[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007529

Length: 1,071

Sequence [FASTA format sequence]
CCCTCAGGAA GTGACGACAG AAGTGCCCTT GACCGGTGGG GCGGGCCGTG CTGTGCGTCG
CTTCGCTCTC GTTGCTGGGA GATGGCTCAG CGTCTTCTCC TGAGGAGGTT CCTGGCCTCT
GTAGTCTCCA GGAAGCCCTC TCATAGTCGG TGGGCACCCC TCGCTTCCAG AGCCCTGCAG
ACCCCACAGC TCAGCCTTAG TAACCTGACA GGAACACCCA GCCAAGCCCG GTCATTATAC
ACTACCCGGG TCTGTACAAC AACCTTTAAC ATCCAGGATG GACCTGACTT TCAAGACCGA
GTTGTCAACA GTGAGACGCC AGTGGTTGTG GATTTCCATG CACAGTGGTG TGGTCCCTGC
AAGATCCTGG GGCCAAGGTT AGAGAAGGTG GTGGCCAAGC AGCATGGAAA GGTGGTGATG
GCCAAGGTGG ATATCGACGA CCACACAGAC CTCGCCATCG AGTACGAGGT GTCGGCGGTG
CCCACTGTGC TGGCCATCAA AAATGGGGAC GTGGTGGACA AGTTTGTGGG CATCAAGGAT
GAGGACCAGC TGGAGGCCTT TCTGAAGAAG CTGATTGGCT GACAAGCAGG GAAGAGTCCT
GACTGCCCCG GCCTGCCATG GTCCCGGGGG ACCCCGTAGA ACTCACAGCC CTTCTGTGCC
AGCCCTTCCC GCCTCGTCCC TCTGACTGGC CCCCATGGGC CCGTGCTTTG GAGACCAGGC
CTCCAAACAC GGGACCCTCA AGCGCTCCCA GCCTGGCTAG CTGCCAGGCT GGCCGCCCCA
GGAGCCAGGA CAGCCGTCTT CCCACCCGCT CTGCTCCCTC CAGGATGCTT GGACAGAGCC
GCGGGGCCAG CCTGTGGTAC CACCTTGGTC CCATCTCCCT GATCCCTTCT GATCTGAACC
CTGGTGCCTG GCTCATCTGC CTCCTGCGTT TTTCTTTCCT GCTGCTGTTT TGTAAAAAAA
AAGAAGGAAA CTAGAAACCC GAACAAGTGA GAGTAACATA CAGTTCTCTC ATTTTGTGCA
GGTCCTTAAT AAGGAACTTT GTGATCCCTC AAAAAAAAAA AAAAAAAAAA A


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXN2thioredoxin, mitochondrial precursor [Homo sapiens]. 2963e-80O
Contig/Assembly ProteinTXNthioredoxin [Homo sapiens]. 68.21e-11O
Contig/Assembly ProteinP4HBprotein disulfide-isomerase precursor [Homo sapiens]. 63.92e-10O
Contig/Assembly ProteinPDIA4protein disulfide-isomerase A4 precursor [Homo sapiens]. 60.82e-09
Contig/Assembly ProteinPDIA3protein disulfide-isomerase A3 precursor [Homo sapiens]. 60.53e-09O
Contig/Assembly ProteinPDIA5protein disulfide-isomerase A5 precursor [Homo sapiens]. 56.25e-08
Contig/Assembly ProteinPDIA2protein disulfide-isomerase A2 precursor [Homo sapiens]. 55.58e-08O
Contig/Assembly ProteinTXNDC2thioredoxin domain-containing protein 2 isoform 2 [Homo sapiens]. 53.53e-07
Contig/Assembly ProteinTXNDC2thioredoxin domain-containing protein 2 isoform 1 [Homo sapiens]. 53.53e-07
Contig/Assembly ProteinTXNDC5thioredoxin domain-containing protein 5 isoform 3 [Homo sapiens]. 53.14e-07O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTxn2thioredoxin, mitochondrial precursor [Mus musculus]. 2853e-77O
Contig/Assembly ProteinTxn1thioredoxin [Mus musculus]. 63.92e-10O
Contig/Assembly ProteinP4hbprotein disulfide-isomerase precursor [Mus musculus]. 63.92e-10O
Contig/Assembly ProteinPdia4protein disulfide-isomerase A4 [Mus musculus]. 628e-10
Contig/Assembly ProteinPdia3protein disulfide-isomerase A3 precursor [Mus musculus]. 60.82e-09O
Contig/Assembly ProteinTxndc2thioredoxin domain-containing protein 2 isoform 2 [Mus musculus]. 572e-08
Contig/Assembly ProteinTxndc2thioredoxin domain-containing protein 2 isoform 1 [Mus musculus]. 572e-08
Contig/Assembly ProteinPdia2protein disulfide-isomerase A2 [Mus musculus]. 55.19e-08O
Contig/Assembly ProteinPdia5protein disulfide-isomerase A5 precursor [Mus musculus]. 54.71e-07
Contig/Assembly ProteinTxndc5thioredoxin domain-containing protein 5 precursor [Mus musculus]. 54.71e-07


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474519PREDICTED: similar to Thioredoxin, mitochondrial precursor (Mt-Trx) (MTRX) (Thioredoxin-2) [Canis familiaris]. 3067e-85
Contig/Assembly ProteinLOC474798PREDICTED: similar to Thioredoxin (ATL-derived factor) (ADF) (Surface associated sulphydryl protein) (SASP) [Canis familiaris]. 68.98e-12
Contig/Assembly ProteinLOC482715PREDICTED: similar to Protein disulfide-isomerase A4 precursor (Protein ERp-72) (ERp72) isoform 1 [Canis familiaris]. 629e-10
Contig/Assembly ProteinLOC482715PREDICTED: similar to Protein disulfide-isomerase A4 precursor (Protein ERp-72) (ERp72) isoform 3 [Canis familiaris]. 629e-10
Contig/Assembly ProteinLOC478279PREDICTED: similar to protein disulfide isomerase-associated 3 precursor [Canis familiaris]. 60.53e-09
Contig/Assembly ProteinLOC483369PREDICTED: similar to prolyl 4-hydroxylase, beta subunit [Canis familiaris]. 60.53e-09O
Contig/Assembly ProteinLOC490552PREDICTED: similar to Thioredoxin domain containing protein 2 (Spermatid-specific thioredoxin-1) (Sptrx-1) [Canis familiaris]. 54.32e-07
Contig/Assembly ProteinLOC478826PREDICTED: similar to DnaJ (Hsp40) homolog, subfamily C, member 10 isoform 3 [Canis familiaris]. 53.93e-07
Contig/Assembly ProteinLOC478826PREDICTED: similar to DnaJ (Hsp40) homolog, subfamily C, member 10 isoform 1 [Canis familiaris]. 53.93e-07
Contig/Assembly ProteinLOC478826PREDICTED: similar to DnaJ (Hsp40) homolog, subfamily C, member 10 isoform 6 [Canis familiaris]. 53.93e-07


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXN2thioredoxin, mitochondrial precursor [Bos taurus]. 3048e-83O
Contig/Assembly ProteinTXNthioredoxin [Bos taurus]. 69.74e-12O
Contig/Assembly ProteinP4HBprotein disulfide-isomerase precursor [Bos taurus]. 63.53e-10O
Contig/Assembly ProteinPDIA3protein disulfide-isomerase A3 precursor [Bos taurus]. 60.53e-09O
Contig/Assembly ProteinPDIA4protein disulfide-isomerase A4 precursor [Bos taurus]. 59.74e-09
Contig/Assembly ProteinTXNDC5thioredoxin domain-containing protein 5 [Bos taurus]. 55.86e-08
Contig/Assembly ProteinTXNDC8thioredoxin domain-containing protein 8 [Bos taurus]. 54.71e-07O
Contig/Assembly ProteinPDIA2protein disulfide-isomerase A2 [Bos taurus]. 53.92e-07O
Contig/Assembly ProteinDNAJC10PREDICTED: DnaJ (Hsp40) homolog, subfamily C, member 10-like [Bos taurus]. 53.14e-07
Contig/Assembly ProteinDNAJC10PREDICTED: DnaJ (Hsp40) homolog, subfamily C, member 10-like isoform 2 [Bos taurus]. 53.14e-07


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXN2thioredoxin, mitochondrial [Sus scrofa]. 3322e-91O
Contig/Assembly ProteinTXNthioredoxin [Sus scrofa]. 69.33e-12O
Contig/Assembly ProteinLOC100522203PREDICTED: protein disulfide-isomerase A4-like [Sus scrofa]. 60.81e-09O
Contig/Assembly ProteinPDIA3protein disulfide-isomerase A3 [Sus scrofa]. 60.52e-09O
Contig/Assembly ProteinTXNDC8thioredoxin domain-containing protein 8 [Sus scrofa]. 57.41e-08O
Contig/Assembly ProteinLOC100518582PREDICTED: protein disulfide-isomerase A5-like isoform 2 [Sus scrofa]. 56.62e-08O
Contig/Assembly ProteinLOC100156354PREDICTED: thioredoxin domain-containing protein 5-like [Sus scrofa]. 54.31e-07
Contig/Assembly ProteinLOC100515671PREDICTED: thioredoxin domain-containing protein 5-like [Sus scrofa]. 53.91e-07O
Contig/Assembly ProteinERP44endoplasmic reticulum resident protein 44 [Sus scrofa]. 526e-07O
Contig/Assembly ProteinDNAJC10PREDICTED: dnaJ homolog subfamily C member 10, partial [Sus scrofa]. 51.21e-06


Assembly Members: 44      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010023B12ADR01_0023_B12.bDB783499 
ADR010029D12ADR01_0029_D12.bDB784054 
ADR010037G10ADR01_0037_G10.bDB784811 
ADR010038A08ADR01_0038_A08.bDB784832 
ADR010049G07ADR01_0049_G07.bDB785892 
ADR010058F07ADR01_0058_F07.bDB786683 
BMWN10067H07BMWN1_0067_H07.bHX209679 
CBLT10039F09CBLT1_0039_F09.b  
CBLT10049B07CBLT1_0049_B07.bHX215068 
CLNT10012D04CLNT1_0012_D04.bFS658010 
ITT010013A02ITT01_0013_A02.bBW977140 
ITT010062C04ITT01_0062_C04.bBW981495 
ITT010072C08ITT01_0072_C08.bBW982401 
LNG010062A03LNG01_0062_A03.bBP433210 
LNG010089F01LNG01_0089_F01.bBP438019 
LNG010103D07LNG01_0103_D07.bBP436511 AK393937
LVRM10047E01LVRM1_0047_E01.bCJ002303 
LVRM10108H01LVRM1_0108_H01.bBP453831 
LVRM10148H06LVRM1_0148_H06.bBP454207 
MLN010043G02MLN01_0043_G02.bCJ011065 
MLN010064C04MLN01_0064_C04.bCJ012672 
OVR010030F08OVR01_0030_F08.bBP143765 
OVRM10052B10OVRM1_0052_B10.bBP147113 
OVRM10084E04OVRM1_0084_E04.bBP150263 
OVRM10210C08OVRM1_0210_C08.bBP457154 AK236637
OVRT10022E09OVRT1_0022_E09.bFS688207 
OVRT10121A08OVRT1_0121_A08.bHX236477 
PTG010034D03PTG01_0034_D03.bFS707392 
SKNB10023F08SKNB1_0023_F08.bDB801244 
SMG010026F01SMG01_0026_F01.bFS715566 
SMG010051G05SMG01_0051_G05.bFS717742 
SMG010096B12SMG01_0096_B12.bFS721525 
SPL010105A08SPL01_0105_A08.bCJ022404 
TCH010040D09TCH01_0040_D09.bCJ025422 
TES010019H01TES01_0019_H01.bCJ031308 
TES010056E09TES01_0056_E09.bCJ033575 
TES010083C11TES01_0083_C11.bCJ035349 
TES010095E11TES01_0095_E11.bCJ036196 
THY010040D05THY01_0040_D05.bBP163525 
THY010120F09THY01_0120_F09.bBP166504 
UTR010014A07UTR01_0014_A07.bBP169630 
UTR010086G11UTR01_0086_G11.bCJ037973 
UTR010092H10UTR01_0092_H10.bCJ038537 
UTR010105F11UTR01_0105_F11.bCJ039626 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
248A900.209WNCAG/Q
G2950.791CGG/R
626A400.121W-
G2450.879
630A500.143W-
G2550.857


Alignment:      TOP

20110601C-007529 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LNG01_0103_D07.b : nnnnnnggctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0034_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0052_B10.b : agttgatcaaagxxxxxxxxxxxxxxxxxxxx
CLNT1_0012_D04.b : ggaccgtttgcngtcggxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0096_B12.b : nnggcttttannnnggagtxxxxxxxxxxxxxxxx
BMWN1_0067_H07.b : tttgcacaggtacgaggxxxxxxxxxx
SMG01_0051_G05.b : nnngggtttnnnntnagataaagcagcxxxxxxx
THY01_0120_F09.b : gttgcxxxxxxxxxxx
OVRM1_0210_C08.b : agttgtcxxxxxxxxxxxxxxxxx
LNG01_0062_A03.b : ntttcgcgattggacttgacxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_E01.b : ttgtcxxxxxxxxxxxxxxxx
LVRM1_0108_H01.b : tagttgtcxxxxxxxxxxxxxxxx
OVR01_0030_F08.b : agaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0062_C04.b : nnnnaatgaaacaxxxxxxxx
MLN01_0064_C04.b : ngttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_H10.b : ntttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0105_F11.b : nnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0038_A08.b : nnnnggtgaaacaxxxxxxx
OVRT1_0022_E09.b : nnaaacctattgcgnacgxxxxxxxxxxxxxxxxxx
SPL01_0105_A08.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0029_D12.b : nnnaaaggatgacacaxxxxxx
MLN01_0043_G02.b : nnnngggtagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0040_D09.b : cttgtgacttgacxxxxxxxxxxxxxxxxx
OVRT1_0121_A08.b : tcagctgtcgxxxxxxxxxxxxxxxxxxxx
TES01_0083_C11.b :
TES01_0019_H01.b :
TES01_0056_E09.b :
ADR01_0037_G10.b : nnnggtgaaacxxxxx
ITT01_0013_A02.b : tagataaacaxxxxx
CBLT1_0039_F09.b : tttgatatgacacgx
LNG01_0089_F01.b : ttttttgctggacttgacxxxxxxxxxxxxxxxxx
UTR01_0014_A07.b : ggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0049_G07.b : nttttatatga
SMG01_0026_F01.b : nggggttttttnatga
ADR01_0023_B12.b :
SKNB1_0023_F08.b :
CBLT1_0049_B07.b : ntttcgacaga
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b : nnnnccgc
THY01_0040_D05.b : ctttttg
TES01_0095_E11.b :
ADR01_0058_F07.b :
ITT01_0072_C08.b :
20110601C-007529 : ..................CCCTCAGGAAGTGACGACAGAAGTGCCCTTGACCGGTGGGGC
---------+---------+---------+---------+---------+---------+ 42
LNG01_0103_D07.b : xxxxxxxxxxxxxxxxxxCCCTCAGGAAGTGACGACAGAAGTGCCCTTGACCGGTGGGGC
PTG01_0034_D03.b : nxxxxxxxxxxxxxxxxxxxxxxxGGAAGTGACGACAGAAGTGCCCTTGACCGGTGGGGC
OVRM1_0052_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGACGACAGAAGTGCCCTTGACCGGTGGGGC
CLNT1_0012_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGACAGAAGTGCCCTTGACCGGTGGGGC
SMG01_0096_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGACAGAAGTGCCCTTGACCGGTGGGGC
BMWN1_0067_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGACAGAACTGCCCTTGACCGGTGGGGC
SMG01_0051_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGAAGTGCCCTTGACCGGTGGGGC
THY01_0120_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggAGAAGTGCCCTTGACCGGTGGGGC
OVRM1_0210_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgAGAAGTGCCCTTGACCGGTGGGGC
LNG01_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAAGTGCCCTTGACCGGTGGGGC
