[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007688

Length: 1,117

Sequence [FASTA format sequence]
TATAAATCGG CCATTTGCTT CGCTCCGCCC CGCAGCCTCG GAGTCCAAGC CGGTTCCTTA
CCGTTCCCGC AGTCGCCCGC CTCCTCTTTC CTTCCAACAT GACAGATGCT GCCGTGTCCT
TCGCCAAGGA CTTCCTGGCA GGTGGAGTAG CCGCGGCCAT CTCCAAGACT GCCGTAGCGC
CCATCGAGCG GGTCAAGCTG CTGCTGCAGG TGCAGCATGC CAGCAAGCAA ATCACTGCAG
ATAAGCAATA CAAGGGCATC ATAGACTGCG TGGTTCGTAT CCCCAAGGAG CAGGGAGTCC
TGTCCTTCTG GCGTGGTAAC CTGGCCAATG TCATCAGATA CTTCCCCACG CAGGCTCTCA
ACTTTGCGTT CAAAGATAAA TACAAGCAGA TCTTCCTGGG CGGTGTGGAC AAGAGGACCC
AGTTTTGGCG CTACTTTGCA GGGAATCTGG CCTCAGGTGG TGCTGCTGGG GCCACATCCT
TGTGTTTTGT GTACCCTCTC GACTTTGCCC GTACTCGTCT AGCCGCTGAT GTGGGCAAAG
CTGGAGCTGA AAGGGAATTC AGAGGCCTCG GCGACTGCCT GGTTAAGATC TACAAATCTG
ACGGGATTAG GGGCCTGTAC CAAGGCTTTA ACGTGTCTGT GCAGGGTATT ATCATCTACC
GAGCTGCCTA CTTCGGTATC TATGACACCG CAAAGGGAAT GCTTCCAGAT CCCAAGAATA
CTCATATCTT CATCAGCTGG ATGATCGCTC AGTCCGTCAC CGCAGTTGCT GGGTTGACTT
CCTATCCGTT TGACACTGTA CGTCGACGCA TGATGATGCA GTCAGGACGC AAAGGAACTG
ATATCATGTA CACAGGCACG CTTGACTGCT GGAGGAAGAT TGCTCGTGAC GAAGGAGCCA
AAGCCTTTTT CAAGGGCGCC TGGTCCAATG TCCTCAGAGG CATGGGTGGT GCTTTTGTGC
TTGTCTTGTA TGATGAAATC AAGAAGTTCA CATAAGTTAT TTCCTAGTTT TTCTCCCTCA
GTGAACAGGC ATGTTGTATT ATATACATAT CTTGAGCATT CCTGGCAAAC TGTGGCTGTC
TATTTATCAT GGCAACTATG TACTGGTTGA AATGGGA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSLC25A5ADP/ATP translocase 2 [Homo sapiens]. 562e-160O
Contig/Assembly ProteinSLC25A6ADP/ATP translocase 3 [Homo sapiens]. 536e-152O
Contig/Assembly ProteinSLC25A4ADP/ATP translocase 1 [Homo sapiens]. 529e-150O
Contig/Assembly ProteinSLC25A31ADP/ATP translocase 4 [Homo sapiens]. 409e-114O
Contig/Assembly ProteinSLC25A24calcium-binding mitochondrial carrier protein SCaMC-1 isoform 2 [Homo sapiens]. 1226e-28
Contig/Assembly ProteinSLC25A24calcium-binding mitochondrial carrier protein SCaMC-1 isoform 1 [Homo sapiens]. 1226e-28
Contig/Assembly ProteinSLC25A25calcium-binding mitochondrial carrier protein SCaMC-2 isoform d [Homo sapiens]. 1042e-22
Contig/Assembly ProteinSLC25A25calcium-binding mitochondrial carrier protein SCaMC-2 isoform c [Homo sapiens]. 1042e-22
Contig/Assembly ProteinSLC25A25calcium-binding mitochondrial carrier protein SCaMC-2 isoform b [Homo sapiens]. 1042e-22
Contig/Assembly ProteinSLC25A42solute carrier family 25 member 42 [Homo sapiens]. 1041e-22O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSlc25a5ADP/ATP translocase 2 [Mus musculus]. 568e-162O
Contig/Assembly ProteinSlc25a4ADP/ATP translocase 1 [Mus musculus]. 524e-149O
Contig/Assembly ProteinSlc25a31ADP/ATP translocase 4 [Mus musculus]. 411e-115O
Contig/Assembly ProteinSlc25a24calcium-binding mitochondrial carrier protein SCaMC-1 [Mus musculus]. 1172e-26
Contig/Assembly ProteinSlc25a42solute carrier family 25 member 42 [Mus musculus]. 1055e-23O
Contig/Assembly ProteinSlc25a23calcium-binding mitochondrial carrier protein SCaMC-3 [Mus musculus]. 1041e-22
Contig/Assembly ProteinSlc25a25calcium-binding mitochondrial carrier protein SCaMC-2 isoform 2 [Mus musculus]. 1019e-22
Contig/Assembly ProteinSlc25a25calcium-binding mitochondrial carrier protein SCaMC-2 isoform 1 [Mus musculus]. 1019e-22
Contig/Assembly ProteinSlc25a25calcium-binding mitochondrial carrier protein SCaMC-2 isoform 3 [Mus musculus]. 1019e-22
Contig/Assembly ProteinSlc25a41solute carrier family 25 member 41 [Mus musculus]. 1002e-21O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC492093PREDICTED: similar to solute carrier family 25, member 5 isoform 1 [Canis familiaris]. 567e-162O
Contig/Assembly ProteinLOC492093PREDICTED: similar to solute carrier family 25, member 5 isoform 2 [Canis familiaris]. 567e-162O
Contig/Assembly ProteinLOC492093PREDICTED: similar to solute carrier family 25, member 5 isoform 4 [Canis familiaris]. 555e-158O
Contig/Assembly ProteinLOC492093PREDICTED: similar to solute carrier family 25, member 5 isoform 6 [Canis familiaris]. 548e-156O
Contig/Assembly ProteinLOC480830PREDICTED: similar to ADP/ATP translocase 3 (Adenine nucleotide translocator 2) (ANT 3) (ADP,ATP carrier protein 3) (Solute carrier family 25, member 6) (ADP,ATP carrier protein, isoform T2) [Canis familiaris]. 539e-153
Contig/Assembly ProteinLOC492093PREDICTED: similar to solute carrier family 25, member 5 isoform 5 [Canis familiaris]. 531e-151O
Contig/Assembly ProteinLOC475630PREDICTED: similar to solute carrier family 25, member 4 [Canis familiaris]. 508e-144O
Contig/Assembly ProteinLOC492093PREDICTED: similar to solute carrier family 25, member 5 isoform 7 [Canis familiaris]. 487e-138O
Contig/Assembly ProteinLOC492093PREDICTED: similar to ADP/ATP translocase 2 (Adenine nucleotide translocator 2) (ANT 2) (ADP,ATP carrier protein 2) (Solute carrier family 25, member 5) (ADP,ATP carrier protein, fibroblast isoform) isoform 3 [Canis familiaris]. 448e-126O
Contig/Assembly ProteinLOC483832PREDICTED: similar to solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31 [Canis familiaris]. 417e-117


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSLC25A5ADP/ATP translocase 2 [Bos taurus]. 573e-163O
Contig/Assembly ProteinSLC25A6ADP/ATP translocase 3 [Bos taurus]. 538e-153O
Contig/Assembly ProteinSLC25A4ADP/ATP translocase 1 [Bos taurus]. 526e-149O
Contig/Assembly ProteinLOC787122PREDICTED: ADP/ATP translocase 1-like [Bos taurus]. 422e-118
Contig/Assembly ProteinLOC787122PREDICTED: ADP/ATP translocase 1-like [Bos taurus]. 422e-118
Contig/Assembly ProteinSLC25A31ADP/ATP translocase 4 [Bos taurus]. 416e-116O
Contig/Assembly ProteinSLC25A24calcium-binding mitochondrial carrier protein SCaMC-1 [Bos taurus]. 1171e-26
Contig/Assembly ProteinSLC25A42solute carrier family 25 member 42 [Bos taurus]. 1064e-23O
Contig/Assembly ProteinSLC25A42PREDICTED: solute carrier family 25, member 42-like [Bos taurus]. 1064e-23O
Contig/Assembly ProteinLOC615258PREDICTED: RIKEN cDNA 4930443G12-like isoform 1 [Bos taurus]. 1026e-22


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100158185PREDICTED: ADP/ATP translocase 2 [Sus scrofa]. 573e-164O
Contig/Assembly ProteinSLC25A6ADP/ATP translocase 3 [Sus scrofa]. 528e-150O
Contig/Assembly ProteinLOC100517196PREDICTED: ADP/ATP translocase 1-like isoform 2 [Sus scrofa]. 524e-149O
Contig/Assembly ProteinLOC100518564PREDICTED: ADP/ATP translocase 4-like [Sus scrofa]. 2162e-56O
Contig/Assembly ProteinSCAMC-1calcium-binding mitochondrial carrier protein SCaMC-1-like [Sus scrofa]. 1202e-27
Contig/Assembly ProteinSLC25A25calcium-binding mitochondrial carrier protein SCaMC-2 [Sus scrofa]. 1032e-22
Contig/Assembly ProteinSLC25A32PREDICTED: mitochondrial folate transporter/carrier [Sus scrofa]. 994e-21O
Contig/Assembly ProteinSLC25A43PREDICTED: solute carrier family 25 member 43 [Sus scrofa]. 96.72e-20O
Contig/Assembly ProteinLOC100525444PREDICTED: brain mitochondrial carrier protein 1-like isoform 2 [Sus scrofa]. 95.94e-20O
Contig/Assembly ProteinLOC100525444PREDICTED: brain mitochondrial carrier protein 1-like isoform 1 [Sus scrofa]. 95.94e-20O


Assembly Members: 42      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010044C04ADR01_0044_C04.bDB785393 
ADR010072F04ADR01_0072_F04.bDB787913 
AMP010090G04AMP01_0090_G04.bBW961628 
CBLT10003F08CBLT1_0003_F08.bHX211965 
CBLT10043A05CBLT1_0043_A05.bHX214700 
CBLT10048B08CBLT1_0048_B08.bHX215010 
CBLT10051E08CBLT1_0051_E08.bHX215241 
CBLT10060F06CBLT1_0060_F06.bHX215927 
CBLT10067H12CBLT1_0067_H12.bHX216523 
CBLT10068D05CBLT1_0068_D05.bHX216561 
CLNT10097H03CLNT1_0097_H03.bFS664137 
DCI010018H01DCI01_0018_H01.bDB791936 
HTMT10049B10HTMT1_0049_B10.bFS667637 AK392088
HTMT10071F12HTMT1_0071_F12.bFS669288 
HTMT10103H03HTMT1_0103_H03.bHX223445 
HTMT10139E08HTMT1_0139_E08.bHX225778 
HTMT10145D02HTMT1_0145_D02.bHX226221 
ITT010008E02ITT01_0008_E02.bBW976723 
ITT010043G10ITT01_0043_G10.bBW979910 
ITT010051D02ITT01_0051_D02.bBW980511 
ITT010083F06ITT01_0083_F06.bBW983398 
ITT010084D02ITT01_0084_D02.bBW983460 
ITT010086A04ITT01_0086_A04.bBW983593 
ITT010088B06ITT01_0088_B06.bBW983790 
KDN010021A10KDN01_0021_A10.bFS672732 
KDN010069B01KDN01_0069_B01.bFS675899 
LVRM10201E10LVRM1_0201_E10.bCJ007108 
OVRM10042A03OVRM1_0042_A03.bBP454812 
OVRM10125G03OVRM1_0125_G03.bBP152659 
OVRM10174D05OVRM1_0174_D05.bBP457835 
OVRM10186D05OVRM1_0186_D05.bBP457842 AK236375
PBL010004A01PBL01_0004_A01.bBW968660 
PBL010023G04PBL01_0023_G04.bBP156263 
PBL010107G06PBL01_0107_G06.bBW975638 
PST010023H01PST01_0023_H01.bHX239124 
PST010055H09PST01_0055_H09.bFS701227 
SKNB10040D01SKNB1_0040_D01.bDB802205 
SMG010091A06SMG01_0091_A06.bFS721098 
SPL010022C12SPL01_0022_C12.bBP157648 
SPL010057D03SPL01_0057_D03.bCJ018139 
THY010031A11THY01_0031_A11.bBP160397 AK398362
THY010075G09THY01_0075_G09.bBP167734 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
84C2550.769WNCTC/L
T900.231TTC/F


Alignment:      TOP

20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0186_D05.b :
SPL01_0057_D03.b : n
PBL01_0107_G06.b :
THY01_0031_A11.b : ttxxxxxxxxxxx
OVRM1_0125_G03.b :
ITT01_0083_F06.b :
OVRM1_0042_A03.b :
PBL01_0004_A01.b :
ITT01_0084_D02.b :
THY01_0075_G09.b : ccttt
ITT01_0086_A04.b :
ITT01_0051_D02.b :
CBLT1_0043_A05.b :
OVRM1_0174_D05.b :
PBL01_0023_G04.b :
CBLT1_0067_H12.b :
CBLT1_0068_D05.b :
CBLT1_0048_B08.b :
HTMT1_0139_E08.b :
HTMT1_0049_B10.b :
HTMT1_0145_D02.b :
CBLT1_0051_E08.b :
HTMT1_0071_F12.b :
CBLT1_0060_F06.b :
AMP01_0090_G04.b : nnnnggtatcttgggggctgctcgcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b :
CLNT1_0097_H03.b :
ADR01_0072_F04.b :
HTMT1_0103_H03.b :
DCI01_0018_H01.b : ttaacgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_B06.b :
ITT01_0008_E02.b :
SKNB1_0040_D01.b :
PST01_0023_H01.b :
KDN01_0069_B01.b :
KDN01_0021_A10.b :
ADR01_0044_C04.b :
CBLT1_0003_F08.b :
SMG01_0091_A06.b :
ITT01_0043_G10.b :
20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0186_D05.b : naatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0057_D03.b : nnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0107_G06.b : nnaaaatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0031_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0125_G03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0083_F06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0042_A03.b : cagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0004_A01.b : ncccccccatgacacaxxxxxxxxxxxxxxxxxxxxx
ITT01_0084_D02.b : nnnggagtaagcagcggtaxxxxxxxxxxxxxxxx
THY01_0075_G09.b : tggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0086_A04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxx
ITT01_0051_D02.b : nnggatatacaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0043_A05.b : nnnccagtgagaggccgtaxxxxxxxxxxxxxxxx
OVRM1_0174_D05.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0023_G04.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxx
CBLT1_0067_H12.b : nnntttttttttttttggatagttagaggxxxxxx
CBLT1_0068_D05.b : tttnnacgagagtagacgccgtxx
CBLT1_0048_B08.b : ttttggcaagtagaggxxxxxx
HTMT1_0139_E08.b : nnttcttttnnnnnnggacgagtacacgxxxxxx
HTMT1_0049_B10.b : tttttccgacggtxxxxxxxxxxxxxxxx
HTMT1_0145_D02.b : nnttttatttnnnccgcaggtagacgxxxxx
CBLT1_0051_E08.b : nnnnnggcaggtagaggxxxxxx
HTMT1_0071_F12.b : ttttcgacggtacgaxxxxxxxxxxx
CBLT1_0060_F06.b : ttttggcaggtagaggxxxxxxx
AMP01_0090_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_E10.b : xxxxxx
SPL01_0022_C12.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0055_H09.b :
CLNT1_0097_H03.b : ncctctttngggattacgtcagcgnacgxxxxxxxxxxxxxxxx
ADR01_0072_F04.b : nnaaataaannnnngactaacaxxxxxxxxxxxxx
HTMT1_0103_H03.b : nngggagagtacgacgxxx
