[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007128

Length: 1,741

Sequence [FASTA format sequence]
CTGGATGATT GAAGGTGACC CAGGAACTGA AAGGATGAAA ATGCAACCTG ACTCTCCCAG
AACCCAGGAA GTTAATAAGA AGCTCTAAAT GCCCTCGAAT TCCAGACCCT GTTCCCTATA
GGTAAAAGAT CATACTTTTT GCTGTTTTAG GGCTTGCTTT CTGCTCTGTA CAAAACTTTG
TGGAAGGGGA AAAACAGGCC CCTGAGTATG TGCCTCTATG CTTGAAACTT CTTGAAACTA
CTTGAGATAA CAGGGAAAGG GTTCCTAACT GCTTGTTTGG CTTCTGTAAA CCTGCTTGCA
TAAGATAAAA AGAGGAGAAG TCAATCGCCT AACCGACCCC AGTAAGATCG GGCGTGCCAC
AAAATGTTGA AAATTCTGAT AAATATATCT TGGCGACAAC ATGTCTCCCC TGCCCAGGAA
CAGGCACAAA CATGTAACTC CAAAACAATT TAAATTAATT GGTCCACAAA GCGCAGGCTC
TCGATGTTTT AAAATGATTG GTTTGTGAAG TGCGGGCTTT GTTGTGAACC CCATAAAAGC
TGTCCCGACT CCGCACTAGG GGCCACAGTC CTCTACCCCT GCGTGGCGTA TGACTGTGAG
CCCCAGCGCG CTTGGAATAA TCCTCTTGCT GTTTGCATCA AGACCGCTTC TCCTGAGTGA
TTTGGGGTGT CGCCTCTTCC GAGTCCAGAC GAGGGGGATT TTCCTTCTGC TGGCCTTTCA
TTTGGTGCGT TGGCCGGGAA ACCCCGCGAC CACCCCTCAC ACCCAAGAAC CGACTTGGAG
GTAAAGGGAT CCCCTTTGGA ATGTGTGTGT GCGTGCCGGC CGGCGTCTCT GTTCTGAGTG
TCTGTTTTCG GTGATGTGCG CTTTCAGTTT GCAGCTGTCC TCTCAGACCG TAAGGACTGG
GGGACTGTGA TCAGCAGACG TGCTAGGAGG ATCACAGGCT GCCACCCTGG GGGACGCCCC
GGGAGCTGGG GAGAGCCAAG GACGCCTGGT GGTCTCCTTC TGTCGGTCAG AGGACCGAGT
TCTGTTGTTG AAGCAAAAGC TTCCCCCTCC GCGGCCGTCT GACTCTTTTG CCTGCTTGTG
GAAGGCGCGG ACGGGTCGCG TGTGTCTGGA TCTGTTGGTT TCTGTTTCGT GTGTCTTTGT
CTTGTGCGTC CTTGTCTACA GTTTTAATAT GGGACAGACG GTGACGACCC CCCCTTAGTT
TGACTCTCGA CCATTTGGAC TGAAGTTAAA TCCAGGGCTC ATAATTTGTC AGTTCAGGTT
AAGAAGGGAC CTTTAATTCT GAGATTATCC TGGCTGTTAA AGCAAATATT TTTCAGACTG
GACCCGGCTC TCATCCTGAT CAGGAGCCCT ATATCCTTAC ATGGCAAGAT TTGGCAGAAG
ATCCTCCGCC ATGGGTTAAA CCATGGCTAA ATAAACCAAG ATAGCCAGGT CCCCAAGTTC
TGGCTCTTGG AGAGAAAAAC AAACACTCGG CTGAAAAAGT CAAGCCCTCT CCTCATATCT
ACCCCGAGAT TGAGGAGCCG CCGGCTTGGC CGGAACCCCA ATCTGTTCCC CCACCCCCTT
ATCCGGCACA GGGTGCTGCG AGGGGACCCT CTGCCCCTCC TGGAGCTCCA GCGGTGGAGG
GACCTGCTGC AGGGACTCGG AGCCGGAGGG GCGCCACCCC GGAGCGGACA GACGAGATTG
CGACATTACC GCTGCGCACG TACGGCCCTC CCATACCGGG GGGGCAATTG CAGCCCCTCC
A


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC610863PREDICTED: similar to USP6 N-terminal like [Canis familiaris]. 54.73e-07O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100515331PREDICTED: hypothetical protein LOC100515331 [Sus scrofa]. 1041e-22O
Contig/Assembly ProteinLOC100620387PREDICTED: MORN repeat-containing protein 5-like, partial [Sus scrofa]. 81.61e-15O


Assembly Members: 27      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10127F07BFLT1_0127_F07.bHX203981 
CLNT10116H10CLNT1_0116_H10.bHX220430 
KDN010099D08KDN01_0099_D08.b  
LNG010010F08LNG01_0010_F08.bBP438545 
LVR010019B07LVR01_0019_B07.bBP442336 
LVRM10018E10LVRM1_0018_E10.bBP451985 
LVRM10092D08LVRM1_0092_D08.bCJ003379 
LVRM10111D12LVRM1_0111_D12.bBP451346 
MLN010022H04MLN01_0022_H04.bCJ009350 AK394412
OVRT10101H08OVRT1_0101_H08.bHX234907 
OVRT10134D04OVRT1_0134_D04.bHX237530 
PBL010036G07PBL01_0036_G07.bBP156312 AK348827
PCT010004B10PCT01_0004_B10.bFS694847 
PCT010004G05PCT01_0004_G05.bFS694889 
PCT010010H03PCT01_0010_H03.bFS695348 
PST010002F09PST01_0002_F09.bFS697185 
PST010017B10PST01_0017_B10.bFS698297 
PST010041G10PST01_0041_G10.bFS700080 
PST010049F03PST01_0049_F03.bFS700713 
PST010050H03PST01_0050_H03.bFS700816 
PST010062H03PST01_0062_H03.bFS701773 
PST010079H10PST01_0079_H10.bFS703123 
SPL010097B12SPL01_0097_B12.bCJ021731 
TCH010014D04TCH01_0014_D04.bCJ023467 
THY010006C01THY01_0006_C01.bBP161835 AK238608
UTR010044B09UTR01_0044_B09.bBP170281 
UTR010070E01UTR01_0070_E01.bBP463844 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
350A300.143W-
G1620.857
653C1600.762WNCTG/L
G410.238GTG/V
857C210.273W-
T800.727
955C400.571W-
T210.429
979A300.600W-
G200.400


Alignment:      TOP

20110601C-007128 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b : nnnnnnnnnnnnnnnnnnnnnnnnnttttnnnnnnnnncccgcctccccctagcctxxxx
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b : ntttccgtggacttgacagttt
UTR01_0044_B09.b : tggttgacxxxxxxxxxxxxxxx
SPL01_0097_B12.b : nnntttgcttgtgacttnacxxx
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : ......................................................CTGGAT
---------+---------+---------+---------+---------+---------+ 6
PBL01_0036_G07.b : naaagtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGAT
LVRM1_0092_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtAT
MLN01_0022_H04.b : gtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtAT
UTR01_0044_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
SPL01_0097_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0111_D12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0002_F09.b : cgatttannnnnnncctgacgttggcactgg
PST01_0050_H03.b : nnnccagctgtggctacggagt
PST01_0062_H03.b : tttcctgcgttggctct
PST01_0017_B10.b : ggctctgg
THY01_0006_C01.b : xxxxxxxxxxxxxxxxxxxgagctgaatgaggatgagggttgggagcaaaagagcagtat
PST01_0079_H10.b : nnncctgcgttg
BFLT1_0127_F07.b : nnnnnacgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0101_H08.b : nnnnccgtcagctgtggxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0134_D04.b : nnnccgtttacnnnnnnnnccgttctgcttacgagtgxxxxxxxxxxxxxxxxxxxx
PST01_0049_F03.b :
LVR01_0019_B07.b : cctttttgtggacxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0010_F08.b : ccxxxxxxxxxxxxxxx
CLNT1_0116_H10.b : nnng
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : GATTGAAGGTGACCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
---------+---------+---------+---------+---------+---------+ 66
PBL01_0036_G07.b : GATTGAAGGTGACCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
LVRM1_0092_D08.b : GATTGAAGGTGACCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
MLN01_0022_H04.b : GATTGAAGGTGACCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
UTR01_0044_B09.b : GATTGAAGGTGACCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
SPL01_0097_B12.b : GATTGAAGGTGACCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
LVRM1_0111_D12.b : xxxxGAAGGTGACCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
PST01_0002_F09.b : agattgAGGTGACCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
PST01_0050_H03.b : agattgAGGTGACCCAGGGACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
PST01_0062_H03.b : ggagatgaggtgaCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
PST01_0017_B10.b : atgattgaggtgaCCAGGAACTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
THY01_0006_C01.b : gattgaaggtgacccaggaacTGAAAGGATGAAAATGCAACCTGACTCTCCCAGAACCCA
PST01_0079_H10.b : gctctgggaggtgaccaggaactgAAGGATGA*AATGCAACCTGACTCTCCCAGAACCCA
BFLT1_0127_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxctgtAAAATGCAACCTGACTCTCCCAGAACCCA
OVRT1_0101_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCAACCTGACTCTCCCAGAACCCA
OVRT1_0134_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCAACCTGACTCTCCCAGAACCCA
PST01_0049_F03.b : cacgttggctctgggaaatgcACCTGACTCTCCC*GAACCCA
LVR01_0019_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCCAGAACCCA
