[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007782

Length: 1,093

Sequence [FASTA format sequence]
GCATTCGGCT CGCCGCGTCG TGCCGTTCTC CCGCTTCCTT TCCTTTTCGT TCCCCTCCTT
CTTTCTTTCC TTCCTTCCTT CCGCCGGGAG CGATGGAGTC GGGGCGCCGG GCGGCCGCGG
CACTGCTGGC GCTGCTGTGC GCTGGCTGCG CGCTGCGCTC CGGACGCGCC CAGTACGAGC
GCTACAGCTT CCGCAGCTTC CCGCGGGACG AGCTGATGCC GCTCGAGTCG GCCTACCGGC
ACGCGCTGGA CCAGTACAGC GGCGAGCACT GGGCCGAGAG CGTGGGCTAC CTGGAGATTA
GCCTGCGGCT GCACCGCCTG CTGCGCGACA GCGAGGCCTT CTGCCACCGC AACTGCAGCG
CGGCGCCACA GCCTGAGCCC ACCGCCGGCC TCGCGCGCTA TCCAGAGCTG CGCCTCTTTG
GGGGCCTGCT GCGCCGCGCA CACTGCCTCA AACGCTGCAA GCAGGGCCTG CCAGCCTTCC
GCCAGTCACA GCCCAGCCGC GAAGTACTGG CCGACTTCCA GCGCCGAGAG CCCTACAAGT
TTCTGCAGTT CGCCTACTTC AAGGCAAATA ATCTCCCGAA AGCCATTGCT GCTGCTCACA
CCTTTCTATT GAAGCATCCT GATGATGAAA TGATGAAGAG AAACATGGCT TATTACAAGA
GCCTGCCTGA TGCCGAGGAC TACATTAAAG ACTTGGAAAG CAAGTCGTAT GAGAGCCTTT
TCATCCGAGC TGTGCGGGCG TACAATGGTG AGAACTGGAG GACGTGCATC ACGGACATGG
AGCTGGCCCT TCCCGACTTC TTCAAGGCCT TTTATGAGTG TCTGGCTGCC TGCGAGGGCT
CCCGGGAGAT CAAGGACTTC AAGGATTTCT ATCTTTCCAT AGCAGATCAT TATGTGGAAG
TTCTGGAATG CAAAATCCAG TGTGAAGAGA ACCTCACCCC AGTTATAGGA GGCTATCCAG
TGGAGAAATT TGTGGCTACC ATGTATCATT ATTTGCAGTT TGCCTATTAT AAGTTGAATG
ACTGGAGAAC GCGGCCCCCT GTGCCGTCAG CTACCTGCTC TTCGATCACA ACGACAGGTC
ATGCAGCAGA ACC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCRTAPcartilage-associated protein precursor [Homo sapiens]. 588e-168O
Contig/Assembly ProteinLEPREL4synaptonemal complex protein SC65 [Homo sapiens]. 3401e-93O
Contig/Assembly ProteinLOC100653071PREDICTED: cartilage-associated protein-like [Homo sapiens]. 2701e-72O
Contig/Assembly ProteinLEPRE1prolyl 3-hydroxylase 1 isoform 2 precursor [Homo sapiens]. 1687e-42O
Contig/Assembly ProteinLEPRE1prolyl 3-hydroxylase 1 isoform 3 precursor [Homo sapiens]. 1687e-42O
Contig/Assembly ProteinLEPRE1prolyl 3-hydroxylase 1 isoform 1 precursor [Homo sapiens]. 1687e-42O
Contig/Assembly ProteinLEPREL1prolyl 3-hydroxylase 2 isoform a [Homo sapiens]. 1663e-41O
Contig/Assembly ProteinLEPREL2prolyl 3-hydroxylase 3 precursor [Homo sapiens]. 98.69e-21O
Contig/Assembly ProteinLEPREL1prolyl 3-hydroxylase 2 isoform b [Homo sapiens]. 75.96e-14O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCrtapcartilage-associated protein precursor [Mus musculus]. 539e-153O
Contig/Assembly ProteinLeprel4synaptonemal complex protein SC65 [Mus musculus]. 3371e-92O
Contig/Assembly ProteinLeprel1prolyl 3-hydroxylase 2 precursor [Mus musculus]. 1663e-41O
Contig/Assembly ProteinLepre1prolyl 3-hydroxylase 1 isoform 2 [Mus musculus]. 1602e-39O
Contig/Assembly ProteinLepre1prolyl 3-hydroxylase 1 isoform 1 [Mus musculus]. 1602e-39O
Contig/Assembly ProteinLeprel2prolyl 3-hydroxylase 3 precursor [Mus musculus]. 1032e-22O
Contig/Assembly ProteinLepre1prolyl 3-hydroxylase 1 isoform 3 [Mus musculus]. 83.62e-16O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC485577PREDICTED: similar to Cartilage-associated protein precursor [Canis familiaris]. 570e-163O
Contig/Assembly ProteinLOC607731PREDICTED: similar to Nucleolar autoantigen No55 [Canis familiaris]. 3293e-90O
Contig/Assembly ProteinLOC478674PREDICTED: similar to leprecan-like 1 isoform 1 [Canis familiaris]. 1732e-43O
Contig/Assembly ProteinLOC606980PREDICTED: similar to leprecan 1 [Canis familiaris]. 1563e-38O
Contig/Assembly ProteinLOC486719PREDICTED: similar to leprecan-like 2 isoform 2 [Canis familiaris]. 71.22e-12O
Contig/Assembly ProteinLOC486719PREDICTED: similar to leprecan-like 2 isoform 1 [Canis familiaris]. 59.36e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCRTAPcartilage-associated protein [Bos taurus]. 597e-171O
Contig/Assembly ProteinCRTAPPREDICTED: cartilage associated protein [Bos taurus]. 597e-171O
Contig/Assembly ProteinLOC788823PREDICTED: synaptonemal complex protein SC65, partial [Bos taurus]. 2263e-59O
Contig/Assembly ProteinLOC788823PREDICTED: synaptonemal complex protein SC65-like, partial [Bos taurus]. 2093e-54O
Contig/Assembly ProteinLEPREL1prolyl 3-hydroxylase 2 [Bos taurus]. 1711e-42O
Contig/Assembly ProteinLEPRE1prolyl 3-hydroxylase 1 [Bos taurus]. 1649e-41O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLEPREL4PREDICTED: synaptonemal complex protein SC65 [Sus scrofa]. 3377e-93O
Contig/Assembly ProteinLOC100622574PREDICTED: cartilage-associated protein-like, partial [Sus scrofa]. 2232e-58O
Contig/Assembly ProteinLEPRE1PREDICTED: prolyl 3-hydroxylase 1 [Sus scrofa]. 71.23e-13O


Assembly Members: 31      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010010G12ADR01_0010_G12.bDB782442 
ADR010064C11ADR01_0064_C11.bFS639981 AK389409
BFLT10003G03BFLT1_0003_G03.bFS640227 
BFLT10076C08BFLT1_0076_C08.bFS645993 
BFLT10099G03BFLT1_0099_G03.bFS647927 
BFLT10101F08BFLT1_0101_F08.bHX201834 
BFLT10124E10BFLT1_0124_E10.bHX203724 
CBLT10035F08CBLT1_0035_F08.bHX214272 
CBLT10072E01CBLT1_0072_E01.bHX216903 
ITT010049H10ITT01_0049_H10.bBW980380 
KDN010089A04KDN01_0089_A04.bFS677468 
LVRM10004E12LVRM1_0004_E12.bCJ001115 
OVR010011A04OVR01_0011_A04.bBP141363 
OVR010044C03OVR01_0044_C03.bBP142239 
OVR010059G04OVR01_0059_G04.bBW964905 
OVR010061F06OVR01_0061_F06.bBW965078 
OVR010070E02OVR01_0070_E02.bBW965859 
OVR010095B05OVR01_0095_B05.bBW967733 
OVRM10056H09OVRM1_0056_H09.bBP154587 
OVRM10062G05OVRM1_0062_G05.bBP152816 
OVRT10032C08OVRT1_0032_C08.bFS688982 
OVRT10076C04OVRT1_0076_C04.bFS692586 
OVRT10083D01OVRT1_0083_D01.bFS693161 
OVRT10086A09OVRT1_0086_A09.bFS693381 
OVRT10086C02OVRT1_0086_C02.bFS693397 
PST010014H07PST01_0014_H07.bFS698130 
PST010018B07PST01_0018_B07.bFS698371 
PST010055H02PST01_0055_H02.bFS701223 
SMG010064E12SMG01_0064_E12.bFS718806 
SPL010101A03SPL01_0101_A03.bCJ022056 
UTR010038C07UTR01_0038_C07.bBP170724 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
164A2120.793WSGGA/G
G600.207GGG/G
279A2530.933WNAGC/S
G200.067GGC/G
707C420.214WSTCC/S
G2200.786TCG/S
749G700.269WSGGG/G
T1810.731GGT/G


Alignment:      TOP

20110601C-007782 : ..........................................................GC
---------+---------+---------+---------+---------+---------+ 2
ADR01_0064_C11.b : nccaaacgatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
KDN01_0089_A04.b : nctgcgttggctctggag
OVRM1_0056_H09.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0049_H10.b : nnnggatgaacaxxxxxxxxxxxxxxx
BFLT1_0101_F08.b : nnnccgtctgc
BFLT1_0124_E10.b : nnnccgtt
BFLT1_0076_C08.b : tacgtt
OVR01_0059_G04.b : nggcttgtgacttga
BFLT1_0003_G03.b : nggactcgt
OVRT1_0086_A09.b : nnggccttnnnnnnnnccgt
OVRT1_0086_C02.b : nnnggctttnnnnggnnccgtt
OVR01_0061_F06.b : nnnggcttgtgacttg
OVR01_0044_C03.b : gggacxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_E12.b :
PST01_0055_H02.b :
OVRT1_0083_D01.b : nnaatcc
OVRT1_0032_C08.b : nggaccc
SMG01_0064_E12.b :
OVRT1_0076_C04.b : nnnnncc
OVRM1_0062_G05.b :
OVR01_0070_E02.b : nnnttgcatggx
UTR01_0038_C07.b : ggggaccgtat
BFLT1_0099_G03.b : gg
OVR01_0095_B05.b : ngggctag
CBLT1_0035_F08.b :
OVR01_0011_A04.b : caacaattgaxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0014_H07.b :
PST01_0018_B07.b :
CBLT1_0072_E01.b :
SPL01_0101_A03.b :
ADR01_0010_G12.b :
20110601C-007782 : ATTCGGCTCGCCGCGTCGTGCCGTTCTCCCGCTTCCTTTCCTTTTCGTTCCCCTCCTTCT
---------+---------+---------+---------+---------+---------+ 62
ADR01_0064_C11.b : ATTCCGCTCGCCGCGTCCTGCCGTTCTCCCGcttcctttccttttccttcccctccttct
KDN01_0089_A04.b : cTTCGGCTCGCCGCGTCGTGCCGTTCTCCCGCTTCCTTTCCTTTTCGTTCccctccttct
OVRM1_0056_H09.b : xxxxxxxxxxxxxxxxxGTGCCGTTCTCCCGCTTCCTTTCCTTTTCGTTCccctccttct
ITT01_0049_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcctactggCTTTTCGTTCccctccttct
BFLT1_0101_F08.b : tgtacgaggtacttgggtncxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
BFLT1_0124_E10.b : agcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCT
BFLT1_0076_C08.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCT
OVR01_0059_G04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0003_G03.b : tagncgtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0086_A09.b : tagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0086_C02.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_F06.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxct
OVR01_0044_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_E12.b : cgtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0055_H02.b : nnnnggtcgctgtggcctggctt
OVRT1_0083_D01.b : gttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0032_C08.b : gtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0064_E12.b : nccccttnntnaagatcatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_C04.b : gttcagcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0062_G05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0070_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0099_G03.b : aatacgtcagcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_B05.b : gacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0035_F08.b : tttggcaggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0011_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0014_H07.b : ngcggtatnnnnngctgcgttggc
PST01_0018_B07.b :
CBLT1_0072_E01.b : tttttggcaggtagacgccgtxxxxxxxxxxxxxxx
SPL01_0101_A03.b : nnncccgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0010_G12.b :
20110601C-007782 : TTCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTCGGGGCGCCGGGCGGCCGCGGCA
---------+---------+---------+---------+---------+---------+ 122
ADR01_0064_C11.b : ttctttccttccttccttccCCCCGGAGCCATGGAGTccgggcgcccggcggccgccgcA
KDN01_0089_A04.b : ttctttccttccttccttccGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVRM1_0056_H09.b : ttctttccttccttccttccGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcg
ITT01_0049_H10.b : ttctttccttccttccttccGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
BFLT1_0101_F08.b : TTCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
BFLT1_0124_E10.b : TTCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
BFLT1_0076_C08.b : TTCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVR01_0059_G04.b : xxCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
BFLT1_0003_G03.b : xxCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVRT1_0086_A09.b : xxCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVRT1_0086_C02.b : xxCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVR01_0061_F06.b : ggCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVR01_0044_C03.b : xxCTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
LVRM1_0004_E12.b : xttTTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
PST01_0055_H02.b : tttcTTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVRT1_0083_D01.b : xxxxxTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVRT1_0032_C08.b : xxxxxTCCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
SMG01_0064_E12.b : xxxxxxxCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVRT1_0076_C04.b : xxxxxxxCTTCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVRM1_0062_G05.b : xxxxxxxxxxCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVR01_0070_E02.b : xxxxxxxxxxCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
UTR01_0038_C07.b : xxxxxxxxxxCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
BFLT1_0099_G03.b : xxxxxxxxxxCCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
OVR01_0095_B05.b : xxxxxxxxxxxCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
CBLT1_0035_F08.b : xxxxxxxxxxgCTTCCTTCCGCCGGCATTGATGGAGTcggggcgccgggcggccgcggcA
OVR01_0011_A04.b : xxxxxxxxxxxCTTCCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
PST01_0014_H07.b : tcggccttcttccttCTTCCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
PST01_0018_B07.b : tggcttcttccttCGCCGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
CBLT1_0072_E01.b : xxxxxxxxxxxxxxxxxxxxxxgGGGAGCGATGGAGTcggggcgccgggcggccgcggcA
SPL01_0101_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGCGATGGAGTcggggcgccgggcggccgcggcA
ADR01_0010_G12.b :
20110601C-007782 : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
---------+---------+---------+---------+---------+---------+ 182
ADR01_0064_C11.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCCCGCTGCGCTCCGGACGCGCCCAGGACGAGCGC
KDN01_0089_A04.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVRM1_0056_H09.b : cTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
ITT01_0049_H10.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
BFLT1_0101_F08.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
BFLT1_0124_E10.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGGCGCGCCCAGTACGAGCGC
BFLT1_0076_C08.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGGCGCGCCCAGTACGAGCGC
OVR01_0059_G04.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
BFLT1_0003_G03.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGGCGCGCCCAGTACGAGCGC
OVRT1_0086_A09.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVRT1_0086_C02.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVR01_0061_F06.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVR01_0044_C03.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
LVRM1_0004_E12.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
PST01_0055_H02.b : CTGCTGGCGCTGCCGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVRT1_0083_D01.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGGCGCGCCCAGTACGAGCGC
OVRT1_0032_C08.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGGCGCGCCCAGTACGAGCGC
SMG01_0064_E12.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVRT1_0076_C04.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVRM1_0062_G05.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVR01_0070_E02.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
UTR01_0038_C07.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
BFLT1_0099_G03.b : CTGCTGGCGCTGCTGTGCACTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
OVR01_0095_B05.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
CBLT1_0035_F08.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGGCGCGCCCAGTACGAGCGC
OVR01_0011_A04.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
PST01_0014_H07.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
PST01_0018_B07.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
CBLT1_0072_E01.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
SPL01_0101_A03.b : CTGCTGGCGCTGCTGTGCGCTGGCTGCGCGCTGCGCTCCGGACGCGCCCAGTACGAGCGC
ADR01_0010_G12.b :
20110601C-007782 : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
---------+---------+---------+---------+---------+---------+ 242
ADR01_0064_C11.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
KDN01_0089_A04.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVRM1_0056_H09.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
ITT01_0049_H10.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
BFLT1_0101_F08.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
BFLT1_0124_E10.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
BFLT1_0076_C08.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVR01_0059_G04.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
BFLT1_0003_G03.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVRT1_0086_A09.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVRT1_0086_C02.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVR01_0061_F06.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVR01_0044_C03.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
LVRM1_0004_E12.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
PST01_0055_H02.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVRT1_0083_D01.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVRT1_0032_C08.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
SMG01_0064_E12.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVRT1_0076_C04.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVRM1_0062_G05.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVR01_0070_E02.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
UTR01_0038_C07.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