DCI01_0018_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_B06.b : nnggatgaa
ITT01_0008_E02.b : nnnggatgaaca
SKNB1_0040_D01.b :
PST01_0023_H01.b :
KDN01_0069_B01.b :
KDN01_0021_A10.b :
ADR01_0044_C04.b :
CBLT1_0003_F08.b :
SMG01_0091_A06.b :
ITT01_0043_G10.b :
20110601C-007688 : ..........TATAAATCGGCCATTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
---------+---------+---------+---------+---------+---------+ 50
OVRM1_0186_D05.b : xxxxxxxxxxTATAAATCGGCCATTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
SPL01_0057_D03.b : xxxxxxxxxxxxxxxATCGGCCATTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
PBL01_0107_G06.b : xxxxxxxxxxtataaATCGGCCATTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
THY01_0031_A11.b : xxxxxxxxxxxxtgaATCGGCCATTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
OVRM1_0125_G03.b : xxxxxxxxxxxxxxxxTCGGCCATTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
ITT01_0083_F06.b : xxxxxxxxxxxxxxxxTCGGCCATTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
OVRM1_0042_A03.b : xxxxxxxxxxxxxxxxxxxxxaTTTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
PBL01_0004_A01.b : xxxxxxxxxxxxxxxxxxxxxxTTTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
ITT01_0084_D02.b : xxxxxxxxxxxxxxxxxxxxxtTTTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
THY01_0075_G09.b : xxxxxxxxxxxxxxxxxxxxxtTTTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
ITT01_0086_A04.b : xxxxxxxxxxxxxxxxxxxxxaTTTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
ITT01_0051_D02.b : xxxxxxxxxxxxxxxxxxxxxxTTTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
CBLT1_0043_A05.b : xxxxxxxxxxxxxxxxxxxxxgATTTGCTTCGCTCCCCTTCGCAGCCTCGGAGTCCAAGC
OVRM1_0174_D05.b : xxxxxxxxxxxxxctggcattttTTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
PBL01_0023_G04.b : xxxxxxxxxxxxxxxxxxxxxxxTTTGCTTCGCTCCGCCCCGCAGCCTCGGAGTCCAAGC
CBLT1_0067_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCCGCAGCCTCGGAGTCCAAGC
CBLT1_0068_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCCGCAGCCTCGGAGTCCAAGC
CBLT1_0048_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCCGCAGCCTCGCAGTCCAAGC
HTMT1_0139_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCGCAGCCTCGGAGTCCAAGC
HTMT1_0049_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgccCCCCGCAGCCTCGGAGTCCAAGC
HTMT1_0145_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCGCAGCCTCGGAGTCCAAGC
CBLT1_0051_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCGCAGCCTCCGATTCCAAGC
HTMT1_0071_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcCCCCGCAGCCTCGGAGTCCAAGC
CBLT1_0060_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCGCAGCCTCGGAGTCCAAGC
AMP01_0090_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCGCAGCCTCGGAGTCCAAGC
LVRM1_0201_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCGCAGCCTCGGAGTCCAAGC
SPL01_0022_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCGCAGCCTCGGAGTCCAAGC
PST01_0055_H09.b : nnnnggctgcgttggctaggCCGCAGCCTCGGAGTCCA*GC
CLNT1_0097_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtCCGCAGCCTCGGAGTCCAAGC
ADR01_0072_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCCGCAGCCTCGGAGTCCAAGC
HTMT1_0103_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCAGCCTCGGATTCCAAGC
DCI01_0018_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCCTCGGAGTCCAAGC
ITT01_0088_B06.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCTCGGAGTCCAAGC
ITT01_0008_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCTCGGAGTCCAAGC
SKNB1_0040_D01.b : nnnnncagactgtggctatggccgcaCCTCGGAGTC*AAGC
PST01_0023_H01.b : ntttttctgctgtggctatggccgcaCCTCGGAGT*CAAGC
KDN01_0069_B01.b : ntttctgaggttgctatgggcaCCTCAGAGTCCAAGC
KDN01_0021_A10.b : gctctgggcaCCTCGGAGTC*AAGC
ADR01_0044_C04.b : nttgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
CBLT1_0003_F08.b : ttnnnccaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0091_A06.b : gcgtctcnnnnnggataaagcagcxxxxxxxxxx
ITT01_0043_G10.b : nnaaatgaacaxxxxx
20110601C-007688 : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
---------+---------+---------+---------+---------+---------+ 110
OVRM1_0186_D05.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
SPL01_0057_D03.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
PBL01_0107_G06.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
THY01_0031_A11.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
OVRM1_0125_G03.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
ITT01_0083_F06.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTTTCCTTCCAACATGACAGATGCT
OVRM1_0042_A03.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
PBL01_0004_A01.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
ITT01_0084_D02.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTCTCCTTCCAACATGACAGATGCT
THY01_0075_G09.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
ITT01_0086_A04.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTTTCCTTCCAACATGACAGATGCT
ITT01_0051_D02.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTTTCCTTCCAACATGACAGATGCT
CBLT1_0043_A05.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
OVRM1_0174_D05.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
PBL01_0023_G04.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
CBLT1_0067_H12.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
CBLT1_0068_D05.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
CBLT1_0048_B08.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
HTMT1_0139_E08.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTTTCCTTCCAACATGACAGATGCT
HTMT1_0049_B10.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
HTMT1_0145_D02.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
CBLT1_0051_E08.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
HTMT1_0071_F12.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
CBLT1_0060_F06.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
AMP01_0090_G04.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
LVRM1_0201_E10.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
SPL01_0022_C12.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
PST01_0055_H09.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCA*CATGACAGATGCT
CLNT1_0097_H03.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTTTCCTTCCAACATGACAGATGCT
ADR01_0072_F04.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
HTMT1_0103_H03.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
DCI01_0018_H01.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTTTCCTTCCAACATGACAGATGCT
ITT01_0088_B06.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTTTCCTTCCAACATGACAGATGCT
ITT01_0008_E02.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCTTCTTTCCTTCCAACATGACAGATGCT
SKNB1_0040_D01.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
PST01_0023_H01.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCA*CATGACAGATGCT
KDN01_0069_B01.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
KDN01_0021_A10.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
ADR01_0044_C04.b : CGGTTCCTTACCGTTCCCGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
CBLT1_0003_F08.b : xxxxxxxxxxxxxxxxxgGCAGTCGCCCGCCTCCTCTTTCCTTCCAACATGACAGATGCT
SMG01_0091_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTTCTTTCCTTCCA*CATGACAGATGCT
ITT01_0043_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTCCAACATGACAGATGCT
20110601C-007688 : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
---------+---------+---------+---------+---------+---------+ 170
OVRM1_0186_D05.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
SPL01_0057_D03.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
PBL01_0107_G06.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
THY01_0031_A11.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
OVRM1_0125_G03.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ITT01_0083_F06.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
OVRM1_0042_A03.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
PBL01_0004_A01.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ITT01_0084_D02.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
THY01_0075_G09.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ITT01_0086_A04.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ITT01_0051_D02.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
CBLT1_0043_A05.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
OVRM1_0174_D05.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
PBL01_0023_G04.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
CBLT1_0067_H12.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
CBLT1_0068_D05.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
CBLT1_0048_B08.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
HTMT1_0139_E08.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
HTMT1_0049_B10.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
HTMT1_0145_D02.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
CBLT1_0051_E08.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
HTMT1_0071_F12.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
CBLT1_0060_F06.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
AMP01_0090_G04.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
LVRM1_0201_E10.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
SPL01_0022_C12.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
PST01_0055_H09.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
CLNT1_0097_H03.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ADR01_0072_F04.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
HTMT1_0103_H03.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
DCI01_0018_H01.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ITT01_0088_B06.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ITT01_0008_E02.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
SKNB1_0040_D01.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
PST01_0023_H01.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
KDN01_0069_B01.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAACCGCGGCCATCTCCAAGACT
KDN01_0021_A10.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ADR01_0044_C04.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
CBLT1_0003_F08.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
SMG01_0091_A06.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
ITT01_0043_G10.b : GCCGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTAGCCGCGGCCATCTCCAAGACT
20110601C-007688 : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
---------+---------+---------+---------+---------+---------+ 230
OVRM1_0186_D05.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
SPL01_0057_D03.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
PBL01_0107_G06.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
THY01_0031_A11.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
OVRM1_0125_G03.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ITT01_0083_F06.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
OVRM1_0042_A03.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
PBL01_0004_A01.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ITT01_0084_D02.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
THY01_0075_G09.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ITT01_0086_A04.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ITT01_0051_D02.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
CBLT1_0043_A05.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
OVRM1_0174_D05.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