LNG01_0010_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0116_H10.b : gctatagctgtagagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0041_G10.b : nttactgac
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
---------+---------+---------+---------+---------+---------+ 126
PBL01_0036_G07.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
LVRM1_0092_D08.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
MLN01_0022_H04.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
UTR01_0044_B09.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
SPL01_0097_B12.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
LVRM1_0111_D12.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
PST01_0002_F09.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
PST01_0050_H03.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
PST01_0062_H03.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCC*ATAGGTAAA
PST01_0017_B10.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCC*ATAGGTAAA
THY01_0006_C01.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
PST01_0079_H10.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCC*ATAGGTAAA
BFLT1_0127_F07.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
OVRT1_0101_H08.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
OVRT1_0134_D04.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
PST01_0049_F03.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
LVR01_0019_B07.b : GGAAGTTAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
LNG01_0010_F08.b : xxxxxxxAATAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
CLNT1_0116_H10.b : xxxxxxxxxTAAGAAGCTCTAAATGCCCTCGAATTCCAGACCCTGTTCCCTATAGGTAAA
PST01_0041_G10.b : tgtggctatggatagagctctAATGCCCTCGAATTC*AGACCCTGTTCCCTATAGGTAAT
KDN01_0099_D08.b : nnnnncctgcggttgctctggaatgccctcaattCAGACCCTGTTCCCTATAGGTAAA
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
---------+---------+---------+---------+---------+---------+ 186
PBL01_0036_G07.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
LVRM1_0092_D08.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
MLN01_0022_H04.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
UTR01_0044_B09.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
SPL01_0097_B12.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
LVRM1_0111_D12.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
PST01_0002_F09.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
PST01_0050_H03.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
PST01_0062_H03.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
PST01_0017_B10.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
THY01_0006_C01.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
PST01_0079_H10.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
BFLT1_0127_F07.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTCTCTGCTCTGTACAAAACTTTGTGGAAG
OVRT1_0101_H08.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
OVRT1_0134_D04.b : AGATCATACTTTTTG*TGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
PST01_0049_F03.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
LVR01_0019_B07.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
LNG01_0010_F08.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
CLNT1_0116_H10.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
PST01_0041_G10.b : A*ATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
KDN01_0099_D08.b : AGATCATACTTTTTGCTGTTTTAGGGCTTGCTTTCTGCTCTGTACAAAACTTTGTGGAAG
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
---------+---------+---------+---------+---------+---------+ 246
PBL01_0036_G07.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
LVRM1_0092_D08.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
MLN01_0022_H04.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
UTR01_0044_B09.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
SPL01_0097_B12.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
LVRM1_0111_D12.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
PST01_0002_F09.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
PST01_0050_H03.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
PST01_0062_H03.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
PST01_0017_B10.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
THY01_0006_C01.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACCTGAG
PST01_0079_H10.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
BFLT1_0127_F07.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
OVRT1_0101_H08.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
OVRT1_0134_D04.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
PST01_0049_F03.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
LVR01_0019_B07.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
LNG01_0010_F08.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
CLNT1_0116_H10.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
PST01_0041_G10.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
KDN01_0099_D08.b : GGGAAAAACAGGCCCCTGAGTATGTGCCTCTATGCTTGAAACTTCTTGAAACTACTTGAG
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
---------+---------+---------+---------+---------+---------+ 306
PBL01_0036_G07.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
LVRM1_0092_D08.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
MLN01_0022_H04.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
UTR01_0044_B09.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
SPL01_0097_B12.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
LVRM1_0111_D12.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
PST01_0002_F09.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
PST01_0050_H03.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
PST01_0062_H03.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
PST01_0017_B10.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
THY01_0006_C01.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
PST01_0079_H10.b : ATAACAGGGAAAGGGCTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
BFLT1_0127_F07.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
OVRT1_0101_H08.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCCGTAAACCTGCTTGCATAAGAT
OVRT1_0134_D04.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
PST01_0049_F03.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
LVR01_0019_B07.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
LNG01_0010_F08.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
CLNT1_0116_H10.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
PST01_0041_G10.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
KDN01_0099_D08.b : ATAACAGGGAAAGGGTTCCTAACTGCTTGTTTGGCTTCTGTAAACCTGCTTGCATAAGAT
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
---------+---------+---------+---------+---------+---------+ 366
PBL01_0036_G07.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
LVRM1_0092_D08.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
MLN01_0022_H04.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