BFLT1_0099_G03.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVR01_0095_B05.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
CBLT1_0035_F08.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
OVR01_0011_A04.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
PST01_0014_H07.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
PST01_0018_B07.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
CBLT1_0072_E01.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
SPL01_0101_A03.b : TACAGCTTCCGCAGCTTCCCGCGGGACGAGCTGATGCCGCTCGAGTCGGCCTACCGGCAC
ADR01_0010_G12.b :
20110601C-007782 : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
---------+---------+---------+---------+---------+---------+ 302
ADR01_0064_C11.b : GCGCTGGACCAGTACAGCGGCCAGCACTGGGCCCAGAGCGTGGGCTACCTGGAGATTAGC
KDN01_0089_A04.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVRM1_0056_H09.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
ITT01_0049_H10.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
BFLT1_0101_F08.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
BFLT1_0124_E10.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
BFLT1_0076_C08.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVR01_0059_G04.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
BFLT1_0003_G03.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVRT1_0086_A09.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGGGCGTGGGCTACCTGGAGATTAGC
OVRT1_0086_C02.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGGGCGTGGGCTACCTGGAGATTAGC
OVR01_0061_F06.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVR01_0044_C03.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
LVRM1_0004_E12.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
PST01_0055_H02.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVRT1_0083_D01.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVRT1_0032_C08.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
SMG01_0064_E12.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVRT1_0076_C04.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVRM1_0062_G05.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVR01_0070_E02.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
UTR01_0038_C07.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
BFLT1_0099_G03.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVR01_0095_B05.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
CBLT1_0035_F08.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
OVR01_0011_A04.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
PST01_0014_H07.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
PST01_0018_B07.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
CBLT1_0072_E01.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
SPL01_0101_A03.b : GCGCTGGACCAGTACAGCGGCGAGCACTGGGCCGAGAGCGTGGGCTACCTGGAGATTAGC
ADR01_0010_G12.b : nnnnaatgaacaxxxx
20110601C-007782 : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
---------+---------+---------+---------+---------+---------+ 362
ADR01_0064_C11.b : CTGCGGCTGCCCCGCCTGCTGCGCGACAGCCAGGCCTTCTGCCACCGCAACTGCAGCGCG
KDN01_0089_A04.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVRM1_0056_H09.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
ITT01_0049_H10.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
BFLT1_0101_F08.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
BFLT1_0124_E10.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
BFLT1_0076_C08.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVR01_0059_G04.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
BFLT1_0003_G03.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVRT1_0086_A09.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVRT1_0086_C02.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVR01_0061_F06.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVR01_0044_C03.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
LVRM1_0004_E12.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
PST01_0055_H02.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVRT1_0083_D01.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVRT1_0032_C08.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
SMG01_0064_E12.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVRT1_0076_C04.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVRM1_0062_G05.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVR01_0070_E02.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
UTR01_0038_C07.b : CTGCGGCTGCACCGCCTGCTGCGCGACTGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
BFLT1_0099_G03.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVR01_0095_B05.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
CBLT1_0035_F08.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
OVR01_0011_A04.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
PST01_0014_H07.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
PST01_0018_B07.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
CBLT1_0072_E01.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
SPL01_0101_A03.b : CTGCGGCTGCACCGCCTGCTGCGCGACAGCGAGGCCTTCTGCCACCGCAACTGCAGCGCG
ADR01_0010_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCCACCGCAACTGCAGCGCG
20110601C-007782 : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
---------+---------+---------+---------+---------+---------+ 422
ADR01_0064_C11.b : GCGCCCCAGCCTGAGCCCACCGCCGGGCTCACGCGCTATCCAGAGCTGCGCCTCTTTGGG
KDN01_0089_A04.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVRM1_0056_H09.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
ITT01_0049_H10.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
BFLT1_0101_F08.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
BFLT1_0124_E10.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
BFLT1_0076_C08.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVR01_0059_G04.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
BFLT1_0003_G03.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVRT1_0086_A09.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVRT1_0086_C02.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVR01_0061_F06.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVR01_0044_C03.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
LVRM1_0004_E12.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
PST01_0055_H02.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVRT1_0083_D01.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVRT1_0032_C08.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
SMG01_0064_E12.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVRT1_0076_C04.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVRM1_0062_G05.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVR01_0070_E02.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
UTR01_0038_C07.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
BFLT1_0099_G03.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVR01_0095_B05.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
CBLT1_0035_F08.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
OVR01_0011_A04.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
PST01_0014_H07.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
PST01_0018_B07.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
CBLT1_0072_E01.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
SPL01_0101_A03.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
ADR01_0010_G12.b : GCGCCACAGCCTGAGCCCACCGCCGGCCTCGCGCGCTATCCAGAGCTGCGCCTCTTTGGG
20110601C-007782 : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
---------+---------+---------+---------+---------+---------+ 482
ADR01_0064_C11.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
KDN01_0089_A04.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVRM1_0056_H09.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
ITT01_0049_H10.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
BFLT1_0101_F08.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
BFLT1_0124_E10.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