LVRM1_0047_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
LVRM1_0108_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
OVR01_0030_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
ITT01_0062_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
MLN01_0064_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
UTR01_0092_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
UTR01_0105_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
ADR01_0038_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
OVRT1_0022_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
SPL01_0105_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
ADR01_0029_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
MLN01_0043_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTGCCCTTGACCGGTGGGGC
TCH01_0040_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGTGCCCTTGACCGGTGGGGC
OVRT1_0121_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagatAGTGCCCTTGACCGGTGGGGC
TES01_0083_C11.b : tttttactgcgttggctatgggAGTGCCCTTGACCGGTGGGGC
TES01_0019_H01.b : tttcctgcgttggctatggagcagAGTGCCCTTGACCGGTGGGGC
TES01_0056_E09.b : tttttcctgctgtggctctggacagAGTGCCCTTGACCGGTGGGGC
ADR01_0037_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCCCTTGACCGGTGGGGC
ITT01_0013_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCCCTTGACCGGTGGGGC
CBLT1_0039_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCCCTTGACCGCTGTGGC
LNG01_0089_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTGACCGGTGGGGC
UTR01_0014_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTGACCGGTGGGGC
ADR01_0049_G07.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTGACCGGTGGGGC
SMG01_0026_F01.b : taagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCGGTGGGGC
ADR01_0023_B12.b : nttaacagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGGTGGGGC
SKNB1_0023_F08.b : nnnnccggggnnnnnnnccaacgttgtgctnggggccggGGGGC
CBLT1_0049_B07.b : gaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggggc
LVRM1_0148_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_E04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0086_G11.b : ttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0040_D05.b : tgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0095_E11.b : tttttcctcgcgtggct
ADR01_0058_F07.b :
ITT01_0072_C08.b :
20110601C-007529 : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
---------+---------+---------+---------+---------+---------+ 102
LNG01_0103_D07.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
PTG01_0034_D03.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
OVRM1_0052_B10.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
CLNT1_0012_D04.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGTGTCTTCTCCTG
SMG01_0096_B12.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
BMWN1_0067_H07.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
SMG01_0051_G05.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
THY01_0120_F09.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
OVRM1_0210_C08.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
LNG01_0062_A03.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
LVRM1_0047_E01.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
LVRM1_0108_H01.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
OVR01_0030_F08.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
ITT01_0062_C04.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
MLN01_0064_C04.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
UTR01_0092_H10.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
UTR01_0105_F11.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
ADR01_0038_A08.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
OVRT1_0022_E09.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
SPL01_0105_A08.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
ADR01_0029_D12.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
MLN01_0043_G02.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
TCH01_0040_D09.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
OVRT1_0121_A08.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
TES01_0083_C11.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
TES01_0019_H01.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
TES01_0056_E09.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
ADR01_0037_G10.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
ITT01_0013_A02.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
CBLT1_0039_F09.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
LNG01_0089_F01.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
UTR01_0014_A07.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
ADR01_0049_G07.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
SMG01_0026_F01.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
ADR01_0023_B12.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
SKNB1_0023_F08.b : GGGCCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
CBLT1_0049_B07.b : ctttCGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
LVRM1_0148_H06.b : xxxxxGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
OVRM1_0084_E04.b : xxxxxGTGCTGTGCGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
UTR01_0086_G11.b : xxxxxxxxxxxxxxGTCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
THY01_0040_D05.b : xxxxxxxxxxxxxxxxCGCTTCGCTCTCGTTGCTGGGAGATGGCTCAGCGTCTTCTCCTG
TES01_0095_E11.b : atggtcttgccctactcttcctacctcttcccttcacAGATGGCTCAGCGTCTTCTCCTG
ADR01_0058_F07.b : nnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0072_C08.b : nnnggagtaacaxxxxxxxxxxxxxxxxxxxx
20110601C-007529 : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
---------+---------+---------+---------+---------+---------+ 162
LNG01_0103_D07.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
PTG01_0034_D03.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
OVRM1_0052_B10.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
CLNT1_0012_D04.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
SMG01_0096_B12.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
BMWN1_0067_H07.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
SMG01_0051_G05.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
THY01_0120_F09.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCCCTCATAGTCGGTGGGCACCCCTC
OVRM1_0210_C08.b : AGGAGGCTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
LNG01_0062_A03.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
LVRM1_0047_E01.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
LVRM1_0108_H01.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
OVR01_0030_F08.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ITT01_0062_C04.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
MLN01_0064_C04.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
UTR01_0092_H10.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
UTR01_0105_F11.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ADR01_0038_A08.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
OVRT1_0022_E09.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
SPL01_0105_A08.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ADR01_0029_D12.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
MLN01_0043_G02.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
TCH01_0040_D09.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
OVRT1_0121_A08.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
TES01_0083_C11.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
TES01_0019_H01.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
TES01_0056_E09.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ADR01_0037_G10.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ITT01_0013_A02.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
CBLT1_0039_F09.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
LNG01_0089_F01.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
UTR01_0014_A07.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ADR01_0049_G07.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
SMG01_0026_F01.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ADR01_0023_B12.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
SKNB1_0023_F08.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
CBLT1_0049_B07.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
LVRM1_0148_H06.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
OVRM1_0084_E04.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
UTR01_0086_G11.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
THY01_0040_D05.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGCCGGTGGGCACCCCTC
TES01_0095_E11.b : AGGAGGTTCCTGGCCTCTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ADR01_0058_F07.b : xxxxxxxxxxxxxxxxxTGTAGTCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
ITT01_0072_C08.b : xxxxxxxxxxxxxxxxxxxxxxxCTCCAGGAAGCCCTCTCATAGTCGGTGGGCACCCCTC
20110601C-007529 : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
---------+---------+---------+---------+---------+---------+ 222
LNG01_0103_D07.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
PTG01_0034_D03.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAATAACCTGACAGGAACACCCAGC
OVRM1_0052_B10.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
CLNT1_0012_D04.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
SMG01_0096_B12.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
BMWN1_0067_H07.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
SMG01_0051_G05.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
THY01_0120_F09.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
OVRM1_0210_C08.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
LNG01_0062_A03.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
LVRM1_0047_E01.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
LVRM1_0108_H01.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
OVR01_0030_F08.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ITT01_0062_C04.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
MLN01_0064_C04.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
UTR01_0092_H10.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
UTR01_0105_F11.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ADR01_0038_A08.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
OVRT1_0022_E09.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
SPL01_0105_A08.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ADR01_0029_D12.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
MLN01_0043_G02.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
TCH01_0040_D09.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
OVRT1_0121_A08.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
TES01_0083_C11.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
TES01_0019_H01.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
TES01_0056_E09.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ADR01_0037_G10.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ITT01_0013_A02.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAATACCCAGC
CBLT1_0039_F09.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
LNG01_0089_F01.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
UTR01_0014_A07.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ADR01_0049_G07.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
SMG01_0026_F01.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ADR01_0023_B12.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
SKNB1_0023_F08.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
CBLT1_0049_B07.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