UTR01_0044_B09.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
SPL01_0097_B12.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
LVRM1_0111_D12.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
PST01_0002_F09.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
PST01_0050_H03.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
PST01_0062_H03.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCAGGCGTGCCACAAAATG
PST01_0017_B10.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCAGGCGTGCCACAAAATG
THY01_0006_C01.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
PST01_0079_H10.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCAGGCGTGCCACAAAATG
BFLT1_0127_F07.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
OVRT1_0101_H08.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
OVRT1_0134_D04.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
PST01_0049_F03.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
LVR01_0019_B07.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
LNG01_0010_F08.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
CLNT1_0116_H10.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
PST01_0041_G10.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
KDN01_0099_D08.b : AAAAAGAGGAGAAGTCAATCGCCTAACCGACCCCAGTAAGATCGGGCGTGCCACAAAATG
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
---------+---------+---------+---------+---------+---------+ 425
PBL01_0036_G07.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
LVRM1_0092_D08.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
MLN01_0022_H04.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
UTR01_0044_B09.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
SPL01_0097_B12.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
LVRM1_0111_D12.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
PST01_0002_F09.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
PST01_0050_H03.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
PST01_0062_H03.b : TTGAAAATTCTGATAAATATATCTTTGGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
PST01_0017_B10.b : TTGAAAATTCTGATAAATATATCTTTGGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
THY01_0006_C01.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
PST01_0079_H10.b : TTGAAAATTCTGATAAATATATCTTTGGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
BFLT1_0127_F07.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
OVRT1_0101_H08.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
OVRT1_0134_D04.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
PST01_0049_F03.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
LVR01_0019_B07.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
LNG01_0010_F08.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
CLNT1_0116_H10.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
PST01_0041_G10.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
KDN01_0099_D08.b : TTGAAAATTCTGATAAATATATCTT*GGCGACAACATGTCTCCCCTGCCCAGGAACAGGC
LVRM1_0018_E10.b : ttgtcxxxxxxxxxxxxxxxxxxxxx
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
---------+---------+---------+---------+---------+---------+ 485
PBL01_0036_G07.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATCGGTCCACAAAGCGCAGGCTCTCGAT
LVRM1_0092_D08.b : ACAAACATGTAACTCCAAAACAATTTAAATTTATTGGTCCACAAAGCGCAGGCTCTCGAT
MLN01_0022_H04.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
UTR01_0044_B09.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
SPL01_0097_B12.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
LVRM1_0111_D12.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
PST01_0002_F09.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
PST01_0050_H03.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
PST01_0062_H03.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
PST01_0017_B10.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
THY01_0006_C01.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
PST01_0079_H10.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
BFLT1_0127_F07.b : ACAAACATGTAACTCCAAAACAATTTGAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
OVRT1_0101_H08.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAACGCAGGCTCTCGAT
OVRT1_0134_D04.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
PST01_0049_F03.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
LVR01_0019_B07.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
LNG01_0010_F08.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
CLNT1_0116_H10.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
PST01_0041_G10.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
KDN01_0099_D08.b : ACAAACATGTAACTCCAAAACAATTTAAATTAATTGGTCCACAAAGCGCAGGCTCTCGAT
LVRM1_0018_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGTCCACAAAGCGCAGGCTCTCGAT
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
---------+---------+---------+---------+---------+---------+ 544
PBL01_0036_G07.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
LVRM1_0092_D08.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
MLN01_0022_H04.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
UTR01_0044_B09.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
SPL01_0097_B12.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
LVRM1_0111_D12.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
PST01_0002_F09.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
PST01_0050_H03.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
PST01_0062_H03.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
PST01_0017_B10.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
THY01_0006_C01.b : GTTTTAAAATGATTGGTTTGTGAAGCGCGGCCTTTTGTTGTGAACCCCATAAAAGCTGTC
PST01_0079_H10.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGCGAACCCCATAAAAGCTGTC
BFLT1_0127_F07.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
OVRT1_0101_H08.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
OVRT1_0134_D04.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
PST01_0049_F03.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
LVR01_0019_B07.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
LNG01_0010_F08.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
CLNT1_0116_H10.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
PST01_0041_G10.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
KDN01_0099_D08.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
LVRM1_0018_E10.b : GTTTTAAAATGATTGGTTTGTGAAGTGCGGGCT*TTGTTGTGAACCCCATAAAAGCTGTC
PCT01_0010_H03.b : nnccccttttnnnnntccctgcggtggcnantgggtgtgACCCCATAAAAGCTGTC
PCT01_0004_B10.b : nnnnaactttannnnnnncctacggtgtgctctggggaagctgt
PCT01_0004_G05.b :
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
---------+---------+---------+---------+---------+---------+ 604
PBL01_0036_G07.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
LVRM1_0092_D08.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
MLN01_0022_H04.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
