_0099_D03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0104_F11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0070_G11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0087_F08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0113_G08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0089_B06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0113_F07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0089_A01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0109_G01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0116_H07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACGTA*GTCTATG
DCI01_0082_D12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0066_A07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0042_F07.b : CGTGAGCCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0007_E11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0007_F05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0070_G09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0066_E08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0069_A07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0110_D12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0025_A12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0094_H06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0061_B02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0053_A07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
OVRM1_0131_B05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0040_A02.b : CGTGANCCTGGTTTTCCC*AGATGCCCAAAGGAAGATGCCGATGGGCAC*TA*GTCTATG
DCI01_0104_H06.b : CGTGAACCTGGTTTTCCCCAGATGCCATAATGAAGATGCCGATGGCNACATA*GTCTATG
DCI01_0059_F03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0016_D11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0118_A07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0085_H02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0108_H04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0083_C10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0070_C11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0081_H07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0087_F09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0034_C07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0088_F09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0084_A01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0036_F02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0071_H07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0118_B09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0068_E08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0112_E09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0091_F07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0070_G02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0107_D05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0013_G03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0028_A02.b : CGTGAACCTGGTTTTC*CCAGATGCCAAAAGGA*GATGCCGATGGGCACATA*GTCTATG
DCI01_0028_F02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGNCACATA*GTCTATG
DCI01_0028_H07.b : CGTGAACCTGGTTTTCGCCATATGCCAAATGGAAGATGCCGATGGCAACATA*CTCTATG
DCI01_0058_H12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0026_A10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0038_G06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0070_E07.b : CGTGAACCTGGTTTTCCCCACATGCCCAAAGGAAGATGCCCATGGCCACATA*GTCTATG
DCI01_0028_G12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0057_B10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0058_C03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0028_H03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0058_C06.b : CGTGAACCTGGTTTTCCCCAAATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0035_F09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0058_B05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0059_D12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0032_E02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0081_H12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0058_B09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0039_A03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGNCACATA*GTCTATG
DCI01_0033_C02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0027_A12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0035_H02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0032_F12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0036_E02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0012_B11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0032_B07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0029_H03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0033_A09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0034_G12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0032_D07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0106_C12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0023_B10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0031_G04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0027_B10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0025_B04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0030_H07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0027_G01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0026_D04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0036_C09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATACCGATGGCAACATA*GTCTATG
DCI01_0017_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0019_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0031_D03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0025_B05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0035_A08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0011_H09.b : CGCGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0026_C08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0017_C01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0031_A06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0018_D09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0025_A04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0031_H06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0036_A06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0011_G10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0020_C10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0037_G07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0017_H02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0038_C05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0029_C05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0029_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0066_H06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0033_C10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0013_E03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0031_C04.b : CGTGAACCTGGTTTTCCCCAGACGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0037_B03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0016_G09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0008_A03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0019_C04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0106_F10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0022_C01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0009_E08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0013_E06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0090_C01.b : CGTGAACCTGGTTTTCCCCACATGCCTAAAGGAAGATGCCGATGGCGACATATGTCTATG
DCI01_0107_B03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0107_E06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0031_G12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0047_F08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAGCATA*GTCTATG
DCI01_0069_A01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0012_G03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0011_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0035_C06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0027_H12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0117_D08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0013_C11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0117_B04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0003_D06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0082_G03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGGAGACGCCGATGGCAACATA*GTCTATG
DCI01_0111_C08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0115_D03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0103_G10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0020_D12.b : CGTGAACCTGGTTTTCCCCAGAAGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0016_G07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0064_C01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0005_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0101_H03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0102_A05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCCATG
DCI01_0021_G05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATAGCAACATA*GTCTATG
