[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007527

Length: 1,000

Sequence [FASTA format sequence]
GCCCACTGGG AGGGCCTGGC CCCTGGGAGG GTGTGGGTGC CAACGGCTGA GACTGGGTAT
AAGGCACCAC CATCCCAGCT GCCCCCGGCT GTTCCCATCA TGCCAGCACT CAGATTCCTG
GCCCTGCTGG CCAGCCTGCT GGCAACCTCC AGGGTTGGCT TGGCCACCCT GGCAGACATT
GTGGGCGGCA GGAGGGCCCA GCCGCAGGAG TTCCCGTTTC TGGCCTCCAT TCAGAAACAA
GGGAGGCCCT TTTGCGCCGG AGCCCTGGTC CATCCCCGCT TCGTCCTGAC AGCGGCCAGC
TGCTTCCGTG GCAAGAACAG CGGAAGTGCC TCTGTGGTGC TGGGGGCCTA TGACCTGAGG
CAGCAGGAGC AGTCCCGGCA GACATTCTCC ATCAGGAGCA TCAGCCAGAA CGGCTATGAC
CCCCGGCAGA ATCTGAACGA TGTGCTGCTG CTGCAGCTGG ACCGTGAGGC CAGACTCACC
CCCAGTGTGG CCCTGGTACC GCTGCCCCCG CAGAATGCCA CAGTGGAAGC TGGCACCAAC
TGCCAAGTTG CGGGCTGGGG GACCCAGCGG CTTAGGAGGC TTTTCTCCCG CTTCCCAAGG
GTGCTCAATG TCACCGTGAC CTCAAACCCG TGTCTCCCCA GAGACATGTG CATTGGTGTC
ATCAGCCGCC GGGGCCGCAT CAGCCAGGGA GACAGAGGCA CCCCCCTCGT CTGCAACGGC
CTGGCGCAGG GCGTGGCCTC CTTCCTCCGG AGGCGTTTCC GCAGGAGCTC CGGCTTCTTC
ACCCGCGTGG CGCTCTTCAG AAATTGGATT GATTCAGTTC TCAACAACCC GCCGGCCTGA
AGGATCCCCT CGCCGAGCCC GTGGGAAGGG GGGCCTGTTA GCCCCCTGGA GCCCTGCCCC
CACTGCCACA CCTCCCGCGC TGCGTGTCCC ATCCCAAAGC CCCATCCTGG ACCGCTCTGT
CGAGGCTGTA ATAAAGAAGC TGTTACCATT CAAAAAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAZU1azurocidin preproprotein [Homo sapiens]. 2671e-71O
Contig/Assembly ProteinELANEneutrophil elastase preproprotein [Homo sapiens]. 1501e-36O
Contig/Assembly ProteinPRTN3myeloblastin [Homo sapiens]. 1463e-35O
Contig/Assembly ProteinCFDcomplement factor D preproprotein [Homo sapiens]. 95.57e-20O
Contig/Assembly ProteinGZMHgranzyme H precursor [Homo sapiens]. 95.19e-20O
Contig/Assembly ProteinGZMAgranzyme A precursor [Homo sapiens]. 94.41e-19O
Contig/Assembly ProteinGZMBgranzyme B precursor [Homo sapiens]. 89.74e-18O
Contig/Assembly ProteinCTSGcathepsin G preproprotein [Homo sapiens]. 89.45e-18O
Contig/Assembly ProteinGZMKgranzyme K precursor [Homo sapiens]. 88.68e-18O
Contig/Assembly ProteinGZMMgranzyme M precursor [Homo sapiens]. 87.81e-17O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinElaneneutrophil elastase precursor [Mus musculus]. 1493e-36O
Contig/Assembly ProteinPrtn3myeloblastin precursor [Mus musculus]. 1341e-31O
Contig/Assembly ProteinGzmkgranzyme K precursor [Mus musculus]. 1002e-21O
Contig/Assembly ProteinPrss57serine protease 57 precursor [Mus musculus]. 95.17e-20O
Contig/Assembly ProteinCtsgcathepsin G preproprotein [Mus musculus]. 92.45e-19O
Contig/Assembly ProteinCma2mast cell protease 10 [Mus musculus]. 89.73e-18O
Contig/Assembly ProteinGzmdgranzyme D [Mus musculus]. 87.81e-17O
Contig/Assembly ProteinMcpt1mast cell protease 1 precursor [Mus musculus]. 872e-17O
Contig/Assembly ProteinCfdcomplement factor D precursor [Mus musculus]. 86.73e-17O
Contig/Assembly ProteinMcpt9mast cell protease 9 precursor [Mus musculus]. 86.73e-17O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinELANEneutrophil elastase [Canis lupus familiaris]. 1611e-39O
Contig/Assembly ProteinLOC608543PREDICTED: similar to Cathepsin G precursor (CG) [Canis familiaris]. 1072e-23O
Contig/Assembly ProteinLOC490629PREDICTED: similar to Granzyme H precursor (Cytotoxic T-lymphocyte proteinase) (Cathepsin G-like 2) (CTSGL2) (CCP-X) (Cytotoxic serine protease-C) (CSP-C) [Canis familiaris]. 1011e-21O
Contig/Assembly ProteinLOC490630PREDICTED: similar to Granzyme B precursor (T-cell serine protease 1-3E) (Cytotoxic T-lymphocyte proteinase 2) (Lymphocyte protease) (SECT) (Granzyme-2) (Cathepsin G-like 1) (CTSGL1) (CTLA-1) (Human lymphocyte protein) (HLP) (C11) [Canis familiaris]. 99.84e-21
Contig/Assembly ProteinLOC487207PREDICTED: similar to Granzyme A precursor (Cytotoxic T-lymphocyte proteinase 1) (Hanukkah factor) (H factor) (HF) (Granzyme-1) (CTL tryptase) [Canis familiaris]. 93.63e-19O
Contig/Assembly ProteinLOC489200PREDICTED: similar to Granzyme K precursor (Granzyme-3) (NK-tryptase-2) (NK-TRYP-2) [Canis familiaris]. 91.31e-18O
Contig/Assembly ProteinLOC485099PREDICTED: similar to protease, serine-like 1 [Canis familiaris]. 90.11e-18
Contig/Assembly ProteinLOC485095PREDICTED: similar to Complement factor D precursor (C3 convertase activator) (Properdin factor D) (Adipsin) [Canis familiaris]. 86.73e-17O
Contig/Assembly ProteinLOC484349PREDICTED: similar to kallikrein 13 precursor [Canis familiaris]. 79.74e-15O
Contig/Assembly ProteinCMA1chymase precursor [Canis lupus familiaris]. 797e-15O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100336938PREDICTED: azurocidin 1 preproprotein-like [Bos taurus]. 2915e-79O
Contig/Assembly ProteinELANEneutrophil elastase [Bos taurus]. 1541e-37O
Contig/Assembly ProteinLOC100298591PREDICTED: proteinase 3 (predicted)-like [Bos taurus]. 1363e-32O
Contig/Assembly ProteinPRSSL1PREDICTED: granzyme M-like [Bos taurus]. 1041e-22O
Contig/Assembly ProteinPRSSL1PREDICTED: granzyme M-like [Bos taurus]. 1032e-22O
Contig/Assembly ProteinGZMKgranzyme K [Bos taurus]. 1003e-21O
Contig/Assembly ProteinGZMKPREDICTED: granzyme K (granzyme 3; tryptase II)-like [Bos taurus]. 1003e-21O
Contig/Assembly ProteinGZMBPREDICTED: granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)-like [Bos taurus]. 98.21e-20O
Contig/Assembly ProteinGZMBPREDICTED: granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)-like [Bos taurus]. 98.21e-20O
Contig/Assembly ProteinLOC100125946hypothetical protein LOC100125946 [Bos taurus]. 97.42e-20O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100522363PREDICTED: azurocidin-like [Sus scrofa]. 392e-109O
Contig/Assembly ProteinLOC100522182PREDICTED: neutrophil elastase-like [Sus scrofa]. 1484e-36O
Contig/Assembly ProteinLOC100623709PREDICTED: myeloblastin-like [Sus scrofa]. 1423e-34O
Contig/Assembly ProteinGZMKgranzyme K [Sus scrofa]. 99.82e-21O
Contig/Assembly ProteinGZMBgranzyme B [Sus scrofa]. 97.41e-20O
Contig/Assembly ProteinLOC396877PREDICTED: complement factor D [Sus scrofa]. 96.32e-20O
Contig/Assembly ProteinLOC100154047PREDICTED: cathepsin G-like [Sus scrofa]. 941e-19O
Contig/Assembly ProteinGZMAgranzyme A [Sus scrofa]. 90.51e-18O
Contig/Assembly ProteinLOC100620361PREDICTED: granzyme A-like [Sus scrofa]. 90.51e-18O
Contig/Assembly ProteinLOC100517351PREDICTED: mast cell protease 3-like [Sus scrofa]. 87.41e-17O


Assembly Members: 45      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BMWN10001D06BMWN1_0001_D06.bHX205679 
BMWN10001H02BMWN1_0001_H02.bHX205714 
BMWN10002E11BMWN1_0002_E11.bHX205759 
BMWN10003D04BMWN1_0003_D04.bHX205804 
BMWN10010F09BMWN1_0010_F09.b  
BMWN10012B08BMWN1_0012_B08.bHX206332 
BMWN10012F04BMWN1_0012_F04.b  
BMWN10015D02BMWN1_0015_D02.bHX206495 
BMWN10018H08BMWN1_0018_H08.bHX206682 
BMWN10020G08BMWN1_0020_G08.bHX206804 
BMWN10022A05BMWN1_0022_A05.b  
BMWN10022D08BMWN1_0022_D08.bHX206902 
BMWN10029B08BMWN1_0029_B08.bHX207341 
BMWN10031E12BMWN1_0031_E12.bHX207495 
BMWN10035B11BMWN1_0035_B11.bHX207734 
BMWN10036B09BMWN1_0036_B09.b  
BMWN10037A07BMWN1_0037_A07.bHX207843 
BMWN10037C01BMWN1_0037_C01.bHX207855 
BMWN10043A06BMWN1_0043_A06.b  
BMWN10044F02BMWN1_0044_F02.bHX208188 
BMWN10045G09BMWN1_0045_G09.bHX208250 
BMWN10048H02BMWN1_0048_H02.bHX208478 
BMWN10049A11BMWN1_0049_A11.bHX208495 
BMWN10050B10BMWN1_0050_B10.bHX208581 
BMWN10050E04BMWN1_0050_E04.bHX208610 
BMWN10053C12BMWN1_0053_C12.bHX208790 
BMWN10054B10BMWN1_0054_B10.bHX208838 
BMWN10057D11BMWN1_0057_D11.bHX209025 
BMWN10058A07BMWN1_0058_A07.bHX209067 
BMWN10060A10BMWN1_0060_A10.bHX209192 
BMWN10065G01BMWN1_0065_G01.bHX209543 
BMWN10070E01BMWN1_0070_E01.bHX209861 
BMWN10070G04BMWN1_0070_G04.bHX209880 
BMWN10073D09BMWN1_0073_D09.b  
BMWN10081B08BMWN1_0081_B08.bHX210535 
BMWN10081C11BMWN1_0081_C11.bHX210547 
BMWN10087H03BMWN1_0087_H03.bHX210945 
BMWN10089E02BMWN1_0089_E02.bHX211058 
BMWN10091A09BMWN1_0091_A09.bHX211166 
BMWN10093H08BMWN1_0093_H08.bHX211338 
BMWN10096D02BMWN1_0096_D02.bHX211506 
BMWN10098C01BMWN1_0098_C01.bHX211599 
BMWN10098D04BMWN1_0098_D04.b  
BMWN10098G06BMWN1_0098_G06.bHX211634 
BMWN10100A05BMWN1_0100_A05.bHX211696 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
661A2000.526WNATC/I
T1800.474TTC/F
804C400.286WSAAC/N
T1000.714AAT/N


Alignment:      TOP

20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BMWN1_0093_H08.b : ttttggcaagttacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_C12.b : ttttagacagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0037_A07.b :
BMWN1_0015_D02.b :
BMWN1_0002_E11.b :
BMWN1_0091_A09.b :
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b :
BMWN1_0022_A05.b :
BMWN1_0087_H03.b :
BMWN1_0020_G08.b :
BMWN1_0035_B11.b :
BMWN1_0022_D08.b :
BMWN1_0098_C01.b :
BMWN1_0012_F04.b :
BMWN1_0001_D06.b :
BMWN1_0058_A07.b :
BMWN1_0045_G09.b :
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b :
BMWN1_0098_D04.b :
BMWN1_0003_D04.b :
BMWN1_0012_B08.b :
BMWN1_0081_B08.b :
BMWN1_0036_B09.b :
BMWN1_0010_F09.b :
BMWN1_0043_A06.b :
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b :
BMWN1_0048_H02.b :
BMWN1_0044_F02.b :
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b :
BMWN1_0001_H02.b :
20110601C-007527 : ............GCCCACTGGGAGGGCCTGGCCCCTGGGAGGGTGTGGGTGCCAACGGCT
---------+---------+---------+---------+---------+---------+ 48
BMWN1_0093_H08.b : xxxxxxxxxxxxGCCCACTGGGAGGGCCTGGCCCCTGGGAGGGTGTGGGTGCCAACGGCT
BMWN1_0053_C12.b : xxxxxxxxxxxxxxxgACTGGGACGGCCTGGCCCCTGGGAGGGTGTGGGTGCCAACGGCT
BMWN1_0037_A07.b : nttggagagacgaggxxxxxxxxxxxxxxxxx
BMWN1_0015_D02.b : ttttggcaggtagaggccgtaxxxxxxxxxxx
BMWN1_0002_E11.b : ttttggagagtacgacgxxxx
BMWN1_0091_A09.b : tttccgagatacgacgcagta
BMWN1_0065_G01.b : ttttggacagtacgacgxxx
BMWN1_0070_E01.b : tttttggatagtacgaggxxx
BMWN1_0037_C01.b : tttttccagagaagaggxxxxx
BMWN1_0089_E02.b : nnnngggacggtacgacgxxxx
BMWN1_0029_B08.b : tttttggcagagtacacxxxxxxx
BMWN1_0098_G06.b : tttttggagagtacacgxxxxx
BMWN1_0073_D09.b : ttggctgagtacgaxxxxxxxx
BMWN1_0022_A05.b : acacgttaagacgcagt
BMWN1_0087_H03.b : ntttaggacggtacaggccg
BMWN1_0020_G08.b : nttggacagtacgacgxxx
BMWN1_0035_B11.b : tggcaagtacgacgccgta
BMWN1_0022_D08.b : nnnggatagtacgacgxxxx
BMWN1_0098_C01.b : ttttgcagagtacgaggcag
BMWN1_0012_F04.b : tttccgcaagagaggccgt
BMWN1_0001_D06.b : nnnnggcaggtacgacgxxxx
BMWN1_0058_A07.b : nnccgcaggtacgacgxxxxx
BMWN1_0045_G09.b : nnnggcaggtacgaggccg
BMWN1_0057_D11.b : nnnncgatagtacgaggxxxxx
BMWN1_0018_H08.b : nnaaaaattaatnnnnnttgttttttnnnggagagtagaggxxx
BMWN1_0081_C11.b : ttttccgagagtacgacgxxxxx
BMWN1_0100_A05.b : tttccgacggtagaggccgta
BMWN1_0050_E04.b : nnnnccgacaagaagacgxxxxx
BMWN1_0054_B10.b : ttttagacaagacacgxxxxxxxxxxxxxxxx
BMWN1_0098_D04.b : tttcgagagaagacgccg
BMWN1_0003_D04.b : tttggcaggtacgacgccg
BMWN1_0012_B08.b : tttttggcagagtagaggxxx
BMWN1_0081_B08.b : tttnggagagtacgacgxxxx
BMWN1_0036_B09.b : caggtaagacgcag
BMWN1_0010_F09.b : nttagatagtacacgcc
BMWN1_0043_A06.b : ttcgcaggtagacngccntagtatttatxxxxxx
BMWN1_0049_A11.b : nnnnnggcaggtagacgx
BMWN1_0096_D02.b : ttttccgacggtagacgxxxxxxxxxxxxx
BMWN1_0070_G04.b : tttggagagtacgacgccgtaxxxxxxxxx
BMWN1_0048_H02.b : nttttggacgagtacacgccgtaxxxxxxxx
BMWN1_0044_F02.b : tggatagtacgaggxxxxxxxxxxxxxxxxx
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b :
BMWN1_0001_H02.b :
20110601C-007527 : GAGACTGGGTATAAGGCACCACCATCCCAGCTGCCCCCGGCTGTTCCCATCATGCCAGCA
---------+---------+---------+---------+---------+---------+ 108
BMWN1_0093_H08.b : GAGACTGGGTATAAGGCACCACCATCCCAGCTGCCCCCCGCTGTTCCCATCATGCCAGCA
BMWN1_0053_C12.b : GAGACTGGGTATAAGGCACCACCATCCCAGCTGCCCCCCGCTGTTCCCATCATGCCAGCA
BMWN1_0037_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaTGGCTGTTCCCATCATGCCAGCA
BMWN1_0015_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcaTGGCTGTTCCCATCATGCCAGCA