UTR01_0044_B09.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
SPL01_0097_B12.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
LVRM1_0111_D12.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PST01_0002_F09.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PST01_0050_H03.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PST01_0062_H03.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PST01_0017_B10.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
THY01_0006_C01.b : CCGACTCCGCACTAAGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PST01_0079_H10.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
BFLT1_0127_F07.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
OVRT1_0101_H08.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
OVRT1_0134_D04.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PST01_0049_F03.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
LVR01_0019_B07.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
LNG01_0010_F08.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
CLNT1_0116_H10.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PST01_0041_G10.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
KDN01_0099_D08.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
LVRM1_0018_E10.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PCT01_0010_H03.b : CCGACTCCGCACTAGGGGCCACAGTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PCT01_0004_B10.b : CCGACTCCGCACTAGGGGCCACGNTCCTCTACCCCTGCGTGGCGTATGACTGTGAGCCCC
PCT01_0004_G05.b : nnnccgccttnnnn
UTR01_0070_E01.b :
TCH01_0014_D04.b :
20110601C-007128 : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
---------+---------+---------+---------+---------+---------+ 664
PBL01_0036_G07.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
LVRM1_0092_D08.b : AGCGCGCTTGGGATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTGG
MLN01_0022_H04.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
UTR01_0044_B09.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
SPL01_0097_B12.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
LVRM1_0111_D12.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCNATCAGACCGCTTCTCCTGAGTGATTTT
PST01_0002_F09.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
PST01_0050_H03.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
PST01_0062_H03.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCGTGAGTGATTTG
PST01_0017_B10.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCGTGAGTGATTTG
THY01_0006_C01.b : AGCGCGCTTGGAAAAATCCTCTCGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGAATTT
PST01_0079_H10.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCGTGAGTGATTTG
BFLT1_0127_F07.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
OVRT1_0101_H08.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
OVRT1_0134_D04.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
PST01_0049_F03.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
LVR01_0019_B07.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
LNG01_0010_F08.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
CLNT1_0116_H10.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
PST01_0041_G10.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
KDN01_0099_D08.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
LVRM1_0018_E10.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCGTGAGTGATTTG
PCT01_0010_H03.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCCTGAGTGATTTG
PCT01_0004_B10.b : AGCGCGCTTGGAATAATCCTCTTGCTGTTTGCATCAAGACCGCTTCTCGTGAGTGATTTG
PCT01_0004_G05.b : nncctgcgttggctctggacctcttgctgtttgctcAGACCGCTTCTCGTGAGTGATTTG
UTR01_0070_E01.b : actttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0014_D04.b :
20110601C-007128 : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
---------+---------+---------+---------+---------+---------+ 724
PBL01_0036_G07.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
LVRM1_0092_D08.b : GGGTGTCGCCTCTTCCGA*TCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
MLN01_0022_H04.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
UTR01_0044_B09.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
SPL01_0097_B12.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
LVRM1_0111_D12.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGNATTTCCTTCTGCTGGCCTTTCATTTG
PST01_0002_F09.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
PST01_0050_H03.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
PST01_0062_H03.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
PST01_0017_B10.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
THY01_0006_C01.b : GGGTGTCGCCTCTTtccgagtccgacgaaggggattttccttctggctgcctttctttgg
PST01_0079_H10.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
BFLT1_0127_F07.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
OVRT1_0101_H08.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
OVRT1_0134_D04.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
PST01_0049_F03.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
LVR01_0019_B07.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
LNG01_0010_F08.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
CLNT1_0116_H10.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
PST01_0041_G10.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
KDN01_0099_D08.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
LVRM1_0018_E10.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
PCT01_0010_H03.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
PCT01_0004_B10.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAGGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
PCT01_0004_G05.b : GGGTGTCGCCTCTTCCGAGTCCAGACGAAGGGGATTTTCCTTCTGCTGGCCTTTCATTTG
UTR01_0070_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTTTCCTTCTGCTGGCCTTTCATTTG
TCH01_0014_D04.b : nnnnggctagtgacttnacxxx
20110601C-007128 : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
---------+---------+---------+---------+---------+---------+ 784
PBL01_0036_G07.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
LVRM1_0092_D08.b : GTGCGTTGGCGGGGAAccccgcga
MLN01_0022_H04.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
UTR01_0044_B09.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
SPL01_0097_B12.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
LVRM1_0111_D12.b : GTGCGTTGGCCCGGNAACCCCGCGAAAACCCCTC
PST01_0002_F09.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
PST01_0050_H03.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
PST01_0062_H03.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
PST01_0017_B10.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
THY01_0006_C01.b : agcgttgccgggaaacccgcgacacccctccacccaaaaaccgacttggaaaaaagggaa
PST01_0079_H10.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
BFLT1_0127_F07.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
OVRT1_0101_H08.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
OVRT1_0134_D04.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