DCI01_0019_H05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0097_H11.b : CGTGAACCTGGTTTTCCCCAGACGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0113_A06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0114_D10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0016_D04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0117_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0010_D04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0014_E10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0008_E08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0014_A11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0114_D07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0109_G06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0103_E12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0075_D06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0086_E02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0018_G07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0069_D05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0091_G06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0115_H03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0076_F08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0015_H03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0020_B12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0091_G05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0099_E12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0106_G09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0011_E09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0097_F02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0086_F05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0106_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0095_G02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0098_H06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0117_E04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0012_G07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0016_E03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0075_H06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0063_G05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0063_A11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAGCATA*GTCTATG
DCI01_0096_F10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGGTGCCGATGGCAACATA*GTCTATG
DCI01_0014_F11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0015_H11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0012_E09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0065_G03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0077_F09.b : CGTGAACCTGGTTTTCCCCACATGCCAGAAGGAAGATGCCGATGGCAACATA*ATCTATG
DCI01_0092_B02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0087_G06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0097_F05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0109_D01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0084_C04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0094_C03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0097_B08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0067_G08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0102_G12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0096_C10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0099_F05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0104_A06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0063_B04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0099_A11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0068_G10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0061_C10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0079_E10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0063_G01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0092_D05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0094_D03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0010_C08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0079_H01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0116_C10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0112_G10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0070_G07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCGACATA*GTCTATG
DCI01_0090_F04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0102_B11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0093_B04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0086_C03.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0093_H05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0111_G06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0113_F08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0112_E10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0094_B06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0095_E10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0113_H09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0115_C02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0097_H05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0023_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0090_E12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0110_B09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0080_E08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0100_A11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0085_D11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0084_F08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0015_F05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0112_D01.b : CGTGAACCTGGTTTTCCC*AGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0045_C01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0100_G04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0073_E02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0101_C04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0061_E05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0011_A07.b : CGTGAACCTGGTTTTCCCCCGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0069_H09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0077_D05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0004_H02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0093_A02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0100_F02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0014_H10.b : CGTGAGCCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0002_G01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0086_D12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0031_F11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0061_D08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0099_E09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0099_C11.b : CGAGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0064_C10.b : CGTGAACCTGATTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0062_D11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0015_G01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0074_C10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0066_B12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0087_E11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0064_F08.b : CGTGAACCTGATTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0057_C12.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0111_C04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0080_A06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0067_E11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0021_D04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0057_B04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0013_D06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0013_C05.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0101_C06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0097_C09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0078_F01.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0071_A06.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0092_H11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
KDN01_0056_D08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0071_D09.b : CGTGAAACCTGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGGCACATA*GTCTATG
DCI01_0068_B09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0065_C09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACTTA*GTCTATG
DCI01_0012_C07.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0002_H04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0082_C08.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0109_A09.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0086_D02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0078_C10.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
DCI01_0001_E04.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGATGGCAACATA*GTCTATG
AMP01_0092_A11.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCAATGGCAACATA*GTCTATG
DCI01_0042_C02.b : CGTGAACCTGGTTTTCCCCAGATGCCAAAAGGAAGATGCCGGTGGCAACATA*GTCTATG
20110601C-007008 : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
---------+---------+---------+---------+---------+---------+ 673
DCI01_0043_E03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0114_F01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0065_E04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0034_B06.b : AAAAGA*CTGCAGAAATGATTCTGGGCC*ATC*CCCGACCCATATGTTTACAACTGGACA
DCI01_0012_C02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCTACCCATATGTTTACAACTGGACA
DCI01_0021_F12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0021_B07.b : AGAAGAACCGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTTACACTGGACA
AMP01_0008_D03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0103_G02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0104_E11.b : AGAAGAACTGCAGAAATGATTCTGGGGC*AT*CCCCGACCCATATGTTTACNACTGGACA