BMWN1_0002_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0091_A09.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0065_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0070_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0037_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0089_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0029_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0098_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0073_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTCCCCATCATGCCAGCA
BMWN1_0022_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCTTTAAGCCAGCA
BMWN1_0087_H03.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0020_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0035_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCTTCATGCCAGCA
BMWN1_0022_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0098_C01.b : tagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0012_F04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCCTT*TGCCAGCA
BMWN1_0001_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0058_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTCCTTTTCATGCCAGCA
BMWN1_0045_G09.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCCTCTTGCCAGCA
BMWN1_0057_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0018_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0081_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0100_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0050_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0054_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0098_D04.b : tagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCCTTATGCCAGCA
BMWN1_0003_D04.b : tagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0012_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCCTCTTGCCAGCA
BMWN1_0081_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTGTTCCCATCATGCCAGCA
BMWN1_0036_B09.b : ttgtatttataccactcctccagggaatttaatgaattgGCTGTTCCCTTTATGCCTTCA
BMWN1_0010_F09.b : gtattatttaaccactcctatagggaatttaatgaattgGCTGTTCCCATTATGCCACCA
BMWN1_0043_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctttaaGCTGTTCCCATCATGCCAGCA
BMWN1_0049_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCCCATCATGCCAGCA
BMWN1_0096_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCCCATCATGCCAGCA
BMWN1_0070_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtatGGTTCCCATCATGCCAGCA
BMWN1_0048_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCCCATCATGCCAGCA
BMWN1_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcattgaTGTTCCCATCATGCCAGCA
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b :
BMWN1_0001_H02.b :
20110601C-007527 : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
---------+---------+---------+---------+---------+---------+ 168
BMWN1_0093_H08.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0053_C12.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0037_A07.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0015_D02.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0002_E11.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0091_A09.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0065_G01.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0070_E01.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0037_C01.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0089_E02.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0029_B08.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0098_G06.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0073_D09.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0022_A05.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0087_H03.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0020_G08.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0035_B11.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0022_D08.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0098_C01.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0012_F04.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0001_D06.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0058_A07.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0045_G09.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0057_D11.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0018_H08.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0081_C11.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0100_A05.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0050_E04.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0054_B10.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0098_D04.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0003_D04.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0012_B08.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0081_B08.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0036_B09.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCCACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0010_F09.b : CTCAGATTCCTGGCCCTGCTGGCCACCCCCCTGTCAACCTCCAGGGTTGGCTTGACCACC
BMWN1_0043_A06.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0049_A11.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0096_D02.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0070_G04.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0048_H02.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0044_F02.b : CTCAGATTCCTGGCCCTGCTGGCCAGCCTGCTGGCAACCTCCAGGGTTGGCTTGGCCACC
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b :
BMWN1_0001_H02.b :
20110601C-007527 : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
---------+---------+---------+---------+---------+---------+ 228
BMWN1_0093_H08.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0053_C12.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0037_A07.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0015_D02.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0002_E11.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0091_A09.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0065_G01.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0070_E01.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0037_C01.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0089_E02.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0029_B08.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0098_G06.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0073_D09.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0022_A05.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0087_H03.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0020_G08.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0035_B11.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0022_D08.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0098_C01.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0012_F04.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0001_D06.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0058_A07.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0045_G09.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0057_D11.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0018_H08.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0081_C11.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0100_A05.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0050_E04.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0054_B10.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0098_D04.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0003_D04.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0012_B08.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0081_B08.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0036_B09.b : CTGGCATACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0010_F09.b : CTGCCACACATTGTGGGCGGCAGGATGGCCCAGCCGCACGAGTTCCCCTTTCTGGCCTCC
BMWN1_0043_A06.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0049_A11.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0096_D02.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0070_G04.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0048_H02.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0044_F02.b : CTGGCAGACATTGTGGGCGGCAGGAGGGCCCAGCCGCAGGAGTTCCCGTTTCTGGCCTCC
BMWN1_0050_B10.b :
BMWN1_0060_A10.b : ttttggagagtacgacgxxxxxxxxxxxxxxxxxxxx
BMWN1_0031_E12.b :
BMWN1_0001_H02.b :
20110601C-007527 : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
---------+---------+---------+---------+---------+---------+ 288
BMWN1_0093_H08.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0053_C12.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0037_A07.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0015_D02.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0002_E11.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0091_A09.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0065_G01.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0070_E01.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0037_C01.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0089_E02.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0029_B08.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0098_G06.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0073_D09.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0022_A05.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0087_H03.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0020_G08.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0035_B11.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0022_D08.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0098_C01.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0012_F04.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0001_D06.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0058_A07.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0045_G09.b : ATTCAGAAACAAGGGAGGCCCTTTTGGGGGGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0057_D11.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0018_H08.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0081_C11.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0100_A05.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0050_E04.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0054_B10.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0098_D04.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0003_D04.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0012_B08.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0081_B08.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0036_B09.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0010_F09.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGCTCCATCCCCGCTTCCTCCTG
BMWN1_0043_A06.b : ATTCAAAAACGGGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0049_A11.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0096_D02.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0070_G04.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0048_H02.b : ATTCAGAAACAAGGGAGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0044_F02.b : ATTCAAAAACAAGGGGGGCCCTTTTGCGCCGGAGCCCTGGTCCATCCCCGCTTCGTCCTG
BMWN1_0050_B10.b : nnnnccgacggtagacgxxxxxxxxxxxxxxxxxxx
BMWN1_0060_A10.b : xxxxxxxxxxxxxxxxxxxxxggctgttcccatcatgccagcactcagattcctggccct
BMWN1_0031_E12.b :
BMWN1_0001_H02.b :
20110601C-007527 : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
---------+---------+---------+---------+---------+---------+ 348