BFLT1_0076_C08.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVR01_0059_G04.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
BFLT1_0003_G03.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVRT1_0086_A09.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVRT1_0086_C02.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVR01_0061_F06.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVR01_0044_C03.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
LVRM1_0004_E12.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
PST01_0055_H02.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVRT1_0083_D01.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVRT1_0032_C08.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
SMG01_0064_E12.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVRT1_0076_C04.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVRM1_0062_G05.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVR01_0070_E02.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
UTR01_0038_C07.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
BFLT1_0099_G03.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVR01_0095_B05.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
CBLT1_0035_F08.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
OVR01_0011_A04.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
PST01_0014_H07.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
PST01_0018_B07.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
CBLT1_0072_E01.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
SPL01_0101_A03.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
ADR01_0010_G12.b : GGCCTGCTGCGCCGCGCACACTGCCTCAAACGCTGCAAGCAGGGCCTGCCAGCCTTCCGC
20110601C-007782 : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
---------+---------+---------+---------+---------+---------+ 542
ADR01_0064_C11.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
KDN01_0089_A04.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVRM1_0056_H09.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
ITT01_0049_H10.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
BFLT1_0101_F08.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
BFLT1_0124_E10.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
BFLT1_0076_C08.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVR01_0059_G04.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
BFLT1_0003_G03.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVRT1_0086_A09.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVRT1_0086_C02.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVR01_0061_F06.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVR01_0044_C03.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
LVRM1_0004_E12.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
PST01_0055_H02.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVRT1_0083_D01.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVRT1_0032_C08.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
SMG01_0064_E12.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVRT1_0076_C04.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVRM1_0062_G05.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACNAGTTT
OVR01_0070_E02.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
UTR01_0038_C07.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
BFLT1_0099_G03.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVR01_0095_B05.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
CBLT1_0035_F08.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
OVR01_0011_A04.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
PST01_0014_H07.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
PST01_0018_B07.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
CBLT1_0072_E01.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
SPL01_0101_A03.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
ADR01_0010_G12.b : CAGTCACAGCCCAGCCGCGAAGTACTGGCCGACTTCCAGCGCCGAGAGCCCTACAAGTTT
20110601C-007782 : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
---------+---------+---------+---------+---------+---------+ 602
ADR01_0064_C11.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
KDN01_0089_A04.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVRM1_0056_H09.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
ITT01_0049_H10.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
BFLT1_0101_F08.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
BFLT1_0124_E10.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
BFLT1_0076_C08.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVR01_0059_G04.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
BFLT1_0003_G03.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVRT1_0086_A09.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVRT1_0086_C02.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVR01_0061_F06.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVR01_0044_C03.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
LVRM1_0004_E12.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
PST01_0055_H02.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVRT1_0083_D01.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVRT1_0032_C08.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
SMG01_0064_E12.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVRT1_0076_C04.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVRM1_0062_G05.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVR01_0070_E02.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
UTR01_0038_C07.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
BFLT1_0099_G03.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVR01_0095_B05.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
CBLT1_0035_F08.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
OVR01_0011_A04.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
PST01_0014_H07.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
PST01_0018_B07.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
CBLT1_0072_E01.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
SPL01_0101_A03.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
ADR01_0010_G12.b : CTGCAGTTCGCCTACTTCAAGGCAAATAATCTCCCGAAAGCCATTGCTGCTGCTCACACC
20110601C-007782 : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
---------+---------+---------+---------+---------+---------+ 662
ADR01_0064_C11.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
KDN01_0089_A04.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVRM1_0056_H09.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
ITT01_0049_H10.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
BFLT1_0101_F08.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
BFLT1_0124_E10.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
BFLT1_0076_C08.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVR01_0059_G04.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
BFLT1_0003_G03.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVRT1_0086_A09.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVRT1_0086_C02.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVR01_0061_F06.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVR01_0044_C03.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
LVRM1_0004_E12.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
PST01_0055_H02.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVRT1_0083_D01.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVRT1_0032_C08.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
SMG01_0064_E12.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVRT1_0076_C04.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVRM1_0062_G05.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVR01_0070_E02.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
UTR01_0038_C07.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
BFLT1_0099_G03.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVR01_0095_B05.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