PST01_0049_F03.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
LVR01_0019_B07.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
LNG01_0010_F08.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
CLNT1_0116_H10.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
PST01_0041_G10.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
KDN01_0099_D08.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
LVRM1_0018_E10.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
PCT01_0010_H03.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
PCT01_0004_B10.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
PCT01_0004_G05.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
UTR01_0070_E01.b : GTGCGTTGGCCGGGAAACCCCGCGACCACCCCTCACACCCAAGAACCGACTTGGAGGTAA
TCH01_0014_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007128 : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
---------+---------+---------+---------+---------+---------+ 843
PBL01_0036_G07.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
LVRM1_0092_D08.b :
MLN01_0022_H04.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
UTR01_0044_B09.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGA
SPL01_0097_B12.b : AGGGACCCCC*TTTGGGATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
LVRM1_0111_D12.b :
PST01_0002_F09.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
PST01_0050_H03.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
PST01_0062_H03.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
PST01_0017_B10.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
THY01_0006_C01.b : cccctttggaatgaggcgggggggccccgtcgcct
PST01_0079_H10.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
BFLT1_0127_F07.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
OVRT1_0101_H08.b : AGGGATCCCC*TTTGNAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
OVRT1_0134_D04.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
PST01_0049_F03.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
LVR01_0019_B07.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
LNG01_0010_F08.b : AGGGATCCCCCTTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
CLNT1_0116_H10.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
PST01_0041_G10.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
KDN01_0099_D08.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
LVRM1_0018_E10.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
PCT01_0010_H03.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
PCT01_0004_B10.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
PCT01_0004_G05.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
UTR01_0070_E01.b : AGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
TCH01_0014_D04.b : xGGGATCCCC*TTTGGAATGTGTGTGTGCGTGCCGGCCGGCGTCTCTGTTCTGAGTGTCT
20110601C-007128 : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
---------+---------+---------+---------+---------+---------+ 903
PBL01_0036_G07.b : GTTTTCNGTGATGTGCGCTTTCAGTTTGCAGCTGTCCCTCTCGACCCGTAAGACTGGGGG
LVRM1_0092_D08.b :
MLN01_0022_H04.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAAGACTGGGGG
UTR01_0044_B09.b :
SPL01_0097_B12.b : GTTTTCGGTGATGTGCGCTTTTCGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
LVRM1_0111_D12.b :
PST01_0002_F09.b : GTTTTCCGTGATGTGCGCTTTCATTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
PST01_0050_H03.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
PST01_0062_H03.b : GTTTTCGGTGATGCGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
PST01_0017_B10.b : GTTTTCGGTGATGCGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
THY01_0006_C01.b :
PST01_0079_H10.b : GTTTTCGGTGATGCGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
BFLT1_0127_F07.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCCCAGACCGTAAAGACTGGGGG
OVRT1_0101_H08.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAAGACTGGGGG
OVRT1_0134_D04.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAAGACTGGGGG
PST01_0049_F03.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAGGGACTGGGGG
LVR01_0019_B07.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
LNG01_0010_F08.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
CLNT1_0116_H10.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
PST01_0041_G10.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
KDN01_0099_D08.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
LVRM1_0018_E10.b : GTTTTCGGTGATGCGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
PCT01_0010_H03.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGA
PCT01_0004_B10.b : GTTTTCGGTGATGCGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
PCT01_0004_G05.b : GTTTTCGGTGATGCGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
UTR01_0070_E01.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
TCH01_0014_D04.b : GTTTTCGGTGATGTGCGCTTTCAGTTTGCAGCTGTCCTCTCAGACCGTAAGGACTGGGGG
20110601C-007128 : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
---------+---------+---------+---------+---------+---------+ 962
PBL01_0036_G07.b : ACTGTGATCAGCAGACGTGCTANGAGGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
LVRM1_0092_D08.b :
MLN01_0022_H04.b : ACTGTGATCAGCAAACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGAGCCCCCGG
UTR01_0044_B09.b :
SPL01_0097_B12.b : ACTGTGATCAGCAAACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGACCCCCCGG
LVRM1_0111_D12.b :
PST01_0002_F09.b : ACTGTGATCAGCAAACGTGCTAAGAAGATCACAAGCTGCC*ACCCTGGGGGACCCCCCGG
PST01_0050_H03.b : ACTGTGATCAGCAGACGTGCTAGGGAGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
PST01_0062_H03.b : ACTGTGATCAGCAGACGTGCTANGAGGATCACAGGCTGCC*ACCCTGGGGGATGCCCCGG
PST01_0017_B10.b : ACTGTGATCAGCAGACGTGCTNAGAGGATCACAGGCTGCC*ACCCTGGGGGATGCCCCGG
THY01_0006_C01.b :
PST01_0079_H10.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*CACCTGGGGGATGCCCCGG
BFLT1_0127_F07.b : ACTGTGATCAGCAGACGTGCTAGGAAGATCACAGGCTGCC*ACCTGGGGGGAGCCCCCGG
OVRT1_0101_H08.b : ACTGTGATCAGCAAACGTGCTAAGGAGATCACAGGCTGCC*ACCCTGGGGGACCCCCggg
OVRT1_0134_D04.b : ACTGTGATCAGCAAACGTGCTAGGAAGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
PST01_0049_F03.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCCACCCTGGGGGGACGCCCCGG
LVR01_0019_B07.b : ACTGTGATCAGCAAACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
LNG01_0010_F08.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCCCACCTTGGGGGAAGCCCCGG
CLNT1_0116_H10.b : ACTGTGATCAGCAAACGTGCTAGGAGGATTCACGGCTGCC*ACCTTGGGGacgccccgga
PST01_0041_G10.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
KDN01_0099_D08.b : ACTGTGATCAGCAGACGTGCTANGAGGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
LVRM1_0018_E10.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGATGCCCCGG
PCT01_0010_H03.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
PCT01_0004_B10.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGATGCCCCGG
PCT01_0004_G05.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGATGCCCCGG
UTR01_0070_E01.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