BMWN1_0093_H08.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0053_C12.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0037_A07.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0015_D02.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0002_E11.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0091_A09.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0065_G01.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0070_E01.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0037_C01.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0089_E02.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0029_B08.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0098_G06.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0073_D09.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0022_A05.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0087_H03.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0020_G08.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0035_B11.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0022_D08.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0098_C01.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0012_F04.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0001_D06.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0058_A07.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0045_G09.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0057_D11.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0018_H08.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0081_C11.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0100_A05.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0050_E04.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0054_B10.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0098_D04.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0003_D04.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0012_B08.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0081_B08.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0036_B09.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0010_F09.b : ACATCCGCCACCTGCTTCCGTGGCAAGAACTGCCCAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0043_A06.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0049_A11.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0096_D02.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0070_G04.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0048_H02.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0044_F02.b : ACAGCGGCCAGCTGCTTCCGTGGCAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0050_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxAAGAACAGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0060_A10.b : gctggccagcctgctggcaacctccagggttGCGGAAGTGCCTCTGTGGTGCTGGGGGCC
BMWN1_0031_E12.b :
BMWN1_0001_H02.b :
20110601C-007527 : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
---------+---------+---------+---------+---------+---------+ 408
BMWN1_0093_H08.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0053_C12.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0037_A07.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0015_D02.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0002_E11.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0091_A09.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0065_G01.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0070_E01.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0037_C01.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0089_E02.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0029_B08.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0098_G06.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0073_D09.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0022_A05.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0087_H03.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0020_G08.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0035_B11.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0022_D08.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0098_C01.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0012_F04.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0001_D06.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0058_A07.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0045_G09.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0057_D11.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0018_H08.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0081_C11.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0100_A05.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0050_E04.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0054_B10.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0098_D04.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0003_D04.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0012_B08.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0081_B08.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0036_B09.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0010_F09.b : TATGACCTGAGGCACCTCGAGCAGTCCCGGCAGACATTCTCCATCATGAGCATCAGCCAG
BMWN1_0043_A06.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0049_A11.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0096_D02.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0070_G04.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0048_H02.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0044_F02.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0050_B10.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0060_A10.b : TATGACCTGAGGCAGCAGGAGCAGTCCCGGCAGACATTCTCCATCAGGAGCATCAGCCAG
BMWN1_0031_E12.b : ttttagagagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0001_H02.b :
20110601C-007527 : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
---------+---------+---------+---------+---------+---------+ 467
BMWN1_0093_H08.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0053_C12.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0037_A07.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0015_D02.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0002_E11.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0091_A09.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0065_G01.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0070_E01.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0037_C01.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0089_E02.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0029_B08.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0098_G06.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0073_D09.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0022_A05.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0087_H03.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0020_G08.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0035_B11.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0022_D08.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0098_C01.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0012_F04.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0001_D06.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0058_A07.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0045_G09.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0057_D11.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0018_H08.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0081_C11.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0100_A05.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0050_E04.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0054_B10.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0098_D04.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0003_D04.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0012_B08.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0081_B08.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0036_B09.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0010_F09.b : AACGGCTATGACCCCCATGCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0043_A06.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0049_A11.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0096_D02.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0070_G04.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0048_H02.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0044_F02.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0050_B10.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0060_A10.b : AACGGCTATGACCCCCG*GCAGAATCTGAACGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0031_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGATGTGCTGCTGCTGCAGCTGGACCGTGA
BMWN1_0001_H02.b : ttttncgagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007527 : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
---------+---------+---------+---------+---------+---------+ 527
BMWN1_0093_H08.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0053_C12.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0037_A07.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0015_D02.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0002_E11.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0091_A09.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0065_G01.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0070_E01.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0037_C01.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0089_E02.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0029_B08.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0098_G06.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0073_D09.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0022_A05.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0087_H03.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0020_G08.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0035_B11.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0022_D08.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0098_C01.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0012_F04.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0001_D06.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0058_A07.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0045_G09.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0057_D11.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0018_H08.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0081_C11.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0100_A05.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0050_E04.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0054_B10.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0098_D04.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0003_D04.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0012_B08.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0081_B08.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0036_B09.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0010_F09.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCATAATGCCACAGTGGA
BMWN1_0043_A06.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0049_A11.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0096_D02.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0070_G04.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0048_H02.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0044_F02.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0050_B10.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0060_A10.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0031_E12.b : GGCCAGACTCACCCCCAGTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