DCI01_0117_F10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0099_E02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0062_H02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0068_D09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0081_D08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0088_F11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0110_G05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0071_F05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0007_G07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0025_G05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0093_C09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0009_F01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0019_E11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0012_H09.b : agaatatctgctgaaatgattctggtgacacccccgaacccatctcgttccctactgaac
AMP01_0013_F02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0089_C06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0018_C04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0070_A10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0056_B08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0024_F07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0054_D03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACGACTGGACA
DCI01_0032_A03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATNGTTTACACTGGACA
DCI01_0043_B07.b : AGAAGAACTGCGGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0012_D01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCTACTCATATGTTTACAACTGGACA
AMP01_0020_B12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACCACTGGACA
DCI01_0026_F02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCCGACCATATGTTTTACACTGGACA
AMP01_0013_G11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0031_H12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0040_G11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCC*TATGTTTACAACTGGACC
DCI01_0040_H10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGA*CCATATGTTTACCACTGGACA
DCI01_0057_C11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACC*ATATGTTTACAACTGGACA
DCI01_0058_B04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0057_F03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0058_G04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0025_F09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0057_B05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0023_A12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGANCCATATGTTTTACACTGGACA
DCI01_0037_C01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGGTTACAACTGGACA
DCI01_0026_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTCTACAACTGGACA
DCI01_0017_F01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*AT*CCCCGACCCATATGTTTACAACTGGACA
DCI01_0032_F03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0102_H05.b : AGAAGAACTGCANGAATGATTCTGGGCC*ATCCCCCGA*CCATATGTTTACNACTGGACA
DCI01_0037_F06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0032_E10.b : AGAAGAACTGCAGAAATGATTCTAGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0028_H06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0026_E06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0018_G12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0103_H03.b : AGAAGAACTGCAGAAATGATTCTGGGCCCATCCCCCGACCCATATNGTTACNACTGGACG
DCI01_0041_E01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0007_B06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0017_G10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0033_H09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0010_B02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGATCCATATGTTTACAACTGGACA
AMP01_0051_G04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ACCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0028_D11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0017_D07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0093_D05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0028_G04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0036_C06.b : AGAAGAACTGCAGATATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0013_A05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0036_C08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCC*GACCCATATGTTTACAACTGGACA
DCI01_0034_E12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCGTATGTTTACAACTGGACA
AMP01_0026_F02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0023_C03.b : AGAAGAACTGTAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0014_D03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0016_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0016_C02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0022_H03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0028_E07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0024_D08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0004_C04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0041_D11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0019_H09.b : AGAAGAGCTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0025_F03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0018_H12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0079_E05.b : ACAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACCACTGGACA
AMP01_0016_D03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0015_H11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0109_F05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0033_F05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0090_B04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0017_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0082_C06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0009_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0108_E12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0115_F04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0024_G06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0092_E04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0012_G10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0017_A10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0077_H05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCC*GACCCATATGTTTACAACTGGACA
DCI01_0109_B11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0057_H07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0029_E04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0077_F03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0015_H05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0096_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0092_E01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0008_B05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0098_D08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0085_H11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0010_A04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0063_G06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0019_D05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0016_F06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0070_G08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0065_B05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0065_A06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0058_F09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0066_D11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0064_D07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0099_D03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0104_F11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0070_G11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0087_F08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0113_G08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0089_B06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0113_F07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0089_A01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0109_G01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0116_H07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0082_D12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0066_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0042_F07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCCTATGTTTACAACTGGACA
DCI01_0007_E11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0007_F05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0070_G09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0066_E08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0069_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCTCGACCCATATGTTTACAACTGGACA
DCI01_0110_D12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0025_A12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0094_H06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0061_B02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0053_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
OVRM1_0131_B05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0040_A02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*AT*CCCCGACCCATATGTTacactggacagc
DCI01_0104_H06.b : AGGAGAACTGCATATCTGATTCTGGGCC*ATCCGCCGACC*ATATGTCTACAACTGGACA
DCI01_0059_F03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0016_D11.b : GGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0118_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0085_H02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0108_H04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0083_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0070_C11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0081_H07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACTCATATGTTTACAACTGGACA
DCI01_0087_F09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0034_C07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0088_F09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0084_A01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0036_F02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCCGACCATATGTTTACAACTGGACA
DCI01_0071_H07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGA*CCATATNGTTAC*ACTGGACA
DCI01_0118_B09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0068_E08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCTTATGTTTACAACTGGACA
DCI01_0112_E09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0091_F07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0070_G02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0107_D05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0013_G03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0028_A02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACC*ATATGTTTTACACTGGACA
DCI01_0028_F02.b : AGAAGAACTGCAGAAATGATTCTGGGGC*ATCCCCCGA*CCATATNGTTAC*ACTGGACA
DCI01_0028_H07.b : AGATGAACTGCAGATATGATTCTGGGCC*ATCCGCCGACCCATATGTCTACAGCTGGACA
DCI01_0058_H12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0026_A10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTTACACTGGACA
DCI01_0038_G06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0070_E07.b : AGAAGAACTGCACAAATGATTCTGCGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0028_G12.b : AGAAGAACTGCATATATGATTCTGGGCC*GTCCCTCGACCCATATGTTTACTACTGGACA
DCI01_0057_B10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTT*ACAACTGGACA
DCI01_0058_C03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0028_H03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACC*ATATGTTTACA*CTGGACA
DCI01_0058_C06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0035_F09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACTACTGGACA
DCI01_0058_B05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0059_D12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0032_E02.b : AGAAGAACTGCAGAAATGATTCTGGGGC*ATCCCCCGACC*ATATGTTTACNACTGGACA
DCI01_0081_H12.b : AGAAGAACTGCAGAAATGATTCTGGGGC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0058_B09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0039_A03.b : AGAAGAACTGCAGAAATGATTCTGGGGCCATCCCCCGA*CCATATGTTTACAACTGGACA
DCI01_0033_C02.b : AGAAGAACTGCAGAGATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0027_A12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGAC*CATATGTTTAC*ACTGGACA
DCI01_0035_H02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTTCAACTGGACA
DCI01_0032_F12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACCACTGGACA
DCI01_0036_E02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATNGTTTACACTGGACA
DCI01_0012_B11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0032_B07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*CATCCCCGACCCATATGTTTACAACTGGACA
DCI01_0029_H03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGANCCATATGTTTACAACTGGACA
DCI01_0033_A09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0034_G12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0032_D07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACC*ATATGTTTACAACTGGACG
DCI01_0106_C12.b : AGAAGAACTGCAGAAATGATTCTGGGGC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0023_B10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0031_G04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0027_B10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0025_B04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACNACTGGACA
DCI01_0030_H07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0027_G01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGNTTACAACTGGACA
DCI01_0026_D04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0036_C09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATACGTTTANCACTGGACA
DCI01_0017_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0019_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0031_D03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0025_B05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0035_A08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0011_H09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0026_C08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0017_C01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0031_A06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0018_D09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0025_A04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0031_H06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0036_A06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0011_G10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0020_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0037_G07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0017_H02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0038_C05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0029_C05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0029_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0066_H06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0033_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0013_E03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0031_C04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0037_B03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0016_G09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0008_A03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0019_C04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0106_F10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATNGTTACAACTGGACA
DCI01_0022_C01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0009_E08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0013_E06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0090_C01.b : AGAAGAACTGCATAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACCGGACA
DCI01_0107_B03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0107_E06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0031_G12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0047_F08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0069_A01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0012_G03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0011_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0035_C06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0027_H12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0117_D08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0013_C11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0117_B04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0003_D06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0082_G03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0111_C08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0115_D03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0103_G10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0020_D12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0016_G07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0064_C01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0005_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0101_H03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGA*CCATATGNNTTACACTGGACA
DCI01_0102_A05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0021_G05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0019_H05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0097_H11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0113_A06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0114_D10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0016_D04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0117_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0010_D04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0014_E10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0008_E08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0014_A11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0114_D07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0109_G06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0103_E12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0075_D06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0086_E02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0018_G07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0069_D05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0091_G06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0115_H03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0076_F08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0015_H03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0020_B12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0091_G05.b : AGAAGAACTGCAGAAATGATCCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0099_E12.b : AGAAGAACTGCAGAAATGATCCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0106_G09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0011_E09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0097_F02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0086_F05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0106_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0095_G02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0098_H06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0117_E04.b : AGAAAAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0012_G07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0016_E03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0075_H06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0063_G05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0063_A11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0096_F10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0014_F11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0015_H11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0012_E09.b : AGAAGAACCGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0065_G03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0077_F09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0092_B02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0087_G06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0097_F05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0109_D01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0084_C04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0094_C03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0097_B08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0067_G08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0102_G12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGA*CCATATGTTTACAACTGGACA