LVRM1_0148_H06.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
OVRM1_0084_E04.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
UTR01_0086_G11.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
THY01_0040_D05.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
TES01_0095_E11.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ADR01_0058_F07.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
ITT01_0072_C08.b : GCTTCCAGAGCCCTGCAGACCCCACAGCTCAGCCTTAGTAACCTGACAGGAACACCCAGC
20110601C-007529 : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
---------+---------+---------+---------+---------+---------+ 282
LNG01_0103_D07.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
PTG01_0034_D03.b : CCAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
OVRM1_0052_B10.b : CNAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
CLNT1_0012_D04.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
SMG01_0096_B12.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
BMWN1_0067_H07.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
SMG01_0051_G05.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
THY01_0120_F09.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
OVRM1_0210_C08.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
LNG01_0062_A03.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
LVRM1_0047_E01.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
LVRM1_0108_H01.b : CTAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
OVR01_0030_F08.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ITT01_0062_C04.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
MLN01_0064_C04.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
UTR01_0092_H10.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
UTR01_0105_F11.b : CAAGCCCGGTCATTATACACTATCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ADR01_0038_A08.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
OVRT1_0022_E09.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
SPL01_0105_A08.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ADR01_0029_D12.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
MLN01_0043_G02.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
TCH01_0040_D09.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
OVRT1_0121_A08.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
TES01_0083_C11.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
TES01_0019_H01.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
TES01_0056_E09.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ADR01_0037_G10.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ITT01_0013_A02.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
CBLT1_0039_F09.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
LNG01_0089_F01.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
UTR01_0014_A07.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ADR01_0049_G07.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
SMG01_0026_F01.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ADR01_0023_B12.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
SKNB1_0023_F08.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
CBLT1_0049_B07.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
LVRM1_0148_H06.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
OVRM1_0084_E04.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
UTR01_0086_G11.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
THY01_0040_D05.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
TES01_0095_E11.b : CAAGCCCGGTCATTATACACTACCCAGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ADR01_0058_F07.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
ITT01_0072_C08.b : CAAGCCCGGTCATTATACACTACCCGGGTCTGTACAACAACCTTTAACATCCAGGATGGA
20110601C-007529 : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
---------+---------+---------+---------+---------+---------+ 342
LNG01_0103_D07.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
PTG01_0034_D03.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
OVRM1_0052_B10.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCNGTGGTTGTGGATTTCCATGCA
CLNT1_0012_D04.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
SMG01_0096_B12.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
BMWN1_0067_H07.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
SMG01_0051_G05.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
THY01_0120_F09.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
OVRM1_0210_C08.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
LNG01_0062_A03.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
LVRM1_0047_E01.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
LVRM1_0108_H01.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
OVR01_0030_F08.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ITT01_0062_C04.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
MLN01_0064_C04.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
UTR01_0092_H10.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
UTR01_0105_F11.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ADR01_0038_A08.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
OVRT1_0022_E09.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
SPL01_0105_A08.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ADR01_0029_D12.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
MLN01_0043_G02.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
TCH01_0040_D09.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
OVRT1_0121_A08.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
TES01_0083_C11.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
TES01_0019_H01.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
TES01_0056_E09.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ADR01_0037_G10.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ITT01_0013_A02.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
CBLT1_0039_F09.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
LNG01_0089_F01.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
UTR01_0014_A07.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ADR01_0049_G07.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
SMG01_0026_F01.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ADR01_0023_B12.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
SKNB1_0023_F08.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
CBLT1_0049_B07.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
LVRM1_0148_H06.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
OVRM1_0084_E04.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
UTR01_0086_G11.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
THY01_0040_D05.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
TES01_0095_E11.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ADR01_0058_F07.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
ITT01_0072_C08.b : CCTGACTTTCAAGACCGAGTTGTCAACAGTGAGACGCCAGTGGTTGTGGATTTCCATGCA
20110601C-007529 : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
---------+---------+---------+---------+---------+---------+ 402
LNG01_0103_D07.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
PTG01_0034_D03.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
OVRM1_0052_B10.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
CLNT1_0012_D04.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
SMG01_0096_B12.b : CAGTGGTGTGGTCCCTGNCAGATCCTGGG*CCNANNGTAGAGAANGTGGTGGCCNAGCAG
BMWN1_0067_H07.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
SMG01_0051_G05.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
THY01_0120_F09.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
OVRM1_0210_C08.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
LNG01_0062_A03.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
LVRM1_0047_E01.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
LVRM1_0108_H01.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
OVR01_0030_F08.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
ITT01_0062_C04.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
MLN01_0064_C04.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
UTR01_0092_H10.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
UTR01_0105_F11.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
ADR01_0038_A08.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
OVRT1_0022_E09.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
SPL01_0105_A08.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAGGGTTAGAGAAGGTGGTGGCCAAGCAG
ADR01_0029_D12.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
MLN01_0043_G02.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
TCH01_0040_D09.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
OVRT1_0121_A08.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
TES01_0083_C11.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
TES01_0019_H01.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
TES01_0056_E09.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
ADR01_0037_G10.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
ITT01_0013_A02.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
CBLT1_0039_F09.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
LNG01_0089_F01.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
UTR01_0014_A07.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
ADR01_0049_G07.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
SMG01_0026_F01.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
ADR01_0023_B12.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
SKNB1_0023_F08.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
CBLT1_0049_B07.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
LVRM1_0148_H06.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCCAAGTTAGAGAAAGTGGTGGCCAAGCAG
OVRM1_0084_E04.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
UTR01_0086_G11.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
THY01_0040_D05.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
TES01_0095_E11.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
ADR01_0058_F07.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
ITT01_0072_C08.b : CAGTGGTGTGGTCCCTGCAAGATCCTGGGGCCAAGGTTAGAGAAGGTGGTGGCCAAGCAG
20110601C-007529 : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
---------+---------+---------+---------+---------+---------+ 462
LNG01_0103_D07.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
PTG01_0034_D03.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
OVRM1_0052_B10.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
CLNT1_0012_D04.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
SMG01_0096_B12.b : CATGGAAAAGTGGTGATGGCCNAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
BMWN1_0067_H07.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
SMG01_0051_G05.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
THY01_0120_F09.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
OVRM1_0210_C08.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
LNG01_0062_A03.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
LVRM1_0047_E01.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
LVRM1_0108_H01.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
OVR01_0030_F08.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ITT01_0062_C04.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
MLN01_0064_C04.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
UTR01_0092_H10.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
UTR01_0105_F11.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ADR01_0038_A08.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