BMWN1_0001_H02.b : xxxxxxxxxtACCCCCACTGTGGCCCTGGTACCGCTGCCCCCGCAGAATGCCACAGTGGA
20110601C-007527 : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
---------+---------+---------+---------+---------+---------+ 587
BMWN1_0093_H08.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0053_C12.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0037_A07.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0015_D02.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0002_E11.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0091_A09.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTANGAGGCTTTTCTC
BMWN1_0065_G01.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0070_E01.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0037_C01.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0089_E02.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0029_B08.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0098_G06.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0073_D09.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0022_A05.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0087_H03.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0020_G08.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0035_B11.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0022_D08.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0098_C01.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0012_F04.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0001_D06.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0058_A07.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0045_G09.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0057_D11.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0018_H08.b : AGCTGGCACCCACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTANGAGGCTTTTCTC
BMWN1_0081_C11.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0100_A05.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0050_E04.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0054_B10.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0098_D04.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0003_D04.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0012_B08.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0081_B08.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0036_B09.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0010_F09.b : AGCTGGCACCCACTGCCAAGTTGCGGGCTGGGGGACCCAACGGCTTATGAGGCTTTTCTC
BMWN1_0043_A06.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0049_A11.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0096_D02.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0070_G04.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAAGAGGCTTTTCTC
BMWN1_0048_H02.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0044_F02.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0050_B10.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0060_A10.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0031_E12.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
BMWN1_0001_H02.b : AGCTGGCACCAACTGCCAAGTTGCGGGCTGGGGGACCCAGCGGCTTAGGAGGCTTTTCTC
20110601C-007527 : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
---------+---------+---------+---------+---------+---------+ 647
BMWN1_0093_H08.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0053_C12.b : CCGCTTCCCAAGCGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCACAGAGACAT
BMWN1_0037_A07.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0015_D02.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0002_E11.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0091_A09.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAAAGACAT
BMWN1_0065_G01.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0070_E01.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0037_C01.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0089_E02.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0029_B08.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0098_G06.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0073_D09.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0022_A05.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0087_H03.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0020_G08.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0035_B11.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0022_D08.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0098_C01.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0012_F04.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0001_D06.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0058_A07.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0045_G09.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0057_D11.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0018_H08.b : CCGCTTCNNCAGGGTGCTNCATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0081_C11.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0100_A05.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0050_E04.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0054_B10.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0098_D04.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0003_D04.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0012_B08.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0081_B08.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0036_B09.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0010_F09.b : CCACTTCCCAAGGGTGCTCAATGTCACCATGACCTCAAACCCGTGTCTCCCCAAAGACAT
BMWN1_0043_A06.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0049_A11.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0096_D02.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0070_G04.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0048_H02.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0044_F02.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0050_B10.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0060_A10.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0031_E12.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
BMWN1_0001_H02.b : CCGCTTCCCAAGGGTGCTCAATGTCACCGTGACCTCAAACCCGTGTCTCCCCAGAGACAT
20110601C-007527 : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
---------+---------+---------+---------+---------+---------+ 706
BMWN1_0093_H08.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGGCGCATCAGCCAGGGAGACAGAAGCACCCCCC
BMWN1_0053_C12.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAAGGAGACAGAGGCACCCCCC
BMWN1_0037_A07.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0015_D02.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0002_E11.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGagctccggcttcttcacc
BMWN1_0091_A09.b : GTGCAATGTTGTCATCAACCGCCCGGGGCCGCATCCACCAGGGAGACAGAGGCACCCCCC
BMWN1_0065_G01.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0070_E01.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0037_C01.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAAGCACCCCCC
BMWN1_0089_E02.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0029_B08.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0098_G06.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0073_D09.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0022_A05.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0087_H03.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0020_G08.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0035_B11.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0022_D08.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0098_C01.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAAGCACCCCCC
BMWN1_0012_F04.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0001_D06.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0058_A07.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0045_G09.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0057_D11.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0018_H08.b : GTGCATTGGTGTCTTCAGCCCGCCGGGGC*GCATCAGCCAGGGAGACAGAGGCACCCCC*
BMWN1_0081_C11.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0100_A05.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0050_E04.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0054_B10.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0098_D04.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0003_D04.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0012_B08.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0081_B08.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0036_B09.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCCCCCCCC
BMWN1_0010_F09.b : GTGCATTGATGACATCAGCCG*CCGGGGCCGCATCAGCCACGGAGACAGACGCACCCCCC
BMWN1_0043_A06.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0049_A11.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0096_D02.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0070_G04.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAAACAGAGGCACCCCCC
BMWN1_0048_H02.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0044_F02.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0050_B10.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0060_A10.b : GTGCATTGGTGTCATCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0031_E12.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
BMWN1_0001_H02.b : GTGCATTGGTGTCTTCAGCCG*CCGGGGCCGCATCAGCCAGGGAGACAGAGGCACCCCCC
20110601C-007527 : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
---------+---------+---------+---------+---------+---------+ 764
BMWN1_0093_H08.b : TCGTCTGCAA*ACGCCTGGCGCAGGGCGTGGCCTCCTTTCTCGGAANGCGTT**NCGCAN
BMWN1_0053_C12.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTTCTCCGGAAGGGTTTTCCGCAA
BMWN1_0037_A07.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0015_D02.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGCCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0002_E11.b : cgcgtggcgctcttcagaaattggattgattcagttctcaacaacccgccggcctgaang
BMWN1_0091_A09.b : TCGTCTGCAA*CGGGCTGGCCCAAGGGCTGGCCTCCCTCCTCCGGAagcttttcccacag
BMWN1_0065_G01.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0070_E01.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCCTCGGNNAGGC*GTTCGCAN
BMWN1_0037_C01.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTNCCTCCGAGCGT**TTNCGCAN
BMWN1_0089_E02.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAN
BMWN1_0029_B08.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCCTCGGAGGCGT*TTCCGCAN
BMWN1_0098_G06.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAN
BMWN1_0073_D09.b : TCGTCTGCAA*CGGCCTGGCGCAAGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCAGCAG
BMWN1_0022_A05.b : TCGTCTGCAAACGGCCTGGCGCAAGGCGTGGCCTCCTTTCTCCGGAGGCGT*TTCCGCAG
BMWN1_0087_H03.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0020_G08.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0035_B11.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0022_D08.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0098_C01.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCTTCCGGNAGCGT*TTCCGCAA
BMWN1_0012_F04.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGCCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0001_D06.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0058_A07.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0045_G09.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0057_D11.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAN
BMWN1_0018_H08.b : TCGTCTGCAA*CGGCCTGGCGCAGGGGCGTGCCCTCTTCCTCCGGAAGCT**TTTCGCAA