PBL01_0023_G04.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
CBLT1_0067_H12.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
CBLT1_0068_D05.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
CBLT1_0048_B08.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
HTMT1_0139_E08.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
HTMT1_0049_B10.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
HTMT1_0145_D02.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
CBLT1_0051_E08.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
HTMT1_0071_F12.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
CBLT1_0060_F06.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
AMP01_0090_G04.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
LVRM1_0201_E10.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
SPL01_0022_C12.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
PST01_0055_H09.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
CLNT1_0097_H03.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ADR01_0072_F04.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
HTMT1_0103_H03.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
DCI01_0018_H01.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ITT01_0088_B06.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ITT01_0008_E02.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
SKNB1_0040_D01.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
PST01_0023_H01.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
KDN01_0069_B01.b : GCCGTAACGCCCATCAAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
KDN01_0021_A10.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ADR01_0044_C04.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
CBLT1_0003_F08.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
SMG01_0091_A06.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
ITT01_0043_G10.b : GCCGTAGCGCCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAA
20110601C-007688 : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
---------+---------+---------+---------+---------+---------+ 290
OVRM1_0186_D05.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
SPL01_0057_D03.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
PBL01_0107_G06.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
THY01_0031_A11.b : ATCACTGCAGATAAGCAGTACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
OVRM1_0125_G03.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ITT01_0083_F06.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
OVRM1_0042_A03.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
PBL01_0004_A01.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ITT01_0084_D02.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
THY01_0075_G09.b : ATCACTGCAGATAAGCAGTACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ITT01_0086_A04.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ITT01_0051_D02.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
CBLT1_0043_A05.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
OVRM1_0174_D05.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
PBL01_0023_G04.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
CBLT1_0067_H12.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
CBLT1_0068_D05.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
CBLT1_0048_B08.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
HTMT1_0139_E08.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
HTMT1_0049_B10.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
HTMT1_0145_D02.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
CBLT1_0051_E08.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
HTMT1_0071_F12.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
CBLT1_0060_F06.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
AMP01_0090_G04.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
LVRM1_0201_E10.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
SPL01_0022_C12.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
PST01_0055_H09.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
CLNT1_0097_H03.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ADR01_0072_F04.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
HTMT1_0103_H03.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
DCI01_0018_H01.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ITT01_0088_B06.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ITT01_0008_E02.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
SKNB1_0040_D01.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
PST01_0023_H01.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
KDN01_0069_B01.b : ATCACTGCAGATAAGCAATACAAGGGCATCATACACTGCGTGGTTCGTATCCCCAAGGAG
KDN01_0021_A10.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ADR01_0044_C04.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
CBLT1_0003_F08.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
SMG01_0091_A06.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGTTCGTATCCCCAAGGAG
ITT01_0043_G10.b : ATCACTGCAGATAAGCAATACAAGGGCATCATAGACTGCGTGGCTCGTATCCCCAAGGAG
20110601C-007688 : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
---------+---------+---------+---------+---------+---------+ 350
OVRM1_0186_D05.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
SPL01_0057_D03.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
PBL01_0107_G06.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
THY01_0031_A11.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
OVRM1_0125_G03.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ITT01_0083_F06.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
OVRM1_0042_A03.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
PBL01_0004_A01.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ITT01_0084_D02.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
THY01_0075_G09.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ITT01_0086_A04.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ITT01_0051_D02.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
CBLT1_0043_A05.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
OVRM1_0174_D05.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
PBL01_0023_G04.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
CBLT1_0067_H12.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
CBLT1_0068_D05.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
CBLT1_0048_B08.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
HTMT1_0139_E08.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
HTMT1_0049_B10.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
HTMT1_0145_D02.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
CBLT1_0051_E08.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
HTMT1_0071_F12.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
CBLT1_0060_F06.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
AMP01_0090_G04.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
LVRM1_0201_E10.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
SPL01_0022_C12.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
PST01_0055_H09.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
CLNT1_0097_H03.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ADR01_0072_F04.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
HTMT1_0103_H03.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
DCI01_0018_H01.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ITT01_0088_B06.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ITT01_0008_E02.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
SKNB1_0040_D01.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
PST01_0023_H01.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
KDN01_0069_B01.b : CAGGGAGTCCTGTCCTTCTGGAGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
KDN01_0021_A10.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ADR01_0044_C04.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
CBLT1_0003_F08.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
SMG01_0091_A06.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
ITT01_0043_G10.b : CAGGGAGTCCTGTCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACG
20110601C-007688 : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
---------+---------+---------+---------+---------+---------+ 410
OVRM1_0186_D05.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
SPL01_0057_D03.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
PBL01_0107_G06.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
THY01_0031_A11.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
OVRM1_0125_G03.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ITT01_0083_F06.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
OVRM1_0042_A03.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
PBL01_0004_A01.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ITT01_0084_D02.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
THY01_0075_G09.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ITT01_0086_A04.b : CAGGCTCTCAACTTTGCGTTCAAAGATATATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ITT01_0051_D02.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
CBLT1_0043_A05.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
OVRM1_0174_D05.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
PBL01_0023_G04.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
CBLT1_0067_H12.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
CBLT1_0068_D05.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
CBLT1_0048_B08.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
HTMT1_0139_E08.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
HTMT1_0049_B10.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
HTMT1_0145_D02.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
CBLT1_0051_E08.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
HTMT1_0071_F12.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
CBLT1_0060_F06.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
AMP01_0090_G04.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
LVRM1_0201_E10.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
SPL01_0022_C12.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
PST01_0055_H09.b : CAGGCTCCCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
CLNT1_0097_H03.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ADR01_0072_F04.b : CAGGCTCTCAACTTTGCGTTCAAAGATA*ATACAAGCAGATCTTCCTGGGCGGTGTGGAC
HTMT1_0103_H03.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
DCI01_0018_H01.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ITT01_0088_B06.b : CAGGCTCTCAACTTCGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ITT01_0008_E02.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
SKNB1_0040_D01.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
PST01_0023_H01.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
KDN01_0069_B01.b : CAAGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
KDN01_0021_A10.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ADR01_0044_C04.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
CBLT1_0003_F08.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
SMG01_0091_A06.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
ITT01_0043_G10.b : CAGGCTCTCAACTTTGCGTTCAAAGATAAATACAAGCAGATCTTCCTGGGCGGTGTGGAC
20110601C-007688 : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
---------+---------+---------+---------+---------+---------+ 470
OVRM1_0186_D05.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAAGTGGTGCTGCTGGG
SPL01_0057_D03.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
PBL01_0107_G06.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
THY01_0031_A11.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
OVRM1_0125_G03.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
ITT01_0083_F06.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
OVRM1_0042_A03.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
PBL01_0004_A01.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCANGTGGTGCTGCTGGG
ITT01_0084_D02.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
THY01_0075_G09.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
ITT01_0086_A04.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
ITT01_0051_D02.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
CBLT1_0043_A05.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
OVRM1_0174_D05.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGCG
PBL01_0023_G04.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
CBLT1_0067_H12.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
CBLT1_0068_D05.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
CBLT1_0048_B08.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
HTMT1_0139_E08.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
HTMT1_0049_B10.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
HTMT1_0145_D02.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
CBLT1_0051_E08.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
HTMT1_0071_F12.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
CBLT1_0060_F06.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
AMP01_0090_G04.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
LVRM1_0201_E10.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
SPL01_0022_C12.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGGATCTGGCCTCAGGTGGTGCTGCTGGG
PST01_0055_H09.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
CLNT1_0097_H03.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
ADR01_0072_F04.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
HTMT1_0103_H03.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
DCI01_0018_H01.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAAGGAATCTGGCCTCAGGTGGTGCTGCTGGG
ITT01_0088_B06.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
ITT01_0008_E02.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
SKNB1_0040_D01.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
PST01_0023_H01.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
KDN01_0069_B01.b : AAGAAGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
KDN01_0021_A10.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
ADR01_0044_C04.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
CBLT1_0003_F08.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
SMG01_0091_A06.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
ITT01_0043_G10.b : AAGAGGACCCAGTTTTGGCGCTACTTTGCAGGGAATCTGGCCTCAGGTGGTGCTGCTGGG
20110601C-007688 : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
---------+---------+---------+---------+---------+---------+ 530
OVRM1_0186_D05.b : GCCACATCCTTGTGTTTTGTGTGCCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
SPL01_0057_D03.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
PBL01_0107_G06.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
THY01_0031_A11.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
OVRM1_0125_G03.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
ITT01_0083_F06.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
OVRM1_0042_A03.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
PBL01_0004_A01.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCCAGCCGCTGAT
ITT01_0084_D02.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
THY01_0075_G09.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
ITT01_0086_A04.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTC*TCTAGCCGCTGAT
ITT01_0051_D02.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
CBLT1_0043_A05.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
OVRM1_0174_D05.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
PBL01_0023_G04.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
CBLT1_0067_H12.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
CBLT1_0068_D05.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
CBLT1_0048_B08.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
HTMT1_0139_E08.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
HTMT1_0049_B10.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
HTMT1_0145_D02.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
CBLT1_0051_E08.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
HTMT1_0071_F12.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
CBLT1_0060_F06.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
AMP01_0090_G04.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGGCTTTGCCCGTACTCGTCTAGCCGCTGAT
LVRM1_0201_E10.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
SPL01_0022_C12.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
PST01_0055_H09.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
CLNT1_0097_H03.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
ADR01_0072_F04.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
HTMT1_0103_H03.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
DCI01_0018_H01.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
ITT01_0088_B06.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGCACTCGTCTAGCCGCTGAT
ITT01_0008_E02.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
SKNB1_0040_D01.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
PST01_0023_H01.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
KDN01_0069_B01.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
KDN01_0021_A10.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
ADR01_0044_C04.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
CBLT1_0003_F08.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
SMG01_0091_A06.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
ITT01_0043_G10.b : GCCACATCCTTGTGTTTTGTGTACCCTCTCGACTTTGCCCGTACTCGTCTAGCCGCTGAT
20110601C-007688 : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
---------+---------+---------+---------+---------+---------+ 590
OVRM1_0186_D05.b : GTGGGCAAAGCTGGAGCTGATAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
SPL01_0057_D03.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
PBL01_0107_G06.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
THY01_0031_A11.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
OVRM1_0125_G03.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
ITT01_0083_F06.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
OVRM1_0042_A03.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
PBL01_0004_A01.b : GTGGGCAAAGCTGGGACCTGAAGGGAATTCAGAGGCCTCCGCGACTGCCTGGTTAAGATC
ITT01_0084_D02.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
THY01_0075_G09.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
ITT01_0086_A04.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
ITT01_0051_D02.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
CBLT1_0043_A05.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
OVRM1_0174_D05.b : GTGGGCAAAGCTGGAGCTGANAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
PBL01_0023_G04.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
CBLT1_0067_H12.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
CBLT1_0068_D05.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
CBLT1_0048_B08.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
HTMT1_0139_E08.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
HTMT1_0049_B10.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
HTMT1_0145_D02.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
CBLT1_0051_E08.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
HTMT1_0071_F12.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
CBLT1_0060_F06.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
AMP01_0090_G04.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
LVRM1_0201_E10.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
SPL01_0022_C12.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
PST01_0055_H09.b : GTGGGCAAAGTTGAAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
CLNT1_0097_H03.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
ADR01_0072_F04.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
HTMT1_0103_H03.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
DCI01_0018_H01.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAAGCCTCGGCGACTGCCTGGTTTAGATC
ITT01_0088_B06.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
ITT01_0008_E02.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
SKNB1_0040_D01.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
PST01_0023_H01.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
KDN01_0069_B01.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATCCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
KDN01_0021_A10.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATCCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
ADR01_0044_C04.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
CBLT1_0003_F08.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
SMG01_0091_A06.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
ITT01_0043_G10.b : GTGGGCAAAGCTGGAGCTGAAAGGGAATTCAGAGGCCTCGGCGACTGCCTGGTTAAGATC
20110601C-007688 : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
---------+---------+---------+---------+---------+---------+ 649
OVRM1_0186_D05.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
SPL01_0057_D03.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
PBL01_0107_G06.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
THY01_0031_A11.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
OVRM1_0125_G03.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCANGGCTTTAACGTGTCTGTGCAGGGTAT
ITT01_0083_F06.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
OVRM1_0042_A03.b : TACNAATCTGAC*GGGATTAGGGGCCTGTACCAAG*CTTTAACGTGTCTGTGCCAGGTAT
PBL01_0004_A01.b : TACAAATCTGAC*GGGGATAGGGGCCTGTACCCAGGCTTTAACGTGTCTGTGCCGGGTAT
ITT01_0084_D02.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
THY01_0075_G09.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
ITT01_0086_A04.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
ITT01_0051_D02.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
CBLT1_0043_A05.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
OVRM1_0174_D05.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
PBL01_0023_G04.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
CBLT1_0067_H12.b : TACAAATCTGAC*GGGATTANGGGCCTGTACCNAGGCTTTTACGTGTCTGTGCAGGGTAT
CBLT1_0068_D05.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
CBLT1_0048_B08.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
HTMT1_0139_E08.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
HTMT1_0049_B10.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
HTMT1_0145_D02.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
CBLT1_0051_E08.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
HTMT1_0071_F12.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
CBLT1_0060_F06.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
AMP01_0090_G04.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
LVRM1_0201_E10.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
SPL01_0022_C12.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
PST01_0055_H09.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
CLNT1_0097_H03.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
