[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-008168

Length: 1,858

Sequence [FASTA format sequence]
GTCGGTGATG GAAGGAGAGC ACGTTCCAGG GCTTGGGCAA AGGAGAGGGA GGTGGCACGC
CCCTCGATTT CTCTATTTTA AGGTGGGGGG GGGCTGTCTT TGTGTAGGAA GGGCTTTCTG
GGCTCTCCCA CCCCTGTGGG AAGCGTTCCC CACCCACTCA CCATCTGCCG AGGGGCAGGA
CCTCAAGGGC AGGAGATCAA CGACTAAGGA CAGCGCTGGG CTTTCTGAAA AGAGTGGAGA
CGAAGGCCTC GGCCCTTCGG GGGATCTGAC TCAAGGCATC ACCCCGCCTC GCCGCCCCCA
GTCCCGGCGC TAAGACCCAG CGGGCACGCC TGGCAGGCCC CGGCCCCTGA GCCCGCCCGC
CTGCCCGCCC GCTGGGCCGG GACGCCTGCT TGGCCGGGGA GAGCCGGCCG GCGCGGAGGG
GGCATGGCTC GGACGGCGTG GGGGCTGCTG TGGCTGCTGC TGGGCAGCGC AGGGGCGCAG
TACGAGAAGT ACAGCTTCCG GGGCTTCCCG CCCGAGGACC TGATGCCCCT GGCCGCGGCC
TACGGGCACG CGCTGGAGCA GTACGAGGGC GAGAGCTGGC GCGAGAGCGC GCGCTACCTC
GAGGCGGCGC TGCGGCTGCA CCGGCTGCTG CGGGACAGCG AGGCCTTCTG CCACGCCAAC
TGCAGCGGCC CCGCGCCGCC CTCCGCCGCG ACCCCCGGGC CGGCGCCGCC CGACCCCGAC
GGCGGTCACG AAGACGAGTG GGCCCGCGAG CTGCAGCTCT TCGGCCACGT CCTGGAGCGC
GCCGCCTGCC TGCGGCGCTG CAAGCGTTCG CTGCCCGCCT TCCAGGTGCC CTACCCGCCG
CGCCAGCTGC TGCGCGACTT CCAGAGCCGC CTGCCCTACC AGTACTTGCA CTACGCGCAG
TTCAAGGCTA ACCGGCTGGA GAAGGCGGTG GCCGCGGCCT ACACCTTCCT CCAGAGGAAC
CCGAAGCACG AGCTCACCGC CAAGTACCTC AACTACTATC GGGGGCTGCT GGACGCCGCC
GAGGAGCCCC TCACGGACTT GGAGGCCCAG CCCTACGAGG CCGTGTTCCT CCGGGCTGTG
AAGCTCTACA ACAGCGGCGA TTTCCGCGGC AGCACGGAGG ACATGGAGCG GGCCCTGGCC
GAGTACCTGG CCGTCTTTGC CCGGTGTCTG GCTGGCTGCG AGGGGGCCCA CGAGCAGGTG
GACTTCAAGG ACTTCTATCC ATCCATAGCA GGTATCTCCT GAGCCAGATT CCGGTGGGCA
TCCCTCTCAG CCACAGGTCC CTGCTTCCCA GAACTCCTGC AGCTCCTTAA CACAACATTC
ATCAGGTACA CGATTATGGC GCACCTACTA AGTGCTTGGG AGGCAGACAG GAGGAAGGCG
TTATCCAGAC TCGCAGCGCT TTCAGTCTCC TGAGAGAGGC TAACAGATCA CCTGCCACTG
GGTGCAGAGG GCTACAGTGG GCAATGTCCA AGGTGCTGGG CATCAGTGCA GAGAGGATGT
GACACCCCAG AGGGGTCTGG GGAGCCTGGA TTCTCAGGTC TTCCAGGCTG AGGGTGCTTC
AGGTGCCAAG GTGCCAAGGT GAGAAACAGC CCAGCAGGTG TGCGCAGAAA GCAGTTTGTG
GCCAGAAATC ACCCCGAGTC TGGAGATCCC TCAGTTGGGG GAAAAAGGAC TGGCCTGAGC
TTCTTTATCT GGGCCTCAGT CCCACCTCCC AACCTCATCT GCCATTCCTT CAGAGTGCCC
TGGCTTCCTC TGGCTTCGGG GTGGCGGCTG AACTGTGGGG GTGGTCTGCC CAGCCCACCA
GTAGCTTCCC TCAGCATCGC TCGTCACTTT ATACGCCTTA TCGCATANGA TCAGCTGG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLEPREL4synaptonemal complex protein SC65 [Homo sapiens]. 419e-117O
Contig/Assembly ProteinCRTAPcartilage-associated protein precursor [Homo sapiens]. 2251e-58O
Contig/Assembly ProteinLEPRE1prolyl 3-hydroxylase 1 isoform 3 precursor [Homo sapiens]. 1104e-24O
Contig/Assembly ProteinLEPRE1prolyl 3-hydroxylase 1 isoform 1 precursor [Homo sapiens]. 1104e-24O
Contig/Assembly ProteinLEPRE1prolyl 3-hydroxylase 1 isoform 2 precursor [Homo sapiens]. 1104e-24O
Contig/Assembly ProteinLEPREL1prolyl 3-hydroxylase 2 isoform a [Homo sapiens]. 89.41e-17O
Contig/Assembly ProteinLOC100653071PREDICTED: cartilage-associated protein-like [Homo sapiens]. 80.55e-15O
Contig/Assembly ProteinLEPREL2prolyl 3-hydroxylase 3 precursor [Homo sapiens]. 77.44e-14O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLeprel4synaptonemal complex protein SC65 [Mus musculus]. 416e-116O
Contig/Assembly ProteinCrtapcartilage-associated protein precursor [Mus musculus]. 2272e-59O
Contig/Assembly ProteinLepre1prolyl 3-hydroxylase 1 isoform 2 [Mus musculus]. 1067e-23O
Contig/Assembly ProteinLepre1prolyl 3-hydroxylase 1 isoform 1 [Mus musculus]. 1067e-23O
Contig/Assembly ProteinLeprel1prolyl 3-hydroxylase 2 precursor [Mus musculus]. 91.72e-18O
Contig/Assembly ProteinLeprel2prolyl 3-hydroxylase 3 precursor [Mus musculus]. 65.12e-10O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC607731PREDICTED: similar to Nucleolar autoantigen No55 [Canis familiaris]. 424e-118O
Contig/Assembly ProteinLOC485577PREDICTED: similar to Cartilage-associated protein precursor [Canis familiaris]. 2282e-59O
Contig/Assembly ProteinLOC606980PREDICTED: similar to leprecan 1 [Canis familiaris]. 1081e-23O