BMWN1_0081_C11.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTTCCTCGGAGGCGT*TTCCGCAG
BMWN1_0100_A05.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0050_E04.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0054_B10.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAA
BMWN1_0098_D04.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0003_D04.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0012_B08.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0081_B08.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTC*GGAGGCGT*TTCCGCAG
BMWN1_0036_B09.b : TCGTCTGCTC*CGGCCTGGCGCATGTCGTGGCCTCCTTCCTCCGAAGCGT**TTCCGCAA
BMWN1_0010_F09.b : TCGTCTGCAA*CGGTCTGCCGCAAGGCGTGGCCTCCTTCCTCCCGAGGCGT*TTCCGCAG
BMWN1_0043_A06.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0049_A11.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0096_D02.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCCTCCGNNA*GCGTTCCGCAN
BMWN1_0070_G04.b : TCGTCTGCAA*CGGCCTGGCGCAAGGCGTGGCCTCCTTCCTCCAGATGTCT*TTCCGCAG
BMWN1_0048_H02.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0044_F02.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0050_B10.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0060_A10.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0031_E12.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
BMWN1_0001_H02.b : TCGTCTGCAA*CGGCCTGGCGCAGGGCGTGGCCTCCTTCCTCCGGAGGCGT*TTCCGCAG
20110601C-007527 : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
---------+---------+---------+---------+---------+---------+ 823
BMWN1_0093_H08.b : GAGCTCCNGCTTTTCTCACCGCGTGGCGCTCTTCAGAAATTGGATTtgatcagttttctc
BMWN1_0053_C12.b : GAACTCCGGCTTCTTCACCCGCGTGGCGCTCTTTCAAAACTGGAATTGATTCAGTTCTCA
BMWN1_0037_A07.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAAAACTGG**ATTGATTCAGTTCTCA
BMWN1_0015_D02.b : GAGCTCCGGCTTCCTTCCCCGGCGTGCCGCTCCTCAAAATTGGGATTGATTCATTTCTCA
BMWN1_0002_E11.b : atcccctcgccgagcccgtggggagggggncnnntnnn
BMWN1_0091_A09.b : acccccgctttcttccccccgtggcgcttttcaaaaatgggaattattcatttccaaaaa
BMWN1_0065_G01.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0070_E01.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTTCTC
BMWN1_0037_C01.b : GAGCTCNGGCTTTCTCACCCGCGTGGCGCTCTTCAAAAATGGG**ATGAATCAGTTCTCA
BMWN1_0089_E02.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0029_B08.b : GAGCTCCNGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTTCTC
BMWN1_0098_G06.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0073_D09.b : GAGCTCGGGCTTCTTCACCCGCGTGGCGCTCTTCAAAAACTGG*ATTGATTCAATTCTCA
BMWN1_0022_A05.b : GAGCTCCGGCTTCTTCCCCCCCGTGGCGCTCTTCACAAATTGG*ATTGATTCAGTTC*CA
BMWN1_0087_H03.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0020_G08.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0035_B11.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAAAATTTGG*ATTGATTCATTTCTCC
BMWN1_0022_D08.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0098_C01.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAAAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0012_F04.b : GAACTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAAAAAATTGAATGGATTCAGTTCTCA
BMWN1_0001_D06.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0058_A07.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCCGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0045_G09.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0057_D11.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0018_H08.b : GAACT*CGGCTTTCTCACCGGCGTGGCGCTCTTCAGAAATTGG*ATTGAATCAGTTCTCA
BMWN1_0081_C11.b : GAGCTCCCGCTTCTTCAACCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCANTTCTCA
BMWN1_0100_A05.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0050_E04.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0054_B10.b : GAACTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAAAAATTGG*ATTGATTCAATTCTCA
BMWN1_0098_D04.b : GAGCTCCCGCTTCTTCACCCGCGTGGCGCTCTTCAAAAACTGG*ATTGATTTCATTCTCA
BMWN1_0003_D04.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0012_B08.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0081_B08.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAAAACTGG**ATTGATTCAGTTCTCA
BMWN1_0036_B09.b : GAGCTCCGGCTTCTTCACCCGCGTGGCCCTCTTAAAAAATTGG*ATTGATTCCGTTCTCA
BMWN1_0010_F09.b : GAGCTCCAGCTTCTTCCCCCGCGTGGCGCTCTTCACAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0043_A06.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAAAAACTGG*ATTGATTCATTTCTCA
BMWN1_0049_A11.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0096_D02.b : GAGCTCCGGCTTTCTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0070_G04.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0048_H02.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0044_F02.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0050_B10.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0060_A10.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAACTGG*ATTGATTCAGTTCTCA
BMWN1_0031_E12.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
BMWN1_0001_H02.b : GAGCTCCGGCTTCTTCACCCGCGTGGCGCTCTTCAGAAATTGG*ATTGATTCAGTTCTCA
20110601C-007527 : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCCGTGGGAAGGGGGGCCTGTTAGCC
---------+---------+---------+---------+---------+---------+ 883
BMWN1_0093_H08.b : acacccgccngctgaangatccctcgcacnncnnggggaagagggggnnnnnn
BMWN1_0053_C12.b : ACAACCCGCCGGGCTGAAAGAatccctccccccaacccgtgggaaggggggcctttttat
BMWN1_0037_A07.b : ACAACCCGCCGGCCTGAAAGATCCCCcccccaaccggtgggaggggggctttttnttcct
BMWN1_0015_D02.b : ACAACCCGCCGGCCTTGAAGATCCCCCTCCCCGACCCCGGGGGAGGGGGGcttgtttacc
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : ccccccggcctaaagatcccccccccaacccctgggaagggaattantagcttcattttn
BMWN1_0065_G01.b : ACAACCCGCCGGCCTGAANGATCCCtcgcgagccgtggggaagggggnnnnnn
BMWN1_0070_E01.b : ACAACCCGCCGGCCTGAANGATCCCCTCGCgagcgtgggggaagggggggnnnnnnnnnn
BMWN1_0037_C01.b : ACAACCCG*CGGCCTGAAGGATCCCCTCGCgagcggtggggaaggggnnnnnnn
BMWN1_0089_E02.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCgaccgnttgggaagagggggggnnnnn
BMWN1_0029_B08.b : ACAACCCG*CGGCCTGAAAGATCCCCTCGCgagccgtgggggaagggggnnn
BMWN1_0098_G06.b : ACAACCCGCCGGCCTGAANGATCCCCTCGCCGAGCgttggggaaggggggncnngttanc
BMWN1_0073_D09.b : CCA*CCCGCCGGCCTGAAAGATCCCCTCGCCAAGCCGTGGGagggggaccttttaatcct
BMWN1_0022_A05.b : ACAACCAGCCGGCCTGTAAGAATCCC*TCACCGAACCCGTGGGAGGGGGtctctcttccc
BMWN1_0087_H03.b : ACAACCCGCCGGCCTGAAAGATCCCCTCGCCGAGCCGTGGGGGAGGGGggcntgtnnggc
BMWN1_0020_G08.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCCGTGGGAAGGGGGnnntnnnnncn
BMWN1_0035_B11.b : ACAACCCGCCGGCCTGAATGAATCCCTCGCCCAGCCCTTGGGGAGGGGGtccttttaccc
BMWN1_0022_D08.b : ACAACCCGCCGGCCTNGAAGATCCCCTCGCCGAGCCCGTGGGGAGGGGGGggctgttnnc
BMWN1_0098_C01.b : ACAACCCGCCGCCCTTGAAGATCCCCTCGCCGAGCCGGGGGGAAGGGGGGnccttttncc
BMWN1_0012_F04.b : ACAACCCGCCGGCCTGAA*GATCCCCTCGCCCAACCCGTGGGAAGGGGGCCtgttaaccc
BMWN1_0001_D06.b : ACAACCCGCCGGCCTGAAGGATCCCC*TCGCCGAGCCCGTGGGAGGGGGGCctnn
BMWN1_0058_A07.b : ACAACCCGCCCGCCTGAAAGATCCCCTCGCCGAGCCCGTGGGAGGGGGGGCtnttncccc
BMWN1_0045_G09.b : ACAACCCGCCGGCCTGAAAGATCCCCTCGCCGAGCCCGTGGGGAGGGGGGCCTnntnncc
BMWN1_0057_D11.b : ACA*CCCGCCGGCCCTGAAGATCCCCTCGCCGAGCCCGTGGGGAGGGGGGCnggttnccc
BMWN1_0018_H08.b : ACCACCCGGCGGCCTGAAGGATCCCCTCGCgagcgngggnaaagagggggnnnnttnnnn
BMWN1_0081_C11.b : ACAACCCGCCGGCCTGATAGATCCCCTCGCCGAGCCGTTGGGAAGGGGGGCCTttttncc
BMWN1_0100_A05.b : ACAA*CCGCCGGCCTGAAGGATCCCCTCGCCGAGCCGTGGGGAGGGGGGGCTGTTtn
BMWN1_0050_E04.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCGTGGGGAAGGGGGGCCTGTtnnnc
BMWN1_0054_B10.b : ACAACCCGCCGGCCTGAAAGATCCCCTCGCCGAGCCGGTGGGAGGGGGGGCttttttccc
BMWN1_0098_D04.b : ACAACCCGGCGGCCTGAAGGATCCCCTCGCCGAGCCCGTGGGAGGGGGGGC*TGTTACCC
BMWN1_0003_D04.b : ACAACCCGCCCGCCTGAAAGATCCCCTCGCCCAGCCCGTGGGAAGGGGGGCCTGTTAACC
BMWN1_0012_B08.b : ACAACCCGCCGGCCTGAAAGATCCCCTCGCCGAGCCCGTGGGAGGGGGGGCCTGTTAACC
BMWN1_0081_B08.b : ACAACCCGCCCGGCTGAAGGATCCCCTCGCCGAGCCCGTGGGGAGGGGGGCCTGTTANNC
BMWN1_0036_B09.b : ACAACCCCCCCGGCctgaatgatcccctccccaaccccgtgggaggggggtcctttatcc
BMWN1_0010_F09.b : ACACCCCGCCGGCCTGAACGATCTCCTCCCCCAACCCGTTGGGAGGGGGGCTtgttaacc
BMWN1_0043_A06.b : ACAACCCGCCGGCCTGAAGGATCCTCTCGCCGAGCCCGTGGGGAGGGGGGCtcgctttcc
BMWN1_0049_A11.b : ACAACCCGCCGGCCTGAANGATCCCCTCGCgagcgggggggaagggggggncnnnntaan
BMWN1_0096_D02.b : ACAACCCGCCGCCCTGAAGatcccctcgcgagccgttgggaaagggggg
BMWN1_0070_G04.b : ACAACCCGCCGGCCTGAAGGAcccctcgccgagccctggggaggggggctttattcctct
BMWN1_0048_H02.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCGGGGGGAGGGGGGnnggnnnncnn
BMWN1_0044_F02.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCCGTGGGAAGGGGGNCTNTTTTCCC
BMWN1_0050_B10.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCCGTGGGAGGGGGGCn
BMWN1_0060_A10.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCCGTGGGGAGGGGGGCCTGTTANCC
BMWN1_0031_E12.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCCGTGGG*AGGGGGGCCTGTTATCC
BMWN1_0001_H02.b : ACAACCCGCCGGCCTGAAGGATCCCCTCGCCGAGCCCGTGGG*AGGGGGGCCTGTTAGCC
20110601C-007527 : CCCTGGAGCCCTGCCCCCACTGCCACACCTCCCGCGCTGCGTGTCCCATCCCAAAGCCCC
---------+---------+---------+---------+---------+---------+ 943
BMWN1_0093_H08.b :
BMWN1_0053_C12.b : ccctcattaatactcttaacccaaatctttatcttcccaacactgttttccccatccaaa
BMWN1_0037_A07.b : tttatatctattattnatttacaatcatctaaatatactttttcatttcaaaactctaaa
BMWN1_0015_D02.b : cccctggaagcctgcccccaatgcaaaccttccgggctggtggtcccatcccaaacccct
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : ttataagtaaaccttttttatggtataaatttgaaaacactaaaagagaagatatgtaga
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b : ccn
BMWN1_0073_D09.b : cattaacacgtctctattttctaacctttcaacctaaagctcctaccacaaacctccttt
BMWN1_0022_A05.b : tcctctatcactcccacatatacacaccatcctatgatcaattcctcaccaaacccactc
BMWN1_0087_H03.b : nnntgg
BMWN1_0020_G08.b : nnnnnnnnnnnnnnnnnnnnngnnnnanntnnnnngntngnngncnnnnnnnnnnnnnnn
BMWN1_0035_B11.b : ccctttaaccctttctccattgtctttatctttctatgttgcctgtccactcacaaaacc
BMWN1_0022_D08.b : cccctgganccctgcccccacttgccancctttccgggcttgcctgtcccatcccaaagc
BMWN1_0098_C01.b : ccct
BMWN1_0012_F04.b : ctggaaaccctgcccccatgcacacctcccgggttgttgttccctccaaaaccccttcct
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : ttgtaacccttctccatctgcccactctccctccgtttctgtcccacccaaagccccttc
BMWN1_0045_G09.b : ccntgnncccctgtcccctttgcccccccttcccgtttgttgtccccccttacccccctt
BMWN1_0057_D11.b : cn
BMWN1_0018_H08.b : ccnnggaancnggncnnaaagggaaaaannnnccgggggggggtgccaacccaaaacccc
BMWN1_0081_C11.b : cccnt
BMWN1_0100_A05.b :
BMWN1_0050_E04.b : cc
BMWN1_0054_B10.b : cttgtaacctctcccccattttctaatctccgacgcgtcatgatccatccaaaaccccaa
BMWN1_0098_D04.b : CCCTGGAACCTTGCCccaatggcaaaactccggagtgggtgtccaatcctaagccccatc
BMWN1_0003_D04.b : CCCTGGAGCCCTGCCcccctgccacaccttccgggctgcgtgtcccatccaaaaccccat
BMWN1_0012_B08.b : CCCTGGAGCCCTGCCcccaatggcacacctcccgggctgcgtgtcccatcccaaaccccc
BMWN1_0081_B08.b : CCCTGAANCCCTGCCcccatggcaaaaccttccggcctgcggggcccatcccaaaacccc
BMWN1_0036_B09.b : cactgtttactatttctcactttgttaatcctatctaaattttttttccaattaattccc
BMWN1_0010_F09.b : ccctgtaagcccgccccccctgccaaacctaccgggatggtggtcccctatccaaagcct
BMWN1_0043_A06.b : ccctgtaacccggaccctagtgaaacaactccaccgtgctagtacactcccaacccccta
BMWN1_0049_A11.b : ccnnnggggagnnggggccnnagtggnaaannnccggggggggggggggncaaancaaaa
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : gtgtattttttacacccttcaaaagtcaataatatattgtgtaaattccctccctctcca
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : CCtgtnnccttgcccctttgcccctcctcccgctctgcttgtccggtcgcgcggcccctg
BMWN1_0050_B10.b :
BMWN1_0060_A10.b : CCCTGGAGCCCTGCCCCCACTGCCACACCTCCCGCGCTGCGTGTCCCATCCCAAAGCCCC
BMWN1_0031_E12.b : CCCTGGATCCCTGCCtcctcctgccactcctccctcgctttgtgtaacatccctaatccc
BMWN1_0001_H02.b : CCCTGGAGCCCTGCCCCCACTGCCACACCTCCCGCGCTGCGTGTCCCATCCCAAAGCCCC
20110601C-007527 : ATCCTGGACCGCTCTGTCGAGGCTGTAATAAAGAAGCTGTTACCATTCAAAAAAAAA...