TCH01_0014_D04.b : ACTGTGATCAGCAGACGTGCTAGGAGGATCACAGGCTGCC*ACCCTGGGGGACGCCCCGG
20110601C-007128 : GAGCTGGGGAGA*GCCAAGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGACCGAGTT
---------+---------+---------+---------+---------+---------+ 1021
PBL01_0036_G07.b : NAGCTGGGGAGA*GCCA*GGacgcctggtggtctcctctgtcgtcagagaccgagtctgt
LVRM1_0092_D08.b :
MLN01_0022_H04.b : agctggggaaaccaaggacccctggtggtctcctctggcggtcaaagaacaattttgttg
UTR01_0044_B09.b :
SPL01_0097_B12.b : GAGCTGGGGgaaacccaagaaccccgggtggtctccttcggtcggtcaaaggaccaattt
LVRM1_0111_D12.b :
PST01_0002_F09.b : aactgggaaaaaccaagacccccgggggtccccttcggcggtcaaggaccaaattctgtt
PST01_0050_H03.b : GAGCTGGGGAGA*GCCA*GGacgcctggtggtctcctctgtcggtcagaggacgagttct
PST01_0062_H03.b : GAGCTGGGGAGA*GCCA*GGAACGCCggtggtctcttctgtcggtcaaaagaccgaatct
PST01_0017_B10.b : GAGCTGGGAAGA*GCCA*GGACGCCTGGTGGTCT*CTTCTGTCGGTCAGAGGAC*GAGTT
THY01_0006_C01.b :
PST01_0079_H10.b : GAGCTGGGGAGA*GCAA*GGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGACgaattc
BFLT1_0127_F07.b : aagcggggaagaccaaagaaccctgttggtctctttctgtcggtcaaaggaccaattctg
OVRT1_0101_H08.b : agctgggaaaaccaagacccctggtggcccctctgtcggtcaagaaccaattttttgtta
OVRT1_0134_D04.b : GAGCTGGGGAaagcagggacccctgtggtccccttctgtcggtaaaggaaccagttcgtt
PST01_0049_F03.b : GAGCTGGGGAAGAGCCAAGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGAC*GAATT
LVR01_0019_B07.b : AAGCTGGGAAAAGCCAAGGACcccctggtggtctcctttcgtcggtcaaaagacccaatt
LNG01_0010_F08.b : GAGCTGGGGAGAAGCCAAGGACGCCTGGTGGTCTCCTTtctgtcggtcaaaagaaccaag
CLNT1_0116_H10.b : gctggggaaacccaggacgccggtggtctcttctgtcggcaaaagacgattttgttgtta
PST01_0041_G10.b : AAGCTGGGGAGA*GCCAAGGACGCCTGGTGGTCTCCTTCTGTCGGTCAaagaccgagttc
KDN01_0099_D08.b : GAGCTGGGGAGAAG*CAAGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAAGACCGAGTT
LVRM1_0018_E10.b : GAGCTGGGGAGA*GCCAGGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGACCGAGGT
PCT01_0010_H03.b : GAGCTGGGGAGA*GCCAAGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGACCGAGTT
PCT01_0004_B10.b : GAGCTGGGGAGA*GCCAGGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGACCGAGTT
PCT01_0004_G05.b : GAGCTGGGGAGA*GCCAGGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGACCGAGTT
UTR01_0070_E01.b : GAGCTGGGGAGA*GCCAAGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGACCGAGTT
TCH01_0014_D04.b : GAGCTGGGGAGA*GCCAAGGACGCCTGGTGGTCTCCTTCTGTCGGTCAGAGGACCGAGTT
20110601C-007128 : CTGTTGTTGAAGCAAAAGCTTCCCCCTCCGCGGCCGTCTGACTCTTTTGCCTGCTTGTGG
---------+---------+---------+---------+---------+---------+ 1081
PBL01_0036_G07.b : tgtgagcaaagcttcccctcggcgcgtctgatctttgctgctgtgaaggccgaacggtcc
LVRM1_0092_D08.b :
MLN01_0022_H04.b : tgaaccaaagctttcccctcgcgggcgtctgatctttgcctgcttgggaaagcccgaagg
UTR01_0044_B09.b :
SPL01_0097_B12.b : tgtttgtgaaacaaaagctttcccctccgggggcggtt
LVRM1_0111_D12.b :
PST01_0002_F09.b : ttaaacaaaaattccccctcccggccgttggacccttttcctctttggaaagccccaagg
PST01_0050_H03.b : ggtgttgaacaaaacctccccctccgcggcggctgaatcttttgctgcttgtgaaagcgc
PST01_0062_H03.b : gttgttgagcaaaagcttcccccttcgcgccgtctgactctttgcctgcttgtgaaagcg
PST01_0017_B10.b : CTGTTGTTGAAcaaagcttccccctcgcggcgtctgactctttgctgcttgtgaangccc
THY01_0006_C01.b :
PST01_0079_H10.b : tgntgntgagcaaaagcttccccctcccggcgtctgactctttggctgcttgtgaaagcc
BFLT1_0127_F07.b : tttttaagcaaaagcttccccttcccggcgtttgaccttttgcctgctttggaaggccga
OVRT1_0101_H08.b : accaaaacttccctccgcggccgttgatcttttgctgcttgggaagcccgaaaggccggg
OVRT1_0134_D04.b : gttaaccaaaccttccctccgggccgtttattctttcctgctttggaaagcccgaaggtc
PST01_0049_F03.b : CTGTTGTTGAAAGC*AAAGCTTCCCCTTCGGCGGCGTCTGACTCTTTTGC*TGCTTGTGG
LVR01_0019_B07.b : tctggttgttaaacaaaaaccttcccccctcccccgcccgtctgaactctttttgccttg
LNG01_0010_F08.b : ttctgttgttgaaacaaaaaccttcccccctccccggcccgtctgaactcttttgccctg
CLNT1_0116_H10.b : aaaaaaacttcccctcccggccgtctaatcttttccttcttgtgaaaggccgaacggccc
PST01_0041_G10.b : tggttgttgaagcaaagcttccccctccgcgccgtctgactcttttgctgcttgggaaag
KDN01_0099_D08.b : CTGTTGTTGAAGCAAAAAGCTTCCCCCTCGCGGGCGTCTGACTCTTTTGCCTGCTTGTGG
LVRM1_0018_E10.b : CTGTTGTTGAAGCAAAAGCTTCCCCCTCCGCGGCCGTCTGACTCTTTTGCCTGCTTGTG*
PCT01_0010_H03.b : CTGTTGTTGAAGCAAAAGCTTCCCCCTCCGCGGCCGTCTGACTCTTTTGCCTGCTTGTGG
PCT01_0004_B10.b : CTGTTGTTGAAGCAAAAGCTTCCCCCTCCGCGGCCGTCTGACTCTTTTGCCTGCTTGTGG
PCT01_0004_G05.b : CTGTTGTTGAAGCAAAAGCTTCCCCCTCCGCGGCCGTCTGACTCTTTTGCCTGCTTGTGG
UTR01_0070_E01.b : CTGTTGTTGAAGCAAAAGCTTCCCCCTCCGCGGCCGTCTGACTCTTTTGCCTGCTTGTGG
TCH01_0014_D04.b : CTGTTGTTGAAGCAAAAGCTTCCCCCTCCGCGGCCGTCTGACTCTTTTGCCTGCTTGTGG
20110601C-007128 : AAGGCGCGGACGGGTCGCGTGTGTCTGGATCTGTTGGTTTCTGTTTCGTGTGTCTTTGTC
---------+---------+---------+---------+---------+---------+ 1141
PBL01_0036_G07.b : gtggtcggatccgtgtttcgttcggggctttgctggcggctgccacagttaatgggacac
LVRM1_0092_D08.b :
MLN01_0022_H04.b : gccccggtggcgggatcgttgtttcggttcgggggctttccctgcgccccttgcccagtt
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b : gcccgggggccgggactgttggtttccgttccggggcttttcctggggcccttgccacan
PST01_0050_H03.b : ggaacggtcccggggtctggacggtggtttcggttcggggggcttgcttgggcgccttgg
PST01_0062_H03.b : ccaagggtcccgtgtgctggaatcgtggttccggtccgggggctttgcctgggcnnctgg
PST01_0017_B10.b : ggacggtcccggtgcctgatcggtggttccgttccggggcttgccttggccccctggcac
THY01_0006_C01.b :
PST01_0079_H10.b : ccgaccggtccggggtcggaatcgtgggtttcgttccgggccttggcctgggcgccttgg
BFLT1_0127_F07.b : aaggccccgggtccggaacctgtgtttctgttcggggtctttgctggccgcctgtccagt
OVRT1_0101_H08.b : gggccggaaccttggttcctttcggggctttgcctgcgcccttccactttttaaggaaaa
OVRT1_0134_D04.b : cggggcccggattgtggttccgttcggggccttgccggggcccctgtcccgtttaaaggg
PST01_0049_F03.b : AAGGCGCGGACGGGTCccggggtctggatctgtgggttccggttccgggtcttggtctgg
LVR01_0019_B07.b : cttgttgaaagggccccgaaaggggcccccggggggtctcgggaatttgtttgggttttc
LNG01_0010_F08.b : cttggggaaagggcccggaaaggggtccgcgtgggggcctggaattttggttggtttttc
CLNT1_0116_H10.b : cggggtcgggaacagtggttccgtttcggggcctttgccgggccccctgcccaattttta
PST01_0041_G10.b : cgcggaaggttcccgtgggccggaactggtggtttcggttcggggggctttgcctggggg
KDN01_0099_D08.b : AAGGCGCGGACGGGTCNCGTGTGTCTGGATCTNGTGGTTTCggttccnggggctttgtct
LVRM1_0018_E10.b : AAGGCGCGGACGGGTCGCGTGTGTCTGGATCTGTTGGTTTCTGTTTCGTGTGTCTTTGTC
PCT01_0010_H03.b : AAGGCGCGGACGGGTCGCGTGTGTCTGGATCTGTTGGTTTCTGTTTCGTGTGTCTTTGTC
PCT01_0004_B10.b : AAGGCGCGGACGGGTCGCGTGTGTCTGGATCTGTTGGTTTCTGTTTCGTGTGTCTTTGTC
PCT01_0004_G05.b : AAGGCGCGGACGGGTCGCGTGTGTCTGGATCTGTTGGTTTCTGTTTCGTGTGTCTTTGTC
UTR01_0070_E01.b : AAGGCGCGGACGGGTCGCGTGTGTCTGGATCTGTTGGTTTCTGTTTCGTGTGTCTTTGTC
TCH01_0014_D04.b : AAGGCGCGGACGGGTCGCGTGTGTCTGGATCTGTTGGTTTCTGTTTCGTGTGTCTTTGTC
20110601C-007128 : TTGTGCGTCCTTGTCTACAGTTTTAATATGGGACAGACGGTGACGACCCCCCCTTAGTTT
---------+---------+---------+---------+---------+---------+ 1201
PBL01_0036_G07.b : ggacaccccctagttaccgacattgaggataatcgggtcaatgccttcgtaaggcctatt
LVRM1_0092_D08.b :
MLN01_0022_H04.b : ttatagggaaaaaggggacaccccccctattttaccctcacttttgatgaattaaccagg
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b : ttttaatgggaaagagtgaaaacccccctatttgcccccacctttggaggagttaacccg
PST01_0050_H03.b : ccacgttttatagggaaaaggtggaaaccccccttaattgactctcacatttggacgaat
PST01_0062_H03.b : ccaaagttaaaatgggaagacgggacaaccccccctaatgactcccacctttgacgaatt
