[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007612

Length: 1,062

Sequence [FASTA format sequence]
GCTCCGTGTG TCGATGTCAA TGTGTCTGTC CTTCACTCCT CCATTGTCTG CCGCCACCAC
TACCGCCGCT GCCACCGTCG CTGCCGGAGT TGCCGCAGCC CCCAGCCTCG CGCGTCGCCG
CTACCTCCTC GGACAGAAAT TTTATGAATA AGCATCAGAA GCCAGTGCTA ACAGGCCAGC
GGTTCAAAAC TCGGAAAAGG GATGAAAAAG AGAAATTCGA ACCCACAGTC TTCAGGGATA
CACTCGTCCA GGGGCTTAAT GAAGCTGGTG ATGACCTTGA AGCTGTAGCC AAGTTTCTGG
ACTCCACAGG CTCAAGATTA GATTATCGTC GCTATGCAGA CACACTCTTC GATATCCTGG
TGGCTGGCAG TATGCTTGCC CCTGGAGGAA CACGCATAGA TGATGGTGAC AAGACCAAGA
TGACCAACCA CTGTGTGTTT TCAGCAAATG AAGATCATGA AACCATCCGA AACTATGCTC
AGGTCTTCAA TAAGCTCATC AGGAGATACA AATATTTGGA AAAGGCATTT GAGGATGAAA
TGAAAAAGCT TCTCCTCTTC CTTAAAGCCT TTTCCGAAAC AGAGCAGACA AAGTTGGCAA
TGCTATCGGG GATTCTGCTG GGCAACGGCA CCCTTCCTGC CACCATCCTC ACCAGTCTTT
TCACTGACAG CTTAGTCAAA GAAGGCATTG CAGCCTCATT TGCTGTCAAG CTTTTTAAAG
CATGGATGGC AGAAAAAGAT GCCAACTCTG TTACCTCCTC TTTGAGAAAA GCCAACTTAG
ACAAGAGGCT GCTTGAACTC TTTCCAGTTA ACAGGCAGAG TGTGGATCAT TTTGCTAAAT
ACTTCACTGA CGCAGGTCTG AAGGAGCTTT CTGACTTCCT CAGAGTCCAG CAGTCCCTGG
GCACCAGGAA GGAGCTGCAG AAGGAGCTCC AAGAGCGTCT TTCTCAGGAA TGCCCCATCA
AGGAGGTGGT GCTCTACGTT AAAGAAGAAA TGAAGAGGAA TGATCTTCCG AGACAGCGGT
GATTGGACTC CTATGGACCT GTATCATGAA CGCTGTGGAG TG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinBZW2basic leucine zipper and W2 domain-containing protein 2 [Homo sapiens]. 567e-166O
Contig/Assembly ProteinBZW2basic leucine zipper and W2 domain-containing protein 2 [Homo sapiens]. 567e-166O
Contig/Assembly ProteinBZW1basic leucine zipper and W2 domain-containing protein 1 isoform 3 [Homo sapiens]. 407e-114O
Contig/Assembly ProteinBZW1basic leucine zipper and W2 domain-containing protein 1 isoform 2 [Homo sapiens]. 407e-114O
Contig/Assembly ProteinBZW1basic leucine zipper and W2 domain-containing protein 1 isoform 1 [Homo sapiens]. 405e-113O
Contig/Assembly ProteinBZW1basic leucine zipper and W2 domain-containing protein 1 isoform 4 [Homo sapiens]. 402e-112O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinBzw2basic leucine zipper and W2 domain-containing protein 2 [Mus musculus]. 565e-165O
Contig/Assembly ProteinBzw1basic leucine zipper and W2 domain-containing protein 1 [Mus musculus]. 405e-113O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475250PREDICTED: similar to basic leucine zipper and W2 domains 2 isoform 1 [Canis familiaris]. 567e-166O
Contig/Assembly ProteinLOC475250PREDICTED: similar to basic leucine zipper and W2 domains 2 isoform 2 [Canis familiaris]. 567e-166O
Contig/Assembly ProteinLOC478865PREDICTED: similar to basic leucine zipper and W2 domains 1 isoform 3 [Canis familiaris]. 407e-114O
Contig/Assembly ProteinLOC478865PREDICTED: similar to basic leucine zipper and W2 domains 1 isoform 2 [Canis familiaris]. 405e-113O
Contig/Assembly ProteinLOC478865PREDICTED: similar to basic leucine zipper and W2 domains 1 isoform 5 [Canis familiaris]. 402e-112O
Contig/Assembly ProteinLOC475250PREDICTED: similar to basic leucine zipper and W2 domains 2 isoform 5 [Canis familiaris]. 2661e-75O
Contig/Assembly ProteinLOC475250PREDICTED: similar to basic leucine zipper and W2 domains 2 isoform 4 [Canis familiaris]. 2661e-75O
Contig/Assembly ProteinLOC609149PREDICTED: similar to basic leucine zipper and W2 domains 1 isoform 3 [Canis familiaris]. 2601e-69O
Contig/Assembly ProteinLOC609149PREDICTED: similar to basic leucine zipper and W2 domains 1 isoform 2 [Canis familiaris]. 2601e-69O
Contig/Assembly ProteinLOC475250PREDICTED: similar to basic leucine zipper and W2 domains 2 isoform 3 [Canis familiaris]. 1875e-52O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinBZW2basic leucine zipper and W2 domain-containing protein 2 [Bos taurus]. 562e-164O
Contig/Assembly ProteinBZW1basic leucine zipper and W2 domain-containing protein 1 [Bos taurus]. 405e-113O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100514864PREDICTED: basic leucine zipper and W2 domain-containing protein 2-like [Sus scrofa]. 567e-166O
Contig/Assembly ProteinBZW1PREDICTED: basic leucine zipper and W2 domain-containing protein 1 isoform 2 [Sus scrofa]. 407e-114O
Contig/Assembly ProteinBZW1PREDICTED: basic leucine zipper and W2 domain-containing protein 1 isoform 1 [Sus scrofa]. 405e-113O
Contig/Assembly ProteinLOC100627810PREDICTED: basic leucine zipper and W2 domain-containing protein 2-like [Sus scrofa]. 1577e-39O


Assembly Members: 35      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010015A06ADR01_0015_A06.bDB782825 
ADR010025D03ADR01_0025_D03.bDB783694 
ADR010068C05ADR01_0068_C05.bDB787532 
AMP010036A10AMP01_0036_A10.bBW957581 
BFLT10099H08BFLT1_0099_H08.bFS647941 
HTMT10027F11HTMT1_0027_F11.bFS666224 
ITT010061G07ITT01_0061_G07.bBW981454 
OVR010018G05OVR01_0018_G05.bBP144108 
OVR010047A07OVR01_0047_A07.bBP141503 
OVR010047E07OVR01_0047_E07.bBP143295 AK234362
OVR010069E09OVR01_0069_E09.bBW965776 
OVRM10004C05OVRM1_0004_C05.bBP456841 
OVRM10005F07OVRM1_0005_F07.bBP459896 
OVRM10049H10OVRM1_0049_H10.bBP154690 
OVRM10070E10OVRM1_0070_E10.bBP150856 
OVRM10081F05OVRM1_0081_F05.bBP151606 
OVRM10120G12OVRM1_0120_G12.bBP153649 
OVRM10203D02OVRM1_0203_D02.bBP457623 
OVRT10038C10OVRT1_0038_C10.bFS689492 
OVRT10038G09OVRT1_0038_G09.bFS689534 
OVRT10079C05OVRT1_0079_C05.bFS692834 
OVRT10094B05OVRT1_0094_B05.bFS694045 
OVRT10134G07OVRT1_0134_G07.bHX237562 
OVRT10135E03OVRT1_0135_E03.bHX237624 
OVRT10148B07OVRT1_0148_B07.bHX238668 
PBL010002B05PBL01_0002_B05.bBP155342 
PTG010083C07PTG01_0083_C07.bFS711444 
PTG010100G01PTG01_0100_G01.bFS712581 
SKNB10037C05SKNB1_0037_C05.bDB802002 
SKNB10096D08SKNB1_0096_D08.bDB805763 
SMG010039C10SMG01_0039_C10.bFS716682 
SPL010003F07SPL01_0003_F07.bBP158543 
TCH010030H06TCH01_0030_H06.bCJ024698 
TCH010098B02TCH01_0098_B02.bCJ029580 
THY010123E04THY01_0123_E04.bBP164741 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
456C2670.943WNCAT/H
T200.057TAT/Y


Alignment:      TOP

20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SMG01_0039_C10.b :
OVRT1_0134_G07.b :
OVR01_0047_E07.b :
PTG01_0100_G01.b :
AMP01_0036_A10.b : nnggcgaaatataagggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_C05.b :
THY01_0123_E04.b :
OVR01_0069_E09.b :
PBL01_0002_B05.b :
OVRT1_0135_E03.b :
ITT01_0061_G07.b :
PTG01_0083_C07.b :
ADR01_0025_D03.b :
OVRM1_0049_H10.b :
ADR01_0068_C05.b :
HTMT1_0027_F11.b :
TCH01_0098_B02.b :
ADR01_0015_A06.b :
OVRM1_0005_F07.b :
OVRT1_0148_B07.b :
OVRT1_0094_B05.b :
SPL01_0003_F07.b :
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b :
OVRT1_0038_G09.b :
OVRT1_0038_C10.b :
TCH01_0030_H06.b :
OVR01_0018_G05.b :
OVR01_0047_A07.b :
BFLT1_0099_H08.b :
SKNB1_0096_D08.b :
20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SMG01_0039_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0134_G07.b : nnngggtaaannnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxx
OVR01_0047_E07.b : gggcttttgggggxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0100_G01.b : nnnnnnnnnnnnnnnnnnnn
AMP01_0036_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_C05.b : nnnaaacat
THY01_0123_E04.b :
OVR01_0069_E09.b : ataggxxxxx
PBL01_0002_B05.b : aaa
OVRT1_0135_E03.b : nnnnnnnnnnnnnnnnn
ITT01_0061_G07.b :
PTG01_0083_C07.b :
ADR01_0025_D03.b :
OVRM1_0049_H10.b :
ADR01_0068_C05.b : nnnnnnnnnnn
HTMT1_0027_F11.b :
TCH01_0098_B02.b : nnn
ADR01_0015_A06.b :
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : n
OVRT1_0094_B05.b : nncctttttn
SPL01_0003_F07.b : catttagctgxxx
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b :
OVRT1_0038_G09.b : nna
OVRT1_0038_C10.b :
TCH01_0030_H06.b :
OVR01_0018_G05.b : gggg
OVR01_0047_A07.b : agggacxxx
BFLT1_0099_H08.b :
SKNB1_0096_D08.b :
20110601C-007612 : .....................................GCTCCGTGTGTCGATGTCAATGT
---------+---------+---------+---------+---------+---------+ 23
SMG01_0039_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxGCTCCGTGTGTCGATGTCAATGT
OVRT1_0134_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCCGTGTGTCGATGTCAATGT
OVR01_0047_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATGTCAATGT
PTG01_0100_G01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnATGTCAATGT
AMP01_0036_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGTCAATGT
OVRT1_0079_C05.b : tcggctgcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0123_E04.b : aaaaacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0069_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0002_B05.b : aaataaaaaaatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0135_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_G07.b : nnnttgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0083_C07.b : gttgaannnnnntagtaaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0025_D03.b : aaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_H10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0068_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxx
HTMT1_0027_F11.b : ttttggcaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0098_B02.b : nggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0015_A06.b : naatgtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_F07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0148_B07.b : nnnaagttcagcggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_B05.b : nnnnnccattggcgtcagagtgagctatcagctctxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0003_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0203_D02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0070_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0081_F05.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0120_G12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0004_C05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0037_C05.b : nnnnnggtcgc
OVRT1_0038_G09.b : atccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_C10.b : nncccccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0030_H06.b : nnnggtaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0018_G05.b : gggaacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0047_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0099_H08.b : gtttcgttcagcgtaggxxxxxxxxxxxxxxxxxxx
SKNB1_0096_D08.b :
20110601C-007612 : GTCTGTCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
---------+---------+---------+---------+---------+---------+ 83
SMG01_0039_C10.b : GTCTGTCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRT1_0134_G07.b : GTCTGTCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVR01_0047_E07.b : GTCTGTCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
PTG01_0100_G01.b : GTCTGTCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
AMP01_0036_A10.b : GTCTGTCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRT1_0079_C05.b : xxxxGTCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
THY01_0123_E04.b : xxxxxxCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVR01_0069_E09.b : xxxxxxCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
PBL01_0002_B05.b : xxxxxxCCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRT1_0135_E03.b : xxxctggCTTCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
ITT01_0061_G07.b : xxxxxxxxxxCACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
PTG01_0083_C07.b : xxxxxxxxxxgACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
ADR01_0025_D03.b : xxxxxxxxxcaACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRM1_0049_H10.b : xxxxxxxxxxgACTCCTCCNTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
ADR01_0068_C05.b : xxxxxxxxxcaACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
HTMT1_0027_F11.b : xxxxxxxxxtgACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
TCH01_0098_B02.b : xxxxxxxxxxxACTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
ADR01_0015_A06.b : xxxxxxxxxxxxCTCCTCCATTGTCTGCCTCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRM1_0005_F07.b : xxxxxxxxxxxxCTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRT1_0148_B07.b : xxxxxxxxxxxxCTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRT1_0094_B05.b : xxxxxxxxxxxxCTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
SPL01_0003_F07.b : xxxxxxxxxxxxCTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRM1_0203_D02.b : xxxxxxxxxxxxtTCCTCCATTGTCAGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRM1_0070_E10.b : xxxxxxxxxxxxxTCCTCCATTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRM1_0081_F05.b : xxxxxxxxxxxxxxxxxxxxTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRM1_0120_G12.b : xxxxxxxxxxxxxxxxxxxxTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRM1_0004_C05.b : xxxxxxxxxxxxxxxxxxxxTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
SKNB1_0037_C05.b : tgttggccacggnatcctccTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRT1_0038_G09.b : xxxxxxxxxxxxxxxxxxxxTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVRT1_0038_C10.b : xxxxxxxxxxxxxxxxxxxxTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
TCH01_0030_H06.b : xxxxxxxxxxxxxxxxxxxxTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVR01_0018_G05.b : xxxxxxxxxxxxxxxxxxxxTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
OVR01_0047_A07.b : xxxxxxxxxxxxxxxxxxxxTTGTCTGCCGCCACCACTACCGCCGCTGCCACCGTCGCTG
BFLT1_0099_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTACCGCCGCTGCCACCGTCGCTG
SKNB1_0096_D08.b :
20110601C-007612 : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
---------+---------+---------+---------+---------+---------+ 143
SMG01_0039_C10.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRT1_0134_G07.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVR01_0047_E07.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
PTG01_0100_G01.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
AMP01_0036_A10.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRT1_0079_C05.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
THY01_0123_E04.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVR01_0069_E09.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
PBL01_0002_B05.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRT1_0135_E03.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
ITT01_0061_G07.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
PTG01_0083_C07.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
ADR01_0025_D03.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRM1_0049_H10.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
ADR01_0068_C05.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
HTMT1_0027_F11.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
TCH01_0098_B02.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
ADR01_0015_A06.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRM1_0005_F07.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRT1_0148_B07.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRT1_0094_B05.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
SPL01_0003_F07.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRM1_0203_D02.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRM1_0070_E10.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRM1_0081_F05.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRM1_0120_G12.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRM1_0004_C05.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
SKNB1_0037_C05.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRT1_0038_G09.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVRT1_0038_C10.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
TCH01_0030_H06.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVR01_0018_G05.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
OVR01_0047_A07.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
BFLT1_0099_H08.b : CCGGAGTTGCCGCAGCCCCCAGCCTCGCGCGTCGCCGCTACCTCCTCGGACAGAAATTTT
SKNB1_0096_D08.b : nnnggccgctgtggctctggagaatt
20110601C-007612 : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
---------+---------+---------+---------+---------+---------+ 203
SMG01_0039_C10.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRT1_0134_G07.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVR01_0047_E07.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
PTG01_0100_G01.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
AMP01_0036_A10.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRT1_0079_C05.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
THY01_0123_E04.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVR01_0069_E09.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
PBL01_0002_B05.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRT1_0135_E03.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
ITT01_0061_G07.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
PTG01_0083_C07.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
ADR01_0025_D03.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRM1_0049_H10.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