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b : attcatttttcttcaccctttttttaagatccctaaaaataaaacttttacaccttctaa
BMWN1_0037_A07.b : atcaacaataccatttgattcttaaaaacaaaccacttcacttttcaaattatatctaca
BMWN1_0015_D02.b : tccttgaaccgtttgttcaggcttgaataaaaaacttgttccctttcaaaaaaatnaaaa
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : tagcgagcatatgccgctaggtcttctataccatgataaaatctttagtatatcaatccc
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : tgaccgttttttatctagcccttacaataatccttttccctttcattaattaaacttcac
BMWN1_0022_A05.b : cataaacctcccttcacgttgtaataattcatacgcaccataccataaaccactgcgcac
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : nnnnnngnnnggngngggggggggttnggggggngggtggttttttgtttgtggggggtg
BMWN1_0035_B11.b : tcctttcttgtacccttttttctaggcttgtataataaaattcttttccttttccaataa
BMWN1_0022_D08.b : cccctcttgggaccgcttctgtcaggcttttataaacaagcctgttccctcttataataa
BMWN1_0098_C01.b :
BMWN1_0012_F04.b : ggaccgcttggcaaggttgtaaaaaaagctttttcccttccnntaaaaaaaaatataatt
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : caagacccttctcgataagcatttataaaacatccgttcccttcctcgaacgcaattcat
BMWN1_0045_G09.b : ctggccccttgttttcgcgtccgatgcctactttgttccttcttttccgtttgcgtgctc
BMWN1_0057_D11.b :
BMWN1_0018_H08.b : ctcctgaaacccccttttaagactttaaaaaaaaaacttttacacttccccaaaaa
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b : tcatggatctcttctgacaaggcgtaaataaaaaaccgtttccttctcatatataacaaa
BMWN1_0098_D04.b : ctggaacgcccggtcgaggcccaaataaaaaactggttcctttccaaataaaataaataa
BMWN1_0003_D04.b : ccgggaccgctctgtcaaggctttataaaaaagcttgtacctttccccgnggctttatac
BMWN1_0012_B08.b : tccctggaccgctctgtcgaagctctaataaaaaactgtttccatccaaaaaaaaaaaaa
BMWN1_0081_B08.b : ttccgggaacgttctgtccaaggctttaaaaagaaagctgtttcctttcccgannanaag
BMWN1_0036_B09.b : cccattctgaaccattttttcctattctttattacagaaccgttactctttctcaccatc
BMWN1_0010_F09.b : aatctggactttctctgttaggcccaccaaaaaacctgttacccttcattatacccacac
BMWN1_0043_A06.b : ctggacgccctttcgcagctcttcacaataccctgttcctcctcaaacaagaataacagc
BMWN1_0049_A11.b : anccccatccggaaccgctcgtgtcgaggctgataaaaaaaaagctgtttccatttcttc
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : gagaactctacggtatggtgtataaaatatctcctttactatttaaaaataacacttctc
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : ctttgcccccctgtgtcgtgtctcttatcagtaacatgtctccttcctgcgcgtgcacga
BMWN1_0050_B10.b :
BMWN1_0060_A10.b : ATCCTGGACCGCTCTGTCGAGGCTCTAATAAAGAACCTGTTACCATTCAAAAAAAAA
BMWN1_0031_E12.b : catcctggaacgctctgttaaggttgtaataaaagatctcgtaccattctaacaatattc
BMWN1_0001_H02.b : ATCCTGGACCGCTCTGTCGAGGCTGTAATAAAGAAGCTGTTACCATTCAAAAAAAAA
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b : tttaaactatacacctaaaaattaaatttacaccactatcgctcctctcttaaatactcc
BMWN1_0037_A07.b : atataaaaaatacttctccttaatacttataaattattactttacaacttttccctcttc
BMWN1_0015_D02.b : ataaaattaatttcttttctttaatgtctcatttctttctattctttcttttccccgccc
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : aggcgacgaaactaggcctcaaaacaaaccgaatcacatatattacaactctcactccct
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : tctttatataattataattactctacctttcctctttcttcattatctatataaagctat
BMWN1_0022_A05.b : tatcttcatattttttcataccaccctcctttcctaatctcctcctattacgtctcccac
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : tgtttttgtgtgtggttgtggttcgtttgtttgtttgtttttttgtttggggtgttgttt
BMWN1_0035_B11.b : ataaattcttatatttattcaaaaatcacttcaatttcatcgtcattttcctaactctct
BMWN1_0022_D08.b : aactcgacaaaattacaatatttaaaaaactgttttctggcgcgcgcatacctttatgac
BMWN1_0098_C01.b :
BMWN1_0012_F04.b : atattattttatttatttccttctctctctttttctttgttcgtgtttcattcttttgtc
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : acacacataaccttccctcacccccccctctctccatccccgcattctcttccctccgcg
BMWN1_0045_G09.b : tccgccctgctgcgtgttttgcccgtgttttccttttgctggccccgtcggcgtttctcc
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b : cttttttttattctaaaaaaaatcatccccacacatataattaaatcctttgagctctct
BMWN1_0098_D04.b : atataactactattttatatttatttttattaatattatatttcctcccgcccccccctt
BMWN1_0003_D04.b : cccgttaagtaataatacacaaaaaataatatatcccatcaattttgtcacaattgacga
BMWN1_0012_B08.b : aataaaaaatttattttttatttttnnatattattttgtcccgcggcccccgacccccct
BMWN1_0081_B08.b : aacaataaatagctttttctaacatattctttccttttgttcantttttttctccgggcc
BMWN1_0036_B09.b : attcaactattacaattttttatgtacactaaaatcactattactttttttctcaacatc
BMWN1_0010_F09.b : ccccctcttctatcttatttatcttcttccccacacacaaacacactttctatcaccccc
BMWN1_0043_A06.b : tctgaatccaccgattctcctcaacatcacgtggtaaacctccctcacaccgctcactac
BMWN1_0049_A11.b : cccgcaaaaaaaaaaaaaaaaaaa
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : gctacgcttccatatttattttatattaatatctatactacaactatctctttttatgtc
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : gagaaagcataacagctcatctgtagtggacgtcgcctcgctataccgtggcggcggcag
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : aaattattactatattatatatttacctaaatttacaacagaatatttattataattaca
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b : cccttttcatattataaacagatatttatcaatcatgtctttattattgatgaatttaat
BMWN1_0037_A07.b : taaaaattcattaaattaacttatctatcttctaattaaaaaatattgtgaaaattttgg
BMWN1_0015_D02.b : ccccattcccctttggggggtttttggaccacacaaaaaaaaatctgttaatttggccac
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : actacaaacgactatttaaataatcattaactaccattaatcacgcaatctatatacaaa
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : tttaagccattttctctcttatactctaaaatttcttttcttcatatatcactttgttca
BMWN1_0022_A05.b : tcaccctaattacagtttaacactaccatatactactcgtctccccatatcattttatcc
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : ttngttttgggtttggtttgtttttttgttggtgggtgtggtgtggttggtttggtntgg
BMWN1_0035_B11.b : atattactatttattttcttctcttttttcctcatattttattttgtcattatttttcat
BMWN1_0022_D08.b : tgtgcccttggctcctatcccctctacgaacttttatagttcaaacacacaaaaaaaacg
BMWN1_0098_C01.b :
BMWN1_0012_F04.b : cggggggtgaatcctcttggtggggttattctctcctcaactgacatccttctggattgt
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : ccccatttcatctttgggcattcttagtatcccccctccctctcttgtatttttgtactc
BMWN1_0045_G09.b : ctttcgggggtgggtcgcttgtccctttcgcgcgttgtttcggttgtcctcctctgtcgt
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b : cccttctactttttataataatatattctagtattctgtcttttaaaatcactttccaca
BMWN1_0098_D04.b : tatcgctgttatgaggtttatatctcacaaattattacttctatctgtttctccctcccc
BMWN1_0003_D04.b : tggtgtcggcggcccccatccccttttggggggttgtgcgcctctaattaaaaccacctg
BMWN1_0012_B08.b : tgggggggttatttggatccaaaataaaaaaacacttgaggagttggaccacccacttta
BMWN1_0081_B08.b : ccaaatccctctcagaagagataattttattcgagtcgatgacctctcttctaattggaa
BMWN1_0036_B09.b : ttctcgataatcaatatattttatatacttcactacttcctcccacttttctttcctatt
BMWN1_0010_F09.b : cctcttcgttcccctcattttatctcgccactatcctctttcctcttacttaaatcacct
BMWN1_0043_A06.b : tctctatacgccggattaataccacccgcagaagcaccgatcacgcacgccataatagcc
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : attttttaccatcaataaacataacacctatttttaaatatatttcttaatcatttttag
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : atgcccagagggaggtcacagtcgcgagcaaacggtccaacgctcgataggtcgagcaaa
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : cttttttaatcatttaaattgattattattcttcttatcgtaccaattatttctttaaaa
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b : caccatttttttcaataatatactatatataatagaatctatctattattatttctattt
BMWN1_0037_A07.b : taaggacatcacaaaaaattggaaaactctcagttagtaaacatttaacgtcaagtcctt
BMWN1_0015_D02.b : ccccattatagggggaaaaaaaactctttttataaaattgggaccttctctttctttgac
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : gaatacagaagtagataaggagcacgaaaatgtaacaacgatgagtactagaacagcgca
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : taatatatattatgatcattatgttatcaacttttctatatttaattcctatatcttatt
BMWN1_0022_A05.b : tatccatcctatacgtattattaccacctcaacacataccactactctataatgcctctc
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : tngtgggntggtggtgtgtgtgtgtttttgtgtttgttttgtgtgtgggtgttggtggtg