CBLT1_0035_F08.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
OVR01_0011_A04.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
PST01_0014_H07.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
PST01_0018_B07.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
CBLT1_0072_E01.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
SPL01_0101_A03.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
ADR01_0010_G12.b : TTTCTATTGAAGCATCCTGATGATGAAATGATGAAGAGAAACATGGCTTATTACAAGAGC
20110601C-007782 : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
---------+---------+---------+---------+---------+---------+ 722
ADR01_0064_C11.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
KDN01_0089_A04.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVRM1_0056_H09.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGGAAGCAAGTCGTATGAGAGCCTTTTC
ITT01_0049_H10.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
BFLT1_0101_F08.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
BFLT1_0124_E10.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
BFLT1_0076_C08.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVR01_0059_G04.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCCTATGAGAGCCTTTTC
BFLT1_0003_G03.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVRT1_0086_A09.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVRT1_0086_C02.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVR01_0061_F06.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVR01_0044_C03.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCCTATGAGAGCCTTTTC
LVRM1_0004_E12.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCCTATGAGAGCCTTTTC
PST01_0055_H02.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVRT1_0083_D01.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVRT1_0032_C08.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
SMG01_0064_E12.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAAGCAGTCGTATGAGAGCCTTTTC
OVRT1_0076_C04.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVRM1_0062_G05.b : CTGCCTGATGCCGAGGACTACATTANAGACTTGGAAAGCAAGTCCTATGAGAGCCTTTTC
OVR01_0070_E02.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCCTATGAGAGCCTTTTC
UTR01_0038_C07.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCCTATGAGAGCCTTTTC
BFLT1_0099_G03.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGGAAGCAAGTCGTATGAGAGCCTTTTC
OVR01_0095_B05.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGANAGCAAGTCGTATGAGAGCCTTTTC
CBLT1_0035_F08.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
OVR01_0011_A04.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCCTATGAGAGCCTTTTC
PST01_0014_H07.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
PST01_0018_B07.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAACCTTTTC
CBLT1_0072_E01.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
SPL01_0101_A03.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
ADR01_0010_G12.b : CTGCCTGATGCCGAGGACTACATTAAAGACTTGGAAAGCAAGTCGTATGAGAGCCTTTTC
20110601C-007782 : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
---------+---------+---------+---------+---------+---------+ 781
ADR01_0064_C11.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
KDN01_0089_A04.b : ATCCGAGCTGTGCGGGCGTACAATGGGGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVRM1_0056_H09.b : ATCCGAGCTGTGCGGGCGNTACATGGGGAGAA*CTGGAGGACGTGCATCACGGACATGGA
ITT01_0049_H10.b : ATCCGAGCTGTGCGGGCGTACAATGGGGAGAA*CTGGAGGACGTGCATCACGGACATGGA
BFLT1_0101_F08.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
BFLT1_0124_E10.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCGTCACGGACATGGA
BFLT1_0076_C08.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVR01_0059_G04.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
BFLT1_0003_G03.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVRT1_0086_A09.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVRT1_0086_C02.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVR01_0061_F06.b : ATCCGAGCTGTGCGGGCGTACAATGGGGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVR01_0044_C03.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCGCGGACATGGA
LVRM1_0004_E12.b : ATCCGAGCTGTGCGGGCGTACNATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
PST01_0055_H02.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVRT1_0083_D01.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACAGACATGGA
OVRT1_0032_C08.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACAGACATGGA
SMG01_0064_E12.b : ATCCGAGCTGTGCGGGCGTACAATGGGGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVRT1_0076_C04.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVRM1_0062_G05.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGAACGTGCATCACGGACATGGA
OVR01_0070_E02.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCCCCGACATGGA
UTR01_0038_C07.b : ATCCGAGCCGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
BFLT1_0099_G03.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVR01_0095_B05.b : ATCCGAGCTGTGCGGGCGTACAATGGGGAGAAACTGGAGGACGTGCATCACGGACATGGA
CBLT1_0035_F08.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
OVR01_0011_A04.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
PST01_0014_H07.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
PST01_0018_B07.b : ATCCGAGCTGTGCGGGCGTACAATGGGGAGAA*CTGGAGGACGTGCATCACGGACATGGA
CBLT1_0072_E01.b : ATCCGAGCTGTGCGGGCGTACAATGGTGAGAA*CTGGAGGACGTGCATCACGGACATGGA
SPL01_0101_A03.b : ATCCGAGCTGTGCGGGCGTACAATGGGGAGAA*CTGGAGGACGTGCATCACGGACATGGA
ADR01_0010_G12.b : ATCCGAGCTGTGCGGGCGTACAATGGGGAGAA*CTGGAGGACGTGCATCACGGACATGGA
20110601C-007782 : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
---------+---------+---------+---------+---------+---------+ 839
ADR01_0064_C11.b : GCTGGC*CCTCCCCGANCTCTT*CAGGGC*TTTTATGAGTGTCTGGCTGCCTGCGAGGGC
KDN01_0089_A04.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVRM1_0056_H09.b : GCTGGC*CCTTCCCGACTTCTcc
ITT01_0049_H10.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
BFLT1_0101_F08.b : GCTGGC*CCTTCCCGACTTTTCTCA*GGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
BFLT1_0124_E10.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGG
BFLT1_0076_C08.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVR01_0059_G04.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
BFLT1_0003_G03.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAAGGC
OVRT1_0086_A09.b : GCTGGC*CCTTCCCGACTTCTTNC*AGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVRT1_0086_C02.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVR01_0061_F06.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVR01_0044_C03.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCC*TTTATGAGTGTCTGGCTGCCTGCGAGGGC
LVRM1_0004_E12.b : GCTGGC*CCTTCCCGACTTCTTNC*AGGCCTTTTATGAGTGTCTGGCTGCCTGCGA
PST01_0055_H02.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVRT1_0083_D01.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVRT1_0032_C08.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
SMG01_0064_E12.b : GCTGGC*CCTTCCCGACTTCT**CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVRT1_0076_C04.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVRM1_0062_G05.b : GCTGGG*CCTTCCCGACTTTCTTCA*GGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVR01_0070_E02.b : ACTGGCCCCTTCCCGACTTCTTTCAAGGCCTTTTATGAGTGTCTGGCTGCCTGCCAAGGC
UTR01_0038_C07.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
BFLT1_0099_G03.b : GCTGGC*CCTTCCCGACTTCTTNC*AGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVR01_0095_B05.b : GCTGGC*CCTTCCCGACTTCTTTCA*GGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGG
CBLT1_0035_F08.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
OVR01_0011_A04.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
PST01_0014_H07.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
PST01_0018_B07.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
CBLT1_0072_E01.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
SPL01_0101_A03.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