ADR01_0068_C05.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
HTMT1_0027_F11.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
TCH01_0098_B02.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
ADR01_0015_A06.b : ATGAATAAGCACCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRM1_0005_F07.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRT1_0148_B07.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRT1_0094_B05.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
SPL01_0003_F07.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRM1_0203_D02.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRM1_0070_E10.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRM1_0081_F05.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRM1_0120_G12.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRM1_0004_C05.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
SKNB1_0037_C05.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRT1_0038_G09.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVRT1_0038_C10.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
TCH01_0030_H06.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVR01_0018_G05.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
OVR01_0047_A07.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
BFLT1_0099_H08.b : ATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
SKNB1_0096_D08.b : tatgaatAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGAT
20110601C-007612 : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
---------+---------+---------+---------+---------+---------+ 263
SMG01_0039_C10.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRT1_0134_G07.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVR01_0047_E07.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
PTG01_0100_G01.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
AMP01_0036_A10.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRT1_0079_C05.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
THY01_0123_E04.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVR01_0069_E09.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
PBL01_0002_B05.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRT1_0135_E03.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
ITT01_0061_G07.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
PTG01_0083_C07.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
ADR01_0025_D03.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRM1_0049_H10.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
ADR01_0068_C05.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
HTMT1_0027_F11.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
TCH01_0098_B02.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
ADR01_0015_A06.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRM1_0005_F07.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRT1_0148_B07.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRT1_0094_B05.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
SPL01_0003_F07.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRM1_0203_D02.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRM1_0070_E10.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRM1_0081_F05.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRM1_0120_G12.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRM1_0004_C05.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
SKNB1_0037_C05.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRT1_0038_G09.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVRT1_0038_C10.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
TCH01_0030_H06.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVR01_0018_G05.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
OVR01_0047_A07.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
BFLT1_0099_H08.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
SKNB1_0096_D08.b : GAAAAAGAGAAATTCGAACCCACAGTCTTCAGGGATACACTCGTCCAGGGGCTTAATGAA
20110601C-007612 : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
---------+---------+---------+---------+---------+---------+ 323
SMG01_0039_C10.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRT1_0134_G07.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVR01_0047_E07.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
PTG01_0100_G01.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
AMP01_0036_A10.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRT1_0079_C05.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
THY01_0123_E04.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVR01_0069_E09.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
PBL01_0002_B05.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRT1_0135_E03.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
ITT01_0061_G07.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
PTG01_0083_C07.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
ADR01_0025_D03.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRM1_0049_H10.b : GCTGGTGATGACCTTGAAGCTGTAGCCCAGTTTCTGGACTCCACAGGCTCAAGATTAGAC
ADR01_0068_C05.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
HTMT1_0027_F11.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
TCH01_0098_B02.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
ADR01_0015_A06.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRM1_0005_F07.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRT1_0148_B07.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRT1_0094_B05.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
SPL01_0003_F07.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRM1_0203_D02.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRM1_0070_E10.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRM1_0081_F05.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRM1_0120_G12.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRM1_0004_C05.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
SKNB1_0037_C05.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRT1_0038_G09.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVRT1_0038_C10.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
TCH01_0030_H06.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVR01_0018_G05.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
OVR01_0047_A07.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGCTCAAGATTAGAT
BFLT1_0099_H08.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGGAGCAAGATTAGAT
SKNB1_0096_D08.b : GCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCCACAGACTCAAGATTAGAT
20110601C-007612 : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
---------+---------+---------+---------+---------+---------+ 383
SMG01_0039_C10.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRT1_0134_G07.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVR01_0047_E07.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
PTG01_0100_G01.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
AMP01_0036_A10.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRT1_0079_C05.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
THY01_0123_E04.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVR01_0069_E09.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
PBL01_0002_B05.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRT1_0135_E03.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
ITT01_0061_G07.b : TATCGTCGCTATGCAGGCACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
PTG01_0083_C07.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
ADR01_0025_D03.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRM1_0049_H10.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
ADR01_0068_C05.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
HTMT1_0027_F11.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
TCH01_0098_B02.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
ADR01_0015_A06.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRM1_0005_F07.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRT1_0148_B07.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRT1_0094_B05.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
SPL01_0003_F07.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRM1_0203_D02.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRM1_0070_E10.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRM1_0081_F05.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRM1_0120_G12.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRM1_0004_C05.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