Contig/Assembly ProteinLOC478674PREDICTED: similar to leprecan-like 1 isoform 1 [Canis familiaris]. 94.43e-19O
Contig/Assembly ProteinLOC486719PREDICTED: similar to leprecan-like 2 isoform 1 [Canis familiaris]. 622e-09
Contig/Assembly ProteinLOC486719PREDICTED: similar to leprecan-like 2 isoform 2 [Canis familiaris]. 55.12e-07O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC788823PREDICTED: synaptonemal complex protein SC65, partial [Bos taurus]. 2965e-80O
Contig/Assembly ProteinLOC788823PREDICTED: synaptonemal complex protein SC65-like, partial [Bos taurus]. 2664e-71O
Contig/Assembly ProteinCRTAPcartilage-associated protein [Bos taurus]. 2242e-58O
Contig/Assembly ProteinCRTAPPREDICTED: cartilage associated protein [Bos taurus]. 2242e-58O
Contig/Assembly ProteinLEPRE1prolyl 3-hydroxylase 1 [Bos taurus]. 1073e-23O
Contig/Assembly ProteinLEPREL1prolyl 3-hydroxylase 2 [Bos taurus]. 93.65e-19O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLEPREL4PREDICTED: synaptonemal complex protein SC65 [Sus scrofa]. 453e-127O
Contig/Assembly ProteinLOC100622574PREDICTED: cartilage-associated protein-like, partial [Sus scrofa]. 1072e-23O


Assembly Members: 15      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10069H12BFLT1_0069_H12.b  
CLNT10085E01CLNT1_0085_E01.bFS663177 
OVR010017A06OVR01_0017_A06.bBP141447 
OVR010037C03OVR01_0037_C03.bBP142233 
OVRM10013E11OVRM1_0013_E11.bBP150930 
OVRM10042A11OVRM1_0042_A11.bBP455407 
OVRM10062A03OVRM1_0062_A03.bBP145076 
OVRM10154D01OVRM1_0154_D01.bBP457503 
OVRT10037C12OVRT1_0037_C12.bFS689404 
OVRT10143E04OVRT1_0143_E04.bHX238281 
PST010019F02PST01_0019_F02.bFS698485 AK396384
PST010056B08PST01_0056_B08.bFS701243 
PST010063A01PST01_0063_A01.bFS701782 
PTG010076B05PTG01_0076_B05.bFS710831 
PTG010097C10PTG01_0097_C10.bFS712296 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
899A730.833WNCAG/Q
G200.167CGG/R


Alignment:      TOP

20110601C-008168 : .............GTCGGTGATGGAAGGAGAGCACGTTCCAGGGCTTGGGCAAAGGAGAG
---------+---------+---------+---------+---------+---------+ 47
PST01_0019_F02.b : gctctggagaggaGTCGGTGATGGAAGGAGAGCACGTTCCAGGGCTTGGGCAAAGGAGAG
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : GGAGGTGGCACGCCCCTCGATTTCTCTATTTTAAGGTGGGGGGGGGCTGTCTTTGTGTAG
---------+---------+---------+---------+---------+---------+ 107
PST01_0019_F02.b : GGAGGTGGCACGCCCCTCGATTTCTCTATTTTAAGGTGGGGGGGGGCTGTCTTTGTGTAG
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : GAAGGGCTTTCTGGGCTCTCCCACCCCTGTGGGAAGCGTTCCCCACCCACTCACCATCTG
---------+---------+---------+---------+---------+---------+ 167
PST01_0019_F02.b : GAAGGGCTTTCTGGGCTCTCCCACCCCTGTGGGAAGCGTTCCCCACCCACTCACCATCTG
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : CCGAGGGGCAGGACCTCAAGGGCAGGAGATCAACGACTAAGGACAGCGCTGGGCTTTCTG
---------+---------+---------+---------+---------+---------+ 227
PST01_0019_F02.b : CCGAGGGGCAGGACCTCAAGGGCAGGAGATCAACGACTAAGGACAGCGCTGGGCTTTCTG
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : AAAAGAGTGGAGACGAAGGCCTCGGCCCTTCGGGGGATCTGACTCAAGGCATCACCCCGC
---------+---------+---------+---------+---------+---------+ 287
PST01_0019_F02.b : AAAAGAGTGGAGACGAAGGCCTCGGCCCTTCGGGGGATCTGACTCAAGGCATCACCCCGC
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : CTCGCCGCCCCCAGTCCCGGCGCTAAGACCCAGCGGGCACGCCTGGCAGGCCCCGGCCCC
---------+---------+---------+---------+---------+---------+ 347
PST01_0019_F02.b : CTCGCCGCCCCCAGTCCCGGCGCTAAGACCCAGCGGGCACGCCTGGCAGGCCCCGGCCCC
OVRM1_0062_A03.b : cagttgacxxxxxxxxxxxxxxxxxxx
OVRM1_0154_D01.b : ncgttgtcxxxxxxxxxxx
PTG01_0076_B05.b : ctcatnnggctaaacaxxx
PTG01_0097_C10.b : nnggacgtaaca
BFLT1_0069_H12.b : nggacttccgtcgcgaacggaggxxx
OVRT1_0037_C12.b : ngggactccgttagcgnacgx
OVRT1_0143_E04.b : nnnttgcttcccnnnnnnccgtctagcgtangxxx