ADR01_0010_G12.b : GCTGGC*CCTTCCCGACTTCTT*CAAGGCCTTTTATGAGTGTCTGGCTGCCTGCGAGGGC
20110601C-007782 : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
---------+---------+---------+---------+---------+---------+ 898
ADR01_0064_C11.b : TCCCGGGAGATCAAGGACTTCAAGGGATTCTATCT*TCCATAGCAGATCATTATGT*GGA
KDN01_0089_A04.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
OVRM1_0056_H09.b :
ITT01_0049_H10.b : TCCCGGGGAGATCAGGACTTNCAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
BFLT1_0101_F08.b : TCCGGGGAGATCAAGGACTTCAAGGATTTCTATCTTTC*ATAGCAGATCATTATGT*GGA
BFLT1_0124_E10.b : CTCCGGGAGATCAGGGACTTCAAGGATTTCTATCTTTTCAAAGCAGATCATTATGTTGGA
BFLT1_0076_C08.b : TCCGGGGA*ATCAAGGACTTCAAGGATTTCTATCTTTCCATAACAGATCATTATGT*GGA
OVR01_0059_G04.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTTCATAACAAATCATTATGT*GGA
BFLT1_0003_G03.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTTCATAGCAGATCATTATGT*GGA
OVRT1_0086_A09.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
OVRT1_0086_C02.b : TCCCGGGAGATCAAGGACTTTCAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
OVR01_0061_F06.b : TCCCGGGAGATCAAGGACTTCCAGGATTTCTATCTTTCCATAGCAGATCATTATGG*GAA
OVR01_0044_C03.b : TCCCGGGAGATCAAGGACTTTCAGGATTTCTATCTTTCCATTACAGAACATTATGT*GGA
LVRM1_0004_E12.b :
PST01_0055_H02.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
OVRT1_0083_D01.b : TCCCGGGAGATCAAGGACTTTTCAGGATTCTATCTTTCCATAGCAGATCATTATGT*GGA
OVRT1_0032_C08.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
SMG01_0064_E12.b : TCCCGGGAGATCAAGGACTTTCAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
OVRT1_0076_C04.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTTCATAGCAGATCATTATGT*GGA
OVRM1_0062_G05.b :
OVR01_0070_E02.b : TCCCGGGAaattcaagactttcaggaatttttatctttccatagcagaatctttatgtgg
UTR01_0038_C07.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
BFLT1_0099_G03.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTTCATAGCAGATCATTATGT*GGA
OVR01_0095_B05.b : TCCCGGGAGATCAATGACTTCCAGGATTTCTATCTTTCCCTAGCAGATCATTATGT*GGA
CBLT1_0035_F08.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
OVR01_0011_A04.b : TCCCGGGAGATCAAGGACTTCAAGGATCTCTATCTTTCCATAGCAGATCATTATGT*GGA
PST01_0014_H07.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
PST01_0018_B07.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
CBLT1_0072_E01.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
SPL01_0101_A03.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGG
ADR01_0010_G12.b : TCCCGGGAGATCAAGGACTTCAAGGATTTCTATCTTTCCATAGCAGATCATTATGT*GGA
20110601C-007782 : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
---------+---------+---------+---------+---------+---------+ 957
ADR01_0064_C11.b : AGTTCCTGGATGCAAA*TCCAGTGTGAAGAGAactcccccccagtataggaggctatcag
KDN01_0089_A04.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGNA*CCTCACCCCAGTTTATAGAGGCTATC
OVRM1_0056_H09.b :
ITT01_0049_H10.b : AGTTCTGGNAATGCAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
BFLT1_0101_F08.b : AGTTCTGGAATGCAAAATCCAGTGTGAGAAGAA*CCTCACCCCAGTTATAGaggtttcca
BFLT1_0124_E10.b : AGTTCTGGAATGCAAAATCCAGTGTGAAAAGAA*ACTCACCCCAGTTATAGGAGGCTATC
BFLT1_0076_C08.b : AGTTCTGGAATGCAAAATTCAGTGTGAAAAGAA*CCTCACCCCA*TTATAGGAAGCTATC
OVR01_0059_G04.b : AATTCTGGAGTGCCAAATTCAATGTGAAGAGAA*CCTCCCCCCAttttaggaagctatcc
BFLT1_0003_G03.b : AGTTCTGGAATGC*AAATCCAGTGTGAAGAGAA*C*TCACCCCAGTTTTAAGAGGCTATC
OVRT1_0086_A09.b : AGTTCTGGAATGCAAAATCCAATGTGAAGAGAA*CCTCACCCCAGT*ATAGGAAGCTATC
OVRT1_0086_C02.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
OVR01_0061_F06.b : AG*TCTGGAAATGCAAATCCAGTGTGAAGAGAA*ACTCACCCCAGTTATAGGAGGCTATC
OVR01_0044_C03.b : AAGTCTGGGATGCAAAATCCAGTGTGAAGAAAA*CCTCACCCCAGTTATAGGAGGCTATC
LVRM1_0004_E12.b :
PST01_0055_H02.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
OVRT1_0083_D01.b : AGTTCTGGAAATGCAAATCCAGTGTGAAGAG*A*CCTCACCCCAGTTATAGGAGGCTATC
OVRT1_0032_C08.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CTCACCCCA**TTATAGGAAGCTATC
SMG01_0064_E12.b : AGTCCTGGA*TGGCAAATCCAGTTGGAAGAGAA*C*TCACCCCAGTTTTAGgaggctatc
OVRT1_0076_C04.b : AGTTCTGGAATGCAAAATCCATTGTGAAAAGAC*CCTCACCCCAGTTATAGGAGGCTATC
OVRM1_0062_G05.b :
OVR01_0070_E02.b : aaaagttctggaatgccaaaatccccgggggaagaagaaccctcccccccccttataggg
UTR01_0038_C07.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
BFLT1_0099_G03.b : AAGTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
OVR01_0095_B05.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAAAA*CCCCCCCCCAGTTATtagagggctat
CBLT1_0035_F08.b : AGTTCTGGAATGCAAAATCCCGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
OVR01_0011_A04.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
PST01_0014_H07.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
PST01_0018_B07.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAACCCTCACCCCAGTTATAGGAGGCTATC
CBLT1_0072_E01.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAGGCTATC
SPL01_0101_A03.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CTTCA*CCCAGTTATAGGAAGCTATC
ADR01_0010_G12.b : AGTTCTGGAATGCAAAATCCAGTGTGAAGAGAA*CCTCACCCCAGTTATAGGAAGCTATC
20110601C-007782 : CAGTGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCTATTATAAGTTG
---------+---------+---------+---------+---------+---------+ 1016
ADR01_0064_C11.b : tggagaatttgtggctacctgtatcataattgcagttgcctatataagttgatgacctga
KDN01_0089_A04.b : CAGTGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCTATTATAAGTTG
OVRM1_0056_H09.b :
ITT01_0049_H10.b : CAGTGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCcctatatagttg
BFLT1_0101_F08.b : gtggagaaattggtgctaccagtatcattattgcagtttgccattataattgaaggactg
BFLT1_0124_E10.b : CAGTGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCTttataaatttg
BFLT1_0076_C08.b : AAGGGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCTAATATAgtttg
OVR01_0059_G04.b : ggtggaaaaattttggggctaccagttatctttatttgccgttttgcctattaaaaagtt
BFLT1_0003_G03.b : CAGTGAAGA*AATTgtgcctacatgtatcattattgcagtttgcctatataagttgatga
OVRT1_0086_A09.b : CAGTGGAG**AATTTGTGGCTACCATGTATCATaattgcagtttgcctatataagtggat
OVRT1_0086_C02.b : CAGTGGAGA*AATTTGTG**CTACATGTATCATTATTgcagtttgcctattataagtgaa
OVR01_0061_F06.b : CAGGGGAGG*AATTTGTGGCTACC*TGTATCCTTATTTGCAGTTgccctatttaaattga
OVR01_0044_C03.b : CAGTGGAAAAAATTTGTGGCTACCCTGTATCATTATTTtgcagtttgcctaattatagtt
LVRM1_0004_E12.b :
PST01_0055_H02.b : CAGTGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCTATTTATAGTGA
OVRT1_0083_D01.b : CAGTGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCTATTatagttga
OVRT1_0032_C08.b : CAGTGGAGA*AATTTGTGGCTACCA*GTATCATTATTTGCAGTTTGCCTATTATAagttt
SMG01_0064_E12.b : ccgtggaaaaatttggggctacatgtatcattatttggcgtttgccattaataagtgaat
OVRT1_0076_C04.b : CAGTGGAG**AATTTGTGGGCTACATGTACCATTATTTGCAATTTGccttttataattga
OVRM1_0062_G05.b :
OVR01_0070_E02.b : agggctatcccgctggaaaaaaaatttgggggctacccagggaatccattaatttgcggt
UTR01_0038_C07.b : CCGTGGAGA*AATTTGTGGTTACCATGTA
BFLT1_0099_G03.b : CAGTGGAGA*AATTTGTGGCTACCATGTATCCATATTTGCAGNTTtgccattataagttg
OVR01_0095_B05.b : ccagtgggaaaaatttgtggctacccggtaccattatttgcggtttggccaataaaagtt
CBLT1_0035_F08.b : CCGTGGAGA*AATTGGTGGCTACCATGTATCATTATTTGCAtttgcctattattagttga
OVR01_0011_A04.b : CAGTGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCCtattataagtt
PST01_0014_H07.b : CAGTGGAGA*AATTTGTGGGCTACATGTATCATTATTTGCAGTTTGCCCCTATATAGTTG
PST01_0018_B07.b : CAGTGGAGA*AATTTGTGGCTACCAGGTATCATTATTTGCAGTTTGCCTATTATAAGT*G
CBLT1_0072_E01.b : CCGTGGAGA*AATTTGTGGCTA*CATGTATCATTATTTGCAGTTTGCCTATTATAagtga
SPL01_0101_A03.b : CAGTGGAGA*AAATTGTGGCTACCATGTATCATTATTTTGCGTTTGCCTATTATAGTTtg
ADR01_0010_G12.b : CAGTGGAGA*AATTTGTGGCTACCATGTATCATTATTTGCAGTTTGCCTATTATAAGTTG
20110601C-007782 : AATGA*CTGGAGAACGCGGCCCCCTGTGCCGTCAGCTACCTGCTCTTCGATCACAACGAC
---------+---------+---------+---------+---------+---------+ 1075
ADR01_0064_C11.b : gaaccggccccccgggcgtcagctactgctttcgatccaagacaggtctgcaccaacctg
KDN01_0089_A04.b : AATGAACTGGAGAACGCGGGCCCCGGTGCCGTCAGCTACCggctcttcaatcacaacgac
OVRM1_0056_H09.b :
ITT01_0049_H10.b : aatgacctgnagaaacgcgcccccctgtgcgtcagctacctgctcttcgatcacaccgac
BFLT1_0101_F08.b : aaaaaccggcccctgtgcgtcagtaacgggttttgataaaaagacaaggttgggacaaaa