SKNB1_0037_C05.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRT1_0038_G09.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVRT1_0038_C10.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
TCH01_0030_H06.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVR01_0018_G05.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
OVR01_0047_A07.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
BFLT1_0099_H08.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
SKNB1_0096_D08.b : TATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCT
20110601C-007612 : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
---------+---------+---------+---------+---------+---------+ 443
SMG01_0039_C10.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRT1_0134_G07.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVR01_0047_E07.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
PTG01_0100_G01.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
AMP01_0036_A10.b : GGAGGAACACGCATAGATGATGGTGACAAGCCCAAGATGACCAACCACTGTGTGTTTTCA
OVRT1_0079_C05.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
THY01_0123_E04.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVR01_0069_E09.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
PBL01_0002_B05.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRT1_0135_E03.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
ITT01_0061_G07.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
PTG01_0083_C07.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
ADR01_0025_D03.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRM1_0049_H10.b : GGAGGAACACGCANAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
ADR01_0068_C05.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
HTMT1_0027_F11.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
TCH01_0098_B02.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
ADR01_0015_A06.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRM1_0005_F07.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRT1_0148_B07.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGACGACCAACCACTGTGTGTTTTCA
OVRT1_0094_B05.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
SPL01_0003_F07.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRM1_0203_D02.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRM1_0070_E10.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRM1_0081_F05.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRM1_0120_G12.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRM1_0004_C05.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
SKNB1_0037_C05.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRT1_0038_G09.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVRT1_0038_C10.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
TCH01_0030_H06.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVR01_0018_G05.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
OVR01_0047_A07.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
BFLT1_0099_H08.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
SKNB1_0096_D08.b : GGAGGAACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCA
20110601C-007612 : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
---------+---------+---------+---------+---------+---------+ 503
SMG01_0039_C10.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRT1_0134_G07.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVR01_0047_E07.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
PTG01_0100_G01.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
AMP01_0036_A10.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRT1_0079_C05.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
THY01_0123_E04.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVR01_0069_E09.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
PBL01_0002_B05.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRT1_0135_E03.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
ITT01_0061_G07.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
PTG01_0083_C07.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
ADR01_0025_D03.b : GCAAATGAAGATTATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRM1_0049_H10.b : GCAAATGAAGATCATGAAACCATCCNAAACTTTGCTCAGGTCTTCAATAAGCTCATCAGG
ADR01_0068_C05.b : GCAAATGAAGATTATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
HTMT1_0027_F11.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
TCH01_0098_B02.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
ADR01_0015_A06.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTAATCAGG
OVRM1_0005_F07.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRT1_0148_B07.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRT1_0094_B05.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
SPL01_0003_F07.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRM1_0203_D02.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRM1_0070_E10.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRM1_0081_F05.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRM1_0120_G12.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRM1_0004_C05.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
SKNB1_0037_C05.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRT1_0038_G09.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVRT1_0038_C10.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
TCH01_0030_H06.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVR01_0018_G05.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
OVR01_0047_A07.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
BFLT1_0099_H08.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
SKNB1_0096_D08.b : GCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAGCTCATCAGG
20110601C-007612 : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
---------+---------+---------+---------+---------+---------+ 563
SMG01_0039_C10.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRT1_0134_G07.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVR01_0047_E07.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
PTG01_0100_G01.b : AGATACAAATATTTGGGAAAGGCATTTGANGATGAAATGAAAAAGCTTCTCCTCTTCCTT
AMP01_0036_A10.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRT1_0079_C05.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
THY01_0123_E04.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTTCCT
OVR01_0069_E09.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
PBL01_0002_B05.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRT1_0135_E03.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
ITT01_0061_G07.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
PTG01_0083_C07.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCT*
ADR01_0025_D03.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRM1_0049_H10.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAANAAGCTTCTCCTCTTCCTT
ADR01_0068_C05.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
HTMT1_0027_F11.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
TCH01_0098_B02.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
ADR01_0015_A06.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRM1_0005_F07.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRT1_0148_B07.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRT1_0094_B05.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
SPL01_0003_F07.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRM1_0203_D02.b : AGATACAAATATTTGGAAAAGGCATTTGACGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRM1_0070_E10.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRM1_0081_F05.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRM1_0120_G12.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRM1_0004_C05.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
SKNB1_0037_C05.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRT1_0038_G09.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVRT1_0038_C10.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
TCH01_0030_H06.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVR01_0018_G05.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
OVR01_0047_A07.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
BFLT1_0099_H08.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
SKNB1_0096_D08.b : AGATACAAATATTTGGAAAAGGCATTTGAGGATGAAATGAAAAAGCTTCTCCTCTTCCTT
20110601C-007612 : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