DCI01_0096_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0099_F05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0104_A06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0063_B04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0099_A11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0068_G10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0061_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0079_E10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0063_G01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0092_D05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0094_D03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0010_C08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0079_H01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0116_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0112_G10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0070_G07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0090_F04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0102_B11.b : AGAAGAACTGTAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTANCACTGGACA
DCI01_0093_B04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0086_C03.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0093_H05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0111_G06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0113_F08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0112_E10.b : AGAAGAACTGCAGAAATGATCCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0094_B06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0095_E10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0113_H09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0115_C02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0097_H05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0023_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0090_E12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0110_B09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0080_E08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0100_A11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0085_D11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0084_F08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTT*ACAACTGGACA
DCI01_0015_F05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0112_D01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0045_C01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0100_G04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0073_E02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0101_C04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0061_E05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0011_A07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0069_H09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0077_D05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0004_H02.b : AGAAGAACTGCGGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0093_A02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0100_F02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0014_H10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0002_G01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0086_D12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0031_F11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0061_D08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0099_E09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0099_C11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0064_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0062_D11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0015_G01.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0074_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0066_B12.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0087_E11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0064_F08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0057_C12.b : AGAAGGACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0111_C04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0080_A06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0067_E11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0021_D04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0057_B04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0013_D06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATATTTACAACTGGACA
AMP01_0013_C05.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0101_C06.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0097_C09.b : AGAAGAAATGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0078_F01.b : AGAAGAAATGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0071_A06.b : AGAAGAAATGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0092_H11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
KDN01_0056_D08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0071_D09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGGTTACCACTGGACA
DCI01_0068_B09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0065_C09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0012_C07.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0002_H04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0082_C08.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0109_A09.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0086_D02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0078_C10.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0001_E04.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
AMP01_0092_A11.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
DCI01_0042_C02.b : AGAAGAACTGCAGAAATGATTCTGGGCC*ATCCCCCGACCCATATGTTTACAACTGGACA
20110601C-007008 : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
---------+---------+---------+---------+---------+---------+ 732
DCI01_0043_E03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACC*GCCAAAGCCTTCAC*ACGT*GTT
DCI01_0114_F01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0065_E04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0034_B06.b : GCATGAACAGAGAACA*TGACTGGAAAGATGGCACCACCCAAGGCatcacaccgtgttcc
DCI01_0012_C02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAAGCCATCACAACGT*GTT
DCI01_0021_F12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAAGCCGTCACAACGT*GTT
DCI01_0021_B07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0008_D03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0103_G02.b : GCATGGACAGAAGAACATGACTGGAGAGATGGCACCCAGCCAGGCCATCANCACGT*GTT
DCI01_0104_E11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAAGGCATCACAACGTGGTT
DCI01_0117_F10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0099_E02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0062_H02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0068_D09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0081_D08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0088_F11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0110_G05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0071_F05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0007_G07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0025_G05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0093_C09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0009_F01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0019_E11.b : GCATGGACAGAGAACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0012_H09.b : agcctggtaatattattatgacttgttacttcacccttgccccagccatttcacaggact
AMP01_0013_F02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0089_C06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0018_C04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0070_A10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0056_B08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0024_F07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0054_D03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0032_A03.b : GCATGGACAGANNGACATGACTGGAGAGATGGGCACAGCCAAGGCCATCACAACGT*GTT
DCI01_0043_B07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCACAACGT*GTT
AMP01_0012_D01.b : GCATGGACAGAGGACACTGACTGGAGATATGGCTccctccaatgccatctcaaattgctt
AMP01_0020_B12.b : GCATGGACAGAGGACAATGACTGGATAGATGGCACCTGCCAAGGCCTTCACAACCT*GTT