ADR01_0072_F04.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
HTMT1_0103_H03.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
DCI01_0018_H01.b : TACAAACCTGACGGGGATTAGGGGCCTGTACCCAGGCTTTAACGTGTCTGgtgcagggaa
ITT01_0088_B06.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
ITT01_0008_E02.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
SKNB1_0040_D01.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
PST01_0023_H01.b : TACAAATCTGAC*GGGATTAGGGGGCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
KDN01_0069_B01.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
KDN01_0021_A10.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
ADR01_0044_C04.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
CBLT1_0003_F08.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
SMG01_0091_A06.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
ITT01_0043_G10.b : TACAAATCTGAC*GGGATTAGGGGCCTGTACCAAGGCTTTAACGTGTCTGTGCAGGGTAT
20110601C-007688 : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
---------+---------+---------+---------+---------+---------+ 708
OVRM1_0186_D05.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCATAGGGAATGCTTGCAG
SPL01_0057_D03.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGGATGCTTCCAG
PBL01_0107_G06.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
THY01_0031_A11.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
OVRM1_0125_G03.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
ITT01_0083_F06.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
OVRM1_0042_A03.b : TATCA*CTACCGAGCT*GGCTACTTCGGTATCTATGAAACCGagaggggatgcctccgaa
PBL01_0004_A01.b : TATCATCACCCGAGCC*TGCCAATTCGGTATCTATGACACCGCAAGGGGAA*GCTTCCAA
ITT01_0084_D02.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
THY01_0075_G09.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
ITT01_0086_A04.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
ITT01_0051_D02.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
CBLT1_0043_A05.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCANAGGGAATGCTTCCAG
OVRM1_0174_D05.b : TATCATCTACGGAGCTGGCCTACTTCGGTATCTTAGACACCGCAAAGGGAATGCTTCCAG
PBL01_0023_G04.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
CBLT1_0067_H12.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
CBLT1_0068_D05.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
CBLT1_0048_B08.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCANAGGGAATGCTTCCAG
HTMT1_0139_E08.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
HTMT1_0049_B10.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCANAGGGAATGCTTCCAG
HTMT1_0145_D02.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
CBLT1_0051_E08.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCANAGGGAATGCTTCCAG
HTMT1_0071_F12.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
CBLT1_0060_F06.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
AMP01_0090_G04.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
LVRM1_0201_E10.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGGATGCTTCCAG
SPL01_0022_C12.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
PST01_0055_H09.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
CLNT1_0097_H03.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCANAGGGAATGCTTCCAG
ADR01_0072_F04.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
HTMT1_0103_H03.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCANAGGGAATGCTTCCAG
DCI01_0018_H01.b : tatcatctaaccgagctgcctacctccgtatccttgacaccgcaaagggatggctttcca
ITT01_0088_B06.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
ITT01_0008_E02.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
SKNB1_0040_D01.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCANAGGGAATGCTTCCAG
PST01_0023_H01.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
KDN01_0069_B01.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
KDN01_0021_A10.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
ADR01_0044_C04.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
CBLT1_0003_F08.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
SMG01_0091_A06.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCANAGGGAATGCTTCCAG
ITT01_0043_G10.b : TATCATCTACCGAGCT*GCCTACTTCGGTATCTATGACACCGCAAAGGGAATGCTTCCAG
20110601C-007688 : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
---------+---------+---------+---------+---------+---------+ 768
OVRM1_0186_D05.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCATTTG
SPL01_0057_D03.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
PBL01_0107_G06.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
THY01_0031_A11.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
OVRM1_0125_G03.b : AATCCAAGAATACTCATATCCTCATCAGCTGGATGATCGCTCATTCCGTCACCGCAATTG
ITT01_0083_F06.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
OVRM1_0042_A03.b : tccaaaaagagcgcaacctccgtcagtggatagaacgcgagggcaaaaaagagataa
PBL01_0004_A01.b : ATCCCAAGAATACTCActatcttcatcacccgggaagatccccccatccgccccccccat
ITT01_0084_D02.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
THY01_0075_G09.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
ITT01_0086_A04.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
ITT01_0051_D02.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
CBLT1_0043_A05.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
OVRM1_0174_D05.b : ATCCCAAGCATACTCTTATCcttccccacctgtatgatcccccaatccgtcaccccagtt
PBL01_0023_G04.b : ATCCCCAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
CBLT1_0067_H12.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCCTCACCGCAATTG
CBLT1_0068_D05.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
CBLT1_0048_B08.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
HTMT1_0139_E08.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
HTMT1_0049_B10.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
HTMT1_0145_D02.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
CBLT1_0051_E08.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
HTMT1_0071_F12.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
CBLT1_0060_F06.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
AMP01_0090_G04.b : ATCCCCAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
LVRM1_0201_E10.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
SPL01_0022_C12.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
PST01_0055_H09.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
CLNT1_0097_H03.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
ADR01_0072_F04.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
HTMT1_0103_H03.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
DCI01_0018_H01.b : atcccaagaatactcaatacctcctcaaccgggaaaatccctcaatccgtcccccccaat
ITT01_0088_B06.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
ITT01_0008_E02.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
SKNB1_0040_D01.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
PST01_0023_H01.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
KDN01_0069_B01.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
KDN01_0021_A10.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
ADR01_0044_C04.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
CBLT1_0003_F08.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
SMG01_0091_A06.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
ITT01_0043_G10.b : ATCCCAAGAATACTCATATCTTCATCAGCTGGATGATCGCTCAGTCCGTCACCGCAGTTG
20110601C-007688 : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
---------+---------+---------+---------+---------+---------+ 828
OVRM1_0186_D05.b : CTGGATTGACTgc
SPL01_0057_D03.b : CTGGGTTGACTTCCTATCCCGTTGACCCTGTACGTCGACGCATGATGATGCAGTCAGGAC
PBL01_0107_G06.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
THY01_0031_A11.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
OVRM1_0125_G03.b : CTG
ITT01_0083_F06.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
OVRM1_0042_A03.b :
PBL01_0004_A01.b : tgccgggttgacttcccatcccgttgaaaacggacctccaaccccaggatgagcccttcc
ITT01_0084_D02.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
THY01_0075_G09.b : CTGGGGTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
ITT01_0086_A04.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
ITT01_0051_D02.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
CBLT1_0043_A05.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
OVRM1_0174_D05.b : g
PBL01_0023_G04.b : CTGGGTTGACTTCCTNNATCGTTGACACTGTACGTCGACGCATGATGATGCANTCAGGAC
CBLT1_0067_H12.b : CTGGGGTTGACTCCCATCCCTTTGAAACTGTACGTCCACCCCTGATGATGCAttccggga
CBLT1_0068_D05.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCCACGCATGATGATGCAGTCAGGAC
CBLT1_0048_B08.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCAACGCATGATGATGCAGTCAGGAC
HTMT1_0139_E08.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
HTMT1_0049_B10.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
HTMT1_0145_D02.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
CBLT1_0051_E08.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
HTMT1_0071_F12.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
CBLT1_0060_F06.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
AMP01_0090_G04.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
LVRM1_0201_E10.b : CTGGGTTGACTTtcctatcgtttga
SPL01_0022_C12.b : CTGGGTTGACTTCCT
PST01_0055_H09.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
CLNT1_0097_H03.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
ADR01_0072_F04.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
HTMT1_0103_H03.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
DCI01_0018_H01.b : tgccgggttgaacttcctatccctttgacacggtacccccacccctgaggaatccattcc
ITT01_0088_B06.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
ITT01_0008_E02.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
SKNB1_0040_D01.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
PST01_0023_H01.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
KDN01_0069_B01.b : CTGGGATGACCTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
KDN01_0021_A10.b : CTGGGTTGACCTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
ADR01_0044_C04.b : CTGGGTTGACTTCTTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
CBLT1_0003_F08.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
SMG01_0091_A06.b : CTGGGTTGACTTCCCTATCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
ITT01_0043_G10.b : CTGGGTTGACTTCCTATCCGTTTGACACTGTACGTCGACGCATGATGATGCAGTCAGGAC
20110601C-007688 : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
---------+---------+---------+---------+---------+---------+ 888
OVRM1_0186_D05.b :
SPL01_0057_D03.b : GCAA*GGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAAGAAGATTGCTCGTG
PBL01_0107_G06.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGNAGAAGATTGCTCGTG
THY01_0031_A11.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
OVRM1_0125_G03.b :
ITT01_0083_F06.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGAATGCTCGTG
OVRM1_0042_A03.b :
PBL01_0004_A01.b : gggccccaagggaatggtttcctgttaaccgggcccctggatcgccggaagaaaaattcc
ITT01_0084_D02.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGAATGCTCGTG
THY01_0075_G09.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTGGACTGCTGGAGGAAAATTGCTCGTG
ITT01_0086_A04.b : GCAAAGGAACTGATATCATGTACACAAGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
ITT01_0051_D02.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
CBLT1_0043_A05.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCCCCTG
OVRM1_0174_D05.b :
PBL01_0023_G04.b : GCNAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGANGAAGAATGCTCGTG
CBLT1_0067_H12.b : cccaagggactgaattcttgtacccaggcccccttgactgctggagaaaaatggtctctt
CBLT1_0068_D05.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGAATGCTCGTG
CBLT1_0048_B08.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAAGAAAAATGCTCGTG
HTMT1_0139_E08.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGNAGAAGA*TGCTCGTG
HTMT1_0049_B10.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGGAGAAGAATGCTCGTG
HTMT1_0145_D02.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAAGA*GATTGCTCGTG
CBLT1_0051_E08.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGNAGA*GATTGCTCGTG
HTMT1_0071_F12.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
CBLT1_0060_F06.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGAATGCTCGTG
AMP01_0090_G04.b : GC*AAGGAACTGATATCATGTACACAGGCCGCTTTGACTGCTGGAGAA**GATGCTCGTG
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
CLNT1_0097_H03.b : GGCAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGAAGGAAGATTGCTCGTG
ADR01_0072_F04.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGNAGAAAGATGCTCGTG
HTMT1_0103_H03.b : GCAAAGGGACTGATATCATGTACACAGGCACGCCTGACTGCTGGAAGAGGATTGCTCGTG
DCI01_0018_H01.b : ggaccccaaggaattggattttttgttccccggccccccttaattgttggaaaaaaaaat
ITT01_0088_B06.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGGAGAAGAATGCTCGTG
ITT01_0008_E02.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
SKNB1_0040_D01.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGNAGGAAGATTGCTCGTG
PST01_0023_H01.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
KDN01_0069_B01.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAATATTGCTCGTG
KDN01_0021_A10.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
ADR01_0044_C04.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGANGAAAATTGCTCGTG
CBLT1_0003_F08.b : GCANAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
SMG01_0091_A06.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGATTGCTCGTG
ITT01_0043_G10.b : GCAAAGGAACTGATATCATGTACACAGGCACGCTTGACTGCTGGAGGAAGAATGCTCGTG
20110601C-007688 : ACGAAGGAGCCAAAGCCTTTTTCAAGGGCGCCTGGTCCAATGTCCTCAGAGGCATGGGTG
---------+---------+---------+---------+---------+---------+ 948
OVRM1_0186_D05.b :
SPL01_0057_D03.b : ACCAAGGACCCAAACCTTTTTCAAGGCGCCtggtcaatgtccccgaaggcatgggtgggg
PBL01_0107_G06.b : ACGAA**AGACCAAAGCCTTTTCAAAGGCGCCTGGTCCA*TGTCCTCAGAgcatgggtgt
THY01_0031_A11.b : ACGAAGGAGCCAAAGCCTTTTTCAAGGGCGCCTGGGCCAATGTCCTCAGAGGCATGGGTG
OVRM1_0125_G03.b :
ITT01_0083_F06.b : ACGAAGGAGCCAAAGCCTTTTTCAAGGGCGCCTGGTCCA*TGTCCTCAGAGGCATGGGTG
OVRM1_0042_A03.b :
PBL01_0004_A01.b : cctggacaaagaaaccaaagcctttttctaggggcccccgggtccatgtcctcccagaga
ITT01_0084_D02.b : ACGAAGGAGCCAAAGC*TTTTTCAAGGGCGCCTGGTCCA*TGTCCTCAGAGGCATGGGTG
THY01_0075_G09.b : ACCAAGGAAGCAAAGC*TTTTTCAAGGGCGCCTGGcccatggtctcgaagcatgggtggt
ITT01_0086_A04.b : ACGAAGGAGCAAAAGCTTTTTTCAAGGGCGCCTGGTCCAATGTCCTCAGAGGCATGGGTG
ITT01_0051_D02.b : ACGAAGGAGCCAAAGCCTTTTTCAAGGGCGCCTGGT*CAATGTCCTCAAAGGCATGGGTG
CBLT1_0043_A05.b : ACGAAAGAGCCAAAGCCTTTTT*CAGGGCGCCTGGTCCAATGTCCTCAGAGGCAGGGGTG
OVRM1_0174_D05.b :
PBL01_0023_G04.b : ACGAANGAGCCAAAGCCTTTTCAAGGCGCCtggtcaatgtcctcgaggcaggggtgggct
CBLT1_0067_H12.b : aacaaaggacccaaaccctttttcaggggcgctggtccaatgcccccaagagcagggggg
CBLT1_0068_D05.b : ACGAAGGACCCAA*GCCTTTTTCAAGGGCGCCTGGTCCA*TGTCCTCAaaggctgggggt
CBLT1_0048_B08.b : ACGAAGGAACAAAAGCCTTTTTCAAGGGCGCCTGGT*CAATGTCCTCAAAGGCATGGGTG
HTMT1_0139_E08.b : ACGAAGGA*CCAAAGCCTTTTTCA*GGGCGCCTGGTCnnatgtctcgaggcatgggtgtg
HTMT1_0049_B10.b : ACGAAAGAGCCAAAGC**TTTTTCAGGGCGCCTGGTCNA*TGTCCTCAaagcatggtggt
HTMT1_0145_D02.b : ACGAAGGAGCCAAAGCCTTTTTCAAGGGCGCCTGGTCCA*TGTCTTCAGAGGCATGGGTG
CBLT1_0051_E08.b : ACGAAGGAG*CAAAGCCTTTTTTCAGGGCGCCTGGTCCA*TGTCCTCAGAAGCATGGGTG
HTMT1_0071_F12.b : ACGAAAGAGCCAAAGCCTTTTTCAAAGGCGCCTGGTCCAATGTCCTCAGAAGCATGGGTG
CBLT1_0060_F06.b : ACGAAGGAGCCAAAGCCTTTTTTCAGGGCGCCTGGTCCA*TGTCCTCAGAAGCATGGGTG
AMP01_0090_G04.b : ACGAAGGAGCCAAGCCCTTTTcagggncgctggtccatgtcctcagagcatgggtgtgct
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : ACGAANGAGCCAAAGCCTTTTTCAAGGGCGCCTGGGTCCATGTCCTCAGAGGCATGGGTG
CLNT1_0097_H03.b : ACNAAAGAACCAAAGCCTTTTCAAGGCGCCtggtccatggtctcagagcatggggggggc
ADR01_0072_F04.b : ACGAANGAGCCAAAGCCTTTT*CANGGGCGCCTGGTCCNATGTC*TCAGAGGCATGGGTG
HTMT1_0103_H03.b : GACGAGGAGCCAAACCTTTTTCAGGGCGCCtggccaattgtcctcaaaggctgggggggg
DCI01_0018_H01.b : gtccctgaaaaaaaaaccaaaaccttttttaaggggccccggtcaatgtcccccaaagga
ITT01_0088_B06.b : ACGAANGAGCCAAAGCTTTTT**CAGGGCGCCTGGTCCA*TGTCCTCN*AGGCATGGGTG
ITT01_0008_E02.b : ACGAAGGAGCCAAAGCCTTTTTC*AGGGCGCCTGGTCCA*TGTCCTC*GAGGCATGGGTG
SKNB1_0040_D01.b : ACCAAGGAGCCAAAGCCTTTTTTCAGGGCGCCTGGTCCNATGTCCTCAAGGGCATGGGTG
PST01_0023_H01.b : ACGAAGGAGCCAAAGCCTTTTT*CAGGGCGCCTGGGTCAATGTCCTCAGAGGCGTGGGTG
KDN01_0069_B01.b : ACGAAAGAGCCAAAGCCTTTTTCAAGGGCGCCTGGTTCTATGTCCTCAGAGGCATGGGTG
KDN01_0021_A10.b : ACGAANGAGCCAAAGCCTTTTTCAAGGGCGCCTGGTCCAATGTCCTCAGAGGCATGGGTG
ADR01_0044_C04.b : ACCAAAGAGCCTAAGCCTTTTTCAAGGGCGCCTTGTCCAATGTCTTCCGAGGCATGGGTG
CBLT1_0003_F08.b : ACGAAGGAGCCAAAGCCTTTTTTCAGGGCGCCTGGTCCAATGTCCTCAGAGGCATGGGTG
SMG01_0091_A06.b : ACGAAGGAGCC*AAGCCTTTTTCAAGGGCGCCTGGTCCAATGTCtcagaggcatgggtgt
ITT01_0043_G10.b : ACGAANGAGCCAAAGCCTTTTTCAAGGGCGCCTGGTCCAATGTCCTCAGAGGCATGGGTG
20110601C-007688 : GTG*CTTTTGTGCTTGTCTTGTATGATGAAATCAAGAAGTTCACATAAGTTATTTCCTAG
---------+---------+---------+---------+---------+---------+ 1007
OVRM1_0186_D05.b :
SPL01_0057_D03.b : cctttgtgcttgcctggatgaagaaaccagaaattcccataaggtaattcccaagttttt
PBL01_0107_G06.b : gcttttgtgcttgtctgtatgagaaantcagaattcacatagtatttctagttttctcct
THY01_0031_A11.b : GTGGCTTTTGTGCTTGTCTTGTATGATGAAAtcaagaaagttcacataagttaattttcc
OVRM1_0125_G03.b :
ITT01_0083_F06.b : GTG*CTTTTGTGCTTGTCTgtatgatgaaaatcagaagtcacantagttatttcctagtt
OVRM1_0042_A03.b :
PBL01_0004_A01.b : cggggggggggcttctggctcgtcttgacaacaaaaacccacaattcccaaccttatttc
ITT01_0084_D02.b : tgcttttgtgctgtctgtatgatgaaatcagaaagttcacatagtattcctagttttctc
THY01_0075_G09.b : gcttttgggcttgtcttgtataagaaaatcaaaaatttcactaaattatttcccaatttt
ITT01_0086_A04.b : GTG*CTTTTGTGCTTGTCTTGTAAGATGAAAtcaaaaagtcacataagttatttcctaat
ITT01_0051_D02.b : GTG*CTTTTGTGNCTGTCTTGTATGATGAAATcaagaatttccctaagttatttctagtt
CBLT1_0043_A05.b : GGG*CTTTTGGGGCTGTCCTGTAGGATGAAATCCAAAAGTTCACATAAGTTATTTCctag
OVRM1_0174_D05.b :
PBL01_0023_G04.b : tttgggctgtctggatgagaaatcagaagtcccntagttatttctagtttttcccctcat
CBLT1_0067_H12.b : ggccttttgggcttgcccggaaaaaaaaaaaccaaaaattccaaaaattttttcccaaat
CBLT1_0068_D05.b : gcttttgggcctggctggaggaagaaacaagaattccctaagttaattcccaatttttcc
CBLT1_0048_B08.b : GTG*CTTTTGTGCTTGctctgtatgagaaatccagaatttcccataagttattttccaat
HTMT1_0139_E08.b : cttttgtgctgtctgtatgatgaaatcagagtcaccatagtattcctagtttctcctcat
HTMT1_0049_B10.b : gcttttgtgctgtctgnatgatgaatcaaaaagtcacatagtatttctagttttccccct
HTMT1_0145_D02.b : GTG*CTTTTGTGCcttgtctgaatgatgaatccagaagtcacataagtaatttcctattt
CBLT1_0051_E08.b : GTG*CTTTTGTGCTTGTCTTGTATGATGAAAtcagaagttcacatagttattccctagtt
HTMT1_0071_F12.b : GTG*CTTTTGTGCTTGTCTTGTATGATGAAAtcaagaagtcacataagttattccctagt
CBLT1_0060_F06.b : GTG*CTTTTGTGCTTGTTCTGTATGATGAAATNCAGAAGTTCACAATAGTTATTTtctag
AMP01_0090_G04.b : ttgtgctgtctgtatgatgaatcagaaagtccactagtattcctagttttctnctccntg
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : GTG*CTTTTGTGCTTGTCTTGTATGATGAAAatcagaagtcacataggttatttcctagt
CLNT1_0097_H03.b : tttgtgctgtcttgtatgagaaaaccagaagtcacatagtttatttctagtttttcccct
ADR01_0072_F04.b : GTG*CTTTgtgcttgtctgtatgatgaaaatcagaagtcacantagttattcctagtttt
HTMT1_0103_H03.b : cctttgtggctgtctggaagaataaaacaaaaaattccattagttatttccgatttttcc
DCI01_0018_H01.b : agggggggggctttggcgcctcttcgataaaaaaaaaacaaaaattccccaaagtttttt
ITT01_0088_B06.b : GTG*CTTTTGTGNCTGTCCTGTATGATGAAAtcagaagtcacataagttatttcctagtt
ITT01_0008_E02.b : GTG*CTTTTGTGCTTTGTCTGTATGATGAAAtcaagaagtcacataagttatttctagtt
SKNB1_0040_D01.b : Ggggcttttggtgctggtctggatgatgaaatcaagaattcacataagttatttcctagt
PST01_0023_H01.b : GTG*CTTTTGTGCTTGTCTTGTATGATGAAAtcaagaagtcacataagttatttcctagt
KDN01_0069_B01.b : GTG*CTTTTGTGCTTGTCTTGAAAGAAGAAAACNAGAAGCTCACTTAAGTTATTTCccag
KDN01_0021_A10.b : GTG*CTTTTGTGCTTGTCTTGTATGATGAAATCAAGAAGTTCACATAAGTTATTTCCTAA
ADR01_0044_C04.b : ATG*CTTTTGTGCTTGTCTGGTATGAaggaattcagaagttcaataaatttatttccaan
CBLT1_0003_F08.b : GTG*CTTTTGTGCTTGTCTTGTATGATGAAAATCAGAAGTTCACATAAGTTATTTCCTAG
SMG01_0091_A06.b : gcttttgtgctggtctgtatgagaaatcaagaagttcactaggtatttctaagttttctc
ITT01_0043_G10.b : GTG*CTTTTGTGCTTGTCNTGTATGATGAAATCAAGAAGTTCACATAAGTTATTTCCTAG
20110601C-007688 : TTTTTCTCCCTCAGTGAACAGGCATGTTGTATT*ATATACATATCTTGAGCATTCCTGGC
---------+---------+---------+---------+---------+---------+ 1066
OVRM1_0186_D05.b :
SPL01_0057_D03.b : tccccctcagggaaagggcatgtttgaattatataaaattcctga
PBL01_0107_G06.b : cantgacagcatgtgtatatatacatatctgagcattctggcgaactgtgctgtcattat
THY01_0031_A11.b : tagttttttctcccctccgtgaaaacagggattgtttgaatttaatataaaataatcttt
OVRM1_0125_G03.b :
ITT01_0083_F06.b : ttctcccntcatgacaggcatgttgtattatatacatatcttgagcattcctggcagact
OVRM1_0042_A03.b :
PBL01_0004_A01.b : cccttttttccccccccacaaaaagggcgtttccattaaaaacaatccttcgcacacccc
ITT01_0084_D02.b : cctcgtgaacagctgttgtatatatacatatctgagcatcctggcaaactgtgctgtcat
THY01_0075_G09.b : tccccccccatggacagggcttgtttgtttttaaaaaacaatttcttaagctttcctggg
ITT01_0086_A04.b : tttccccctccgtgaacgggatgttgtataaaataactaccttgacattcctggcaaact
ITT01_0051_D02.b : tttcccccccaggaaacggcctgttgtattatataacttatctgaactttcctgcagact
CBLT1_0043_A05.b : ttttcccccccaatgaacggcctgttgtattatataccaatctggaccttcctggcaaac
OVRM1_0174_D05.b :
PBL01_0023_G04.b : gaaaggcatgttgattaataaaaatctggcatcctgcaaagtgtggtgtcattatcatgg
CBLT1_0067_H12.b : ttttcccccccagggaaaagggcggttttattaattaaacatatttgggaacacccgggg
CBLT1_0068_D05.b : ccccaatgaaaggcctggttgattaaaaacattccttgactttctgggcaacgttggcgt
CBLT1_0048_B08.b : ttttccccctcaatggaacaggctgttgtattataaaaataatttgaacattccgggcaa
HTMT1_0139_E08.b : gacagcatgtgtatattacaatctgacattctgcagatgtggctgcatttacatgcacta
HTMT1_0049_B10.b : catgacagcatgtgtataaataactatctgagcatctggcgaacgttgcggcatttacag
HTMT1_0145_D02.b : ttcccctcagtgaacaggcagttgtattaaaaaacaatcttgacattccggcaaaacgtg
CBLT1_0051_E08.b : ttctcctcagtgaacggcatgttgtataaataaatatcttgagcattctggcagacggtg
HTMT1_0071_F12.b : tttctccctcagtgacaggcatgttgtattaaataaatatcttgaacatcccgggcagac
CBLT1_0060_F06.b : tttttctccctcagtgaacaggcatggtgttataaataacatatcttgagcattcctggc
AMP01_0090_G04.b : acagcatgtgtataaatacatacttgacttcctgccaactgtgctgccatatcagggcac
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : ttttctccctcagtgacaagcatgttgtattattaacatatcttgagcattctggcagac
CLNT1_0097_H03.b : tcatgaaaaggctggtgtataaataaaaatacttgagattctgggcaaatgttgctgttt
ADR01_0072_F04.b : ctcctcagtgaacaggcatgtgattaatacatatctgagcattctggcagatgnntgctg
HTMT1_0103_H03.b : cccccaggaaaggcctgtttgattataaaaatattttgagcttcctggggaaaggttggc
DCI01_0018_H01.b : ccacattttcccccccggagaaaggagggttgttttataaaaatactttgagactcccgg
ITT01_0088_B06.b : tttctcctcagtgacaagcatgttgtatatatacatatcttgagcattctggcagaactg
ITT01_0008_E02.b : tttcccctcagtgacaggcatgttgtatatataactatcttgagcatcctggcgactgtt
SKNB1_0040_D01.b : ttttctccctcatgaacaggcatgttgtattatataacatatcttgagcattcctggcag
PST01_0023_H01.b : ttttctccctcagtgaacaggcatgttgtattatataacatatcctgaacattcctggca
KDN01_0069_B01.b : tttttctccctcagtgaacaggcatgttgtattatataacatatcttgaacatttctgac
KDN01_0021_A10.b : GTTTTCTCCCTCAGTGAACAGGCATGTTGTATTTATATACATATCTTGAGCAattcctgg
ADR01_0044_C04.b : ttttccccctccgtgaaaagggatgttgtattaaaaaaaaatcttgggcatttctgggaa
CBLT1_0003_F08.b : TTTTTCTCCCTCAGTGAACAAGCATGGTGTAATAATATACATATCTTGAGCAttcctggc
SMG01_0091_A06.b : cctcgtgaacaggcttgtgtattaaaaacataacttgagcatccgtgcaacggttggtgt
ITT01_0043_G10.b : TTTTTCTTCCTCAGTGAACANGCATGTTGTATT*ATATACATATCTTGAGCATTCCTGGC
20110601C-007688 : AAACTGTGGCTGTCTATTTATCATGGCAACTATGTACTGGTTGAAATGGGA.........