---------+---------+---------+---------+---------+---------+ 623
SMG01_0039_C10.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRT1_0134_G07.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVR01_0047_E07.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
PTG01_0100_G01.b : AAAGCNNNTTTCGAAACAGAGCAGACAAAGTTGGCNATGCTATCGGGGATTCTGCTGGGC
AMP01_0036_A10.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRT1_0079_C05.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
THY01_0123_E04.b : TAAGCCTTTTCgaaacagaacaaacaagttgggcaagctatcggggatctgctgggcacc
OVR01_0069_E09.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
PBL01_0002_B05.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRT1_0135_E03.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
ITT01_0061_G07.b : GAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
PTG01_0083_C07.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGN
ADR01_0025_D03.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGAATCTGCTGGGN
OVRM1_0049_H10.b : AAAGCCTTTTCCGAAACAGAGCAGACNAAGTTGGCNATGCTATCGGGGATTCTGCTGGGC
ADR01_0068_C05.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
HTMT1_0027_F11.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
TCH01_0098_B02.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
ADR01_0015_A06.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRM1_0005_F07.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRT1_0148_B07.b : AAAGCCTTTTCCGAAACAG**CAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRT1_0094_B05.b : AAAGCCTTTTCCGAAACAG**CAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
SPL01_0003_F07.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRM1_0203_D02.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRM1_0070_E10.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRM1_0081_F05.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCCGGGC
OVRM1_0120_G12.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRM1_0004_C05.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGGCATGCTATCGGGGATTCTGCTGGGC
SKNB1_0037_C05.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRT1_0038_G09.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVRT1_0038_C10.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
TCH01_0030_H06.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVR01_0018_G05.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
OVR01_0047_A07.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
BFLT1_0099_H08.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
SKNB1_0096_D08.b : AAAGCCTTTTCCGAAACAGAGCAGACAAAGTTGGCAATGCTATCGGGGATTCTGCTGGGC
20110601C-007612 : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
---------+---------+---------+---------+---------+---------+ 683
SMG01_0039_C10.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRT1_0134_G07.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAG
OVR01_0047_E07.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
PTG01_0100_G01.b : AACGGCACCCTTTCTGGGCACAATCTCAACAGTCTTTTCCCTGAAAGCTTAGTCCAAGAA
AMP01_0036_A10.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRT1_0079_C05.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
THY01_0123_E04.b : gcccccttccg
OVR01_0069_E09.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
PBL01_0002_B05.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRT1_0135_E03.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
ITT01_0061_G07.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
PTG01_0083_C07.b : CACGGCACCTTTCCTGGGCACATNNCTCACAGTCTTTTCACTGACAGCTTAGTCAAAGAA
ADR01_0025_D03.b : CACGGCACCCTTCCTGGCCACATCCCTCACAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRM1_0049_H10.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
ADR01_0068_C05.b : AACGGCACCCTTCCTGCCACCATCCCTCACAGTCTTTTCACTGACAGCTTAGTCAAAGAA
HTMT1_0027_F11.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
TCH01_0098_B02.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
ADR01_0015_A06.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRM1_0005_F07.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRT1_0148_B07.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRT1_0094_B05.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
SPL01_0003_F07.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRM1_0203_D02.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRM1_0070_E10.b : AACGGCACCCTTTCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTATTCAAAGAA
OVRM1_0081_F05.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRM1_0120_G12.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRM1_0004_C05.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
SKNB1_0037_C05.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRT1_0038_G09.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVRT1_0038_C10.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
TCH01_0030_H06.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVR01_0018_G05.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
OVR01_0047_A07.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCGAAGAA
BFLT1_0099_H08.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
SKNB1_0096_D08.b : AACGGCACCCTTCCTGCCACCATCCTCACCAGTCTTTTCACTGACAGCTTAGTCAAAGAA
20110601C-007612 : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
---------+---------+---------+---------+---------+---------+ 743
SMG01_0039_C10.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRT1_0134_G07.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVR01_0047_E07.b : GGCATTGCAGCCTCATTTGCTGTCAAGCCTTTTAAAGCATGGATGGCAGAAAAAGATGCC
PTG01_0100_G01.b : GGCTTTGCAGC*TCATTTGCTGTCAAGGCTTTTAAAGCATGGATGGCAAAAAAAatgcca
AMP01_0036_A10.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRT1_0079_C05.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
THY01_0123_E04.b :
OVR01_0069_E09.b : GGCATTGCAGCCTCATTTGCTGTCCAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
PBL01_0002_B05.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRT1_0135_E03.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
ITT01_0061_G07.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
PTG01_0083_C07.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGAATGGCAGAAAAAGATGC*
ADR01_0025_D03.b : AGCATTGCAGCCTCATTTGCTGTCGAGCTTTTTA*AGCATGGATGGCAGAAAAAGATGC*
OVRM1_0049_H10.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAANAAGATGCC
ADR01_0068_C05.b : GGCATTGCAGCCTCATTTGCTGTCGAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
HTMT1_0027_F11.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGANAAAGATGCC
TCH01_0098_B02.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
ADR01_0015_A06.b : AGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGGCAAAAAAGATGCC
OVRM1_0005_F07.b : GGCATTGCAGCCTCATTTGCTGTCNAGCTTTTTTAAGCATGGATGGCAGAAAAAGATGCC
OVRT1_0148_B07.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRT1_0094_B05.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
SPL01_0003_F07.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRM1_0203_D02.b : GGCATTGCAGCCTCATTTGCTGTNCAGCTTTTTTAAGCATGGATGGCAGAAAAAGATGCC
OVRM1_0070_E10.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRM1_0081_F05.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRM1_0120_G12.b : GGCATTGCAGCCTCATTTGCTGTNCAGCTTTTTTAAGCATGGATGGCAGAAAAAGATGCC
OVRM1_0004_C05.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCNAGAAAAGATGCC
SKNB1_0037_C05.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRT1_0038_G09.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVRT1_0038_C10.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
TCH01_0030_H06.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVR01_0018_G05.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
OVR01_0047_A07.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
BFLT1_0099_H08.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
SKNB1_0096_D08.b : GGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCC
20110601C-007612 : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
---------+---------+---------+---------+---------+---------+ 802
SMG01_0039_C10.b : AACTCTGTTACCTCCTCTTTGAGAAAAAGCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVRT1_0134_G07.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAAC*TAGA*CNAGAGGCTTGCTGAACTCTT
OVR01_0047_E07.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
PTG01_0100_G01.b : actcggttacctccccttgaaaaagacccaacttaaacaaaaggctggctggaacctttt