BFLT1_0124_E10.b : atgacccgaaaacgcggccccctgtgcggtcaattactggcttttaattaaaaaaaaaag
BFLT1_0076_C08.b : atgacctgaagaaccggccccctgtgcggcagctacctggttttgattaaaacaacaagt
OVR01_0059_G04.b : gaatgaccctgaaaaaaggcgggccccctggggccgtccgactacctggctctttcgaat
BFLT1_0003_G03.b : actgaaaacgcgggcccctgggcgtcagctacgggttcttgattccaagaacaaggcatg
OVRT1_0086_A09.b : gacctgaaaaggcggcccctgtgcgtcagctactgctctcgatcaaacgacaagtcatgc
OVRT1_0086_C02.b : tgacctgagaaacgcgcccctgtgcgtcagctactgcctctcgatacacgacaggtctgc
OVR01_0061_F06.b : atgacctgaagaacgcggcccccggtgcgtcggctactggtcttcgattcacgggacaag
OVR01_0044_C03.b : ggaatgacctgaaagaaccccgcccccctgggcccgtccacctaccttggtcctccaatc
LVRM1_0004_E12.b :
PST01_0055_H02.b : AATGA*CTGNAGAACGCGGCCCCCTGGTGCGTCAGCTACCTGCTCttcgatcancacgac
OVRT1_0083_D01.b : atgacctgaagaacgcgccccctgtgcgtcagctactgctcttcaatcacaagaaaaggt
OVRT1_0032_C08.b : gaaggactgaaaaaagcggcccctgggccgtcagctactggcctttcattcaaaaaacaa
SMG01_0064_E12.b : gacctggaaaaagcgccccctggtgcgcagttacctggtcttcatccaaggacaggtcat
OVRT1_0076_C04.b : atgacctgagaacggggcccctgtgccgtcacctactgcttcttattaaaagaaaaggtc
OVRM1_0062_G05.b :
OVR01_0070_E02.b : ttggccccatttaaaaaatttgaaaagaccctcgaaaaaaacgcgcggcccccctggggg
UTR01_0038_C07.b :
BFLT1_0099_G03.b : aatgacctgaagaaggcggcccctgtgccgtcagctacctgctcttcgggcaaaagacca
OVR01_0095_B05.b : tgaaggacccggaaaaaacgcggcccccctgggccgtcaagctaactggtttcttgattc
CBLT1_0035_F08.b : atgacctgaaaaagcggcccccctggtgcgcagctacctggcttttgattaaaagaacaa
OVR01_0011_A04.b : gaatgacctgaagaacgcgggccccctgtgcccgtcagcctacctgctcttcgatcacaa
PST01_0014_H07.b : AAATGACCTGAGAACGCGGCCCCCTGTGCCGTCAGCTACCTGCTCTTCGATCANCACGAC
PST01_0018_B07.b : AATGACCTGNAGAACGCGGCCCCCTGTGCCGTCAGCTACCTGCTCCTCGATCACAACGAC
CBLT1_0072_E01.b : atgacctgaagacgcgggcccctgtgccgtcagctacctggtcttcgatcacaagacaag
SPL01_0101_A03.b : atgacctgaagaaagcggccccctgtgccgtcagctacctgctcttcgatccaacgacaa
ADR01_0010_G12.b : AATGACCTGAAGAACGCGGCCCCCTGTGCCGTCAGCTACCTGCTCttcgatcacaacgac
20110601C-007782 : AGGTCATGCAGCAGAACC..........................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b : gggatacccatccccgggacaggggggcttcgaggaacttcccccccaccaaaccgtcct
KDN01_0089_A04.b : aagtcatgcagcaaaaactggggtattaccgtaccccagggacaagtgggggcttcggat
OVRM1_0056_H09.b :
ITT01_0049_H10.b : aggtcatgcagcaaaacctggtgtattaccagtacaccaggaacaatggggggcttttcg
BFLT1_0101_F08.b : ctggggattccaatcccagggaaaggggggtttcgaagaacttcccccaaacaaaacgtt
BFLT1_0124_E10.b : gcattgcacaaaaccggggttttaccatatcccagggaaagtgggggctttcggaagaac
BFLT1_0076_C08.b : catgaacaaaacctggggtttaccataccccaggacaagggggggtttcgaaaaaatttc
OVR01_0059_G04.b : tccaaacaacaaggttctgggccgccaaaacccgtggggttttacccggttacccccagg
BFLT1_0003_G03.b : caacaaaaccgtgggtataccagtaacccaggaaaaatgggggcctttcgaagaaacatt
OVRT1_0086_A09.b : acaaaactggtgataccgtacacaggacaatgggggtttggatgacattcagccaaacca
OVRT1_0086_C02.b : acaaaactgtggatacattaccaaggacaatgggggcttcgattacattcgcccaaccaa
OVR01_0061_F06.b : gtctgccccaaaacctggggttttcccagtcccacggaacaatggggggctttcggatga
OVR01_0044_C03.b : ccaaccgaaaagggtcattgcaaccaaaaaccctgggggggtattaccccataacccccc
LVRM1_0004_E12.b :
PST01_0055_H02.b : naggtcatgcagcagaacctggtgtattacagtaccacggggacagtgggggctttcgga
OVRT1_0083_D01.b : catggcacaaacctggtgtattaccgtacccaggaacagtggggctttcggataactttc
OVRT1_0032_C08.b : gtcatgcacaaaaactggtgtataaccttacccagggaaaaggggggtttggatgaaatt
SMG01_0064_E12.b : gcagcaaacctggggatttacctttccccagggaaaaggggggctttcggaagaaaattc
OVRT1_0076_C04.b : tgcaccaaaccggtggtttaccataccccaggacaaggggggcttcggataaactttccc
OVRM1_0062_G05.b :
OVR01_0070_E02.b : ccgggaaggaaaaaccggggtcttttaaaatacaaaagaacaaagggttctttgtcgggc
UTR01_0038_C07.b :
BFLT1_0099_G03.b : ggtctggcacaaaaactgttgtattaccgtaccccgggaaagtgggggctttcggatgaa
OVR01_0095_B05.b : caaacgaacagggccatgccgccaaaacctggtggattttacccggacccacaaggggaa
CBLT1_0035_F08.b : gtcatgcgccaaacctggggtattacagtaccccgggaaaatgggggctttggatgaact
OVR01_0011_A04.b : ccgaccaaggtcatgcagcagaaacctgggtggtattacccggtacccccgggggaacaa
PST01_0014_H07.b : AGGTCATGCAGCAGAACCtggtgtattacagtacacagggacaangngggcttttcgatg
PST01_0018_B07.b : Aaggtcatgcagcaaaccctggtgtattacagtaccccgggacagggggggctttcgatg
CBLT1_0072_E01.b : gttatgccacagaacctggtgtatacccgtaccacgggaccagtgggggctttcggataa
SPL01_0101_A03.b : ggtcatgcagcaaaacctggtgaattaccagtacacagggacaattgggggctttcggat
ADR01_0010_G12.b : aaggtcatgcaacagaacctggtgtattaccagtaccacaaggacaagtggggggctttt
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b : tcttaggggccccccccaaagacttttcctttctggaaccagggggggga
KDN01_0089_A04.b : gacatttccggccaaaccaaaaccgttcctttctttaggggactccctccaaaaaaactg
OVRM1_0056_H09.b :
ITT01_0049_H10.b : atgacatttccagccaaaaccaaaccattcaattcttaatgggcctcctccccaagagac
BFLT1_0101_F08.b : tttttttagggaaaccccaaaaactttaatttcaagaaatatgggtaagagggggggtga
BFLT1_0124_E10.b : tttccccccaaaacaaaaacctttcattctttagtggaccacccccaaaaaacttgttat
BFLT1_0076_C08.b : cccccaaacacaaaaattcgtttttatgggaccaccccccaaaaactgtatattttcaag
OVR01_0059_G04.b : gggaaaaggggggggccttttcggaaa
BFLT1_0003_G03.b : ccacgccgaaaaaaacagttcgttcttaaaggaaaacccccaaaaaagcttttaatttgc
OVRT1_0086_A09.b : aacattcttctttagggtaaccctcaaaaaacttttaattttaggaaaaaagggtatatt
OVRT1_0086_C02.b : gcagtcagtcttatggactacctccaaaaccgttgactgctaagaaaatatggtaaataa
OVR01_0061_F06.b : catttccgcgcaaaaccaaaaccgttcaattctttaggggactacctcccagaaaaaact
OVR01_0044_C03.b : aggggacacaaagggggggggcctttttcgggtataaagcattttttcccaccccccaaa
LVRM1_0004_E12.b :
PST01_0055_H02.b : tgagcatttcagcccagacaaaagcaggtcagttctttatgtgactacactccaaaaaga
OVRT1_0083_D01.b : cgccccaaccaaagcagtcagttctttatgggacaacctccaaaagaatgttaaacttgc
OVRT1_0032_C08.b : tcccccccaaccaaacagttcattcttaaggggcaccctcaaaaaaaggtttaacttgct
SMG01_0064_E12.b : ccgcccaaacaaaaacattccttctttatgggaccccccccaaaaagattgtaaatttct
OVRT1_0076_C04.b : cccaaccaaaacattctttttttagggactcacccagaaaacttttgattgctggaaaat
OVRM1_0062_G05.b :
OVR01_0070_E02.b : aaaaaaccctgggggtttatataacccccgccaccccccgggggaaacaaaggggggggg
UTR01_0038_C07.b :
BFLT1_0099_G03.b : catttccgcccaaacaaaacaattcatttcttaaggggataccctccaaaaaaccgtatg
OVR01_0095_B05.b : cagggggggggcctttcggaaagaacattttcccctcccaaaccacaaagagacgtccta
CBLT1_0035_F08.b : ttctagcccaaccaaaacgagttagtttttaagggaaccccctccgaaagagctgtttaa
OVR01_0011_A04.b : gtgggggggctttttcgggattgagccattttccccgccccccaaaccagaaaaaccaag
PST01_0014_H07.b : acatttcagcccagacagagcaggtcagttctttatggactacctcagaaagaatgttga
PST01_0018_B07.b : agcatttcagccacgacaaagcagttcagtttttaatgggactccctcagaagaactgta
CBLT1_0072_E01.b : catttcggcccaaccgaaaccattcatttttaatgggactacccccaaagagctgtagaa
SPL01_0101_A03.b : gagcatttcccgcccgaacaaaagcagttcaattccttaaggggctac
ADR01_0010_G12.b : cgatgaaccatttcaacccaaaccaaaacaattcaattcttttatgtgactaccctccaa
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b :
KDN01_0089_A04.b : ttaactttcctaggaaaccttatgattatataagggaaggccggaatactggaaaacctt
OVRM1_0056_H09.b :
ITT01_0049_H10.b : tgttgactttcctaggaaacttatggttaatattagggaaaggcttggaaatcttggaca
BFLT1_0101_F08.b : aattgaaacctgggcggggaacatttccccccaaaattcccggttggaaattctcttttc
BFLT1_0124_E10.b : tttctaggaaaaatttggatatatttggggaaggtcgggaatttgggaacaccctgggcg
BFLT1_0076_C08.b : gaaacttggattatatagggaagccgggatactggaaaaccctgagcgggaaaacctttc
OVR01_0059_G04.b :
BFLT1_0003_G03.b : taagaaacttatggattattatgggaaagtcgggaaaatggcaaacctttggggtggaga
OVRT1_0086_A09.b : tggaaaggttggaacctggaaacctttgatggggaacctttcccccccaaaaatttcccg
OVRT1_0086_C02.b : ggaaggtctgaatctggaaccttggacggggaacactttccccccaaaattccctggtta
OVR01_0061_F06.b : ttataactttctaggagaaaaaaa
OVR01_0044_C03.b : acacccaaaaaacaaatttttcaacatttttttttttaaatggggggaatcctcactccc
LVRM1_0004_E12.b :
PST01_0055_H02.b : ctgtatgattggctagggaaacttatggatgattattaggaaaagtcttggaatcttgga
OVRT1_0083_D01.b : taagaaacaatggattataaaagggaaggtcttgaatactgaaaaatttggacgtggaga
OVRT1_0032_C08.b : aggaaaattatggttaatttggggaaaggcggaaaaagggaaaacctggattggggaaac
SMG01_0064_E12.b : taggaaaaattgtgtgatgttgaggagaggcgcggaaattgggaacccctgtgggggggg
OVRT1_0076_C04.b : agggtatgtaaggggagggtggaaattggacaccttggaggggaacccttgtccgcccaa
OVRM1_0062_G05.b :
OVR01_0070_E02.b : gt
UTR01_0038_C07.b :
BFLT1_0099_G03.b : atttgctagggaacctttggataatttaggggaaggccggaaaacctgaaaaccctgggc
OVR01_0095_B05.b : ttctctttaaggtgaactctccctcccacaaaaagactctgttg
CBLT1_0035_F08.b : tttcctaggaaaattagtaataagatagaggaaagttcggaaaacgtggaaacccttggg