PST01_0017_B10.b : agtttaattggacaacgggacacccccttattgactccactttgaagaattaatccggcc
THY01_0006_C01.b :
PST01_0079_H10.b : caaagtttaatagggaaggacgggaccacccccctagttgactccgaccattggaagaag
BFLT1_0127_F07.b : ttaaatgggaacaagggcacccccccttttttcctcccctttggaggagataaaccggcg
OVRT1_0101_H08.b : aaggaaaacccccttttttccttaccatttgagaaataacccgggcatattttttttcgg
OVRT1_0134_D04.b : aaaaggggcaccccccttttgtaccccccattggaaaaattaaacgggccaaatttcctc
PST01_0049_F03.b : gcgtcttggctacgttttaaatgggaaaacggtgacaccccccttattgactccgaccct
LVR01_0019_B07.b : tgtttttccggggggttctttttttttttgtgggcccccccctttgttctaacacagt
LNG01_0010_F08.b : ggttttccggggggtctttttttccttgggggccccccccttttgccctaaacaggtttt
CLNT1_0116_H10.b : aagggaagaaggggacccccccctttttgacctcccctttgggagaattaaccggggcca
PST01_0041_G10.b : cccttgccaagttttaataggaaagaaggtgacaaccccccttattggaatccaacattt
KDN01_0099_D08.b : tgggcgtcttggctacaggtttatatgggacagaggtgacacccccccttagttgactcc
LVRM1_0018_E10.b : TTGTGCGTCCTTGTCTACAG*TTTAATATGGGACAGACAGTGACGACCCCCCTTTAATTT
PCT01_0010_H03.b : TTGTGCGTCCTTGTCTACAGTTTTAATATGGGACAGACGGTGACGACCCCCCCTTAGTTT
PCT01_0004_B10.b : TTGTGCGTCCTTGTCTACAGTTTTAATATGGGACAGACGGTGACGACCCCCCCTTAGTTT
PCT01_0004_G05.b : TTGTGCGTCCTTGTCTACAGTTTTAATATGGGACAGACGGTGACGACCCCCCCTTAGTTT
UTR01_0070_E01.b : TTGTGCGTCCTTGTCTACAGTTTTAATATGGGACAGACGGTGACGACCCCCCCTTAGTTT
TCH01_0014_D04.b : TTGTGCGTCCTTGTCTACAGTTTTAATATGGGACAGACGGTGACGACCCCCCCTTAGTTT
20110601C-007128 : GACTCTCGACCATTTGGACTGAAGTTAAATCCAGGGCTCATAATTTGTCAGTTCAGGTTA
---------+---------+---------+---------+---------+---------+ 1261
PBL01_0036_G07.b : caattcgggttaaaaattaagggcgtcttctttggactccttgaattgaaatcccggtaa
LVRM1_0092_D08.b :
MLN01_0022_H04.b : ggctaattttccttcggttaaagggccttatttcgaatccgggcgtaaaaaatttttaag
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b : ggcccaatttgcctccggggtaaaaggccctttttcaaatatccggcgtaaaaaaaaatt
PST01_0050_H03.b : taataccgggccaaaattttccttctggtaaaaaggactttattgaaattcccgggtgta
PST01_0062_H03.b : aatccaggtctaatttgcactcggtaaaaggacctttaattgaaataccgggttaaacaa
PST01_0017_B10.b : caattttccttcggtaaaaggacttattctaaattccggcgtaaacaaattttaaggacc
THY01_0006_C01.b :
PST01_0079_H10.b : ttaatccgggcccaatttgcccttcggttaaaagggacttaattcgaaaattccgggctt
BFLT1_0127_F07.b : ccaattgtctttgggaaaaggccttttttaaaatcccggggtaaaaaaattttaaggagc
OVRT1_0101_H08.b : gtaaaggcctttttcaataaccgcggaaaaaaattttaaggacgccccttgttgggccac
OVRT1_0134_D04.b : gggtaaaggcctttttctaaaatcgggttaaaaatattttaagggcgctctccgttggac
PST01_0049_F03.b : tggactgattaaatcagggttcaaatttgccttcggttaaaaggactttaatctaattac
LVR01_0019_B07.b :
LNG01_0010_F08.b : tttaaaataatggggaaaaaaaaaaaaggggggggaaaaacaaaaacccccccccccccc
CLNT1_0116_H10.b : tattgttttctggtaaagggccttttttgaaattcccgcgtttaaacaaattttaaaggg
PST01_0041_G10.b : gaaggaattaatcagggtcctaattgtcggttaggtaaaaagaacttatttctaaaatac
KDN01_0099_D08.b : gaccattgaatgagttaatccaggctcaaattttccgtccagtaaaagggacctaaattc
LVRM1_0018_E10.b : Gctctccgacagctggactaattttaatcggggt
PCT01_0010_H03.b : GACTCTCGACCATTTGGACTGAAGTTAAATCCAGGGCTCATAATTTGTCAGTTCAGGTTA
PCT01_0004_B10.b : GACTCTCGACCATTTGGACTGAAGTTAAATCCAGGGCCCATAATTTGTCAGTTCAGGTTA
PCT01_0004_G05.b : GACTCTCGACCATTTGGACTGAAGTTAAATCCAGGGCTCATAATTTGTCAGTTCAGGTTA
UTR01_0070_E01.b : GACTCTCGACCATTTGGACTGAAGTTAAATCCAGGGCTCATAATTTGTCAGTTCAGGTTA
TCH01_0014_D04.b : GACTCTCGACCATTTGGACTGAAGTTAAATCCAGGGCTCATAATTTGTCAGTTCAGGTTA
20110601C-007128 : AGAAGGGACCTTTAATTCTGAGATTATCCTGGCTGTTAAAGCAAATATTTTTCAGACTGG
---------+---------+---------+---------+---------+---------+ 1321
PBL01_0036_G07.b : ggaaaaaagcccctgctgaaaaccgaacctcttcaaggcgggccttcccggggggccccc
LVRM1_0092_D08.b :
MLN01_0022_H04.b : ggcgcctcctcttggaggctttttatggaattggaaatccccggttaaaagaaaaaaaac
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b : tttaaaagaccggccttcccggttggacccctttttttggagaatttgaaaaaacccccc
PST01_0050_H03.b : aacaatttttaaaggaccggctcccctgttggagccttccttatggaaatgtgaaaaccc
PST01_0062_H03.b : tttttcaaagggcggcttttcgttaggacctatcttagggaaattgaaaaactcccgtgt
PST01_0017_B10.b : ggttctcgtaggccttatttagggaatttaaaacccccggtaacggaaatacaaaacccc
THY01_0006_C01.b :
PST01_0079_H10.b : taacaaaatttttaagagacccgtcccatcgttatggagccctactcttagggaaatttg
BFLT1_0127_F07.b : cgcctccgtgaggccctttcttggaaatgtgaaaaccccgggtaaaaggaaaaaaacagg
OVRT1_0101_H08.b : ctttgggaaatgaaaaccccccgggaacgaaaaaaaaaacccctctctggaaaaaaagaa
OVRT1_0134_D04.b : ctttcctgtgaaggaaaaccccccggaaagggaaaaaaaaacccctttgtgtgaaaacaa
PST01_0049_F03.b : cgccgttaagcaaattttcaaaggaacccctcttcggtaggaaccattcctttggagatt
LVR01_0019_B07.b :
LNG01_0010_F08.b : cccttttaaatattttttttttaaaccccccttcct
CLNT1_0116_H10.b : ccgcctcctcgttggggccttttctctggggatttgaaacacccgcgggtaaaaggcaaa
PST01_0041_G10.b : cggctgttagaaaaattttcagagggacgggtttctcggttggaacctatctttttggaa
KDN01_0099_D08.b : gaattaccggctgtaagcaaattttcaaatggacggttcatcggatagacctaattcttt
LVRM1_0018_E10.b :
PCT01_0010_H03.b : AGAAAGGACCTTTAATTCTGAGATTATCCTGNCTGTTAAAGCAAATATTTTTCAGACTGG
PCT01_0004_B10.b : AGAAGGGACCTTTAATTCTGAGATTATCCTGNNCTGTAAAGCAAATATTTTTCAGACTGG
PCT01_0004_G05.b : AGAAGGGACCTTTAATTCTGAGATTATCCTGGCTGTTAAAGCAAATATTTTTCAGACTGG
UTR01_0070_E01.b : AGAAGGGACCTTTAATTCTGAGATTATCCTGGCTGTTAAAGCAAATATTTTTCAGACTGG
TCH01_0014_D04.b : AGAAGGGACCTTTAATTCTGAGATTATCCTGGCTGTTAAAGCAAATATTTTTCAGACTGG
20110601C-007128 : ACCCGGCTCTCATCCTGATCAGGAGCCCTATATCCTTACATGGCAAGATTTGGCAGAAGA
---------+---------+---------+---------+---------+---------+ 1381
PBL01_0036_G07.b : cggggggcagccaaacccctcttcttt
LVRM1_0092_D08.b :
MLN01_0022_H04.b : gcccctctctggaaaaccct
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b : gggtttacgggtgaaaaaaaaaagccccccttttgtgttga
PST01_0050_H03.b : ccgggtaaacggaataaacaaaacgcccccctttggtgagaaaaaccgctgaatacgctc
PST01_0062_H03.b : taacggaaaaaacaaaagccccctt
PST01_0017_B10.b : ctcgctggaaaaaaccgaaaacccccttccaa
THY01_0006_C01.b :
PST01_0079_H10.b : gaaaaacccccccggg
BFLT1_0127_F07.b : cccttgtgtggaaaaaaaggaaaaccccttcccagaaggggggcacttcctcccgggggg
OVRT1_0101_H08.b : aaaccctccaaaaagcggggcctccccgccggggggcg
OVRT1_0134_D04.b : gaagctccttcctagaggggggggactccctngggggggtcttccnttnnnnnggtgnnn
PST01_0049_F03.b : ggaaaaacccccggggtaacagggaaaacaaaaacggccccgttgtttgaaaaaaaaccc
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b : aaacaagccgctccttggcttagaaaaactcgggaaaacccctctcctcaagagacgggg
PST01_0041_G10.b : atttggaaaaatcctcctggtaaaccggtaaaaaaaaaaacggccccattgtgtttgaaa
KDN01_0099_D08.b : gggaaattgggaaaccccccggtaaaacggtaaaaacaaagccgtccaattggctctgga
LVRM1_0018_E10.b :
PCT01_0010_H03.b : ACCCGGCTCTCATCCTGATCAGGAGCCCTATATCCTTACATGGCAAGATTTGGCAGA*GA
PCT01_0004_B10.b : ACCCCGCTCTCATCCTGATCAGGAGCCCTATATCCTTACATGGCAAGATTTGGCAGAAGA
PCT01_0004_G05.b : ACCCGGCTCTCATCCTGATCAGGAGCCCTATATCCTTACATGGCAAGATTTGGCAGAAGA
UTR01_0070_E01.b : ACCCGGCTCTCATCCTGATCAGGAGCCCTATATCCTTACATGGCAAGATTTGGCAGAAGA
TCH01_0014_D04.b : ACCCGGCTCTCATCCTGATCAGGAGCCCTATATCCTTACATGGCAAGATTTGGCAGAAGA
20110601C-007128 : TCCTCCGCCATGGGTTAAACCATGGCTAAATAAACCAAGATAGCCAGGTCCCCAAGTTCT
---------+---------+---------+---------+---------+---------+ 1441
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b : tcatccca