AMP01_0036_A10.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*NCAGAGGCTGCTTGAACTCTT
OVRT1_0079_C05.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
THY01_0123_E04.b :
OVR01_0069_E09.b : AACTCTGTTACCCCCCCTTTGAGAAAAGCCAACTTTGAACAGAAGGCTGCTTGAACTCTT
PBL01_0002_B05.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVRT1_0135_E03.b : AACTCTGTTACCTCCTCTTTGAGAAAAG*CAACTTAGA*CAAGAGGCTGCTTGAACTCTT
ITT01_0061_G07.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
PTG01_0083_C07.b : AACTCTGGTACCTCCTCTTTGAGAAAAGCCAACTAAGA*CAAGAGGCTGgctggaatcct
ADR01_0025_D03.b : AACTCTGTTAACTTCTCTCTGAGAAAGGC*AACTTAGA**CAAGAGCTGCTTGACCTCTT
OVRM1_0049_H10.b : NACTCTGTTACCTCCTCTTTGAGAAAAGCCA*CTTAGA*CNAGAGGCTGCTTGAACTCTT
ADR01_0068_C05.b : NACTCTNGTACCTCCTCTCTGAGGAAAGCCAACTTTAGACA*GAGGCTGCTTGAACTCTT
HTMT1_0027_F11.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
TCH01_0098_B02.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGGGGCTGCTTGAACTCTT
ADR01_0015_A06.b : CACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAaaacagaaggctgcctggaaccct
OVRM1_0005_F07.b : AACTCTGTTACCTCCTNNCTTGAGAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVRT1_0148_B07.b : AACTCTGTTACCTCCTCTTNGAGAAAAGCAAACTTTAG*ACAGAGGCTGCTTGAACTCTT
OVRT1_0094_B05.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
SPL01_0003_F07.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVRM1_0203_D02.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CNAGANGCTGCTTGAACTCTT
OVRM1_0070_E10.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CACGAGGCTGTTTGA*CTCTT
OVRM1_0081_F05.b : AACTCTGTTACCTCCTCTTT
OVRM1_0120_G12.b : AACTCTGTTACCTCCTCTTTGAGAAAAGC*AACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVRM1_0004_C05.b : AACTCTGCTACCTCCTCTTTGAGAAAAGC*AACTTAGA*GCAGAGGCTGCTTGAACTCTT
SKNB1_0037_C05.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVRT1_0038_G09.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVRT1_0038_C10.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
TCH01_0030_H06.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVR01_0018_G05.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
OVR01_0047_A07.b : AACTCTGTTACCTCCTCTTTGAGAACAGCCAACTTAGA*CNAGAGGCTGCTTGAACTCTT
BFLT1_0099_H08.b : AACTCTGTTACCTCCTCTTTGANGAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
SKNB1_0096_D08.b : AACTCTGTTACCTCCTCTTTGAGAAAAGCCAACTTAGA*CAAGAGGCTGCTTGAACTCTT
20110601C-007612 : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
---------+---------+---------+---------+---------+---------+ 862
SMG01_0039_C10.b : TTCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATA*TTCACTGACGCAAGTCTGAA
OVRT1_0134_G07.b : TCCAGTTA*CAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
OVR01_0047_E07.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
PTG01_0100_G01.b : ccagttaaagggcaaaggggggatcatttgggaaaaaactcccaggaaccagggttaaaa
AMP01_0036_A10.b : TCCCAGTTACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTNGACGCAGTCTGAA
OVRT1_0079_C05.b : TTCAGTTAACAGGCAGAGTGTGGATCATTTTTGCTAATACTTCACTGACGCAGGTCTGAA
THY01_0123_E04.b :
OVR01_0069_E09.b : TCCGGTTAACAGGCcgaatgggggaacattttgcttaaatacttcactgaccccagggct
PBL01_0002_B05.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
OVRT1_0135_E03.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
ITT01_0061_G07.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
PTG01_0083_C07.b : tttccgtttaacaggcaaaggggggatcaatttgctaaatactttcctgaacccaggctg
ADR01_0025_D03.b : TCCAGTTA*CAGGCAAAGTGGGGATCATTTgctaataactcactgacgcaggtctgaaga
OVRM1_0049_H10.b : TCCAGTTNACAGGCAGAGTGTGGATCAT
ADR01_0068_C05.b : TCCAGT*AACAGGCAGAGTGTGGATCATTTTTGCTAATANCTCACTGACGCAGGTCTGAA
HTMT1_0027_F11.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
TCH01_0098_B02.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
ADR01_0015_A06.b : ttccatttaaagggcaaatgggggatcattttggcaaaatacttaatggacgcaggttct
OVRM1_0005_F07.b : TCCAGTTAACAGGCAG
OVRT1_0148_B07.b : TCCAAGTAACAGGCAGAGTGTGGATCATTTTGCTAANTACTTCACTGACGCAGGTCTGAA
OVRT1_0094_B05.b : TTCAGNTNACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
SPL01_0003_F07.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
OVRM1_0203_D02.b : T
OVRM1_0070_E10.b : TTCAGTTA*CAGGCACAGTGTGGATCATTT
OVRM1_0081_F05.b :
OVRM1_0120_G12.b : TCC
OVRM1_0004_C05.b : TCCA
SKNB1_0037_C05.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
OVRT1_0038_G09.b : TCCAGTTA*CAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
OVRT1_0038_C10.b : TCCAGTTA*CAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
TCH01_0030_H06.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
OVR01_0018_G05.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
OVR01_0047_A07.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCACGTCTGAA
BFLT1_0099_H08.b : TCCAGTTA*CAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
SKNB1_0096_D08.b : TCCAGTTAACAGGCAGAGTGTGGATCATTTTGCTAAATACTTCACTGACGCAGGTCTGAA
20110601C-007612 : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
---------+---------+---------+---------+---------+---------+ 921
SMG01_0039_C10.b : GGAACTTTCTGACTTCCTCAGA*TCCAACAGTCCCTGGGCACCA*GGAAGGAACTGCAAA
OVRT1_0134_G07.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA**GAAGGAGCTGCaga
OVR01_0047_E07.b : AGAGTTTTCTGACTTCCTCAAAGTCCAGCAGTCCCTGGGGACCAAGGAAGGAGCTGCAAA
PTG01_0100_G01.b : aaactttttaatttctaaaagaccaaaaatcccgggggccacagaaggaacttccaaagg
AMP01_0036_A10.b : NGAGCTTTCTGACTTCNTCAGAGTCCACCAGTCCCTGGGCACA**GGAAGGAGCTGCAGA
OVRT1_0079_C05.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA**GAAAGAGCTGCAGA
THY01_0123_E04.b :
OVR01_0069_E09.b : gaaaggagcttttcgaacttccccaaaaatccaccagttccctggggaccccggaaaggg
PBL01_0002_B05.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
OVRT1_0135_E03.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACA**GGAAGGAGCTGCAGA
ITT01_0061_G07.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
PTG01_0083_C07.b : aagggagctttctgaaattcctcaaatcccaaagtccctggggacccagaaggacctgca
ADR01_0025_D03.b : actttcggatttcttagattcagcaattcctgggcaccagaaaggactgccaaaggactc
OVRM1_0049_H10.b :
ADR01_0068_C05.b : GGAGCTTTCTGACTTCCTCAGAGTCAAGCAGTCCCTGGGCAACC*AGAAAGAGCTGCAaa
HTMT1_0027_F11.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGGAAGAGCTGCAGA
TCH01_0098_B02.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
ADR01_0015_A06.b : gaaagaactttctagacttcccaaaagtccagcaatcccttggcaccaagaaaggagctg
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : GGAGCTTTCTGGACTTCTCA*AGTCCAGCAGTCCCTGGGCACCA*GGAAGaactgcaaaa
OVRT1_0094_B05.b : AGAGCTTTCTGACTTCCTCAGGAGTCAGCAGTCCCTGGGCACCA*GGAAGagctgcagaa
SPL01_0003_F07.b : NGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*NGAAGGAGCTGCAGA
OVRT1_0038_G09.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAAGAGCTGCAGA
OVRT1_0038_C10.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
TCH01_0030_H06.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACC**GGAAGGAGCTGCAGA
OVR01_0018_G05.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAAGAGCTGCAGA
OVR01_0047_A07.b : GGAGCTTTCTGACCTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
BFLT1_0099_H08.b : GGAGCTTTCTGACTTCCTCAGAGTCAAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
SKNB1_0096_D08.b : GGAGCTTTCTGACTTCCTCAGAGTCCAGCAGTCCCTGGGCACCA*GGAAGGAGCTGCAGA
20110601C-007612 : AGGAGCTCCAAGAGCGTCTTTCTCAGGAATGCCCC*ATCAAGGAGGTGGTGCTCTACGTT
---------+---------+---------+---------+---------+---------+ 980
SMG01_0039_C10.b : AGGAcctcaagaacgtctttctcagaatgccccatcaggaaggggggctttctttaagaa
OVRT1_0134_G07.b : aggacctcaagagcgtctttctcaggatgccccacaaggagtggtgctctcgttaagaga
OVR01_0047_E07.b : AGGAGCTCCAAGAagcgcctttctcaggaatggccccatcaagggaggggggggctctac
PTG01_0100_G01.b : agtcccaaaaaagcctttccaagaaggggccctcaaggggggggggctctccttttaaaa
AMP01_0036_A10.b : AGagctccnagatcgtctttctcagatgccccatcaaggagtggtgctctcgtaaaaana
OVRT1_0079_C05.b : AGGAACTCCAAGAGCGTCTTTCTCAGGAATGCCCC*ATCAAGGAGGTGGTGCTCTACGTT
THY01_0123_E04.b :
OVR01_0069_E09.b : agctgcaaaaggagcttccaaaaacggttcttctccaggaatggccccctcccagggagg
PBL01_0002_B05.b : AGGAGCTCCAAGAGCGTCTTTCTCAGGGATGCCCA*TCaaaggagtggtgctctacgtta
OVRT1_0135_E03.b : AAGACCTTCAAGA*CGTCTTTCTCAGGGATGCCCC*ATCAAGGAGGTGGTGCTCTcgttt
ITT01_0061_G07.b : AGGAGCTCCNAGAGCGTCTTTCTCAGGAATGCCCC*CATCAGGAGGTGGTGCTCTACGTT
PTG01_0083_C07.b : aaaggggcctcaaaaaggtctttcccgggaaggccccatcagggggggggggtctccctt
ADR01_0025_D03.b : agaacgtccttctcagaaggcccatcaggaggggtggccccctttaagagaaatgaaaag
OVRM1_0049_H10.b :
ADR01_0068_C05.b : nggactcccagagcgtctttctcaggatgccccatcaaggaggtgtgcttctacgtaaag
HTMT1_0027_F11.b : AAGAGCTCCAAGA*CGTCTTTCTCAGGAATGCCC**ATCAGGGAGGTGGTGCTCTACGTT