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : TGAGCCCGCCCGCCTGCCCGCCCGCTGGGCCGGGACGCCTGCTTGGCCGGGGAGAGCCGG
---------+---------+---------+---------+---------+---------+ 407
PST01_0019_F02.b : TGAGCCCGCCCGCCTGCCCGCCCGCTGGGCCGGGACGCCTGCTTGGCCGGGGAGAGCCGG
OVRM1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCCTGCTTGGCCGGGGAGAGCCGG
OVRM1_0154_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTGGCCGGGGAGAGCCGG
PTG01_0076_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTGGCCGGGGAGAGCCGG
PTG01_0097_C10.b : gctggtcggntccgaaxxxxxxxxxxxxxxxxxxxxxxxxxtTTGGCCGGGGAGAGCCGG
BFLT1_0069_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgccgcttaGGGAGAGCCGG
OVRT1_0037_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcttAGAGCCGG
OVRT1_0143_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCCGG
PST01_0063_A01.b : ncc
OVRM1_0013_E11.b : agttcgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
---------+---------+---------+---------+---------+---------+ 467
PST01_0019_F02.b : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
OVRM1_0062_A03.b : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
OVRM1_0154_D01.b : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
PTG01_0076_B05.b : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
PTG01_0097_C10.b : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
BFLT1_0069_H12.b : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
OVRT1_0037_C12.b : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
OVRT1_0143_E04.b : CCGGCGCGGAGGGGGCATGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
PST01_0063_A01.b : gcgttggctggaGGGGCTGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
OVRM1_0013_E11.b : xxxxxxxxxxxxxxxxxTGGCTCGGACGGCGTGGGGGCTGCTGTGGCTGCTGCTGGGCAG
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
---------+---------+---------+---------+---------+---------+ 527
PST01_0019_F02.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
OVRM1_0062_A03.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
OVRM1_0154_D01.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
PTG01_0076_B05.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
PTG01_0097_C10.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
BFLT1_0069_H12.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
OVRT1_0037_C12.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
OVRT1_0143_E04.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
PST01_0063_A01.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
OVRM1_0013_E11.b : CGCAGGGGCGCAGTACGAGAAGTACAGCTTCCGGGGCTTCCCGCCCGAGGACCTGATGCC
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b :
20110601C-008168 : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
---------+---------+---------+---------+---------+---------+ 587
PST01_0019_F02.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
OVRM1_0062_A03.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
OVRM1_0154_D01.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
PTG01_0076_B05.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
PTG01_0097_C10.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
BFLT1_0069_H12.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
OVRT1_0037_C12.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
OVRT1_0143_E04.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
PST01_0063_A01.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
OVRM1_0013_E11.b : CCTGGCCGCGGCCTACGGGCACGCGCTGGAGCAGTACGAGGGCGAGAGCTGGCGCGAGAG
OVRM1_0042_A11.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0017_A06.b : tgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0037_C03.b : cggggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0085_E01.b : tgattacgttagcgnacgxxxx
PST01_0056_B08.b :
20110601C-008168 : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
---------+---------+---------+---------+---------+---------+ 647