DCI01_0026_F02.b : GCATGGACAGAAGGACATGACTGGAGAGATGGCACCAG*CAAAGCCATTCCCACGT*GGT
AMP01_0013_G11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCTAGGCCATCACAACGT*GTT
DCI01_0031_H12.b : GCATGAACAGAAGACATTAACTGGAGAGATGGCACCAGCCAAGCCCTTCACAA*GT*GGT
DCI01_0040_G11.b : GCATGGACCGANGACCATGACTGGAGAGATGGCACCAGCCAAGGCCATC*CCACGT*GTT
DCI01_0040_H10.b : GCATGGACAGAGGAC*ATGACTGGAGAGATGGCACCGCCCAGGCCCATC*CAACGT*GTT
DCI01_0057_C11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCNAGGCCATCACAACGT*GGT
DCI01_0058_B04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0057_F03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0058_G04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0025_F09.b : GCATGAACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*TGT
DCI01_0057_B05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGTGTTT
DCI01_0023_A12.b : GCATGGACAAGAGGACATGACTGGAGAGATGGCAACAGCCAAGGCCATCACAACGT*GTT
DCI01_0037_C01.b : GCATGGACAGAGGAACATGACTGGAGAGATGGCACCAGCCCAAGCCATCANCACGT*GTT
DCI01_0026_A07.b : GCATGGACAGAAGACAATGACTGGAGAGATGGCACCAGTCAAAGCCATCACAACGT*GTT
DCI01_0017_F01.b : GCATGGACAGAGGGACATGACTGGAGAGATGGCAC*AGCCNAGGCCATCANCACGT*GTT
DCI01_0032_F03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0102_H05.b : GCATGGACAGAGGGACATGACTGGAGAGATGGCACCAGCCAAAGCCATCANCACGT*GGT
DCI01_0037_F06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCACAACGT*GTT
DCI01_0032_E10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0028_H06.b : GCATGGACAGAGGACTATGACTGGAGAGATGGCACCAGCCAAAGCCATCACAACGT*GTT
DCI01_0026_E06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0018_G12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0103_H03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGGCATCANCACGT*GTT
DCI01_0041_E01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAAGCCATCACAACGT*GTT
AMP01_0007_B06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0017_G10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0033_H09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAAGGCATCANCACGT*GTT
DCI01_0010_B02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0051_G04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0028_D11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0017_D07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGGCATCACAACGT*GTT
AMP01_0093_D05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0028_G04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0036_C06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGTACCAGTCCAGGCCATCANCACGT*GTT
DCI01_0013_A05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0036_C08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0034_E12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0026_F02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0023_C03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0014_D03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0016_A07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0016_C02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0022_H03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0028_E07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0024_D08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0004_C04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0041_D11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0019_H09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0025_F03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0018_H12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0079_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAATGCCATCACAACGT*GTT
AMP01_0016_D03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0015_H11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0109_F05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0033_F05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0090_B04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0017_A07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0082_C06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0009_A07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0108_E12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0115_F04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0024_G06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0092_E04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0012_G10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0017_A10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0077_H05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0109_B11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0057_H07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0029_E04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0077_F03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0015_H05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0096_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0092_E01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0008_B05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0098_D08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCAACACAACGT*GTT
DCI01_0085_H11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0010_A04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0063_G06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0019_D05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0016_F06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACAT*GTT
DCI01_0070_G08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0065_B05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0065_A06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0058_F09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCTGCCAAGGCCATCACAACGT*GTT
DCI01_0066_D11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0064_D07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0099_D03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0104_F11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCGGCCCAGGCCATCANCACGT*GTT
DCI01_0070_G11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0087_F08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0113_G08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0089_B06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0113_F07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0089_A01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0109_G01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0116_H07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0082_D12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0066_A07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0042_F07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0007_E11.b : GCATGGACAGAGGACGATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0007_F05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0070_G09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0066_E08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0069_A07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0110_D12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0025_A12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0094_H06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0061_B02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0053_A07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
OVRM1_0131_B05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0040_A02.b : tggacagagacatgactgagagatggcacagccaggccatcacacgtgtcccctgacgga
DCI01_0104_H06.b : GCATGCACAGAGAAC*ATGACTGGAGAGATgcaccagctangncatcacatcgtgttccc
DCI01_0059_F03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0016_D11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0118_A07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0085_H02.b : GCATGGACAGAGGACAATGGCTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0108_H04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGGCATCANCACGT*GTT
AMP01_0083_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0070_C11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0081_H07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0087_F09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0034_C07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0088_F09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0084_A01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0036_F02.b : GCATGGACAGAAGGACATGACTGGAGAGAGGGCACCAACCAAGCCATcacaacgtgtccc
DCI01_0071_H07.b : GCATGGACAGNAGGTCATGACTGGAGAGATGGCACCCAGCCAGGCCATCACAACGT*GTT
DCI01_0118_B09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0068_E08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0112_E09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0091_F07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0070_G02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0107_D05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0013_G03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0028_A02.b : GCATGGACAGAGGACAATGACTGAAAAGATGGCACAACCCAAGGCatcccacctggttcc
DCI01_0028_F02.b : GCATGGACAGANGACNATGACTGGAGAGATGGCACCAGCCAAAGGCATCANCACGT*GTT
DCI01_0028_H07.b : GTATGGACATAGGACAATGACTGGAGAGATGGCACCAGCCCAAGCCATCACACAGT*GTT
DCI01_0058_H12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0026_A10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAAGCCATCACAACGT*GTT
DCI01_0038_G06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCNAAGGCATCACAACGT*GTT
DCI01_0070_E07.b : GCATGGGCACAGGACCATGACTGGAGAGATGGCGCCAGCCCAGGCCATCACAACGT*GTT
DCI01_0028_G12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAACCTACGCCATCACAACGT*GTG
DCI01_0057_B10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0058_C03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0028_H03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGC*ATCANCACGT*GTT
DCI01_0058_C06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCNACCAGCCAGGCCATCACAACGT*GTT
DCI01_0035_F09.b : GCATGTACAGAGGAACATGACTGGAGAGATGGCTACAGCCCAAGCCATCACAACGT*GTT
DCI01_0058_B05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0059_D12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0032_E02.b : GCATGGACAGNAGAACATGACTGGAGAGATGGCACCAGCAAAGGCCATCACAACGT*GTT
DCI01_0081_H12.b : GCATGGACAGAGGAACATGACTGGAGAGATGGGCACCAGCAAGGCCATCACAACGT*GTT
DCI01_0058_B09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0039_A03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCA*CCAAGGCCATCACCACGT*GTT
DCI01_0033_C02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0027_A12.b : GCATGGACAGAGGACNATGACTGGAGAGATGGCACCAGCCAAGGC*ATCAACACGT*GTT
DCI01_0035_H02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0032_F12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0036_E02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAAGCCATCACAACGT*GTT
DCI01_0012_B11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAAGCCATCACAACGT*GTT
DCI01_0032_B07.b : GCATGGACAGAGGAACATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0029_H03.b : GCATGGACAGANNGACATGACTGGAGAGATGGCACCAGCCA*GGCCATCANCACGT*GTT
DCI01_0033_A09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0034_G12.b : GCATGGACAGAGGAACATGACTGGAGAGACGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0032_D07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCNAGGCCATCACAACGTGTTC
DCI01_0106_C12.b : GCACGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCANCACGT*GTT
DCI01_0023_B10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0031_G04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCNAGGGCATCANCACGT*GTT
DCI01_0027_B10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAAGCCAGGCCATCANCACGT*GTT
DCI01_0025_B04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0030_H07.b : GCATGGACAGAGGACAATGACTGGAGAGATAGCACCCAGCCAGGGCATCANCACGT*GTT
DCI01_0027_G01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCACAACGT*GTT
DCI01_0026_D04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0036_C09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAAGCCATCACAACGT*GTT
DCI01_0017_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0019_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCNAGGCCATCACAACGT*GTT
DCI01_0031_D03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0025_B05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0035_A08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0011_H09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0026_C08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0017_C01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCACAACGT*GTT
DCI01_0031_A06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0018_D09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAAGCCATCACAACGT*GTT
DCI01_0025_A04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACGACGT*GTT
DCI01_0031_H06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCNAGGCCATCACAACGT*GTT
DCI01_0036_A06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0011_G10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0020_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0037_G07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0017_H02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0038_C05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0029_C05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCCAGCCAGGCCATCACAACGT*GTT
DCI01_0029_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0066_H06.b : GCATGGACAGAGGACAATGACTGAAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0033_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0013_E03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0031_C04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0037_B03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0016_G09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0008_A03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0019_C04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0106_F10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGGCATCANCACGT*GTT
DCI01_0022_C01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0009_E08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0013_E06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0090_C01.b : GTATGGACACAGGACAATGACTGGAGAGATGGCACCAGCCATCGCCATCACGACGT*GTA
DCI01_0107_B03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0107_E06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCACAACGT*GTC
DCI01_0031_G12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
AMP01_0047_F08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0069_A01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0012_G03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0011_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0035_C06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
AMP01_0027_H12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0117_D08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0013_C11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0117_B04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0003_D06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0082_G03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0111_C08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0115_D03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0103_G10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCANCACGT*GTT
DCI01_0020_D12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0016_G07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0064_C01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0005_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0101_H03.b : GCATGGACAGANNGACATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0102_A05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0021_G05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0019_H05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0097_H11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCCAGCCAGGCCATCACAACGT*GTT
DCI01_0113_A06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0114_D10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0016_D04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0117_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0010_D04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0014_E10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0008_E08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0014_A11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0114_D07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0109_G06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0103_E12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAGGGCCATCACAACGT*GTT
DCI01_0075_D06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0086_E02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0018_G07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0069_D05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0091_G06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0115_H03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0076_F08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0015_H03.b : GCATGGACAGAGGACAATGACTGAAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0020_B12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0091_G05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0099_E12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0106_G09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0011_E09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0097_F02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0086_F05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0106_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0095_G02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0098_H06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0117_E04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0012_G07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0016_E03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0075_H06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0063_G05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0063_A11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*CTT
DCI01_0096_F10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0014_F11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0015_H11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GCT
DCI01_0012_E09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0065_G03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0077_F09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0092_B02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0087_G06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0097_F05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0109_D01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0084_C04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0094_C03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0097_B08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0067_G08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0102_G12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCACAACGT*GTT