TCH01_0098_B02.b : AGGAGCTCCCAGAGCGTCTTTCTCAGGAATGCCCC*ATCAAGGGAGTGGTGCTCTACNGT
ADR01_0015_A06.b : caaaagggacttccaaaagcgtctttccaaggaatgcccatcaaaggaggggggtcccac
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : gggactcaagagcgtcttcccaggatgccccatcaggaagtggtggcccacttaagaaaa
OVRT1_0094_B05.b : gagctccagagcgtctttctcagaatgcccatcaggaggtgtgctctcntnaagaagatt
SPL01_0003_F07.b : GGGAGCTCCAAGAGCGTCTTTCTCANGAATGCCCC*ATCAAGGAGGTGGTGCTCTACGTT
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b : AAGAGCTCCAAGAGCGTCTTTCTCAGGAATGCCC**ATCAAGGGAGTGGTGCTCTACGTN
OVRT1_0038_G09.b : GGGAGCTCCAAAAGCGTGTTTCTCAAGAATGCCCC*ATCAAGAAGGGGGTGCTCTccttt
OVRT1_0038_C10.b : AGGAGCTCCAAGAGCGTCTTTCTCAGGAATGCCCC*ATCNAGGAGGTGGTGCTCTACGTT
TCH01_0030_H06.b : AGGAGCTCCAAGAGCGTCTTTCTCAGGAATGCCCC*ATCAAAGAGGTGGTGCTCTACGTT
OVR01_0018_G05.b : AGGAGCTCCCAGAGCGTCTTTCTCAGGGATGCCCCCATCAGGANGGTGGTGCTCTACGTT
OVR01_0047_A07.b : AGGAGCTCCAAGAGCGTCTTTCTCAGGAATGCCCC*ATCAAGGAGGTGGTGCTCTACGTT
BFLT1_0099_H08.b : AGGAGCTCCAAGAGCGTCTTTCTCAAGAATGCCCC*ATCAAGGGAGTGGTGCTCTACGTT
SKNB1_0096_D08.b : AGGAGCTCCAAGAGCGTCTTTCTCAGGAATGCCCC*ATCAAGGAGGTGGTGCTCTACGTT
20110601C-007612 : AAAGAAGAAATGAAGAGG*AATGATCTTCCGAGACAGCGGTGATTGGACTCCTATGGACC
---------+---------+---------+---------+---------+---------+ 1039
SMG01_0039_C10.b : aaatgaaaaaggatgatcttcggaaaacccggtgatgggaatctaaggacctgttcctga
OVRT1_0134_G07.b : aataaaaggaagatcttcggaaaaagcgggatggacttctatggactgtacaaaaccctg
OVR01_0047_E07.b : cgtaaaagaaaaaaaggaaaagggaaggatttttcccgaaaaaaaccgggggattgggac
PTG01_0100_G01.b : aaaaaagaaaagaaaattctttccgaaaaagggggagtggaaccccttgggccgttttaa
AMP01_0036_A10.b : aatgagagaatgatcttccgaaacacgtgatggactctttggacctgatctgaacccttg
OVRT1_0079_C05.b : AAAGAAAAAATGAgaaggatgatcttcccgaaacggcggggattgaactctatggacctg
THY01_0123_E04.b :
OVR01_0069_E09.b : gggggcgtcctccctttaagaaaaaaaatgtaaggaggaatggatttctcccggagaaca
PBL01_0002_B05.b : aagagaaatgaagaggaatgatcttccggaaacagcggggattggactcctatggactgt
OVRT1_0135_E03.b : aagaaaaatgagaggattgatctcccgaaacgcgtgattgactcttaggactgttcagga
ITT01_0061_G07.b : NAAGAGAAAATGAgagaatgatcttccggagacagcgtgatggactctatggactgtaca
PTG01_0083_C07.b : taaaaaaaaatggaaagagaatgattttctcgaaaaacgggggaaatgggccccctggga
ADR01_0025_D03.b : gaagattttccgaaaaagcgggaatggaatccatggaacggttccggacccttggaatgg
OVRM1_0049_H10.b :
ADR01_0068_C05.b : aggaatgaanaggatgatcttccggaaacgcgtgatggaactcctatgaactgtatcaga
HTMT1_0027_F11.b : AAgaggaatgaagaggatgatcttccggaaacgcggtgattgaactccttgggactgttc
TCH01_0098_B02.b : AAAAGAGAAATGAAGAGG*AATGATCTTncngagacagcgntgattggactcctatggna
ADR01_0015_A06.b : ctttaagaaaaaattgaaagggaatgtttttccggaaaagcggggaattggacctctatg
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : aatgaagaggatgattttcggaaacgcgggggatgacccctaggaccgtatctgaacctt
OVRT1_0094_B05.b : gagagaatgatctccggagacgcgtgatggactctaggaccgtatctgacgctgtggatg
SPL01_0003_F07.b : AAAGAGGAAATGAGGAGGgaatgatcttccggaagacagcgggtgatttggactccctat
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b : AAAGAAgaatgannaggaatgatcttccgagacngcggtgatggactcctatggactgta
OVRT1_0038_G09.b : aaaaaaaaatgaaagaggaagattattctgaaacagagaggttggggaatgaacccctag
OVRT1_0038_C10.b : AAAGAAGAAtgaagaggaatgatcttcgggagacgcggtgatggaactcttatnacctgt
TCH01_0030_H06.b : AAAGAAGAAATGAAGAGG*AAtgatcttcgggagacagcggtggatggaatccaaggaac
OVR01_0018_G05.b : AAAGAAGAAATGAAGAGG*AAtgatcttncgggagacagcgggtgattggactcctatgg
OVR01_0047_A07.b : AAAGAAGAAATGAAGAGG*AAtgatctttccggagacaggcggtgattggactcctatgg
BFLT1_0099_H08.b : AAgaagaaatgaagaggatgatcttccggaaacggcggtgattgaactctatggactgta
SKNB1_0096_D08.b : AAAGAAGAAATGAAGAGGAAATGATCTTCCGAGACAGCGGTGATTGGACTCCTATGGACC
20110601C-007612 : TGTATCATGAACGCTGTGGAGTG.....................................
---------+---------+---------+---------+---------+---------+ 1062
SMG01_0039_C10.b : aacttggtgatggaaaaaaaagaggaattgttgccaacagccctaaacccctgaagaaaa
OVRT1_0134_G07.b : gaagggaaaaaaaggaaatttttccaaagggctcaaccctaaaaaaaccccccccggggg
OVR01_0047_E07.b : tccctattggacctggattcatgaaacccttgggggaaggggaaaaaaaaaaagggaggg
PTG01_0100_G01.b : gaaaccggggggaggaaaaaaaaggaaaaattttttccaaaagccccccaaacccgaaaa
AMP01_0036_A10.b : gaaaggaacaaaagaggactttttgcgacagccccaagcctgaaaaaaacctcaccctgg
OVRT1_0079_C05.b : tatcatgaccgctggggatggaaacaaaaggagagactttttgccaaaaaggccttaagc
THY01_0123_E04.b :
OVR01_0069_E09.b : ccggggaatttggacccccttatggaaaccgggtatctatgaaaccctttggtgagggcg
PBL01_0002_B05.b : atcatgaacgcctgtggagggggacaagaagggaggaactggtttgccgaacaggcccct
OVRT1_0135_E03.b : cgctgtggaggaacagaaggagaatttgtgcaaaaggcctaaacccggaagaaacccccc
ITT01_0061_G07.b : tgacgctgtggagtgaacagaggaggacttgtgcggagcagcctcagcactgaggtactg
PTG01_0083_C07.b : ccttttaaaaaaacccgtggggggggaaaaaaaaggggaaattttttgcaaaaagggccc
ADR01_0025_D03.b : aacaaaaggaaaattgtttcaaaaggccccaaaaccgaaaaaaaccccacctcggggggt
OVRM1_0049_H10.b :
ADR01_0068_C05.b : ccctggggattgaacaagaggagaactggttgcgaaaggcctcagacctgaagaaaactc
HTMT1_0027_F11.b : agaaagctggggaggggacaaaaggaagaatttgttcccaacaggccctcacaccaaaga
TCH01_0098_B02.b : ctgtatcatgaacgctgtggagtggaacagaagggagaactggttgcaagcaagccctca
ADR01_0015_A06.b : gaaccgtttcttgaaaccttgggaggggaaaaaaaaggaagaaattgtttccaaaaaggc
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : tgggatgaaaaaaaggaggaattgttgcgacaggcctaagccctgaagaaaagccccctc
OVRT1_0094_B05.b : aacagaagagaattgttgccacaggcctaagactgaagaaagctcatccggtggatcact
SPL01_0003_F07.b : ggaccttgtatcatggaacgctgtgggaagtggaaacaaa
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b : tcagaccgctgtggagtggaacnnagaagagaactgnntgcgagcaggcctcaagcactg
OVRT1_0038_G09.b : ggactgtaaaaggaagctggggaaagggaaagaaagaggatttgttgccaaacggcccta
OVRT1_0038_C10.b : atctgaaagctgtggatggaacaaaaggaggactgttgncgaacaggcctaagccctgaa
TCH01_0030_H06.b : tgtatcagaaacccgttggagtggaacaaaaggaagaacatgttgccgaacaggccctca
OVR01_0018_G05.b : gacctgtatcatgaacgctgngggagtggaacaagaagggaaggaacttggttgccgagc
OVR01_0047_A07.b : gacctgtattatgaaacgctggggaagtggaaacaaaaagggaggaaacttggtggccca
BFLT1_0099_H08.b : tcaggaagctgtggagggaacaagaggagaacttggtgcaacaggcccccaaccctgaag
SKNB1_0096_D08.b : TGTATCATGAACGCTGTGGAGTGaanncagaanngagaaactgnntgccgagcagccctc
20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 1062
SMG01_0039_C10.b : cgcccactccgggggttttacctccagggcgtcaaagttattcctccaaaagttaaaaac
OVRT1_0134_G07.b : tttcccccaggcgataaaatgttcccccaagggtaaaaaagtttaacacttttttaaacc
OVR01_0047_E07.b : aaatttggttggcccaaagaaagggccccctcaaacaaaccttgaaaaaaaaaaaatccc
PTG01_0100_G01.b : aaaacccccccccgggggggtttcccccccggggggaaaaaatgtttcccccaagggtaa
AMP01_0036_A10.b : gttttcctcccgggaataaaactatccccccacagttaaaa
OVRT1_0079_C05.b : accggaagcaaacgcttccctcccggtggtttcagctccaaggccgtcaaagcgtacctc
THY01_0123_E04.b :
OVR01_0069_E09.b : aaaacagaaaggggaggaacctttttggtcccaaagaagggcccttcctgccccccttaa
PBL01_0002_B05.b : caagcacctgaaagcaaaacgctccccccccccggggcggttttccagctccccaaggcg
OVRT1_0135_E03.b : ccgggggttttcccccaggccagaaagtgatcctccaaaggttaaaaacgtttgaaccct
ITT01_0061_G07.b : actgggacatctagctgcagcaatgcaccctccntgggacaagggtccgttgtatgggcc
PTG01_0083_C07.b : taaaacccgggaaaaaaacccccccccccggggggtgtttcccccccggggggcgagaaa
ADR01_0025_D03.b : ttatccaaggccatcaaatgatccccccaagggtaaaaacgtttgaaacttcttttgaaa
OVRM1_0049_H10.b :
ADR01_0068_C05.b : ccctccggtggtttccttccagggcatcgagtgaccccccccaaggttaaaaacggttga
HTMT1_0027_F11.b : aaaagcccccccggggggattcctcccagggcgtgaaattatccccccagaggtcaaaaa
TCH01_0098_B02.b : gcacctgaagcatacgctcactcttgctgtttcagctccaaggcagtcgaactgatcttc
ADR01_0015_A06.b : ctcaaacacctaaagaaaagcctccactcgggggtttatcctcccaaggcgataaaaagt
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : ctggggtgttccctcccaggcggtaaattatccccccaaggtgaaaaagtgttgacatcc
OVRT1_0094_B05.b : ccaggcctcaaatgatccctccaaggtcaaactgttgaaaatccttttgaaccttcaaaa
SPL01_0003_F07.b :
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b : aagcatacctccactctggctgatcagctccaagccatcgactgacctctcctaaggttc
OVRT1_0038_G09.b : agacccgaagcaaaccctccctccgggtgttttcctccagaggcggttaaatgattcccc
OVRT1_0038_C10.b : gcatacctccatcctggttgattcgctccagggcgttaaaaggaatccctccaaaggtaa
TCH01_0030_H06.b : agccctggaagcaaacgctccactccgggctgttttcgctcccagggccgtcaaactgat
OVR01_0018_G05.b : agggccctcaagcaacctggaggcaaatacgcctccacttcccgggctgggattccacgc
OVR01_0047_A07.b : agcagggccctcaaggcacctttgaaggaaattccccttccccctcccgggggttgtaat
BFLT1_0099_H08.b : aatacgcccctccgggggtattcgctcccagccgtcaaagtatcccctcaaaaggtcaga
SKNB1_0096_D08.b : aagcactgaagcatacgctcaactcctggctgtattcgctccccaggcagtcaggctgat
20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 1062
SMG01_0039_C10.b : tgttagcaaacccttttggaaactttaaaaagggggtccttttaaaaggtgtgtggggaa
OVRT1_0134_G07.b : ttaaaaaagggctttttaaagaggggggagaactttagggtaaaacccgccccggagttt