BMWN1_0035_B11.b : ccactttactataacttaatttaacttttccttacatctcttcgtcttaccacacatata
BMWN1_0022_D08.b : tgcgatttagcacctatttgtgacactagcaaacatactctatttgatacttcgaacaca
BMWN1_0098_C01.b :
BMWN1_0012_F04.b : gccccacacccaaagcgaaaaaatatccttctttgaatttgacaccttttttttcaaaca
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : ccccctcccaaacgccacaaccctccttttgccccctcgctccctcctctcatcacctgc
BMWN1_0045_G09.b : cgcggtcgtggtgtcttctgtttcgcgttcacgtacctttcttgtgccccattacaaata
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b : agagatatctaactcacctacatcataatatcttttttttaatcgctcttttttcacgta
BMWN1_0098_D04.b : ctcaaaaagctaagaatattctctattttctaaatatttgtctctactttatcttaacaa
BMWN1_0003_D04.b : gtaaatcgcacaaaccccgctaagcactgaacaagcctttttttgaattcgagattttcc
BMWN1_0012_B08.b : aagggaggaaaaaaggtttattgggaaattggaagaccttgcttttttcaacctttacgc
BMWN1_0081_B08.b : gcacccactctcaaccagcaaaaaattgtttttaaaaattctctcctacatttataatca
BMWN1_0036_B09.b : acttacctttcgtgtcctctctctatgtttttacacacttataattcgctatgtactctc
BMWN1_0010_F09.b : ctccaccccccctcatatcctgtatcttctcactctctctttatacccttctctcatact
BMWN1_0043_A06.b : tgccaacgccgtgaatatcccactcatcaactacacactactaactgctgccaatcccat
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : atctatttatgtaaatactatgataaagttcttcatatattttttattgtactatactat
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : cgacgctcgttgccggaaaattgtgtggtttcgtagtcgcccctgacccggtggcaacaa
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : aaaaatattttaacatttatcaaatatatccatcattattttattattattttttatcaa
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b : atatttagaattacaattcattattgact
BMWN1_0037_A07.b : attataaaacataattcacacatatatgatcgatacatctgaattgtaagtgttaagtag
BMWN1_0015_D02.b : cccatacgccctaaaatatctaacacacttttcttttttttttttcgcctgggggggagg
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : taaactacctctcacagtaatcgctagagcgcgtcgccagagataatcactatttatgta
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : atttatcaccccaattcttctaatttcctctcacttatactgttaatctaatgtactcca
BMWN1_0022_A05.b : cactcacccctcacattctcttctaacactacctatcatccaaccaccctaatatacatc
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : ttttgttgtggtgtgttggtgggtgtggtggtgtggtgttttgtgttgttggtgtgtgtg
BMWN1_0035_B11.b : ccttcctcaatatactcttctcgctatgttctatattaatatactttaatatttacacta
BMWN1_0022_D08.b : tcctcaattaacacaacatacttcattcacgttcttacctactcactccttaatactact
BMWN1_0098_C01.b :
BMWN1_0012_F04.b : ttgacacaataattttacacctccattttttattttgctttagtagggggaagatcattt
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : gacctacccgacaacaatccccatacctttttttccttattgacgtcacgggcacagtac
BMWN1_0045_G09.b : gacaaatgacgaactgactgaatactatcccttccagagggggcgctggcatctgttgtg
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b : atcttttcatatattcaaaattatccacacgtccatcagaagtagaaacacacctattct
BMWN1_0098_D04.b : caaaacatcatataaaccaactcttcttgtatctttttcctgtgaatgggggagagtatc
BMWN1_0003_D04.b : ttctcaccaatactctctataaaagtcaccctcttcttttttttttcttggggggggggg
BMWN1_0012_B08.b : cgaaaaaaattttaccaacaattccttttttttgttcagtgcgggaggggggggagtttt
BMWN1_0081_B08.b : tcttctctcgcacaaaaaaataacacaaatttttacattattctttctttgggcggggga
BMWN1_0036_B09.b : tactattatacacacttctttatttaatttgtatactctaacacatgttacaatacaaaa
BMWN1_0010_F09.b : ccccaaccgccactcatttactatcttatactcttactcacctccccctctccatatttt
BMWN1_0043_A06.b : atgtgctacaaatgaatgcgcatcgcaacaagccctacaataacgtcaaatcatctctac
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : tcattttattctcataaactccactgacattagggcgttttatacatattctcttcttca
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : cacttgttatctacttaaagtgcaggtcaatgctacccgcatatgtatgcaatcgaagga
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : gcttatgcttcattttacatattttatattctacttttttctttaagttatttatgcttc
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b : tctcctcgagtacagcaaacattcatcttgatctatacttgcaaaatatgactgagcatg
BMWN1_0015_D02.b : gattttttttccttataaactccccactgtgaaagtgcttattttgtcctcctttttcat
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : tgaatagaagatcaccatttcttaaataaatgcacgacacaaaactccatacagatacgc
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : catctattacattcctatcgatcctaacatataatcaccctcattacatctcaatcctcc
BMWN1_0022_A05.b : taccacgactatcacaccctcctccccaaccatcttttcattacaacaatacaactaata
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : ttggtaggtttttggtgtatgtggtgtggttggtgtgtggggggtttttgttgtggtttt
BMWN1_0035_B11.b : tctacatctacaaattactctatctatccctaactattaatttggttatctgctgcactg
BMWN1_0022_D08.b : ctacgtggaatcagatcctctcttttaattaacatacaccctcacccattacttctacca
BMWN1_0098_C01.b :
BMWN1_0012_F04.b : cccctttgaactactcctcgctaatgttctttttattttctcctcctctcttcttttggt
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : aaaccctcactttaaccaaaactattcgcagcttttctcgttatctccacctctacttaa
BMWN1_0045_G09.b : caaagcgtgacccatggaatagactccatgagacatcccattgcgccgtatcagcgcgat
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b : ttgctctccttaagacgatattatgaacatacctctcatattttactctccaccacacca
BMWN1_0098_D04.b : tactaactactactcacttttgatgctatatactttaattaaaataaaaatcgtttctcg
BMWN1_0003_D04.b : gggcttctcatttaatataccaccttggaagttttttgccacatttctcacccagggccg
BMWN1_0012_B08.b : tctcctatataacccccacgcgggagagggtgtttttatggtttcttcctcctctacaaa
BMWN1_0081_B08.b : ggttttctttatttactaccacatcggcagcatgttcataatctcttctctctcctcaat
BMWN1_0036_B09.b : tcttcattaaatactccataacccattcactatccttctcttgtcattcttctatctatt
BMWN1_0010_F09.b : tactactttatattatcccccccacacccccttttctttttctaccctctttattctcct
BMWN1_0043_A06.b : gaagtgaaactatacgtttcgcagctcctaacccataacaaaaattcacgtcgcgcctca
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : caccttattacatcatatgtttccttcttacatacgtctctctatctctanccatacttc
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : ctgcgatcangtatacgttagaatatggccgagcatggtcgcgaactaatatagtatgac
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : cctatccattaacttatatttcttataatctttcatctcacttaacattttagtttatat
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b : tgtagtttgtgtaccagatatggttcgatgcgtagtcgggaatgagaagcggtttgtatt
BMWN1_0015_D02.b : ttaaatctctactatcatctttgttgtctctctttctaagtcgtcttttttcatatgcta
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : gtcagttaaataacgcgcattaaatgtaatatcacgcacgtnatgaaaccgtccgcaang
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : atcatcttactctatcaccagctgttactttatcaatacatagcccttttttcttctgtc
BMWN1_0022_A05.b : tcgacgactatacaaattacttacacatcttccctgctcacctgactacactcaccacat
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : tttgtgagttgtgttttgtgtggtggtgtgggtgtgtatttgtgtggtttggctgcgtag
BMWN1_0035_B11.b : cttctattaattcactctttcatctacttcatgtataatacaacttcacgtcactataat
BMWN1_0022_D08.b : ttcaccttccaccgcgcagtaaccccatttcatatttatccctagtataaatataatttg
BMWN1_0098_C01.b :
BMWN1_0012_F04.b : tgcttgttggcctgatctcctcatagatgttctttacttaaatacgtgatatccatcccc
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : aacttcaccacccacttcatattcctcaccatcccttaattccaatcgctaattagaaag
BMWN1_0045_G09.b : gctcgaggtcatcatatgtactggcacctcacaacgctataagcagtattagacagtaca
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b : acttcctatctatctctactctctcctcc
BMWN1_0098_D04.b : actatctcattcattgctctctcattatctatattagtgatcattctcaacctatacatc
BMWN1_0003_D04.b : gtgtgtgattgttttcccccgggatgttttctatatatgaccaataatatttccactata
BMWN1_0012_B08.b : tcagcactgttttgggggcggggtattctccctagggggttgtttccttcgcgggaccca
BMWN1_0081_B08.b : cacttctatattctgccggatctttgaattgttttcttctcccactttttatatttcatt
BMWN1_0036_B09.b : ctactcatattattctccttctatactatttataactacattacagtctacatactcttt
BMWN1_0010_F09.b : ccccccaccctccctttctactcttctatctatcgcttcaccacctttgcatatttactc
BMWN1_0043_A06.b : cctctacatagcaccacatacaccttagtaaacacgctatattacctaaatgatgaatcc
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : acctttcttacacatactacatttctatctttatcatatttattgacacttattaacctt