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b : ccccttcgggggtggggcaaatttttctcggtat
OVRT1_0101_H08.b :
OVRT1_0134_D04.b : nntgcgccgcggttccttttttttctaaccgcnnnnnngannnnnnnt
PST01_0049_F03.b : gaaaaagccctccttcacaaggagcgtgtggacaattttccccttcagggtggaactcct
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b : ggacaacccc
PST01_0041_G10.b : aaaaacgcgaaaagcgccctctcatccgaaaggaacgctgggacac
KDN01_0099_D08.b : aaaaaatcggaaagcacctccattaccaatagaacgcggtgagacctttcccctttgagg
LVRM1_0018_E10.b :
PCT01_0010_H03.b : TCCTCCGCCCTGGG*TAAACCATGGCTAAATAAACCA*GATTAGCCGGGTCCCAAGTTCT
PCT01_0004_B10.b : TCCTTCGCCATGGGTTAAAACATGGCTAAATAAAACAAGAATGCCCAGGTCCCCAGTTCT
PCT01_0004_G05.b : TCCTCCGCCATGGGTTAAACCATGGCTAAATAAACCA**GATAGCCAGGTCCCCAGTTCT
UTR01_0070_E01.b : TCCTCCGCCATGGGTTAAACCATGGCTAAATAAACCAAGATAGCCAGGTCCCCAAGTTCT
TCH01_0014_D04.b : TCCTCCGCCATGGGTTAAACCATGGCTAAATAAACCAAGATAGCCAGGTCCCCAAGTTCT
20110601C-007128 : GGCTCTTGGAGAGAAAAACAAACACTCGGCTGAAAAAGTCAAGCCCTCTCCTCATATCTA
---------+---------+---------+---------+---------+---------+ 1501
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b : ctccggagcgctaaaagcc
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b : gtgggactcctctcccggaggttggatagggcccaaaaaaaattcngcccgggtcttctt
LVRM1_0018_E10.b :
PCT01_0010_H03.b : GGCTCTTGGAGAGAAAAAaaacactcggctggaaagtcagccctctcctcaaatctcccc
PCT01_0004_B10.b : GGCTCTTGGAGAGAAAAACA*Accctcggctgaaaaatcaagccttctcctcaatctacc
PCT01_0004_G05.b : GGCTCTTGNAGAGAAAAACA*ACACTCGGCTGAAAA*GTNCAGCCCTCTCCTCATATCTA
UTR01_0070_E01.b : GGCTCTTGGAGAGAAAAACAAACACTCGGCTGAAAAAGTCAAGCCCTCTCCTCATATCTA
TCH01_0014_D04.b : GGCTCTTGGAGAGAAAAACAAACACTCGGCTGAAAAAGTCAAGCCCTCTCCTCATATCTA
20110601C-007128 : CCCCGAGATTGAGGAGCCGCCGGCTTGGCCGGAACCCCAATCTGTTCCCCCACCCCCTTA
---------+---------+---------+---------+---------+---------+ 1561
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b : tttttttgttt
LVRM1_0018_E10.b :
PCT01_0010_H03.b : aaaattgagacccgccggcttgcccgaaacccaatctgtcccccaaccccttatccgaac
PCT01_0004_B10.b : ccgaaattggggaccctcggtctggccggaaccccatctgttcccccaccccttatcggc
PCT01_0004_G05.b : CCCCGAGATTtgagagccgcggcttgccngaaccccnatctgntcccccacccctatcng
UTR01_0070_E01.b : CCCCGAGATTGAGGAGCCGCCGGCTTGGCCGGAACCCCAATCTGTTCCCCCACCCCCTTA
TCH01_0014_D04.b : CCCCGAGATTGAGGAGCCGCCGGCTTGGCCGGAACCCCAATCTGTTCCCCCACCCCCTTA
20110601C-007128 : TCCGGCACAGGGTGCTGCGAGGGGACCCTCTGCCCCTCCTGGAGCTCCAGCGGTGGAGGG
---------+---------+---------+---------+---------+---------+ 1621
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b : aggtggcttgaagggacccttggcccttctggaactccacggggaaggacctgtttcggg
PCT01_0004_B10.b : acaggggctggcagggacctctgccccttcggaattccccggggaagaacttgtcaagga
PCT01_0004_G05.b : cacaggtgctgcgagggacctctgcccttctnagctccacgtggaaggactgctgcagga
UTR01_0070_E01.b : TCCGGCACAGGGTGCTTCGAGGGGACCCTCTGCCCCTCCTGGAACTCCaccggggggagg
TCH01_0014_D04.b : TCCGGCACAGGGTGCTGCGAGGGGACCCTCTGCCCCTCCTGGAGCTCCAGCGGTGGAGGG
20110601C-007128 : ACCTGCTGCAGGGACTCGGAGCCGGAGGGGCGCCACCCCGGAGCGGACAGACGAGATTGC
---------+---------+---------+---------+---------+---------+ 1681
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b : atccagaccgaagggccccacccgaacgaaaaaaaaaatgcaaattacacctggcaataa
PCT01_0004_B10.b : atcgaaccgaagggccccccccgagcggaaaacaaaatggaattaccgtgccctaaggcc
PCT01_0004_G05.b : ctcgagcggagggcgccacccccgacgacgacaaatgcnacttacgctgccagtacgcct
UTR01_0070_E01.b : gaccctgctccaggggactccggaaccggaaggggccccccccccgggaacggaaaaaac
TCH01_0014_D04.b : ACCTGCTGCAGGGACTCGGAGCCGGAGGGGCGCCACCCCGGAGCGGACAGACGAGATTGC
20110601C-007128 : GACATTACCGCTGCGCACGTACGGCCCTCCCATACCGGGGGGGCAATTGCAGCCCCTCCA
---------+---------+---------+---------+---------+---------+ 1741
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b : ggcctccttaggggggcaatgcccccctcaattggcccttcttcgcaaatttaaatgaaa
PCT01_0004_B10.b : tcttttccggggcattgaaccccccaatggccttttttgcgaattataaaaaaaaaaacc
PCT01_0004_G05.b : tcatacgggggcaatgcaccctccgtttggcccttccttgcaatttaaatggatacaaca
UTR01_0070_E01.b : aaaatttgccaaaattacccccctgccccccttaagggccccctcccataccgggggggg
TCH01_0014_D04.b : GACATTACCGCTGCGCACGTACGGCCCTCCCATACCGGGGGGGCAATTGCAGCCCCTCCA
20110601C-007128 : ............................................................
---------+---------+---------+---------+---------+---------+ 1741
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b : taaacatcctttttggaaacccaaggcccggggttggacctttttttccccccctttggg
PCT01_0004_B10.b : tccttttgagaacccaggcccggggggggggcctattttcccccccccgggggttccccc
PCT01_0004_G05.b : tcctttcccaaaacccagccccgggtggggaaccttgttccccccccctggaaatgaaac
UTR01_0070_E01.b : cccaatttggcgcccccctcccggtatttgggccccttttttctttcttggccaattttt
TCH01_0014_D04.b : tattggccttttcttctgcagatcttataattgaaatctaccatccccttttcccgagga
20110601C-007128 : ............................................................
---------+---------+---------+---------+---------+---------+ 1741
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b : atggaaccgtcagacctctcccggggaagaaatttttggttaaaaaaaaaggttgttttg
PCT01_0004_B10.b : cccccccccccgggggaaaatgtttggcaaaaaaaaaaactcttgtggggggccgcaaaa
PCT01_0004_G05.b : ccccaaccccccccggggaaaaatttttgggttaaaaaaaaacttttgtgggggggccga
UTR01_0070_E01.b : ttttttaaattttaaaaaaacttctaaacccctttccccccccccccttttttccccccg
TCH01_0014_D04.b : tcccatggctcagggggtgggtgaagccctttgtttctcaccaccccttgggagattgtc
20110601C-007128 : ............................................................
---------+---------+---------+---------+---------+---------+ 1741
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b : ggggcggtaataaaaaccccccccccaaaaaaaatgtttttttttgtataaaaaaaaaaa
PCT01_0004_B10.b : aaaaccccccccaaaaaagagttttttttaaaaaaaaaanntnttnnnnnnnnnntcttc
PCT01_0004_G05.b : aataaaaaccccccccacaaaaaaaaagtttttttttttttgaaaaaaaaaaaaattttt
UTR01_0070_E01.b : ggagaggaaattcccctcccccccacaaatgggccgccccccccccctcc
TCH01_0014_D04.b : aaactggtacgaccctctcccaacggggacggaggaattttgtaaagcgtaaaaaaaaaa
20110601C-007128 : ............................................................
---------+---------+---------+---------+---------+---------+ 1741
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b : aaatttttttgttaattttgggggaatctttttcgttttccctcc
PCT01_0004_B10.b : tcccccccctcctttgtagtataaaggaaaaaaaaaa
PCT01_0004_G05.b : tttttaattgggaatatnnnnntctactcttcccccccnnnnnnnnnaaaaaagaaaaac
UTR01_0070_E01.b :
TCH01_0014_D04.b : aaaaaggccctgggtccaactcgggggcggcccctaaaatcctctgggggccagttatgt
20110601C-007128 : ............................................................
---------+---------+---------+---------+---------+---------+ 1741
PBL01_0036_G07.b :
LVRM1_0092_D08.b :
MLN01_0022_H04.b :
UTR01_0044_B09.b :
SPL01_0097_B12.b :
LVRM1_0111_D12.b :
PST01_0002_F09.b :
PST01_0050_H03.b :
PST01_0062_H03.b :
PST01_0017_B10.b :
THY01_0006_C01.b :
PST01_0079_H10.b :
BFLT1_0127_F07.b :
OVRT1_0101_H08.b :
OVRT1_0134_D04.b :
PST01_0049_F03.b :
LVR01_0019_B07.b :
LNG01_0010_F08.b :
CLNT1_0116_H10.b :
PST01_0041_G10.b :
KDN01_0099_D08.b :
LVRM1_0018_E10.b :
PCT01_0010_H03.b :
PCT01_0004_B10.b :
PCT01_0004_G05.b : gannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0070_E01.b :
TCH01_0014_D04.b : acccttt