OVR01_0011_A04.b : gttttcaagtttcctttttaaattggggggaaactatacccccctccccccaaaaaaaaa
PST01_0014_H07.b : cttgctaagaaaatatggatgatataaggaagtccggaaactggcgaccctggaatgaag
PST01_0018_B07.b : tgatttgctaggaaacttatggatgatatgagggaaggtcggaaaactgaacacaccttg
CBLT1_0072_E01.b : tttgctaggaaactattgattattatggggaaggtctgaaatttggaacaccctggagcg
SPL01_0101_A03.b :
ADR01_0010_G12.b : aaagagctgtataactttgcctaaggaaaacttaatgaattataataaggaaaagtcctt
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b :
KDN01_0089_A04.b : tgggacttggaaacacctttcccgcaccaaaagattccctccggtttggaaaaatatttg
OVRM1_0056_H09.b :
ITT01_0049_H10.b : acccttggactggagggaaaccctttcccaccccaaaagattccctcgtggttttgaaaa
BFLT1_0101_F08.b : ctataacccacctctttgagagggggccctcttattaggggggtcttggttttttatccg
BFLT1_0124_E10.b : gggggaaacctctctcccaccaaaaaattctcccgggttgagaaaatattccttctcttt
BFLT1_0076_C08.b : ccccccaaattcccttggttggaaaaattttcctctttcaaatatacccaacctttttgg
OVR01_0059_G04.b :
BFLT1_0003_G03.b : cacctttctccccccaaaaaactccccctgttgggaaacattttccctctttctcaaaat
OVRT1_0086_A09.b : gttaaaaaaattcccccttttcaagtaacaccaacctttcctgagaaaggccctctcaaa
OVRT1_0086_C02.b : aaaatttttctcttccaaatgaacaaacccctttcgggaaggaacccctctatatggggg
OVR01_0061_F06.b :
OVR01_0044_C03.b : ccccccccccaaaaaagaaaaagaagaaagctg
LVRM1_0004_E12.b :
PST01_0055_H02.b : caacccttggactggaggaaacactttctccgcgcccaaagaacttccctccgggtttag
OVRT1_0083_D01.b : caacctttccacccccaagaaatcccccgggtaggaaaaaatctccctcctttccaatgt
OVRT1_0032_C08.b : ctcttccccccccaaagactcccccgggtagaaaaaaatcccttcttttccacaaaaaac
SMG01_0064_E12.b : aaaaccttctctcccccccaaaattccccccggttggaaaaaaattttgctcttttccca
OVRT1_0076_C04.b : aattcccctgttggaaaatttctccttttctatgaaccaaaccttttcggagagggacct
OVRM1_0062_G05.b :
OVR01_0070_E02.b :
UTR01_0038_C07.b :
BFLT1_0099_G03.b : tgggggaaaacatttccccccccagaaaattcccccgggttcggaaaaatatctcctctc
OVR01_0095_B05.b :
CBLT1_0035_F08.b : gtgggagaaaccgcttttccaccgccaaaaactcccccgggttcagaaaaaaattctctc
OVR01_0011_A04.b : aagaaagccttttttttattt
PST01_0014_H07.b : gaaccttatccacaccaaaaattccccggttcggaacaatctccctcctttcaaatgaac
PST01_0018_B07.b : acctgaggaacccttatcccacccaaagacccccctggtctggaaaattttggttctttc
CBLT1_0072_E01.b : ggggaaccctttctccccccaaagaactccccggggttaggaaaatcctcgcttcttccc
SPL01_0101_A03.b :
ADR01_0010_G12.b : gaaaaactggaaaaactctttgaactgggagaaaacccctagttccacaaccacaaaaaa
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b :
KDN01_0089_A04.b : cttcttttccaaaatatacccaaccctctttcttgtagaaaggaccc
OVRM1_0056_H09.b :
ITT01_0049_H10.b : aattttgttcccctttccccagtgtaaccccaaaccctctttcttgaacaaaaggaaccc
BFLT1_0101_F08.b : gccacgttctaaacccccggggtggccctttnaaatgaagggggtgttaataaaataaaa
BFLT1_0124_E10.b : caaaagaaaccacaacctcttttcttgaagggggacaccctccctcacaaaaggggaggc
BFLT1_0076_C08.b : atgaagggaccctctcccaaaagggtgggcttctgtaaatttttaaacccgtgttctctt
OVR01_0059_G04.b :
BFLT1_0003_G03.b : aactcagaaacctttttttgagagaaagaaccccctctcaaataaaggggagacctctcc
OVRT1_0086_A09.b : aaagggggagcctgtgtgatttctttccccccgcttcctttt
OVRT1_0086_C02.b : gtgccttggttttttttaacgcggtttcgttctaaaccccccggtgttttcttttaaat
OVR01_0061_F06.b :
OVR01_0044_C03.b :
LVRM1_0004_E12.b :
PST01_0055_H02.b : aacaaattttccctccctttccagatggaaccacaacccctttttccgggaagggaggga
OVRT1_0083_D01.b : aacacaaaccttttcctggagaagggaccccccctcaaaaagaggggaagcctctgtgga
OVRT1_0032_C08.b : cacaaccctcttcttggaaagaagagccccctcccactcacgg
SMG01_0064_E12.b : ataaacccaacccccttctgggggagggggaccccctcccacactcagggggaggccccg
OVRT1_0076_C04.b : tcttaataggggaggcatttgtattttttaaccccgtatcagacataaccccggggatat
OVRM1_0062_G05.b :
OVR01_0070_E02.b :
UTR01_0038_C07.b :
BFLT1_0099_G03.b : ttttcccataga
OVR01_0095_B05.b :
CBLT1_0035_F08.b : tttttcccatgttaacccagcaacccttttttctgtgagaggagaaacccctttattatt
OVR01_0011_A04.b :
PST01_0014_H07.b : caaacccctttctggagaaaggagccccttaaaataaaggggaggccttgtggattgttt
PST01_0018_B07.b : caaatgaaccaaaccccttctcggggagaaggaccccccccatattaaagggagcggctc
CBLT1_0072_E01.b : aattaaaccaaacccctttccgggaggaaagggaccccttccctattttgcgg
SPL01_0101_A03.b :
ADR01_0010_G12.b : tttccctccggggttcagaaaaaaaatttttttctttccttttcccaaagattaaaaccc
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b :
KDN01_0089_A04.b :
OVRM1_0056_H09.b :
ITT01_0049_H10.b : ctctctccctcaacggggtgcgccccc
BFLT1_0101_F08.b : aaacgccacctatataatctattcatttcgtannnnnnnnnn
BFLT1_0124_E10.b : gctttgtgtatatcttataacccgcccttctccctctcctttttctt
BFLT1_0076_C08.b : ccttta
OVR01_0059_G04.b :
BFLT1_0003_G03.b : gtccccttc
OVRT1_0086_A09.b :
OVRT1_0086_C02.b :
OVR01_0061_F06.b :
OVR01_0044_C03.b :
LVRM1_0004_E12.b :
PST01_0055_H02.b : gaccccctctctaattataaaggggaagcggttccgtggcccattctttaacac
OVRT1_0083_D01.b : attcttaacacggggggttctttgtcccttttgtc
OVRT1_0032_C08.b :
SMG01_0064_E12.b : ttgccactcttttaacccggcgc
OVRT1_0076_C04.b : accttctgtagaatgaagactgttaaaaattaaaagaaa
OVRM1_0062_G05.b :
OVR01_0070_E02.b :
UTR01_0038_C07.b :
BFLT1_0099_G03.b :
OVR01_0095_B05.b :
CBLT1_0035_F08.b : aaacgggggacccctccgggttcagattcttcaaaccc
OVR01_0011_A04.b :
PST01_0014_H07.b : taaaangcgggtttcgtgccttcttggcctataaccccgccgggtggaacctcttgtaaa
PST01_0018_B07.b : cgtacattgttttagagggcggatttcgcgtccctttcggcccataagggcccggcaggt
CBLT1_0072_E01.b :
SPL01_0101_A03.b :
ADR01_0010_G12.b : ccaaacccctttttacttgttaaacgaaaggaaaaccccctttttcaaaaaatttaacaa
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b :
KDN01_0089_A04.b :
OVRM1_0056_H09.b :
ITT01_0049_H10.b :
BFLT1_0101_F08.b :
BFLT1_0124_E10.b :
BFLT1_0076_C08.b :
OVR01_0059_G04.b :
BFLT1_0003_G03.b :
OVRT1_0086_A09.b :
OVRT1_0086_C02.b :
OVR01_0061_F06.b :
OVR01_0044_C03.b :
LVRM1_0004_E12.b :
PST01_0055_H02.b :
OVRT1_0083_D01.b :
OVRT1_0032_C08.b :
SMG01_0064_E12.b :
OVRT1_0076_C04.b :
OVRM1_0062_G05.b :
OVR01_0070_E02.b :
UTR01_0038_C07.b :
BFLT1_0099_G03.b :
OVR01_0095_B05.b :
CBLT1_0035_F08.b :
OVR01_0011_A04.b :
PST01_0014_H07.b : agaggaaaggtgaagatataaa
PST01_0018_B07.b : ttgaagcctcttttagagacttt
CBLT1_0072_E01.b :
SPL01_0101_A03.b :
ADR01_0010_G12.b : agggtgaacccgcctctccggtgtccacatttgctccttaaaaaacagctcgccgtgaat
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b :
KDN01_0089_A04.b :
OVRM1_0056_H09.b :
ITT01_0049_H10.b :
BFLT1_0101_F08.b :
BFLT1_0124_E10.b :
BFLT1_0076_C08.b :
OVR01_0059_G04.b :
BFLT1_0003_G03.b :
OVRT1_0086_A09.b :
OVRT1_0086_C02.b :
OVR01_0061_F06.b :
OVR01_0044_C03.b :
LVRM1_0004_E12.b :
PST01_0055_H02.b :
OVRT1_0083_D01.b :
OVRT1_0032_C08.b :
SMG01_0064_E12.b :
OVRT1_0076_C04.b :
OVRM1_0062_G05.b :
OVR01_0070_E02.b :
UTR01_0038_C07.b :
BFLT1_0099_G03.b :
OVR01_0095_B05.b :
CBLT1_0035_F08.b :
OVR01_0011_A04.b :
PST01_0014_H07.b :
PST01_0018_B07.b :
CBLT1_0072_E01.b :
SPL01_0101_A03.b :
ADR01_0010_G12.b : ttttccccgggttcccccactttttcaaggtgtccccaaataaaacagccccccccagtc
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b :
KDN01_0089_A04.b :
OVRM1_0056_H09.b :
ITT01_0049_H10.b :
BFLT1_0101_F08.b :
BFLT1_0124_E10.b :
BFLT1_0076_C08.b :
OVR01_0059_G04.b :
BFLT1_0003_G03.b :
OVRT1_0086_A09.b :
OVRT1_0086_C02.b :
OVR01_0061_F06.b :
OVR01_0044_C03.b :
LVRM1_0004_E12.b :
PST01_0055_H02.b :
OVRT1_0083_D01.b :
OVRT1_0032_C08.b :
SMG01_0064_E12.b :
OVRT1_0076_C04.b :
OVRM1_0062_G05.b :
OVR01_0070_E02.b :
UTR01_0038_C07.b :
BFLT1_0099_G03.b :
OVR01_0095_B05.b :
CBLT1_0035_F08.b :
OVR01_0011_A04.b :
PST01_0014_H07.b :
PST01_0018_B07.b :
CBLT1_0072_E01.b :
SPL01_0101_A03.b :
ADR01_0010_G12.b : caaacaggttttcccttgtaacaccccttctctcttttttacaggaaaaaaaaattttgt
20110601C-007782 : ............................................................
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0064_C11.b :
KDN01_0089_A04.b :
OVRM1_0056_H09.b :
ITT01_0049_H10.b :
BFLT1_0101_F08.b :
BFLT1_0124_E10.b :
BFLT1_0076_C08.b :
OVR01_0059_G04.b :
BFLT1_0003_G03.b :
OVRT1_0086_A09.b :
OVRT1_0086_C02.b :
OVR01_0061_F06.b :
OVR01_0044_C03.b :
LVRM1_0004_E12.b :
PST01_0055_H02.b :
OVRT1_0083_D01.b :
OVRT1_0032_C08.b :
SMG01_0064_E12.b :
OVRT1_0076_C04.b :
OVRM1_0062_G05.b :
OVR01_0070_E02.b :
UTR01_0038_C07.b :
BFLT1_0099_G03.b :
OVR01_0095_B05.b :
CBLT1_0035_F08.b :
OVR01_0011_A04.b :
PST01_0014_H07.b :
PST01_0018_B07.b :
CBLT1_0072_E01.b :
SPL01_0101_A03.b :
ADR01_0010_G12.b : tttaggagacctccccgggtgttgttttaaa