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : tctccgactacgaggcaagcacctggattcttaaactgcattgctatgagatactgcacc
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : atatatcacttctgatttactcctcacagtaattatgaaattacgttcattacttaatta
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b : gagcgcacgaataatctggtgactaatatca
BMWN1_0015_D02.b : caaatatttatctctcctcc
BMWN1_0002_E11.b :
BMWN1_0091_A09.b : agtacaataatactacaatactgatcgcttactcacaa
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : tactaatacgtattcattcttacttttaccttctcgcatcatgatcaatatctcttgtca
BMWN1_0022_A05.b : cccactacattctacccacttctccctatccttgtgtacctctctatattgctaccactt
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : gttgtgggggttgttgttngtgataagatgagacaggtgatgttgtacccagactatcct
BMWN1_0035_B11.b : tatattttca
BMWN1_0022_D08.b : acacctcaatataataatgagtgacacagctctaaatccccctttcaatctaaggagagc
BMWN1_0098_C01.b :
BMWN1_0012_F04.b : tcgtccct
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : ctacgacactcccatttcacaactaccctctccattctcccttcactcaacattgtcatt
BMWN1_0045_G09.b : aaagaaaccgcctctataacgcgtgaaacatgcctagctatgggtacagatcctc
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b :
BMWN1_0098_D04.b : aactatgtctataacaattgcatataagctatgatatctcatccatatatatatctacta
BMWN1_0003_D04.b : aactggtttatttcccccattaatataagaaactaaagctctctctgcccaacctcattt
BMWN1_0012_B08.b : aatatttatgaacccagccggataagtcggttgtttttttaccccccaa
BMWN1_0081_B08.b : gttcacaacggatgaatgagatagttgatatctcccctcatcaactatcacaacaaaaaa
BMWN1_0036_B09.b : gtactctatgtggtatgaattattatatctactctcccatacgatactcgtctcacttat
BMWN1_0010_F09.b : tttactacatcatactctttctttacacgtctacctatacatactcactccctccctctc
BMWN1_0043_A06.b : tctacaagcaccgatatagatccactantaacataatgtctcatacgcgatatcgactac
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : attcatgaaaaccgctatgcaaatctatacctcttccactcattaccactactcatatac
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : gacacactcgaaaccaacggcaacgctgcggcgtacattgtcaagggtctgttctcagcg
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : attcttttttatacttactttcatatcaaactacctactacttatcatgaacatcatgat
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b :
BMWN1_0015_D02.b :
BMWN1_0002_E11.b :
BMWN1_0091_A09.b :
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b : ttcnttttcacctctatccatgatgcatccacataccatactatacttataccata
BMWN1_0022_A05.b : attctaccaaatcaatttcactcataccttcatcttcaccatgccttcagcccactcctc
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : gcgtagcacatggtgaatcatcgagcgccaacgatgctccntccaatcctctccagactc
BMWN1_0035_B11.b :
BMWN1_0022_D08.b : cacaacctcccatcgtacctcnaggactagtnttattgacatatacccgtatacaagtgt
BMWN1_0098_C01.b :
BMWN1_0012_F04.b :
BMWN1_0001_D06.b :
BMWN1_0058_A07.b : atcaaatcctattgcttatcccg
BMWN1_0045_G09.b :
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b :
BMWN1_0098_D04.b : tctgatgaaattctatacatcttcaaancaatatgtctaagcatgtacgaatatgtaacg
BMWN1_0003_D04.b : tttatgaatta
BMWN1_0012_B08.b :
BMWN1_0081_B08.b : ananannnnnnnntaanannnnngcaaannnntttttttgtatacaccccatattaataa
BMWN1_0036_B09.b : gtctaccaagtactcttagttccatattgtctn
BMWN1_0010_F09.b : acatcacttgattcatcattatctgtattgg
BMWN1_0043_A06.b : cacgaatcatctccaagacatggtcaacactatacacctcatcgcgcatatattg
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b : tcatgctctacttgtaaatgaacccttaacatacatan
BMWN1_0048_H02.b :
BMWN1_0044_F02.b : aatgaacgggagccgg
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : tatacttttcttcaatccaattaatttatttcgttctaatctttattcttaatataatct
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b :
BMWN1_0015_D02.b :
BMWN1_0002_E11.b :
BMWN1_0091_A09.b :
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b :
BMWN1_0022_A05.b : cctatatgatataan
BMWN1_0087_H03.b :
BMWN1_0020_G08.b : ggctcgcaga
BMWN1_0035_B11.b :
BMWN1_0022_D08.b : tacatctn
BMWN1_0098_C01.b :
BMWN1_0012_F04.b :
BMWN1_0001_D06.b :
BMWN1_0058_A07.b :
BMWN1_0045_G09.b :
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b :
BMWN1_0098_D04.b : tcaatatttatgatagttaagttatg
BMWN1_0003_D04.b :
BMWN1_0012_B08.b :
BMWN1_0081_B08.b : gaatgatacaacnnnnncatgtnannnnt
BMWN1_0036_B09.b :
BMWN1_0010_F09.b :
BMWN1_0043_A06.b :
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b :
BMWN1_0048_H02.b :
BMWN1_0044_F02.b :
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : ctatttgtttactgattttccccacatactatataagaactattattttattatccaatt
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b :
BMWN1_0015_D02.b :
BMWN1_0002_E11.b :
BMWN1_0091_A09.b :
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b :
BMWN1_0022_A05.b :
BMWN1_0087_H03.b :
BMWN1_0020_G08.b :
BMWN1_0035_B11.b :
BMWN1_0022_D08.b :
BMWN1_0098_C01.b :
BMWN1_0012_F04.b :
BMWN1_0001_D06.b :
BMWN1_0058_A07.b :
BMWN1_0045_G09.b :
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b :
BMWN1_0098_D04.b :
BMWN1_0003_D04.b :
BMWN1_0012_B08.b :
BMWN1_0081_B08.b :
BMWN1_0036_B09.b :
BMWN1_0010_F09.b :
BMWN1_0043_A06.b :
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b :
BMWN1_0048_H02.b :
BMWN1_0044_F02.b :
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : aaaaactttaatttttagcacttaaattttcatgcataattataactaattgttactaaa
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b :
BMWN1_0015_D02.b :
BMWN1_0002_E11.b :
BMWN1_0091_A09.b :
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b :
BMWN1_0022_A05.b :
BMWN1_0087_H03.b :
BMWN1_0020_G08.b :
BMWN1_0035_B11.b :
BMWN1_0022_D08.b :
BMWN1_0098_C01.b :
BMWN1_0012_F04.b :
BMWN1_0001_D06.b :
BMWN1_0058_A07.b :
BMWN1_0045_G09.b :
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b :
BMWN1_0098_D04.b :
BMWN1_0003_D04.b :
BMWN1_0012_B08.b :
BMWN1_0081_B08.b :
BMWN1_0036_B09.b :
BMWN1_0010_F09.b :
BMWN1_0043_A06.b :
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b :
BMWN1_0048_H02.b :
BMWN1_0044_F02.b :
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : attaatagtattctgattcatctacataacaattttgttattatatatctttcatctatg
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b :
BMWN1_0015_D02.b :
BMWN1_0002_E11.b :
BMWN1_0091_A09.b :
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b :
BMWN1_0022_A05.b :
BMWN1_0087_H03.b :
BMWN1_0020_G08.b :
BMWN1_0035_B11.b :
BMWN1_0022_D08.b :
BMWN1_0098_C01.b :
BMWN1_0012_F04.b :
BMWN1_0001_D06.b :
BMWN1_0058_A07.b :
BMWN1_0045_G09.b :
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b :
BMWN1_0098_D04.b :
BMWN1_0003_D04.b :
BMWN1_0012_B08.b :
BMWN1_0081_B08.b :
BMWN1_0036_B09.b :
BMWN1_0010_F09.b :
BMWN1_0043_A06.b :
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b :
BMWN1_0048_H02.b :
BMWN1_0044_F02.b :
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : ccaattatttcgctatatatctttcttataactcacttctttgctctccattttttcttt
BMWN1_0001_H02.b :
20110601C-007527 : ............................................................
---------+---------+---------+---------+---------+---------+ 1000
BMWN1_0093_H08.b :
BMWN1_0053_C12.b :
BMWN1_0037_A07.b :
BMWN1_0015_D02.b :
BMWN1_0002_E11.b :
BMWN1_0091_A09.b :
BMWN1_0065_G01.b :
BMWN1_0070_E01.b :
BMWN1_0037_C01.b :
BMWN1_0089_E02.b :
BMWN1_0029_B08.b :
BMWN1_0098_G06.b :
BMWN1_0073_D09.b :
BMWN1_0022_A05.b :
BMWN1_0087_H03.b :
BMWN1_0020_G08.b :
BMWN1_0035_B11.b :
BMWN1_0022_D08.b :
BMWN1_0098_C01.b :
BMWN1_0012_F04.b :
BMWN1_0001_D06.b :
BMWN1_0058_A07.b :
BMWN1_0045_G09.b :
BMWN1_0057_D11.b :
BMWN1_0018_H08.b :
BMWN1_0081_C11.b :
BMWN1_0100_A05.b :
BMWN1_0050_E04.b :
BMWN1_0054_B10.b :
BMWN1_0098_D04.b :
BMWN1_0003_D04.b :
BMWN1_0012_B08.b :
BMWN1_0081_B08.b :
BMWN1_0036_B09.b :
BMWN1_0010_F09.b :
BMWN1_0043_A06.b :
BMWN1_0049_A11.b :
BMWN1_0096_D02.b :
BMWN1_0070_G04.b :
BMWN1_0048_H02.b :
BMWN1_0044_F02.b :
BMWN1_0050_B10.b :
BMWN1_0060_A10.b :
BMWN1_0031_E12.b : ttctatctccctcn
BMWN1_0001_H02.b :