---------+---------+---------+---------+---------+---------+ 1117
OVRM1_0186_D05.b :
SPL01_0057_D03.b :
PBL01_0107_G06.b : catggcactagtactgttgaatggagcaatatatccgtgaccgtttcccttagccttctg
THY01_0031_A11.b : gaaacaattccctgggccaaaatgggtttgggctgggttctan
OVRM1_0125_G03.b :
ITT01_0083_F06.b : gttggctgtctatttatcatggcactatgtactggttgaaaatgggaagcataatcccac
OVRM1_0042_A03.b :
PBL01_0004_A01.b : ggccaacggtgtgcggctttttatcgggcgacatcaaagggggaaaaacgggcgcaccat
ITT01_0084_D02.b : tttcatggcactagtactgttggaatggaagcatatacccgtgaccgtttccttaagcat
THY01_0075_G09.b : aaaaaggttgggggtttttt
ITT01_0086_A04.b : gttgcctgtctattttcaaggcaactagtactggttaaaatgggagcaataaaccccgtg
ITT01_0051_D02.b : gtgggcggctattttcatggcactatgtactggtgaaaatggaaacaaaaacccccgtga
CBLT1_0043_A05.b : ggttggctgtctattttcaagggcaccaggtacggttgaaaatggaaacaataaaccccg
OVRM1_0174_D05.b :
PBL01_0023_G04.b : cacttgtacgggtaaaaggggaacaaaaatccggtacctttttcttagcctttctgaaaa
CBLT1_0067_H12.b : aaaatgtttggcgtttttttttacaggggccattttttctgggtgaaaaaggggaaaaaa
CBLT1_0068_D05.b : catttttaagggcaacttttctggtaaaaagggaagacaaatactccgtgcccgttttcc
CBLT1_0048_B08.b : aggttggctgttcattatcatggcacctagttccggtttaaaagggaacaaaaaaatccg
HTMT1_0139_E08.b : gtctgttgaaatggagaaatactcgtgaagtttccttagccttctgaaaggggaccataa
HTMT1_0049_B10.b : ggcactagtctggtgaaatggagcaaaataccgtgacgttttccttaagccttctgaaag
HTMT1_0145_D02.b : gcggttatttttcagggcaacatttccgggttaaaatggaaacaaaaataccccggaaca
CBLT1_0051_E08.b : gctttcatttatcatggaactatgtactgttaaaaatggagccaataaccccctgaccgt
HTMT1_0071_F12.b : ggtggctgtctattatcaatggcaccatgtactgttgaaatgggaaaccatatacctccg
CBLT1_0060_F06.b : agacggtggcctgtctattatcatgggcacttatgtctgtttgaaatgggaagcataata
AMP01_0090_G04.b : tagactggtgaaatggagcaaatcccccggacgtttcccttagccttctgaatgatggac
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : tggtggctgtcatttatcaatggcactatgtacggggtaaaatgggaagcataatactca
CLNT1_0097_H03.b : ttttacatggaactagtaccggtgaaaggggaacataaaaccccgggacggtttctctta
ADR01_0072_F04.b : tctattatcatggncactatgactgggtgaaatggaacaataaactcccgtgaccggttt
HTMT1_0103_H03.b : gtttttttttaagggccacttgttcgggttaaaatggggaaaaaaacccccgggaccctt
DCI01_0018_H01.b : gaaaagatggggggcttttttaaaggggcaatttcttggtttaaaagggaaacaaaaccc
ITT01_0088_B06.b : tgctgtctttnatcatggncactatgtactggttgaaatggaagcataatatcactgaca
ITT01_0008_E02.b : ggctgtctatttatcatggcactatgtactggttgaaatgggaagcatatactcactgac
SKNB1_0040_D01.b : actgttggctggctatttattcatgcaacctagtactgggtgaaaaggggaagcatatta
PST01_0023_H01.b : gactgttggctggctatttatcatgggcactatgtactgtttgaaatgggaagcaataat
KDN01_0069_B01.b : aaaatggtggctgttctatttacaatggcaacatgtactggttgaaaattggaaacaaaa
KDN01_0021_A10.b : cagactgntggctgtctatttattcatggcaactatgtactggttgaaaatgggaaagca
ADR01_0044_C04.b : aagttggctggtatttatcatgggaactatgtactgtttgaaaggggaaacataataccc
CBLT1_0003_F08.b : aactgttggctgtctatttatcatgggcactatgtactggttgaaaatgggaagccataa
SMG01_0091_A06.b : ccaatatcaatggcactatgactgttgaaaatggaaacaatatactccgtgacagttttc
ITT01_0043_G10.b : AAACTGTGGCTGTCTATTTATCATGGCAACTATGTACTGGTTGAAATGGGAagcaataat
20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 1117
OVRM1_0186_D05.b :
SPL01_0057_D03.b :
PBL01_0107_G06.b : aaaagagggaccattaattttattccccctccgaaaagccattgaaaaaaaaaatttgaa
THY01_0031_A11.b :
OVRM1_0125_G03.b :
ITT01_0083_F06.b : gtgacagttttcccttaagccatttcatgaaatgatgggacccattaatttttatttcgn
OVRM1_0042_A03.b :
PBL01_0004_A01.b : atcccccgtccacttttcttttcatcttttcttcttaggcggggccaccactaattatta
ITT01_0084_D02.b : tcatgatatgagggaccattaattttaatccgcccccgaaaagacaattaaaaaaaaaaa
THY01_0075_G09.b :
ITT01_0086_A04.b : acccatttcccttaagccttccctgaaaagagggcaccattaaatttttatttccccccc
ITT01_0051_D02.b : ccttttcccttaagcctttcaggaaaagaggggcccataaattttttttccgccccccga
CBLT1_0043_A05.b : ggcaccgtttctctaagccttcccaggaaagaggggcccattaattttttttccgtcctc
OVRM1_0174_D05.b :
PBL01_0023_G04.b : gaggaccattaattttatcgccctcgaaaagaattgaaaataaatttgaattaaaaaaaa
CBLT1_0067_H12.b : aatacccccggggggcctttttttcttaaaaccttttctgagaaaaagggggggcccctt
CBLT1_0068_D05.b : ttaaacctttccagaaaagaggggcccattaattttttttccccccccggaaaaggcaat
CBLT1_0048_B08.b : tggccgtttttcctaaagcctttcctgaagggagggacccattttttttttttttccccc
HTMT1_0139_E08.b : ttttatcgcccccgaaagaaatggaaaaaaaattgaataaaaaaaaaaaaaaaaaaaccg
HTMT1_0049_B10.b : gaggcccattattttttttcccccccgaaagaaatttgaaaaaaaatttgttttnnaaan
HTMT1_0145_D02.b : gttctcctaagcccttccatgaaagaggggaccatttttttttttttcccccccccgaaa
CBLT1_0051_E08.b : tttccttaaacatttcatgaaagatggaccaataatttttatttctcccccggaaatgaa
HTMT1_0071_F12.b : tgacagttttccttaggccttttcctgaaaaggagggaccaataatttttaattcacccc
CBLT1_0060_F06.b : cccacttgacagttttccttaagccttttctgaaaatgagggacccaattatttttttat
AMP01_0090_G04.b : catttttttttc
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : cgtgacagttttccttaaagccatttcatgaaatgatgggaccnattaattttttattcg
CLNT1_0097_H03.b : agcttttctgaaaagaggggaccaataattttttttcagcccccggaaaaggcaatttga
ADR01_0072_F04.b : ccttaagcatttctgaaaagatgggaccattaaatttttttcccccccccggaaaagcaa
HTMT1_0103_H03.b : tttctttaagcctttccggaaaagaagggacccaatatttttttttccccccccgcaaaa
DCI01_0018_H01.b : cgcgggacgtttccttaagacttcctaaagagggggggccctattttttttttccctncc
ITT01_0088_B06.b : gttttctctaaagcattcatgaaatgaagggacaataaatttttattcgcccctccgaaa
ITT01_0008_E02.b : cgttttcccttaaacatttcatgaaatgatggacccattaaatttttattcgccctcccg
SKNB1_0040_D01.b : tcacgtgacagttttccctaaagcctttcctgaaaatgaggaacccatttaatttttatt
PST01_0023_H01.b : actccgttgacagttttctcttaaaccatttcccggataaggatggggacccaatttatt
KDN01_0069_B01.b : aaacccacgtgacaatttttcccttaaaaccttttcctggaaaggaggggacccatttaa
KDN01_0021_A10.b : taatactcacgttgacagttttccttaaagcccattccatgaaaatgatgggacccataa
ADR01_0044_C04.b : cttggccgttttcctttagccttttctgataaggagggacccatttattttttttttcgc
CBLT1_0003_F08.b : tactccgtgtaacagtttctctaaagcattttcttgatatgatgggacccaataattttt
SMG01_0091_A06.b : cttaaccctttccggaaagggtggaccaataaattttaatccgcccccggaaaaggcatt
ITT01_0043_G10.b : actcacgtgaccagtttctcctaaaagcatttccatgaaatgatgggaaccatttaattt
20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 1117
OVRM1_0186_D05.b :
SPL01_0057_D03.b :
PBL01_0107_G06.b : ataaaaaaaaaaaaaaaggcattgtccaatgggtgcgccctcaaatctcgggcactatcc
THY01_0031_A11.b :
OVRM1_0125_G03.b :
ITT01_0083_F06.b : ccccccgaaaaaggcaatttgagaaataaaaattggaaaaaaa
OVRM1_0042_A03.b :
PBL01_0004_A01.b : cttccctcccccccacaagaccataagccagaccctactctcgctactaaaattcaaaac
ITT01_0084_D02.b : tttgaattaaaaaaaaaaagcgcttgcccactgggtcggcgcccaaattccccggggcac
THY01_0075_G09.b :
ITT01_0086_A04.b : tgaaaaagaacaattgaaaatataaaattcgaaaataaaaaaaaaaaaagcacatgttcc
ITT01_0051_D02.b : aaaggaaattgaaaaaaaaaaattcggatataaaaaaaaaaaagcgcttgttccaatccg
CBLT1_0043_A05.b : cggaaaagaaaaattgagaaaaataattttggggtttaaaacacagcaacccacaacatc
OVRM1_0174_D05.b :
PBL01_0023_G04.b : aagccatgtcaagcggtcggccttattcctcaggccattctacctttttaaggcaaggga
CBLT1_0067_H12.b : ttttttttttttttccgccccct
CBLT1_0068_D05.b : tgtaaaaaaaaattccgagatttnaaaaaaaaaaaaaaaaaaagaaaannannaanaana
CBLT1_0048_B08.b : cccgaaaggcaaatttaaaaaaaaaatttgggtttttgaaacaaaaaaataaaaaacaag
HTMT1_0139_E08.b : cccgccccttggggttggccaagaaatttggggaacccaagggaaagtttgtttggtttt
HTMT1_0049_B10.b : aaaaaaaannaaaaaanannnnnnnnncagcacggcgcccccctggggggtgccccaaaa
HTMT1_0145_D02.b : aggcaatttaagaaaaaaaattcggaaataaaangagaaagaggaaganaaanannnnnn
CBLT1_0051_E08.b : attggaaaaaaaaattcggattcnnanaaaaaaaaaaaaaaaaaaaaaaaannnnnnnnn
HTMT1_0071_F12.b : cccgaaaagacaatttaaaaaaaaaaattggnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0060_F06.b : tccgccccccggaaaaggacaatttgagaaaataaaatttccggaatttnnanaaanana
AMP01_0090_G04.b :
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : tcatcctgaaaatgaaatttgaaaataaaattttgaaattaaaaaaaaaaaaaagccaat
CLNT1_0097_H03.b : aaaaaaaaatctggataaaaaaaaaaaaaggcagtgcctagtagggcgcgccccaatatt
ADR01_0072_F04.b : attggaaaaaaaaaattggaaaaaaaaaaaaagccccttgctccacttaggccggcccct
HTMT1_0103_H03.b : gcaaattgaaaataaccctttggagaagaaaaaaaaaaataaacggtggtggtgttcccc
DCI01_0018_H01.b : cccaaggaatttgggaaaaaatatttttaaaaaaataaaaaaaaaagaggggccgccgcc
ITT01_0088_B06.b : agaacaattgagaataaaatattggaaataaaaaaaaaaaagagcctgggctcactcggg
ITT01_0008_E02.b : aaaaggacaattttagaaataaaaatccgaaataaaaaaaaaaaaaaaaagggcaatgtg
SKNB1_0040_D01.b : ccgcccccccgaaaaagggaaatttgaaaaaaaaaatatttgaaaaaaaaaaa
PST01_0023_H01.b : ttttatttcagccccccggaaaaaggaaaatttgaaaaaataaaatttctggaaattaaa
KDN01_0069_B01.b : attttttatttcgcccctcctgaaaaaggaacaattggaaaaaatacaaatttctgaaat
KDN01_0021_A10.b : aattttttaattcagcccatctggaaaatggcaaatttgagaaaaaaaaaatctggaaat
ADR01_0044_C04.b : ccccctgaaaagaaaatttgaaaaaaaaatatcttgaattataaaaaaaaaaaggccctg
CBLT1_0003_F08.b : tattcagtccctccgagaaagaaaatttgaagaaaaaaatttctggggaannaaaaaaaa