OVRT1_0022_E09.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
SPL01_0105_A08.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ADR01_0029_D12.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
MLN01_0043_G02.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
TCH01_0040_D09.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
OVRT1_0121_A08.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCTAG
TES01_0083_C11.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
TES01_0019_H01.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
TES01_0056_E09.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ADR01_0037_G10.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ITT01_0013_A02.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
CBLT1_0039_F09.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
LNG01_0089_F01.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
UTR01_0014_A07.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ADR01_0049_G07.b : CATGGAAAGGTGGTGACGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
SMG01_0026_F01.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ADR01_0023_B12.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
SKNB1_0023_F08.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
CBLT1_0049_B07.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
LVRM1_0148_H06.b : CATGGAAAAGTGGTGATGGCCAAAGTGGATATCGACGACCACACAGACCTCGCCATCGAG
OVRM1_0084_E04.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
UTR01_0086_G11.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
THY01_0040_D05.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
TES01_0095_E11.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ADR01_0058_F07.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
ITT01_0072_C08.b : CATGGAAAGGTGGTGATGGCCAAGGTGGATATCGACGACCACACAGACCTCGCCATCGAG
20110601C-007529 : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
---------+---------+---------+---------+---------+---------+ 522
LNG01_0103_D07.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
PTG01_0034_D03.b : TACGAAGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
OVRM1_0052_B10.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCACAAATGGGGACGTGGTGGACAAG
CLNT1_0012_D04.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
SMG01_0096_B12.b : TACGAAGTGTCGGCGGTGCCCACTGTGCTGGNCATCAAAAATGGGGACGTGGTGGACCAG
BMWN1_0067_H07.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
SMG01_0051_G05.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
THY01_0120_F09.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
OVRM1_0210_C08.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
LNG01_0062_A03.b : TACGAG**GTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
LVRM1_0047_E01.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
LVRM1_0108_H01.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
OVR01_0030_F08.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
ITT01_0062_C04.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
MLN01_0064_C04.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
UTR01_0092_H10.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
UTR01_0105_F11.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGATAAG
ADR01_0038_A08.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
OVRT1_0022_E09.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
SPL01_0105_A08.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
ADR01_0029_D12.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
MLN01_0043_G02.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
TCH01_0040_D09.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
OVRT1_0121_A08.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
TES01_0083_C11.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
TES01_0019_H01.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
TES01_0056_E09.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
ADR01_0037_G10.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
ITT01_0013_A02.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
CBLT1_0039_F09.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
LNG01_0089_F01.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
UTR01_0014_A07.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
ADR01_0049_G07.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
SMG01_0026_F01.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
ADR01_0023_B12.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCNAAAATGGGGACGTGGTGGACAAG
SKNB1_0023_F08.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
CBLT1_0049_B07.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
LVRM1_0148_H06.b : TACCAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACATGGTGGACAAG
OVRM1_0084_E04.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
UTR01_0086_G11.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
THY01_0040_D05.b : TACGAGGCGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
TES01_0095_E11.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
ADR01_0058_F07.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
ITT01_0072_C08.b : TACGAGGTGTCGGCGGTGCCCACTGTGCTGGCCATCAAAAATGGGGACGTGGTGGACAAG
20110601C-007529 : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
---------+---------+---------+---------+---------+---------+ 582
LNG01_0103_D07.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
PTG01_0034_D03.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
OVRM1_0052_B10.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
CLNT1_0012_D04.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGAATGGCTGA
SMG01_0096_B12.b : *TTGTGGGCATCAAGGATGAAGACCAACTGGAGGCCTTTCTGAA*AANCTGATGGGCTGA
BMWN1_0067_H07.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
SMG01_0051_G05.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
THY01_0120_F09.b : TTTGTGGGCATCAAGGATGAGGACCACCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
OVRM1_0210_C08.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
LNG01_0062_A03.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
LVRM1_0047_E01.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
LVRM1_0108_H01.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
OVR01_0030_F08.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ITT01_0062_C04.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
MLN01_0064_C04.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
UTR01_0092_H10.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
UTR01_0105_F11.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ADR01_0038_A08.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
OVRT1_0022_E09.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
SPL01_0105_A08.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ADR01_0029_D12.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
MLN01_0043_G02.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
TCH01_0040_D09.b : ATTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
OVRT1_0121_A08.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
TES01_0083_C11.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
TES01_0019_H01.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
TES01_0056_E09.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ADR01_0037_G10.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ITT01_0013_A02.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
CBLT1_0039_F09.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
LNG01_0089_F01.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
UTR01_0014_A07.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ADR01_0049_G07.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
SMG01_0026_F01.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ADR01_0023_B12.b : TTTGTGGGCATCAAGGATGAGGGACAGCTGGANGCCTTTCTGAAGAAGCTGATTGGCTGA
SKNB1_0023_F08.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
CBLT1_0049_B07.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
LVRM1_0148_H06.b : TTTGTGGGCGTCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAAGAACTGATTGGCTGA
OVRM1_0084_E04.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
UTR01_0086_G11.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
THY01_0040_D05.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
TES01_0095_E11.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ADR01_0058_F07.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
ITT01_0072_C08.b : TTTGTGGGCATCAAGGATGAGGACCAGCTGGAGGCCTTTCTGAAGAAGCTGATTGGCTGA
20110601C-007529 : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
---------+---------+---------+---------+---------+---------+ 641
LNG01_0103_D07.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCAGGGAAC*CCCGTAGAA
PTG01_0034_D03.b : CAACAAGGGA*GAGTCCTGACTGCCCCGGCCTGCCATGGTCCCAGGGAAC*CCCGTAAAA
OVRM1_0052_B10.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
CLNT1_0012_D04.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCAGGGAAC*CCCGTAGAA
SMG01_0096_B12.b : CAACCCGGGAAAAGTCCTGACTGCCC*GGCCTGGCATGGTCCCGGGGGAC*CCgtaaaac
BMWN1_0067_H07.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTTTAA
SMG01_0051_G05.b : CAAGCAGGNAAGAGTCCTGACTGCCCCGGCCTGCCATGGNTCC*GGGGAC*CCCGTAGAA
THY01_0120_F09.b : CAAGCCGGGAAGAGTCCTGACTGCCCCGGGCTGCatggtcccagggaacccgtataataa
OVRM1_0210_C08.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
LNG01_0062_A03.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCAGGGAAC*CCCGTAGAA
LVRM1_0047_E01.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
LVRM1_0108_H01.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
OVR01_0030_F08.b : CGAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
ITT01_0062_C04.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
MLN01_0064_C04.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGCAGAA
UTR01_0092_H10.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
UTR01_0105_F11.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
ADR01_0038_A08.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCAGGGAAC*CCCGTAGAA
OVRT1_0022_E09.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCAGGGAAC*CCCGTAGAA
SPL01_0105_A08.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
ADR01_0029_D12.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
MLN01_0043_G02.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
TCH01_0040_D09.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
OVRT1_0121_A08.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCAGGGAAC*CCCGTAGAA
TES01_0083_C11.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
TES01_0019_H01.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
TES01_0056_E09.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
ADR01_0037_G10.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
ITT01_0013_A02.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
CBLT1_0039_F09.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
LNG01_0089_F01.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGGC*CCCGTAGAA
UTR01_0014_A07.b : CGAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
ADR01_0049_G07.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
SMG01_0026_F01.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
ADR01_0023_B12.b : NCAGCAGGAAAGAGT*CTGACTGCCCCG*CCTGGCATGGTCCCGGGGGAC*CCCGTA*AA
SKNB1_0023_F08.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
CBLT1_0049_B07.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
LVRM1_0148_H06.b : CAAGCAGGNAAGAGTCCTGACTGGCCCGGCCTGCCATGGTTCCCGGGGGA*CCCCTAAAA
OVRM1_0084_E04.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
UTR01_0086_G11.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
THY01_0040_D05.b : CAATCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCAGGGAACCCCCGTATAA
TES01_0095_E11.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAAAA
ADR01_0058_F07.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
ITT01_0072_C08.b : CAAGCAGGGAAGAGTCCTGACTGCCCCGGCCTGCCATGGTCCCGGGGGAC*CCCGTAGAA
20110601C-007529 : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
---------+---------+---------+---------+---------+---------+ 700
LNG01_0103_D07.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
PTG01_0034_D03.b : ATCACAG*CCCTTCTGTGGCAGGCCTTCCCGCCTCGTCCCTCTGACTGGGCCCCATGGGG
OVRM1_0052_B10.b : CTCACAG*CCCT*CTGTGCCAGNCCTTCCCGCCTCGTCCCTCTGACTGGCCCTCATGGGG
CLNT1_0012_D04.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
SMG01_0096_B12.b : caaaaggcttttggggcaagcctttccgcctgttcctttgaatggcccctggggcccgtg
BMWN1_0067_H07.b : CTCACAG*CCCT*CTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGG
SMG01_0051_G05.b : CTCACAG*CCCTTCTGTNGCAGCCNTTTCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
THY01_0120_F09.b : gngccct
OVRM1_0210_C08.b : CTCACAG*CCCT*CTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGTCACCATGGGC
LNG01_0062_A03.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
LVRM1_0047_E01.b : CTCACAG*CCCT*CTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGG
LVRM1_0108_H01.b : CTCACAG*CCCT*CTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGG
OVR01_0030_F08.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
ITT01_0062_C04.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
MLN01_0064_C04.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
UTR01_0092_H10.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
UTR01_0105_F11.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
ADR01_0038_A08.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
OVRT1_0022_E09.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
SPL01_0105_A08.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
ADR01_0029_D12.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
MLN01_0043_G02.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
TCH01_0040_D09.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
OVRT1_0121_A08.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
TES01_0083_C11.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGG
TES01_0019_H01.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
TES01_0056_E09.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
ADR01_0037_G10.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
ITT01_0013_A02.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
CBLT1_0039_F09.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
LNG01_0089_F01.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
UTR01_0014_A07.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
ADR01_0049_G07.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
SMG01_0026_F01.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
ADR01_0023_B12.b : CTCACAG*CCCTTCTGTGGCAGCCCTTTCCGCtcgtccctctgatgggccccatggggcc
SKNB1_0023_F08.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
CBLT1_0049_B07.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
LVRM1_0148_H06.b : ATCACAG*CCC*TCTGTTGCAGCCCTTCCCTGCTCGTCCCTCTGACTGGCCCCatgggac
OVRM1_0084_E04.b : CTCACAG*CCCT*CTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
UTR01_0086_G11.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
THY01_0040_D05.b : CTCACAGCCCCTTCTGTGCCAGCCCTTCCCcgcctcgtcccctctgattggcccccttgg
TES01_0095_E11.b : CTCACAG*CCCTTCTGTGCCAGCCCTTTCCGCCTCGTCCCTCTGACTGGCCCCCATGGCC
ADR01_0058_F07.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
ITT01_0072_C08.b : CTCACAG*CCCTTCTGTGCCAGCCCTTCCCGCCTCGTCCCTCTGACTGGCCCCCATGGGC
20110601C-007529 : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
---------+---------+---------+---------+---------+---------+ 759
LNG01_0103_D07.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
PTG01_0034_D03.b : CCGTGC*TTGGAGAACCAGCCTCCAAACACGGGACCCTCAAGCGCTCCC*CAACTGGCTA
OVRM1_0052_B10.b : CCGTGCTTTGGAGA*CAGGCCTCCNAACACGGGACCCTC*AGCGCTCCC*AGCCTGGCTA
CLNT1_0012_D04.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
SMG01_0096_B12.b : gtttgaaaacagggcttcaaaaagggaaccttaaagcctcccaacctggtatacccccag
BMWN1_0067_H07.b : CCGTGCTTTGGAAGACAAGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGTCTA
SMG01_0051_G05.b : CCGTGCTTTGGAGA*CAGGNCCNTCAACACGGGACCCCTCAGCGCTTCC*AGCCTGGCTA
THY01_0120_F09.b :
OVRM1_0210_C08.b : CCGTGCTTTGGAGACCAAGCCTTCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
LNG01_0062_A03.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
LVRM1_0047_E01.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*An
LVRM1_0108_H01.b : CCGTGCTTTGGAGA*CAGGCCTCCCAACACGGGACCCCTCAGCGCTCCC*AGCCTGGCTA
OVR01_0030_F08.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCCCAGCCTGGCTA
ITT01_0062_C04.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
MLN01_0064_C04.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCCTCAGCGCTCCC*AGCCTGGCTA
UTR01_0092_H10.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
UTR01_0105_F11.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
ADR01_0038_A08.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
OVRT1_0022_E09.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
SPL01_0105_A08.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
ADR01_0029_D12.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
MLN01_0043_G02.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
TCH01_0040_D09.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
OVRT1_0121_A08.b : CCGTGCTTTGGAGACCAGGCCTCCAAAACCTGGACCCTCAAGCCCTCCC*CGCCTGGCTA
TES01_0083_C11.b : CCGTGCTTTGGAAGACAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
TES01_0019_H01.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
TES01_0056_E09.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
ADR01_0037_G10.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
ITT01_0013_A02.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
CBLT1_0039_F09.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
LNG01_0089_F01.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
UTR01_0014_A07.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
ADR01_0049_G07.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
SMG01_0026_F01.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
ADR01_0023_B12.b : gtggctctggaaaccaggctccaaaaacggaaccttaaaggcttccaacctgggtaattg
SKNB1_0023_F08.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
CBLT1_0049_B07.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
LVRM1_0148_H06.b : cgtgctttgaaaacaagcctcaaacacgggaccttcagcgctcccacctggctagatggc
OVRM1_0084_E04.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTNCAGCGCTCCC*AGCCTGGCTA
UTR01_0086_G11.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
THY01_0040_D05.b : gcccgtgctttttggagacccggcccttccaaacacgggaccctcaggcgctcccagtct
TES01_0095_E11.b : CCGTGCTTTGGAGACAAGCCCT*CAAACACGGGACCCTCAAGCGCTCCC*AGCCTGCCTA
ADR01_0058_F07.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
ITT01_0072_C08.b : CCGTGCTTTGGAGACCAGGCCTCCAAACACGGGACCCTCAAGCGCTCCC*AGCCTGGCTA
20110601C-007529 : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
---------+---------+---------+---------+---------+---------+ 816
LNG01_0103_D07.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
PTG01_0034_D03.b : ACTGCCAAGCTGGGCGCCCC*CAGAAACA*GGAAAACCGTCTTTCCACCC*GCTttgttt
OVRM1_0052_B10.b : GCTGCCCAGCTGGCCGCCCC*AGGAGCC
CLNT1_0012_D04.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
SMG01_0096_B12.b : gtggggccccaagaaacaaaaaaaggtttttcccacccgtttgttcccctcaaaagattg
BMWN1_0067_H07.b : GCTGCCAGGTTGGCCccccaggagccagaaaagcttttttccaccggttcgtgctcctcc
SMG01_0051_G05.b : GCTGCCAGGCTGGCCGCCCC*CAGAGACA*Gaacaagcgttcttccaccggctctgtccc
THY01_0120_F09.b :
OVRM1_0210_C08.b : GCTGCCAGGCTGTGCTGCCC*AGGA
LNG01_0062_A03.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
LVRM1_0047_E01.b :
LVRM1_0108_H01.b : GCTGCCAGGCTGGCCGCCCC*CAGAG
OVR01_0030_F08.b : GCTGCCAGGCTGGCCGCCCCCAGGAGCCA*GGACAGCCGTCTTCCCACCCCGCTCTGCTC
ITT01_0062_C04.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
MLN01_0064_C04.b : GCTGCCAGGCTGGGCGCCCC*ATGAGCCA*GGACAGCCGTCTTCCCCCCCCGCTCTGCTC
UTR01_0092_H10.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTTCTTCCCACCCGCTCTGCTC
UTR01_0105_F11.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTTCCACCC*GTTCTGCTC
ADR01_0038_A08.b : GCTGCCAGGCTGGCCGCCCC*ANGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
OVRT1_0022_E09.b : GCTGCCAGGCTGGCCGCCCC*ANGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
SPL01_0105_A08.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTTCCACC**GCTCTGCTC
ADR01_0029_D12.b : GCTGCCAGGCTGGCCGCCCC*AGGAAGCA*GGACAGCCGTCTTTCCCACC*GCTCTGCTC
MLN01_0043_G02.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
TCH01_0040_D09.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
OVRT1_0121_A08.b : GCTGCCAGGCTGGCCCCCCCCAGGAGTCA*GGACAGCCGTTTTCCCACCtcttcgctccc
TES01_0083_C11.b : GCTGCCAGGCTGGGCGGCCCCAGGAGCCAAGGACAGGCGTCTTCCCAACCGGCTCTGCTC
TES01_0019_H01.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
TES01_0056_E09.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
ADR01_0037_G10.b : GCTGCCAGGCTGGGCGCCCC*AGGAGCCA*GGACAGCCGTCTTTCCACCC*GCTCTGCTC
ITT01_0013_A02.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
CBLT1_0039_F09.b : GCTGCCAGGCTGGCCGCCCC*AAGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTT
LNG01_0089_F01.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
UTR01_0014_A07.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCG*GGACAGCCGTCTTCCCACCC*GCTCTGC
ADR01_0049_G07.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
SMG01_0026_F01.b : GCTGCCAGGCTGGCCGCCCCCA*GAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
ADR01_0023_B12.b : cagggttggcccccccagaaaccagaaaggcgtttttcacccggtttggtccttcagaat
SKNB1_0023_F08.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
CBLT1_0049_B07.b : GCTGCCAGGCTGGCCGCCCC*AAGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
LVRM1_0148_H06.b : aggctggccgcccaagagcaagacagacgccttccaccgctctgctcctccagggcggtc
OVRM1_0084_E04.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACC
UTR01_0086_G11.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
THY01_0040_D05.b : gcctagctgcccgcctgggcccccccggagccaggaacaggccgtcttcccccccccctc
TES01_0095_E11.b : GCTGGCAGGTTGGCCGCCCC*GGGAACCA*GGAAAGGCGTCTTTCCACCCGCcttggctc
ADR01_0058_F07.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
ITT01_0072_C08.b : GCTGCCAGGCTGGCCGCCCC*AGGAGCCA*GGACAGCCGTCTTCCCACCC*GCTCTGCTC
20110601C-007529 : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
---------+---------+---------+---------+---------+---------+ 872
LNG01_0103_D07.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGGCAGCCTGTGGTA*CCACTTGGGG*TCC
PTG01_0034_D03.b : cttcaagaagtttggacaaaaccccggggccacctggggtacacccttggtccctccccc
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : *CCTCCAGAATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
SMG01_0096_B12.b : gaaaaaacccgggggcccccccgggggaaacccttgggccccttccccggaaccccttta
BMWN1_0067_H07.b : agggctggttccctgctcccagaagcttggaaaaactgccgggccgcctgtggaacacct
SMG01_0051_G05.b : tccagatgcttggacagagcggcggggcagcctggggaccaacttggtccatcttctgga
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b : *CCTCCNAGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCA*CTTGGT*CCC
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b : *CCTCCCGGATGCTTGGgacagagccggcggggccagcctggggaaccccctttggtccc
ITT01_0062_C04.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCCGTGGTA*CCACCTTGGT**CC
MLN01_0064_C04.b : *CCTTCAGGAAGCTTGGACAGA*GCCGCGGGGGCCGCCCGTGGTA*CCCCCTTGGT*CCC
UTR01_0092_H10.b : CCCTCCAGGATGCTTGGACAGAAGCCGCGGGGCCAGCCTGTGGTAACCACCTTGGTTCCC
UTR01_0105_F11.b : *CCTTCAGGATGCTTGGACAGA*CCCGCGGGGCCCGCCTGTGGTA*CC*CCTTGGT*CCC