DCI01_0096_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0099_F05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0104_A06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCCAGGCCATCACAACGT*GTT
DCI01_0063_B04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0099_A11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0068_G10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0061_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0079_E10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0063_G01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0092_D05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0094_D03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0010_C08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0079_H01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0116_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0112_G10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0070_G07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0090_F04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0102_B11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCNAGGCCATCANCACGT*GTT
DCI01_0093_B04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0086_C03.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0093_H05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0111_G06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0113_F08.b : GCATGGACAGAGGGCAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0112_E10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAATGT*GTT
DCI01_0094_B06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0095_E10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0113_H09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0115_C02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0097_H05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0023_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0090_E12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0110_B09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0080_E08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0100_A11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0085_D11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0084_F08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0015_F05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0112_D01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0045_C01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0100_G04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0073_E02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0101_C04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCGTCACAACGT*GTT
DCI01_0061_E05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0011_A07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0069_H09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0077_D05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0004_H02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0093_A02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAGGGCCATCACAACGT*GTT
DCI01_0100_F02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0014_H10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0002_G01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0086_D12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0031_F11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGTCATCACAACGT*GTT
DCI01_0061_D08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0099_E09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0099_C11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0064_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0062_D11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0015_G01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0074_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0066_B12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0087_E11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0064_F08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0057_C12.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0111_C04.b : GCATGGACAGAGGGCAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0080_A06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0067_E11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0021_D04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0057_B04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACTAGCCAAGGCCATCACAACGT*GTT
DCI01_0013_D06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGTACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0013_C05.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0101_C06.b : GCGTGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCANCACGT*GTT
DCI01_0097_C09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0078_F01.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0071_A06.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0092_H11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
KDN01_0056_D08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0071_D09.b : GCCTGGACAGAAGACCATGACTGGAGAGATGGCAACAGCCAAGGGCATCACCACGT*GTT
DCI01_0068_B09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0065_C09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0012_C07.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0002_H04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0082_C08.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0109_A09.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0086_D02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0078_C10.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0001_E04.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
AMP01_0092_A11.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
DCI01_0042_C02.b : GCATGGACAGAGGACAATGACTGGAGAGATGGCACCAGCCAAGGCCATCACAACGT*GTT
20110601C-007008 : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
---------+---------+---------+---------+---------+---------+ 788
DCI01_0043_E03.b : CCCCGACGGG*AACCTTTCC*CTCACCCC**TGGAAcggattttcgtccacgtattcaca
DCI01_0114_F01.b : CCCTGACGGG*AAGCCTTCC*CCTCACCC**TGAAACGGA*ATTNCG*TCTACGTATTC*
DCI01_0065_E04.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0034_B06.b : tgacgggaagctttccctcacccctgaaaacgaattttctccactattccacaccttggt
DCI01_0012_C02.b : CCCTGACGGG*AAGCCTTCC*C**TCACCCTGGAAACGGA*ATTTCG*TCTACGTATTC*
DCI01_0021_F12.b : CCCTGACGGG*AAGCCTTTC*CCTCAACCCCTGAAAAGGA*ATTTCG*TCTACGTATTCC
DCI01_0021_B07.b : CCCTGACGGG*AAGCCTTTT*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTTC
AMP01_0008_D03.b : CCCTGACGGG*AAGCCTTTC*CCTC*CCCCTGGAAACGGA*ATTTCG*TCTACGTAATTC
DCI01_0103_G02.b : CCCTGACGGG*AAGCCTTNC*CCTCACCCCTTGGAACNGA*AATTCGGTCTACGTATTCC
DCI01_0104_E11.b : CCCTGACGGG*GAGCCTTTCCCCTCACCCCTGGAAACGGA*TTTTCG*TCTACGTATTCT
DCI01_0117_F10.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0099_E02.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0062_H02.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0068_D09.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0081_D08.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCT
DCI01_0088_F11.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAATGGA*ATTTCG*TCTACGTATTCC
DCI01_0110_G05.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0071_F05.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0007_G07.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0025_G05.b : CCCTGACGGG*AAGCCTTTC*C*TCACCCCTGGAAAC*GA*ATTTCG*TCTACGTATTCC
DCI01_0093_C09.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0009_F01.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0019_E11.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0012_H09.b : cacgcatacatcttattccctccctcttctcacccctattcccttcatctcccctcctcc
AMP01_0013_F02.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0089_C06.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0018_C04.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0070_A10.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACATATTCC
AMP01_0056_B08.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0024_F07.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0054_D03.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0032_A03.b : CCCTGACGGN*AAGCCTTTT*CCTCACCCCTGGAAAC*GA*ATTTCG*TCTACGTATTC*
DCI01_0043_B07.b : CCCTGACGGG*AAGCCTTTT*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
AMP01_0012_D01.b : ccctgacttgaatgcttttccctcctccttgtatatgtccttccttctacttattcacca
AMP01_0020_B12.b : CCCTGACGGG*AAGnntttggggggcggcaaaaaacatacttcttttccccnttttacta
DCI01_0026_F02.b : CCCTGACGGA*AACCCTTTC*C*TCACCCCTGGAAACGaattccgtctacctattcccca
AMP01_0013_G11.b : CCTTGACGGG*AAGCCTTTC*CTCACCCCCTGGAAactttaatttccttctcgtattcca
DCI01_0031_H12.b : CCCTGACGGG*AAGC*TTTC*CCTCACCCCTGGAAACGGA*ATTTCtccaacgttttccc
DCI01_0040_G11.b : CCCTGACGGA*AACCCTTTC*CTCCCCCCCGGAAAACGGA*TTTTCtcctactatccccc
DCI01_0040_H10.b : CCCTGACGGG*AAGTCTTTC*CC*CCCCCCCGGAAACCGA*ATTTCctcctacctatccc
DCI01_0057_C11.b : CCCTGACGGG*AAGCCTTTC*C*TCNACCCTGGAAACGNA**TTTCG*TCTACGTATcca
DCI01_0058_B04.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGGAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0057_F03.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0058_G04.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0025_F09.b : TCCTGACNGGAAAGCCTTTC*CCTCACCCTTGAAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0057_B05.b : CCCTGACGGG*AAGCCTTTC*CCTCACCCCTGGAAACGGA*ATTTCG*TCTACGTATTCC
DCI01_0023_A12.b : CCCTGACGGG*AAGCCTTTC*CCTCCACCCTGGAAACGGA*ATTTCG*TCTACGTATTC*
DCI01_0037_C01.b : CCCTGACGGA*AAGCCTTTC*CCTCACCCCTGGAA*CGGA*AATTCG*TCTACGTATTC*
DCI01_0026_A07.b : CCCTGACCGGGAAGCCTTTC*CCTCACCCCTGG