SMG01_0091_A06.b : tgaaaaaaaaaattgaaaaaaaaaaaaaaaaggccatggccaagttaggcggcgccttaa
ITT01_0043_G10.b : tttattccagtcctcctgaaaatgacaaattggagaaaataaaaattctgaaaattaaaa
20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 1117
OVRM1_0186_D05.b :
SPL01_0057_D03.b :
PBL01_0107_G06.b : aaactttttaaaaggcccagagtataaaaaaccggcctttaaaccggaaaaacttttttt
THY01_0031_A11.b :
OVRM1_0125_G03.b :
ITT01_0083_F06.b :
OVRM1_0042_A03.b :
PBL01_0004_A01.b : cctccgccttttataccgtagcgcgccccatactc
ITT01_0084_D02.b : taccccaccttttaaagggcccaggggctataacaggggcgccttaacccggggaaaccc
THY01_0075_G09.b :
ITT01_0086_A04.b : cactcaggtccgcccctcaaatacctcggggcaacttcgccacccttttgtgaagagccc
ITT01_0051_D02.b : gtcggccctctaataccctgggggcacatatcccaccttttttgaagggccctaagagaa
CBLT1_0043_A05.b : taccgaantgactccgcccctgtcccctcggggggagtggccgcccataattacgagagg
OVRM1_0174_D05.b :
PBL01_0023_G04.b : ttaacacggcctttaacggggaaacctgatttaaccttgggatgaaccccaaccgaaaat
CBLT1_0067_H12.b :
CBLT1_0068_D05.b : annnnnnnnnaaaaaaccccgcgccccctcctctgtggttttcccacaagaaatatttgt
CBLT1_0048_B08.b : acanntcgcgcgcgcgcccccccccgtgggggaatatataccaaaccccctccttttttg
HTMT1_0139_E08.b : tttttacaaaaaaaaaattttttgggggggtgttaacgggggggttctctcccccccctt
HTMT1_0049_B10.b : aattgggtgaa
HTMT1_0145_D02.b : nnnnnnnctccagcccccacccccngggggtggggcgccctcctctttgttttgttgaac
CBLT1_0051_E08.b : nnccaaacaccccccccgctattttgggtgttgtttcgaagaagtcagactgacacccac
HTMT1_0071_F12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0060_F06.b : aaaaanaaaaanaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnncccccgcccgccgc
AMP01_0090_G04.b :
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : tggtcaagtggggccggcccaaatatttaaaaaacccaacctcccgaacgaaaaaaaaag
CLNT1_0097_H03.b : aaaaaaaaccccccccccgagagaaaaaaaaagattgtggttaggtt
ADR01_0072_F04.b : caatatccgggggccagttacacccccttttttaaggggccaaggagaattaacagacgg
HTMT1_0103_H03.b : cggcggacctccttgtgcactcttgtggtgtatttatacctccgtcatccggnagcacac
DCI01_0018_H01.b : caattttat
ITT01_0088_B06.b : tcggcccctaaatcctcaggcgcgactacccacccttttgataaggggccaaagggataa
ITT01_0008_E02.b : ccaaattgggtccgccccctcgatttccctgggggccaacttacgtaccccttttgtaaa
SKNB1_0040_D01.b :
PST01_0023_H01.b : aaaaaaaaaaaaggcccaatggctccaaattaaggccggcc
KDN01_0069_B01.b : tataaaaaacaaaaaaggcccactgttctctaaccttcgggccggcgccctaaacatctt
KDN01_0021_A10.b : taaaaaaaaaaaaaaagccaagtggctcaacttgaggtccggccctaaaaaattaaaaaa
ADR01_0044_C04.b : gcttcatttggatcgcgccactttataatccgggggtgcatttaattactctttttttat
CBLT1_0003_F08.b : aaaaaaaaaaaananaaannnnnnannnnnnnnnnnnnnnnnngnnngnnnnnnngnggg
SMG01_0091_A06.b : atcctccggggccattatacacccctttttgaaaaggccccaaggggcaattaaaaggcg
ITT01_0043_G10.b : aaaaaaaaaaaaggcccttgtgtccaaactccaagtccgggcctcctaaatacccctcgg
20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 1117
OVRM1_0186_D05.b :
SPL01_0057_D03.b :
PBL01_0107_G06.b : aaacacttt
THY01_0031_A11.b :
OVRM1_0125_G03.b :
ITT01_0083_F06.b :
OVRM1_0042_A03.b :
PBL01_0004_A01.b :
ITT01_0084_D02.b : tggttttaaccctctgtggaaggaaaccaaaa
THY01_0075_G09.b :
ITT01_0086_A04.b : aaagaggatataaagaggggcgcttttacactggggaaaactcctgttttggaaacactc
ITT01_0051_D02.b : aaaaaaggcggcccttttacccctgagaaaccttggttttaaacacttctgggtaatgga
CBLT1_0043_A05.b : tagggcacaccacgagaccgacacacttcgcaagagggaaccgtttatctacnctacacc
OVRM1_0174_D05.b :
PBL01_0023_G04.b : tggggcccccgggtttaaaaaaacattttaaacccccctaaaataaaaaagtttattttg
CBLT1_0067_H12.b :
CBLT1_0068_D05.b : tggacacccccaggaaaaattttttgttgtgtttttttttaaaaaaaaaaacaaacttct
CBLT1_0048_B08.b : tcagggtaagaacaaaaaaattttgtggatgccgctattttaaaagtatgtaaattatag
HTMT1_0139_E08.b : nnnnnccgcgcctacaaaacgctgtgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0049_B10.b :
HTMT1_0145_D02.b : aaaaagagaaaagaacggggagtgggttttttttttaatgacaaactaaccttttttttg
CBLT1_0051_E08.b : attgggagatttttgttttttttttttttacaaaacaaaaattctttttttgtggtgggg
HTMT1_0071_F12.b :
CBLT1_0060_F06.b : ctcttttttttgtgtgtttctcaagaaacaacttgtggggtacaaaacanggagaaaaaa
AMP01_0090_G04.b :
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : cagtgttgtattgtttgccttagggcaaaaaagaccccatccaaaattttttctctgggg
CLNT1_0097_H03.b :
ADR01_0072_F04.b : ccccttcaccagag
HTMT1_0103_H03.b : gagaagtgggaatttgtttgttttttctttcaacacgacaataaatacacgttgttgtgg
DCI01_0018_H01.b :
ITT01_0088_B06.b : acagcgggccctttatacgggggaaaactgtgtttggaacactttgtggaattgaacccc
ITT01_0008_E02.b : aggccccataggggttataaaacggccggccttttacacttgggggaaaagtt
SKNB1_0040_D01.b :
PST01_0023_H01.b :
KDN01_0069_B01.b : aagaaaaaacctccacacctctccccaaacacgaaaaaaagagaaaaaattttgggtgtt
KDN01_0021_A10.b : aacccccacctccccgaaccgaaaaaaagaagcaatgttggttatgtttttggccttaag
ADR01_0044_C04.b : aagtgtcctataatcctataaacgacgtgtgcttctatatgtacggaatattcttttttt
CBLT1_0003_F08.b : cacgcccccctctttttgtgtggtttccacccaaaacaaggtgagtgccacccacggggg
SMG01_0091_A06.b : ggccctttaaacccggagaaaacttcttgattttaaaactcttgggggattggaacccca
ITT01_0043_G10.b : ggcccaaattaccgaaccccgtttttttaaaaagggcccctaagagagccaataaaacag
20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 1117
OVRM1_0186_D05.b :
SPL01_0057_D03.b :
PBL01_0107_G06.b :
THY01_0031_A11.b :
OVRM1_0125_G03.b :
ITT01_0083_F06.b :
OVRM1_0042_A03.b :
PBL01_0004_A01.b :
ITT01_0084_D02.b :
THY01_0075_G09.b :
ITT01_0086_A04.b : ttggggatttggccccccaattaccggagtaattttggtgtcc
ITT01_0051_D02.b : ccccccgttcgctgaatt
CBLT1_0043_A05.b : acaacaaatacaacctattctatcttatgtgcgtggtgagtgcgtcatacgccct
OVRM1_0174_D05.b :
PBL01_0023_G04.b :
CBLT1_0067_H12.b :
CBLT1_0068_D05.b : ttgggggggggg
CBLT1_0048_B08.b : ccctcttacttccccggagggggtgttttttgtgccggt
HTMT1_0139_E08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0049_B10.b :
HTMT1_0145_D02.b : ggggggggtggttgtggggggggggnnatttgccccctccccccccccggcgcnaaaaaa
CBLT1_0051_E08.b : ggggttttaaacgcggggggttttctccccctccccgcccaacagttaaaaaaaaaaaaa
HTMT1_0071_F12.b :
CBLT1_0060_F06.b : tttttttttagtgttctcctctaacacacaacaaaaaaaaggggtgtgttgtggg
AMP01_0090_G04.b :
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b : gtcaaaaagtttttgggccgcggaaattttt
CLNT1_0097_H03.b :
ADR01_0072_F04.b :
HTMT1_0103_H03.b : tgcgggcggccacctccccgcgc
DCI01_0018_H01.b :
ITT01_0088_B06.b : aaacccggaaaatttttgtggccccctgcgtctcttaatataaacaaatttttttatgcc
ITT01_0008_E02.b :
SKNB1_0040_D01.b :
PST01_0023_H01.b :
KDN01_0069_B01.b : atttct
KDN01_0021_A10.b : ggtaaaaaaaaaacccaatttcacaaaatttttctgctctttggtgtgcacacagtatta
ADR01_0044_C04.b :
CBLT1_0003_F08.b : aaatcttttttgtgtgctttttttcaaaaacaaaaaaaccctgttttttttgtgggggag
SMG01_0091_A06.b : atatcccggaaaatttggtggggaaccgcgccgcgtttttaaataaaacaccggtttttg
ITT01_0043_G10.b : gaccggcccctttttaacctggtcggagaaatcctttgggatttttaaaaaacactcttg
20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 1117
OVRM1_0186_D05.b :
SPL01_0057_D03.b :
PBL01_0107_G06.b :
THY01_0031_A11.b :
OVRM1_0125_G03.b :
ITT01_0083_F06.b :
OVRM1_0042_A03.b :
PBL01_0004_A01.b :
ITT01_0084_D02.b :
THY01_0075_G09.b :
ITT01_0086_A04.b :
ITT01_0051_D02.b :
CBLT1_0043_A05.b :
OVRM1_0174_D05.b :
PBL01_0023_G04.b :
CBLT1_0067_H12.b :
CBLT1_0068_D05.b :
CBLT1_0048_B08.b :
HTMT1_0139_E08.b :
HTMT1_0049_B10.b :
HTMT1_0145_D02.b : aaccaactaacctc
CBLT1_0051_E08.b : g
HTMT1_0071_F12.b :
CBLT1_0060_F06.b :
AMP01_0090_G04.b :
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b :
CLNT1_0097_H03.b :
ADR01_0072_F04.b :
HTMT1_0103_H03.b :
DCI01_0018_H01.b :
ITT01_0088_B06.b : ccccccattataaaactccaaat
ITT01_0008_E02.b :
SKNB1_0040_D01.b :
PST01_0023_H01.b :
KDN01_0069_B01.b :
KDN01_0021_A10.b : ttggagccggcgaggaatattttcttcc
ADR01_0044_C04.b :
CBLT1_0003_F08.b : gatttttaaacgcgcggggttgttctctccccacggcgcaa
SMG01_0091_A06.b : taaccgtccccctgtttccttgtttcccccnnttgnnnnaaaatttttgtttgggccctc
ITT01_0043_G10.b : gggaaaatt
20110601C-007688 : ............................................................
---------+---------+---------+---------+---------+---------+ 1117
OVRM1_0186_D05.b :
SPL01_0057_D03.b :
PBL01_0107_G06.b :
THY01_0031_A11.b :
OVRM1_0125_G03.b :
ITT01_0083_F06.b :
OVRM1_0042_A03.b :
PBL01_0004_A01.b :
ITT01_0084_D02.b :
THY01_0075_G09.b :
ITT01_0086_A04.b :
ITT01_0051_D02.b :
CBLT1_0043_A05.b :
OVRM1_0174_D05.b :
PBL01_0023_G04.b :
CBLT1_0067_H12.b :
CBLT1_0068_D05.b :
CBLT1_0048_B08.b :
HTMT1_0139_E08.b :
HTMT1_0049_B10.b :
HTMT1_0145_D02.b :
CBLT1_0051_E08.b :
HTMT1_0071_F12.b :
CBLT1_0060_F06.b :
AMP01_0090_G04.b :
LVRM1_0201_E10.b :
SPL01_0022_C12.b :
PST01_0055_H09.b :
CLNT1_0097_H03.b :
ADR01_0072_F04.b :
HTMT1_0103_H03.b :
DCI01_0018_H01.b :
ITT01_0088_B06.b :
ITT01_0008_E02.b :
SKNB1_0040_D01.b :
PST01_0023_H01.b :
KDN01_0069_B01.b :
KDN01_0021_A10.b :
ADR01_0044_C04.b :
CBLT1_0003_F08.b :
SMG01_0091_A06.b : tgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0043_G10.b :