ADR01_0038_A08.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
OVRT1_0022_E09.b : *CCTCCAAGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CAAC*TTGGT*CCC
SPL01_0105_A08.b : *CCTCCA*GATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
ADR01_0029_D12.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
MLN01_0043_G02.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGGCAGCCTGTGGTA*CCACCTTGGT*CCC
TCH01_0040_D09.b : *CCTCCAAGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCCTGGT**CC
OVRT1_0121_A08.b : tcagaatgcttggacaaacctccgggccacccgttatacaccttggtccatcttcctatc
TES01_0083_C11.b : *CCTCCAGGAAGCTTGGACAGAACCCCCGGGGCCCGCCGGTGGTA*CCACCTTGGT*CCC
TES01_0019_H01.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
TES01_0056_E09.b : *CCTCCCAGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
ADR01_0037_G10.b : *CCTCCAGGATGCTTGGACAGA*ACCGCGGGGCCAGCCTGTGGTA*CCACCTTGGG*TCC
ITT01_0013_A02.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CC*
CBLT1_0039_F09.b : *CCTCCAGGATGCTTGGAAAAA*CCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
LNG01_0089_F01.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCCACTCGGG*TCC
UTR01_0014_A07.b :
ADR01_0049_G07.b : *CCTCCAAGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
SMG01_0026_F01.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*C*ACCTTGGT*CCC
ADR01_0023_B12.b : ctttggaaaaaaccccggggccaccggggggaccccttgggcccccccccgaaacccttt
SKNB1_0023_F08.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
CBLT1_0049_B07.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
LVRM1_0148_H06.b : g
OVRM1_0084_E04.b :
UTR01_0086_G11.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
THY01_0040_D05.b : tgcttccttccggaattctttgaactgaccccccggggccaccctgtggacccaccctgg
TES01_0095_E11.b : cttccaggaagcttgaaacaaaccccggggccagcctgggggaacccccttggtcccctc
ADR01_0058_F07.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
ITT01_0072_C08.b : *CCTCCAGGATGCTTGGACAGA*GCCGCGGGGCCAGCCTGTGGTA*CCACCTTGGT*CCC
20110601C-007529 : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGCGTT
---------+---------+---------+---------+---------+---------+ 930
LNG01_0103_D07.b : ATCTCCCT*GATCCCTTCTGATCTGANCCCTGGN*TGCTGGCTCATCTGCCTCCTG*CGT
PTG01_0034_D03.b : cgatccttctaattgaaacccgggggccgggtcaactggctcggcggttttctttccggc
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGCGTT
SMG01_0096_B12.b : aataacacccgggggcggggcaccccgcccccggtgtttttcttcggcggggtgtttttg
BMWN1_0067_H07.b : gggccccttccctgatccctttatttgaaacccggggcctgctcaactgcccctgggttt
SMG01_0051_G05.b : tcctttcgattggaccccggtgcctggtcaactgccccggcttttttttcggccgccgtt
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTG*CGT
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b : ttctccctggatcccttttctgatttgaaccctggtgcccgggttcatctgcctcctgcg
ITT01_0062_C04.b : ATCTCCCT*GATCCCTctgatctgaacctggtgctggctcatctgcctctgcgtttttct
MLN01_0064_C04.b : ATtctccttgaatctttcggaattgaaccctggtgcctgggctcatccggccccctgggt
UTR01_0092_H10.b : CTCTCCCT*GATCCCTTCTGATCTGAACCCctggggcctgggctcatctggcctcctggc
UTR01_0105_F11.b : TTCTCCCTTGACCCCTTCTGATCTGAACCCTGGgtgcctgggttcatctgcctccctgcg
ADR01_0038_A08.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGCGTT
OVRT1_0022_E09.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GGCTGGCTCATCTGCCTCCTGCCTT
SPL01_0105_A08.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGNT*GCCTGGCTCATCTGCCTCCTGCGTT
ADR01_0029_D12.b : ATCNTCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCTTCCTGCGTT
MLN01_0043_G02.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTTCTGCG*T
TCH01_0040_D09.b : ATCTCCCT*GATCCCTTCTGATCTGAAC*CTGGT*GCCTGGCTCATCTGCCTCCTGCGTT
OVRT1_0121_A08.b : cctttgattgaacccgggtggcggttatttgcctctgtatttttctttccggtgccgttt
TES01_0083_C11.b : ACCTCCCG*GAACCCTTCCGATTCGAACCCTGGT*GCCTGGGTCATCTGgccccgggggt
TES01_0019_H01.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGCGTT
TES01_0056_E09.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GGCTGGCTCATCTGCCTCCTGCGTT
ADR01_0037_G10.b : ATCTCCCT*GATCCCTTCGGATCTGAACCCTGGT*GCCTGGCTCATCTGCCCCCTGCTTT
ITT01_0013_A02.b : ATCCTCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGCCTCATCTGCCTCCTGCGTT
CBLT1_0039_F09.b : ATCTCCCT*GATCCCTTCTGATTTGAACCCTGGG*GCCTGGCTCATCTGCCTCCTGCGTT
LNG01_0089_F01.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGGCGT
UTR01_0014_A07.b :
ADR01_0049_G07.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTTCTGGCGT
SMG01_0026_F01.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGTTGGCCTGGCTCATCTGCCTCCTGCGTT
ADR01_0023_B12.b : gaaatgaacccgggggcgggggcactggccccgggggttttttttcccgggcgcttttga
SKNB1_0023_F08.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGCGTT
CBLT1_0049_B07.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGCG*T
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b : ATCTCCCT*GATCCCTTCTGATCTGGACCCTGGT*GCCTGGCTCATCTGCCTCCCTGCGT
THY01_0040_D05.b : gtccctcttccttgatctctttctggattttgaaccccgggtggcctgggccattcttgc
TES01_0095_E11.b : cccccgattcctttcaaattgaaccctgggggccggggccacctgcccccggggtttttc
ADR01_0058_F07.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGCGTT
ITT01_0072_C08.b : ATCTCCCT*GATCCCTTCTGATCTGAACCCTGGT*GCCTGGCTCATCTGCCTCCTGCGTT
20110601C-007529 : TTTCTTTCCTGCTGCTGTTTTGTA*AAAAAAAAGAAGGAAACTAGAAACCCGAACAAGTG
---------+---------+---------+---------+---------+---------+ 989
LNG01_0103_D07.b : TTTTCTTCCTGCTGCTGTTTTGTA*AAAAAGAAGGAAGGAACTAGAAACCCGAACAgtga
PTG01_0034_D03.b : ggcggttttttaaaaaaaaaaagggaaccttaaccccccccagggggaataaaattcagt
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : TTTCTTTCCTGCTGCTGTTTTGTA*AAAAGAAAGAAGGAAACTAGGAACCCGAcagtgag
SMG01_0096_B12.b : taaaaaaaaaagggggttctttccccccccaaaggggggaaaaaaacctttttccttttt
BMWN1_0067_H07.b : ttctttcggcgcttttttgaaaaaaaaaaaagggactataaccccaaacgttgaagggta
SMG01_0051_G05.b : tggaaaagaaagaaggaactggaacccgaccagggaagaaataaatttcccctttgggcg
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b : TTTCTTTCCTGCTGCTGTTTGGTA*AAAAGAAAGAAGGAActagaaaccgaacagtgaga
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b : tttttcttttctgctgctggtttgtaaaaaaaaaaaaaaggaaactaaaaacccgaaaaa
ITT01_0062_C04.b : ttctgctgctgtttgtaaaaagaaagaggaactagaacccgaccagtgagattactacat
MLN01_0064_C04.b : ttttccttctggcttcctgttttggaaaaaaaaaaaaaaggaaacttgaacccccaacaa
UTR01_0092_H10.b : gttttccttttcctggcggctggtttggaaaanaagaaaagaaggaaactttgaaacccc
UTR01_0105_F11.b : ttttttctttcctgcctgctggtttgtaaaaaaagaaaagaaagaaacttcagaaacccc
ADR01_0038_A08.b : TTTCTTTTCTGGTGCTGGTTTGGA*AAAAGAAAGAAGGAActaaaaacccgacaagtgan
OVRT1_0022_E09.b : TTTTCTTCCTGCTGCTGTTTTGTA*AAAAAGAAGAAGGAAACTtgaaccccaacagttag
SPL01_0105_A08.b : TTTCTTTC*TGCTGCTGTTTTGTA*AAAAAGAAGAAAGAAACTAGAACCCTGAACAgtga
ADR01_0029_D12.b : TTTCTTTCCTGCTGCTGGTTTGTA*AAAAAAAAGAAGGAAACTAGAAACCCAAACA*GTG
MLN01_0043_G02.b : TTTCTTTCCTGCTGCTGTTTTGTA*AAAAAGAAGGAAGAAACTTGAAACCCGAACAAGTG
TCH01_0040_D09.b : TTTCTTTCCGGCTGCTGTTTTGGAAAAAAGAAAGAAGGGAACTtgaaaacccaaacaagt
OVRT1_0121_A08.b : ttgaaacagaacagaggaaccctttacccaaaatttggaattcctaccttttctcccttt
TES01_0083_C11.b : tttcttttccgcggcgggtttggaaaaaaaaaaaagggaaaccgaaaacccgaacaaggt
TES01_0019_H01.b : TTTCTTTCCTGCTGCTGTTTTGTA*AAAAGAAAGAAGGGAACTAGAAACCCGAcaagtga
TES01_0056_E09.b : TTTCTTTCCTGCTGCTGTTTTGTAAAAAAGAAAGAAGGAAACTAGAAACCCGAACAAGTG
ADR01_0037_G10.b : TTCTTTCCggtgctgttttgaaaaaaaaagaagggaactaaaaccccgaaaagtggaaat
ITT01_0013_A02.b : TTTCTTTC*TGCCGCTGTTTTGAA*AAAAaaaagaaggaactagaaacccgaccagtgga
CBLT1_0039_F09.b : TTTTTTTCCCGGCGCTGTTTTGTA*AAAAAAAAGAAGGAAACTAcaaccccaacaaatgg
LNG01_0089_F01.b : TTTCTT*CCTGCTGCTGTTTTGTA*AAAAAGAAAGAGGGAACTAGAAACCCGAccagtga
UTR01_0014_A07.b :
ADR01_0049_G07.b : TTTCTTTCCTGCTGCTGTTTTGGA*AAAAGAAAAGAAGGAActcaaaaccccgaacagtg
SMG01_0026_F01.b : TTTCTTTCCTGCTGCTGTTTTGTA*AAAAAAAAGAAGGAAACTtagaaccccgacaggtg
ADR01_0023_B12.b : aaaaaaaaaagggaactttaacccccccagggggaaaaaaaacaattttccccttttttg
SKNB1_0023_F08.b : TTTCTTTCCTGCTGCTGGTTTGTAAAAAAGAAAGAAGG*AACTAGAAGCCCGAACAAGTG
CBLT1_0049_B07.b : TTTCTTTCCTGCTGCTGTTTTGTAAAAAAGAAAGAAGGAAACTAGAAcccgaacagtgag
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b : TTTTCTTTCTGCTGCTGTTTTGTA*AAAAAGAAGAAGGAAACTAGAAACCCGAACAAGTG
THY01_0040_D05.b : cctctgggctttttctttttcctgcctgcttgtttttaaaaacaaaaaaaaaaagggaaa
TES01_0095_E11.b : tttcccggcggcgggtttggaaaaaaaaaaaaaagaaactttaaaccccaaaaagtggaa
ADR01_0058_F07.b : TTTCTTTCCTGCTGCTGTTTTGTA*AAAAAAAAGAAAGAAACTAGAAACCCGAACAAGTG
ITT01_0072_C08.b : TTTCTTTCCTGCTGCTNGTTTGTAAAAAAGAAAGAAGGAAACTAGAAACCCGAACAAGTG
20110601C-007529 : AGAGTAACATACAGTTCTCTCATTTTGTGCAGGTCCTTAATAAGGAAC*TTTGTGATCCC
---------+---------+---------+---------+---------+---------+ 1048
LNG01_0103_D07.b : aagaacatacagtctctcattttgtgcagtccttaataagaactttgtgatcctctaaaa
PTG01_0034_D03.b : tctccctttttggggggccctaaaaaaaaattttggatcccctccccccccggggaaaca
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : agtacatacagttctctctttttgggcaggtctttaataaagaactttgtgaccctctaa
SMG01_0096_B12.b : gttgggggctttaaaaaaaattttgtgtcccccccccccccccgggaaaaaaacccccgg
BMWN1_0067_H07.b : tacattcttctttttggccagtctaaaaacaaattttttttcctctcaattataatacaa
SMG01_0051_G05.b : gtcctataaaaacttttgatcccttaaaaaaaaaaaaagccaatggttcaatggggggcg
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b : gtaactaagttctctcttttgtgaggtcctaataagaactttgggatcctctaaaaaaaa
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b : atggaaaagaaacttaaagtttctcttcatttttggggcagggcctttaaaaaaaaaaat
ITT01_0062_C04.b : tctctcatttgtgcggtcctaataagaaatttgtgatcccttacctccccggaagacaaa
MLN01_0064_C04.b : atggaaagtaacatccggttcctctcttttggggaggttcctaaaaaaagaaattttggt
UTR01_0092_H10.b : gaaacaaagtgagaaataaacattacattttctcctcattttttggccagggtccttaaa
UTR01_0105_F11.b : aaacaaagtgaaaaataaacttacagtttcttcttcttttggtgccgggctcctttaata
ADR01_0038_A08.b : agtacatacagttctctcatttgtgcaggtccttataaagacttttgtgatccctcacct
OVRT1_0022_E09.b : agtaacatccattctctcttttgtgcaggtccttaataagacttttgggatcccctaaaa
SPL01_0105_A08.b : gagtacatacagttctctcattttgtgcaggtcttaataaagaacttttgtgatcccttt
ADR01_0029_D12.b : AGAGTAACATACAGTTCTCTCATTTTGTGgcagtcccttataaagaacttttgtgatccc
MLN01_0043_G02.b : AGAGTAACATACAGTTCTCctcttttgtggaggtctttaataaagaacttttgtgatccc
TCH01_0040_D09.b : gaaagtaccttacagttcctctccttttggggcaggtccttaaataaaaaatttttggga
OVRT1_0121_A08.b : gggcggccttaactacaacttttgtgttctctcaaaaaaaataaaaaaagcgcctttttg
TES01_0083_C11.b : gaagaaaacaaaaattcctccatttttgggcagggccctaataaaaaaattttttgaacc
TES01_0019_H01.b : gagtaacttcagttctctcatttgtgcaagtcctaataaaaaactttgtgatccctctac
TES01_0056_E09.b : AGAGTAACATACAGTTCTCTCATTTTGTGCAGGTCCTtataaagacttttgtgatccctc
ADR01_0037_G10.b : acatacagtttctcttttgggcaggtcctataaaaacttttgtaatctctactcccctgg
ITT01_0013_A02.b : agtaacatacagtttctcccttttgtggcagtccttaataaaaaactttggtgatcaaaa
CBLT1_0039_F09.b : aagtaaaatccggttctccatttttggaaggtcctttaaaaaaattttgtgatccctcta
LNG01_0089_F01.b : gagtacatactgtctctcatttgtggaagtcctaataaagacttttgtatccttctaaaa
UTR01_0014_A07.b :
ADR01_0049_G07.b : aagagtacatacagttctctcatttgtgcaagtccttaataaaacttttgtgatcctcta
SMG01_0026_F01.b : aaattaacatcaattcttttctttttgggcaggccttaataaaaaactttggggatccct
ADR01_0023_B12.b : ggggccctttaaaaaaaattttggaacccccccccccccgggagaaaaaaaaccgggccc
SKNB1_0023_F08.b : AGAGTAACATACAGTTCTCTCATTTTGTGCAGGTCCTtaaaaagaacttttgtgatccct
CBLT1_0049_B07.b : agtaactacagttccccattttggtgcggtccttataaaaacttttgtgatccccctaaa
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b : AGAGTAACATACAGTTCCCTCATTTTGTGCAGGTCCTAAATAAGAAACTTTTGTGATCCC
THY01_0040_D05.b : cataaaaaaaccgtctcaccctggtaaaaatatcaattcccgtttcttcctttttttttg
TES01_0095_E11.b : gtaacataccgtttcctccattttgtggggagccttaataaaaaaaattttggaaccccc
ADR01_0058_F07.b : AGAGTAACATACAGTTCTCTCATTTTGTGCAGGTCCTTaataaagaacttttgtgatccc
ITT01_0072_C08.b : AGAGTAACATACAGTTCTCTCATTTTGTGCANGTCCTTAATAAGGAAC*TTTGTGATCCC
20110601C-007529 : TCAAAAAAAAAAAAAAAAAAAAA.....................................