OVR01_0047_E07.b : ccctccccctcttccctggggttgtggatattttcacacccctccccccaaaggggggcc
PTG01_0100_G01.b : aaaatgtttttaacacccctcttttaaaccccctaaaaaagggggtttttttaaaaagag
AMP01_0036_A10.b :
OVRT1_0079_C05.b : ctcaaaagtttagaaacgttttgaaacctcctttgagaagccttcaagaatgggtctctc
THY01_0123_E04.b :
OVR01_0069_E09.b : gaacaaaacacctcctcattcttcgtggggggtttattcccccccca
PBL01_0002_B05.b : cccgctccaaagccggatccccccccccccccaaaaggggtgtcaaaaaaaaaaaaaggg
OVRT1_0135_E03.b : cttttgaacccttaaaaatgggtctctttaacgtgggcggggaacaccttaagggcaaaa
ITT01_0061_G07.b : caccagccaactacattccgaggtttcatccactgccccccaaagttcggggaaccgtgg
PTG01_0083_C07.b : aggttcctccccaaaaggtgaaaaaaattgttttaaaccccctttttttaaacaccttta
ADR01_0025_D03.b : cctttcgaaaatggtttctttaaaccgaggttggggaaaacctatttaaggtaaaaaacc
OVRM1_0049_H10.b :
ADR01_0068_C05.b : aaactccttttggagccttgaaaatgggttcttttaaactgagggccgggaaaacattta
HTMT1_0027_F11.b : ccgtttgaaacttcttttagaaacctttaaaaaacggttcttttataacgagggggagga
TCH01_0098_B02.b : tcccaaaggtcaagaatctgtttgcaacttcatttttgagaccctccgaagaattggttt
ADR01_0015_A06.b : tatcctccccaaaggttagaaatatgtttagaaatcctcttttgaaacctttcaaaaatg
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : cttttggaaccttcaaatggggttcttttaagggtggggggggaaacctttgaggtgtaa
OVRT1_0094_B05.b : cgggttcttttaacgggggggggggaaactttattgtaaaaacctgcccaggaagttttg
SPL01_0003_F07.b :
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b : gaatacggtagaaactcccttatgagcctttcaaaaacgggtccctttaaacggaaggcg
OVRT1_0038_G09.b : ccaaagggtaaaaatggtttgaacccccctttttgagaccttcaaaaaggggttcctttt
OVRT1_0038_C10.b : aaatcgttataaaactccctttagaaacttttaaaaaatgggtttctttataccggaggg
TCH01_0030_H06.b : cctcccccaaaggttggaaactgttatgaaactcctttttggaagcctttcaaaaatcgg
OVR01_0018_G05.b : tttcccaagggcccaggtccaaaaacttgaatcccctccctctcaaaaaagggggtttca
OVR01_0047_A07.b : ttcagccttcccaaagggggcccagggtcagaaaagctttaatttcccttcccccccccc
BFLT1_0099_H08.b : aactgtttgaaactccttttgaaacctttcaaaaaggggttcttttaaagcgaggggggt
SKNB1_0096_D08.b : cctcctccagaangtcagaatactgtatgacacatcattttatgaagcctttccaagatc
20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 1062
SMG01_0039_C10.b : acacttttgaggttaaaaaacccgccccaaagaaaagttttctgcgaaaaaaattttttg
OVRT1_0134_G07.b : ttcccaaaaatttgggcaacaaaacaaagggaaaaaggggcaccaaccgccccccgggaa
OVR01_0047_E07.b : acaggccccaaaaaaagaacttgttaaatatccctcccccc
PTG01_0100_G01.b : ggggggggaaaaaaattttttggggggaaaaacacctctcccccaaaagagttttttttt
AMP01_0036_A10.b :
OVRT1_0079_C05.b : ttaaagctatgggcggggaaaactattagaaggcaaaaaacctgtgccacagggagggtt
THY01_0123_E04.b :
OVR01_0069_E09.b :
PBL01_0002_B05.b : tttttgagaaaaaaacccccccccttttttttttttaaaaaagcaccctcttttttt
OVRT1_0135_E03.b : accgtgcccgggaaggttttcccagaaattttgtgtgtcacgaaaaatcccgggggaaat
ITT01_0061_G07.b : aaataagggcttctaaaagaccccaaccaaaaaaaaaagcctgtgggtggggggccgtaa
PTG01_0083_C07.b : aaaaaaggggggcttttttataaggagggggggggggggaaacattttttgtgggggcaa
ADR01_0025_D03.b : tttcccaagcaagggttttggcagaaaaatttggggttcctggaaaaactcttccgggga
OVRM1_0049_H10.b :
ADR01_0068_C05.b : atggtcaaaccctccccagcaaagtttttgccataaaaattttagt
HTMT1_0027_F11.b : aaacatttgagtggaaaaaaccttccccggaaaatttttttccaagaaaattttgggtgc
TCH01_0098_B02.b : tttttaagcggagggctggtggaaacccattgaaggttaaaaaacagttccccaggaaag
ADR01_0015_A06.b : gggtctcttttaaagcgtggtgggtgggaaacgcattttaagggttacaaaacacttttc
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : aaccctccccagaagggtttttcccaaaaatttgtggggtccgaaaaattctcgggggaa
OVRT1_0094_B05.b : ccgaaaatttgggtgcaggaaaaatttcggggaaaggggttaacccctgggccacttggg
SPL01_0003_F07.b :
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b : agggaaaccatttaagggtcaaaaccagtccccagcaaggttttttcccaagaaaaattt
OVRT1_0038_G09.b : aaggggtgggggggaaaactttttagaggcaaaaccccgtccccggggaagttttttccc
OVRT1_0038_C10.b : cgggggaaaaacgtttgaaggtaaaaaaccattgcccgaggaaggttttctgacagaaaa
TCH01_0030_H06.b : tttcctttaaaaggg
OVR01_0018_G05.b : aaaaaaaaataatcggggttttattttggaaaaacaaaaacaa
OVR01_0047_A07.b : ccaaaaagggggggttaa
BFLT1_0099_H08.b : gaaaccatttaaggggaaaaaacctgccccaggaaaggttttttacaaa
SKNB1_0096_D08.b : gtggtccctttataagctgatggctgatgaaaaccaaattgaatggtacaaaaacatgtc
20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 1062
SMG01_0039_C10.b : ggttccccgaaaaaaatctctgggggaaaatttggtctcaaaaaatttttcaaaatttt
OVRT1_0134_G07.b : taaaaacttaaaaaaccccgcgggnnntnctttgtgntnnangagagtgaccgtagtggg
OVR01_0047_E07.b :
PTG01_0100_G01.b : ccaaaaaatttttttggtggggcgaaaaaaaaaatcctggggg
AMP01_0036_A10.b :
OVRT1_0079_C05.b : tcttgacagagaaattttgtgtggctaagcaaaaaacttccggggggaaattgggtgtaa
THY01_0123_E04.b :
OVR01_0069_E09.b :
PBL01_0002_B05.b :
OVRT1_0135_E03.b : ggtgggacaaccggccccccccggggggtaaaaaaggttttaaaaagagggggggcggac
ITT01_0061_G07.b : tcccgggccgaggacccttttaagggccgggaaaaaaggggctttctcggggaacggttg
PTG01_0083_C07.b : aacactctccctcccaagaaagttttttttctcaaaaaaaaaattttttgggggtcccca
ADR01_0025_D03.b : aaatgtgtttaaaataatggcccaccctctggagaaactaaaaaattcttctcaaaaaaa
OVRM1_0049_H10.b :
ADR01_0068_C05.b :
HTMT1_0027_F11.b : aaggaaaaaattttctggggaaattgggttccaaaaagggggcacacttg
TCH01_0098_B02.b : ggtttttgcaaaaaaatctcgtgggtgcaacggaaaaaactatcgggggg
ADR01_0015_A06.b : caaagaaaaaggttttttgccacataaaattttgtgtgtgtcacgcgcaaaatatcttct
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : ttggtgtcaaactgggccccctgggaaaattaaaaactcctttaaaaaagccccgagaga
OVRT1_0094_B05.b : gaaatagaaagtctttaaaaaaagcttcggaaattttttttgggggttggcccaccaagg
SPL01_0003_F07.b :
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b : ta
OVRT1_0038_G09.b : aaaaaaatttttgggcgcaaggaaaaaattttcggggggaaaatgggtttnaaaccgggt
OVRT1_0038_C10.b : attttgggtttaaggcaaaaaatcttcgggggaaaaattgggtttaaaacctggtccccc
TCH01_0030_H06.b :
OVR01_0018_G05.b :
OVR01_0047_A07.b :
BFLT1_0099_H08.b :
SKNB1_0096_D08.b : cccaaggcaaaaggttttctgcccagaaaaaatccttaagttcccatgccaaaaaatcca
20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 1062
SMG01_0039_C10.b :
OVRT1_0134_G07.b : a
OVR01_0047_E07.b :
PTG01_0100_G01.b :
AMP01_0036_A10.b :
OVRT1_0079_C05.b : cacccgtggcccaccttgtggagaaataaaaaaatgcttcttcagaaaaaagtctcctcg
THY01_0123_E04.b :
OVR01_0069_E09.b :
PBL01_0002_B05.b :
OVRT1_0135_E03.b : ccccccaaaattnnnngggggcggaannnggaataatattgngcccccgcgccccccc
ITT01_0061_G07.b : ggggtgggggagacaaaaaaaaaaaaaaaaaangccgnnaaaaaaaannnnnntcccccc
PTG01_0083_C07.b : ggaaaaaaaaatctccggggggaaaaatggtgggttttaaaaaaaaatggtgggccaccc
ADR01_0025_D03.b : aacctcttcggaaatattttt
OVRM1_0049_H10.b :
ADR01_0068_C05.b :
HTMT1_0027_F11.b :
TCH01_0098_B02.b :
ADR01_0015_A06.b : gagggaaaattggggttataacaatatagggtccccatcttctggagagtcattgtaaaa
OVRM1_0005_F07.b :
OVRT1_0148_B07.b : gtttttttggcgggggcacccaaaaggagaaa
OVRT1_0094_B05.b : agaaat
SPL01_0003_F07.b :
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b :
OVRT1_0038_G09.b : gcccacctgtggagggattagaaaaagtcgttaaa
OVRT1_0038_C10.b : ctctgggaaacactaaaaaaatttcttcagagaa
TCH01_0030_H06.b :
OVR01_0018_G05.b :
OVR01_0047_A07.b :
BFLT1_0099_H08.b :
SKNB1_0096_D08.b : atcgaggggaaaaattgggttcaatacacaaccggtccccacccctcgggagggacctt
20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 1062
SMG01_0039_C10.b :
OVRT1_0134_G07.b :
OVR01_0047_E07.b :
PTG01_0100_G01.b :
AMP01_0036_A10.b :
OVRT1_0079_C05.b : gagagttttttttttgtggcgggntggcccccctctataggaggagtaacactatggtgc
THY01_0123_E04.b :
OVR01_0069_E09.b :
PBL01_0002_B05.b :
OVRT1_0135_E03.b :
ITT01_0061_G07.b : cgcactgcagtgactcgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PTG01_0083_C07.b : tttggggagggaaaaaaaaaaaaaatctctttcttaaaaaaaaaaaaac
ADR01_0025_D03.b :
OVRM1_0049_H10.b :
ADR01_0068_C05.b :
HTMT1_0027_F11.b :
TCH01_0098_B02.b :
ADR01_0015_A06.b : a
OVRM1_0005_F07.b :
OVRT1_0148_B07.b :
OVRT1_0094_B05.b :
SPL01_0003_F07.b :
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b :
OVRT1_0038_G09.b :
OVRT1_0038_C10.b :
TCH01_0030_H06.b :
OVR01_0018_G05.b :
OVR01_0047_A07.b :
BFLT1_0099_H08.b :
SKNB1_0096_D08.b :
20110601C-007612 : ............................................................
---------+---------+---------+---------+---------+---------+ 1062
SMG01_0039_C10.b :
OVRT1_0134_G07.b :
OVR01_0047_E07.b :
PTG01_0100_G01.b :
AMP01_0036_A10.b :
OVRT1_0079_C05.b :
THY01_0123_E04.b :
OVR01_0069_E09.b :
PBL01_0002_B05.b :
OVRT1_0135_E03.b :
ITT01_0061_G07.b : nnnn
PTG01_0083_C07.b :
ADR01_0025_D03.b :
OVRM1_0049_H10.b :
ADR01_0068_C05.b :
HTMT1_0027_F11.b :
TCH01_0098_B02.b :
ADR01_0015_A06.b :
OVRM1_0005_F07.b :
OVRT1_0148_B07.b :
OVRT1_0094_B05.b :
SPL01_0003_F07.b :
OVRM1_0203_D02.b :
OVRM1_0070_E10.b :
OVRM1_0081_F05.b :
OVRM1_0120_G12.b :
OVRM1_0004_C05.b :
SKNB1_0037_C05.b :
OVRT1_0038_G09.b :
OVRT1_0038_C10.b :
TCH01_0030_H06.b :
OVR01_0018_G05.b :
OVR01_0047_A07.b :
BFLT1_0099_H08.b :
SKNB1_0096_D08.b :