---------+---------+---------+---------+---------+---------+ 1071
LNG01_0103_D07.b : aaaaaaaaaaaaaagcccatgtctccactgcagtccggccctctaattatctcgagggca
PTG01_0034_D03.b : aaccctgccccgaaaaatatcttttgcccacccctttccccaaaaaaccttctcccacca
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : aaaaaaaaaaaaaggccaattggttccaactgtcagtcccgcccctaaataatctaaaaa
SMG01_0096_B12.b : gggcccaaaaaaataattttgggcaccccctttttttgggaaaaaaaatctcttcccacc
BMWN1_0067_H07.b : gagataaaaacattgaattttcttatactccttgacctttcgtttccttccgccgcccca
SMG01_0051_G05.b : gccctctaaaattcctgggggccaatttaggtccccttttttgaaaagggcccatagggg
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b : aaagcactgtgccaactgcggtccggccctctattacctcaagggcaagttacctaccac
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b : tttttggggatcccttttacccccccccttgggaaaaacccaaacccttggggccccctg
ITT01_0062_C04.b : cccgggccctgactaaataccttgttcacccccttcccgcaaaagcacttctccaggcaa
MLN01_0064_C04.b : aacccctctaaaaaaaaaaaaaaaaaggccctttgtccctaacttccagggcccgcccct
UTR01_0092_H10.b : taaagaaacttttgtgggatccccttttaaaaaaaaaaaaaaaaaaaaaggcgccacctt
UTR01_0105_F11.b : aaaaaaattttttgggaatcccttccttnnnanataacaatactaacacctcaattatta
ADR01_0038_A08.b : cccatggggaaaccaaacccggggcctgactaaataacctctgttcaaacccctttccgc
OVRT1_0022_E09.b : aaaaaaaaaaaaggccatttgcctagctgaggccggccgcttacaactaaaaaaaacccc
SPL01_0105_A08.b : aaaaaaaaaaaaaaaaaaaagggcccaagtggctcaaattgcaggtccggccgctcttaa
ADR01_0029_D12.b : tctaaaaaaaaaaaaaaaaaaggccactttgctcaaccttcaggtcccggccccttaaaa
MLN01_0043_G02.b : ctctaannaaaaaannnaaaaaaaaaaaaaaaaaaagggccatttggctcaacctgcagt
TCH01_0040_D09.b : atccctctccctccccacggtgaaaaacaaaacccctgggcccctgaactaaattaccct
OVRT1_0121_A08.b : tccattgcgggttggtccctaaatattcttaaaaatactctccccccctcctttattata
TES01_0083_C11.b : cctcaccccccctgggaaaaacaaaacccggggccccgaacaaatttaacccttggcacc
TES01_0019_H01.b : ctccacggtgaagacaagaccctgggcccgaactaaatacccttcgtccaaccccctttc
TES01_0056_E09.b : tactcccccgtgaagaccaaaccctgggcctgagctaattacctctgtcaaccccctttc
ADR01_0037_G10.b : gaaacaaacctgggcccgaattaattaccttgtcaccccccttttccccaagacccttcc
ITT01_0013_A02.b : aaaaaaaaaaaaggccccttttgcttcacctccaggctccgccccccctaaaatttccct
CBLT1_0039_F09.b : cccccccctgggaaaccaaacctgggccctaactaattacctttgttccacccccttttc
LNG01_0089_F01.b : aaanannnnnaaaaanannnnnnnaaggcccggtgtcaactgcagttcggccctctaaaa
UTR01_0014_A07.b :
ADR01_0049_G07.b : cctcccctgggagaccaaccctggcctgagtaaattcctttgtccaacccccttcccccg
SMG01_0026_F01.b : cttaaaaaaaaaaaaaaaaaaaaagcccaattgtgtcaacctgagggtcgggccctcttt
ADR01_0023_B12.b : ggaaaaaaataattttgttagaccccctttttcccgaaaaaaccttctctctcccccaaa
SKNB1_0023_F08.b : ctacctcccactgggaagaccaaaccctgggcccggagctaaattaccctctgttcacac
CBLT1_0049_B07.b : aaaaaaaaaaataaaaaacaaaactaaataaaaaaattttagtccccggcccggatccct
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b : TCTaaaaaaaaaaaaaaaaaaaagggccccttgggtttcaactgtcggtcccgggcccct
THY01_0040_D05.b : tcccggttccccttcattacaaaaaaatctttttgtgtccccccttccatcccctcccct
TES01_0095_E11.b : cccccccccccgggaaaaaaaaaacccgtggcccgaggaaaataaaccccgtggtaaacc
ADR01_0058_F07.b : tctacctccactgtgaaaaccagaccctgggccctgagctaattaacctcggtccaaccc
ITT01_0072_C08.b : TCaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007529 : ............................................................
---------+---------+---------+---------+---------+---------+ 1071
LNG01_0103_D07.b : agcttaccgtaccactccttggaaaaggccctaaggagctattaactagccggccgtctt
PTG01_0034_D03.b : aagggaccaaaatgcccccgggggctcccccccttttttttggagttgaaaaaattttcc
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : aaacctcccaccctcccctgaaccgaaaataaaagaaggcattgtggtggtaactgttat
SMG01_0096_B12.b : aaaaaaaaaaaaaaaaccccccgggggggggccccccccttttttttggggggggagaaa
BMWN1_0067_H07.b : cttcttgggggttgtcgacacaataaatctcatttttgtgtaccatctataatgcaaaat
SMG01_0051_G05.b : atttaaagaggccgggcctttttaacccggggggaaaattttgggtttttaaaaaatttt
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b : tttttgtaaagggcccaaagggagcattaactgggaggccccgtttaacccgggcggaaa
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b : aaactttaaattttccccctctttttctccccccccccccccctttttttcccccccccc
ITT01_0062_C04.b : aggagcgaattcctccctgggtcctcccctttattcggaggcgaacacctcctcctttcc
MLN01_0064_C04.b : tcttaaattatcctcggaggggccaggttatccggtaccccttttttttgaaaagagggt
UTR01_0092_H10.b : tggcc
UTR01_0105_F11.b : tattaccttattctta
ADR01_0038_A08.b : aaaaaaccctttctccaagcaaagggcacgaaaatggttccgctggggggactggcccct
OVRT1_0022_E09.b : cccctcccctgacccgaacaaaagaagcaattgtgtgtacttgtttttcccttaagggtt
SPL01_0105_A08.b : ataatcctctaaggggccaagcttaac
ADR01_0029_D12.b : attcccttgggggcccaactttaccctaccacgtttttttgaaaaggggcccctaagggg
MLN01_0043_G02.b : cggggcccctctaattaccctggggggccaaggcttagcgtaccagctttttggtaaagg
TCH01_0040_D09.b : ttgttcccaccccccctttcccgcccaaaaagccaccttcccccccg
OVRT1_0121_A08.b : aaaaaaaaaagaatttttgtttaactgttagcccccctttttgtattataagctattccc
TES01_0083_C11.b : acccccttttccccccaaaagagcacttttcctcccgaaaaaagggacaaaaagtgtgcc
TES01_0019_H01.b : cggcagaaaccaccttccttccggcacagggcaacaacttggctccgctgggggcatcct
TES01_0056_E09.b : cgccgaaagcaccttcctccaggaaagggcaacaaatgggtcccctgggggatcctgcac
ADR01_0037_G10.b : ccagacaaggaaaaaagggttccctggggctctgcacttttactgaagttaaactatttc
ITT01_0013_A02.b : cagggggcccaaccttaaccgtacccagttttcttggtaaaaggggtcccctaagggagg
CBLT1_0039_F09.b : cgcaaagagacccttctcccggccaaagggagcaaattcttcccctgggggatccgcccc
LNG01_0089_F01.b : tccttaagggccagtttacgtaccacttctggaaagggcccatatgactattaaccaggc
UTR01_0014_A07.b :
ADR01_0049_G07.b : aaagccccttcttccccgccaaggcaacaaagggcctccgcgggggctctgccacctttt
SMG01_0026_F01.b : aaatatcccctgggggggccaagtttaccgttcccccctttttttgaaaaggggggccct
ADR01_0023_B12.b : ggggcccaaaatgttcccctctggggactcttcccccttttttttgtaggggggagaaaa
SKNB1_0023_F08.b : ccccctacccgccggaaaaccccccttcttccccggccaaggggaacccaacgggggttc
CBLT1_0049_B07.b : ttggggggtaatggtccccaacttaaaaactggtagttgggcaccccccttaagcgggga
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b : tta
THY01_0040_D05.b : cttgcgtaaagaaacaacaaaccctctcgcgtccccttttataacttaaatattatcccc
TES01_0095_E11.b : cccttttccgaagaaaaaacacttttccccccataacaaaggggaaaataatgtttcccc
ADR01_0058_F07.b : cctttcccgcagaaagcacctttctcccagcacagggcacgaaagtgcctccggctgggg
ITT01_0072_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007529 : ............................................................
---------+---------+---------+---------+---------+---------+ 1071
LNG01_0103_D07.b : ttaagctggatggaaagctactggtttgggagaactctcgggggggcttggcacccccga
PTG01_0034_D03.b : cccctaaacccctttcttaaaaagttcttttaaaaaagaaaaaaaagaggggtctcctaa
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : ggcgccttaaaggttccataaagcatagctcccaattcccaaaaaggcttttttccgcgt
SMG01_0096_B12.b : aaaattctctccccaaaaaantttttttttttaaaaacctctaaaaaaaaaaaaaaaaaa
BMWN1_0067_H07.b : agcttcttttttgatccctttttttcatctctgcaaaataccactatttttcttatgggg
SMG01_0051_G05.b : ttgggggattgggaacccccaaaaacccggggaaaattttttggggaaccccccccccgg
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b : tgcatctgatttttgagaaccttttgggggaaagtgacacccccagataagccgggaaaa
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b : ccaaaaaaaagac
ITT01_0062_C04.b : ccctttgaaaaagtttgtaaaaggacaaacaggggcgtaaaaaaaaaaggatggatgggc
MLN01_0064_C04.b : ccctttagtgggccaatttaaacatagagcttgcgcccta
UTR01_0092_H10.b :
UTR01_0105_F11.b :
ADR01_0038_A08.b : ttaactgggagttaaaaaatcttccccccataacaccttttttagaaaaggttctggaaa
OVRT1_0022_E09.b : aaaaaaaaacccccaattccaaaaagtttttccggctaattggttggcaacaaaagtttt
SPL01_0105_A08.b :
ADR01_0029_D12.b : ggcgtttaaaaacaggggcgggcgccctttttacaacctgaaggggagaaagcgacctgg
MLN01_0043_G02.b : ggccctaaagggagtgaatataacctgggccggggcccgtttttaacgctgtggcgggaa
TCH01_0040_D09.b :
OVRT1_0121_A08.b : taattgactaaagttttttttacgtatatattggggcggaaagtcctacacttactgtct
TES01_0083_C11.b : tccctggggggcacccggcacccttttactctgagagggtcaaagaaaatctttcccccc
TES01_0019_H01.b : gcacctttgacctggaaggtcaaaacttacttctctcccaataccagccctttttgatat
TES01_0056_E09.b : cttgaccgtgaagtgaaaataacttccccccttacaccctttctaataagggttcctgga
ADR01_0037_G10.b : tccataacccttttttaaaaggtcctgaaaacggacaaaaaggggtctctaaaaaaaaaa
ITT01_0013_A02.b : cctaattaagactaggcccgggcgccctttttttcaacctcgggacggggaaaacgctac
CBLT1_0039_F09.b : cttgacttggaagttaaaacctatctccctccttacaccctttctttataacggtttctg
LNG01_0089_F01.b : tggcccttttccccggggggaaacgcactggatttttggaacctttttgggggaaattgt
UTR01_0014_A07.b :
ADR01_0049_G07.b : acctggaaggtggaaactactttcccccctttacaacctttcttgataagggttcctgaa
SMG01_0026_F01.b : tatgggaggcatttataacaggccgtggccgcgttttaaaaccctgaagtggaaaacgtt
ADR01_0023_B12.b : aaatttctcccctataaaaccctttttttaaaagagtttttttgaaaagagaaaaaaaaa
SKNB1_0023_F08.b : ctcctg
CBLT1_0049_B07.b : aaaagcttttttggaatttgaacgttttttttttacactaaagccaaaaaagttaaccca
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b :
THY01_0040_D05.b : ccttttgttcctcccccccccccctttctcttcccccctcccacagaaaatagacctata
TES01_0095_E11.b : ggtgggggaccccccaccctttttttttgggaggaggaaaaaaattttcccccctcttat
ADR01_0058_F07.b : catctgccacctttgactcggaaggttcaaaaatacttccccccattagcagcccttctc
ITT01_0072_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007529 : ............................................................
---------+---------+---------+---------+---------+---------+ 1071
LNG01_0103_D07.b : attacccgggaataatttatgtaaggtaacccacccgcgtgattctttgagattaaaaac
PTG01_0034_D03.b : aaaaaaaaaatttttgttttgggcccctaaattttgggggagaaacaccctttttttagg
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : ttaatggggttgcaaacccaaaggttttaatgtgggaccgcgcgccgagcaatattcctt
SMG01_0096_B12.b : aaggggggggtgcttaaaaaaaaaaaaaaaaaaanttttttttttttgggggccgcgctt
BMWN1_0067_H07.b : gcgcgggtatttccttctcttgataggttgcttcttctataaatatctctgcggtgttat
SMG01_0051_G05.b : ggttttttcaaataaaaaaacacacggtttttgtttttttcc
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b : atttggtagggtaccccagccggctt
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b :
ITT01_0062_C04.b : gcctaacccgggcatcccctttaagctagttaagagcttccgggacggtggcctgacccn
MLN01_0064_C04.b :
UTR01_0092_H10.b :
UTR01_0105_F11.b :
ADR01_0038_A08.b : aaggacaaaaaaaagggtggctttaaaaaaaaaaaaaaaaaaaaaaagcttgtgtcaatg
OVRT1_0022_E09.b : aagttggtcggggcggacaatttcctctctccccaaaaccggggggtgggggggggttct
SPL01_0105_A08.b :
ADR01_0029_D12.b : gattctttag
MLN01_0043_G02.b : acgcctacctgggatttttgaagaaacaaactgtgggggggaaat
TCH01_0040_D09.b :
OVRT1_0121_A08.b : ttctccggcaatcaataaatctcccactcccacttaactcccctgcttcgtgcgggcatc
TES01_0083_C11.b : cattttaaaaccccttccttagaaataaagctcccctggtaaaaaggggcccaaaaaagt
TES01_0019_H01.b : acaggttccgggaaaaaagggacaataaaaagggggggcggtcaaaaaaaaaaaaaggcc
TES01_0056_E09.b : aacggactaaaagagggggcggctaaaaaaaaaaaagaccttgtcctctgggcggcctca
ADR01_0037_G10.b : aaaagggtggtcgtggggggcctattccggggcattccc
ITT01_0013_A02.b : cttgggtatttggtgaagaaccttccttgttgtggtggcaaattgtcaacaccctcccca
CBLT1_0039_F09.b : gaaaacgggcaaaaaaaggggtccgttttaaccacaacaatattaaccacataaattacg
LNG01_0089_F01.b : gcaaccccggattagccgggaaaaatttttttaggtaacacccccctcccgaatttcccc
UTR01_0014_A07.b :
ADR01_0049_G07.b : aaacaagacaataaagggggtgcggttcaaaaaaaaaaaaaaaaaaccttgttttttctg
SMG01_0026_F01.b : cttgggaatttttaagaaacctttctttgtggggggaatttggaaaaaccccccaaattt
ADR01_0023_B12.b : aagaggtgggtcgtgaaaaaaa
SKNB1_0023_F08.b :
CBLT1_0049_B07.b : ttgttcttttttttgcgtggggagggtggggttttctcttataaccccacccggaagagc
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b :
THY01_0040_D05.b : ctttcttttcccctccccccacgtcccacaaactgaggggtgtacatcgccataacaatg
TES01_0095_E11.b : acaccctcttttttataaagcggtcccttgaaaaaagatgtccacaagaggggtgggtgc
ADR01_0058_F07.b : tgaaaacaggttcctggaaaaacggaccaaaaacaggtgtgcccgttcaaaaaaaaaaaa
ITT01_0072_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgactaatgggaaacttacttccaaatt
20110601C-007529 : ............................................................
---------+---------+---------+---------+---------+---------+ 1071
LNG01_0103_D07.b : cgccggtctgttttttctccggtttgcccccctgtataaccttgtgttgttcccccccaa
PTG01_0034_D03.b : ccctgaaaattaaaaaggcgcttttttctggagaattgttttttaatctttttttt
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : cctttctccaaaacacgggccggggggggggggggagtattctccgggggtgtctctccc
SMG01_0096_B12.b : tttttagtgggggggaggatcctcttcttttttttt
BMWN1_0067_H07.b : tcattatcatcattatttgtataatttggttccatatatttatgcttcttaattagtaag
SMG01_0051_G05.b :
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b :
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b :
ITT01_0062_C04.b : nnaatnnnnncntnaaatatcccttcctttaagggcgcnnnnnnnnnnnnnnnnnnnnnn
MLN01_0064_C04.b :
UTR01_0092_H10.b :
UTR01_0105_F11.b :
ADR01_0038_A08.b : ggcggcctctaaatcttggggac
OVRT1_0022_E09.b : ccgggggttttctcaagggaaaaaaattgacaccccccct
SPL01_0105_A08.b :
ADR01_0029_D12.b :
MLN01_0043_G02.b :
TCH01_0040_D09.b :
OVRT1_0121_A08.b : tccgtgggttctttctctgtgtttgctacttgtcatcatgatctcaatcttctttctt
TES01_0083_C11.b :
TES01_0019_H01.b : attgtca
TES01_0056_E09.b : attaaaaacaccacccccccccaaaaaaagtgtgttgtgtttttttgttaaaaaaacata
ADR01_0037_G10.b :
ITT01_0013_A02.b : aatttaaccttgagggaaaaaaaatttttggggagaggtttaaacaccgccactctcgcc
CBLT1_0039_F09.b : atccctacacaattcaccgcccccccccttgggtgtttgtaaccaaaaatgttgtgtcac
LNG01_0089_F01.b : gaaattaaaataacgcggtcttttgttttttacccctttggcccccccttgaaaaccctg
UTR01_0014_A07.b :
ADR01_0049_G07.b : gcgcgcccttttattctggggcgccttcttccct
SMG01_0026_F01.b : aacctccgggaaaaaaatttttgggtgaagggtgaacaaccccacttttggcgcaaaatt
ADR01_0023_B12.b :
SKNB1_0023_F08.b :
CBLT1_0049_B07.b : ttatttgagcctcctctcctcaaaactgcccgggtggggggggtaccccaacggtttttt
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b :
THY01_0040_D05.b : caatcttccgacctctctccccccctctcgcctgggcgtggggggcgacgcgatttcaca
TES01_0095_E11.b : aataaaaaaaacaaaagagcggattttaccctcgtgcgt
ADR01_0058_F07.b : agccattgtccaaccgcagggcggccctttaaaatcctcaggggccgagttacgtaccat
ITT01_0072_C08.b : taacctcagggaaaataaattttaagggaaaagggttaacacccgcatgcctctccttga
20110601C-007529 : ............................................................
---------+---------+---------+---------+---------+---------+ 1071
LNG01_0103_D07.b : agttttgaaaaaaatttttttttttttaaggggagcccagtgtcctcccnnnnnnnnnnn
PTG01_0034_D03.b :
OVRM1_0052_B10.b :
CLNT1_0012_D04.b : tggagatcaaaaaatgatagccccaccacaacaatccgtt
SMG01_0096_B12.b :
BMWN1_0067_H07.b : agattaatctatta
SMG01_0051_G05.b :
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b :
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b :
ITT01_0062_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0064_C04.b :
UTR01_0092_H10.b :
UTR01_0105_F11.b :
ADR01_0038_A08.b :
OVRT1_0022_E09.b :
SPL01_0105_A08.b :
ADR01_0029_D12.b :
MLN01_0043_G02.b :
TCH01_0040_D09.b :
OVRT1_0121_A08.b :
TES01_0083_C11.b :
TES01_0019_H01.b :
TES01_0056_E09.b : aaaattttctttgtgccattttgcggcatctct
ADR01_0037_G10.b :
ITT01_0013_A02.b : ctaga
CBLT1_0039_F09.b : accaagggaaaagttttagatggattttttatacaaaaaaataaatttttttgtgggagt
LNG01_0089_F01.b : tttgttcccccccaagagttttttaaaaaaaatttttttnnnnnntannnnntaccccag
UTR01_0014_A07.b :
ADR01_0049_G07.b :
SMG01_0026_F01.b : ttcttccggatatttaaaaaattccgggggttgtt
ADR01_0023_B12.b :
SKNB1_0023_F08.b :
CBLT1_0049_B07.b : ccaacgggcacgaaaatgtaatttaaggaaaaacggtggttatgcccccctaacatctag
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b :
THY01_0040_D05.b : tctctcgctc
TES01_0095_E11.b :
ADR01_0058_F07.b : ttttttgaaagagccccatatggataa
ITT01_0072_C08.b : aatttcttccggtttattttaaaaatttaccggggcttggtctattgttgggtttaatta
20110601C-007529 : ............................................................
---------+---------+---------+---------+---------+---------+ 1071
LNG01_0103_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PTG01_0034_D03.b :
OVRM1_0052_B10.b :
CLNT1_0012_D04.b :
SMG01_0096_B12.b :
BMWN1_0067_H07.b :
SMG01_0051_G05.b :
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b :
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b :
ITT01_0062_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0064_C04.b :
UTR01_0092_H10.b :
UTR01_0105_F11.b :
ADR01_0038_A08.b :
OVRT1_0022_E09.b :
SPL01_0105_A08.b :
ADR01_0029_D12.b :
MLN01_0043_G02.b :
TCH01_0040_D09.b :
OVRT1_0121_A08.b :
TES01_0083_C11.b :
TES01_0019_H01.b :
TES01_0056_E09.b :
ADR01_0037_G10.b :
ITT01_0013_A02.b :
CBLT1_0039_F09.b : ggttntcaacccggagccn
LNG01_0089_F01.b : cgtatctagtggcnnnnnnnnnnnnnnncnnnnt
UTR01_0014_A07.b :
ADR01_0049_G07.b :
SMG01_0026_F01.b :
ADR01_0023_B12.b :
SKNB1_0023_F08.b :
CBLT1_0049_B07.b : gcgagaagaactcg
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b :
THY01_0040_D05.b :
TES01_0095_E11.b :
ADR01_0058_F07.b :
ITT01_0072_C08.b : agccaggttttgtgccccccccccnttttgttaataccacactttgagtttttttaaacc
20110601C-007529 : ............................................................
---------+---------+---------+---------+---------+---------+ 1071
LNG01_0103_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PTG01_0034_D03.b :
OVRM1_0052_B10.b :
CLNT1_0012_D04.b :
SMG01_0096_B12.b :
BMWN1_0067_H07.b :
SMG01_0051_G05.b :
THY01_0120_F09.b :
OVRM1_0210_C08.b :
LNG01_0062_A03.b :
LVRM1_0047_E01.b :
LVRM1_0108_H01.b :
OVR01_0030_F08.b :
ITT01_0062_C04.b : nnnnnnn
MLN01_0064_C04.b :
UTR01_0092_H10.b :
UTR01_0105_F11.b :
ADR01_0038_A08.b :
OVRT1_0022_E09.b :
SPL01_0105_A08.b :
ADR01_0029_D12.b :
MLN01_0043_G02.b :
TCH01_0040_D09.b :
OVRT1_0121_A08.b :
TES01_0083_C11.b :
TES01_0019_H01.b :
TES01_0056_E09.b :
ADR01_0037_G10.b :
ITT01_0013_A02.b :
CBLT1_0039_F09.b :
LNG01_0089_F01.b :
UTR01_0014_A07.b :
ADR01_0049_G07.b :
SMG01_0026_F01.b :
ADR01_0023_B12.b :
SKNB1_0023_F08.b :
CBLT1_0049_B07.b :
LVRM1_0148_H06.b :
OVRM1_0084_E04.b :
UTR01_0086_G11.b :
THY01_0040_D05.b :
TES01_0095_E11.b :
ADR01_0058_F07.b :
ITT01_0072_C08.b : ccccccccccaaaaaaagattttttt