PST01_0019_F02.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
OVRM1_0062_A03.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
OVRM1_0154_D01.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
PTG01_0076_B05.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
PTG01_0097_C10.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
BFLT1_0069_H12.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
OVRT1_0037_C12.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
OVRT1_0143_E04.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
PST01_0063_A01.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
OVRM1_0013_E11.b : CGCGCGCTACCTCGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
OVRM1_0042_A11.b : xxxxxxxxxccttGAGGCGGCGCTGCGGCTGCACCGGCTGCTGCGGGACAGCGAGGCCTT
OVR01_0017_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGGCTGCTGCGGGACAGCGAGGCCTT
OVR01_0037_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCGAGGCCTT
CLNT1_0085_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGAGGCCTT
PST01_0056_B08.b :
20110601C-008168 : CTGCCACGCCAACTGCAGCGGCCCCGCGCCGCCCTCCGCCGCGACCCCCGGGCCGGCGCC
---------+---------+---------+---------+---------+---------+ 707
PST01_0019_F02.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
OVRM1_0062_A03.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
OVRM1_0154_D01.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
PTG01_0076_B05.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
PTG01_0097_C10.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
BFLT1_0069_H12.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
OVRT1_0037_C12.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
OVRT1_0143_E04.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
PST01_0063_A01.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
OVRM1_0013_E11.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
OVRM1_0042_A11.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
OVR01_0017_A06.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
OVR01_0037_C03.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
CLNT1_0085_E01.b : CTGCCACGCCAACTGCAgcggccccgcgccgccctccgccgcgacccccgggccggcgcc
PST01_0056_B08.b :
20110601C-008168 : GCCCGACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
---------+---------+---------+---------+---------+---------+ 767
PST01_0019_F02.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
OVRM1_0062_A03.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
OVRM1_0154_D01.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
PTG01_0076_B05.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
PTG01_0097_C10.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
BFLT1_0069_H12.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
OVRT1_0037_C12.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
OVRT1_0143_E04.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
PST01_0063_A01.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
OVRM1_0013_E11.b : gcccgACCCCGACGGCGGTCACTAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
OVRM1_0042_A11.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
OVR01_0017_A06.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
OVR01_0037_C03.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
CLNT1_0085_E01.b : gcccgACCCCGACGGCGGTCACGAAGACGAGTGGGCCCGCGAGCTGCAGCTCTTCGGCCA
PST01_0056_B08.b :
20110601C-008168 : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
---------+---------+---------+---------+---------+---------+ 827
PST01_0019_F02.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAG*T
OVRM1_0062_A03.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
OVRM1_0154_D01.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
PTG01_0076_B05.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
PTG01_0097_C10.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
BFLT1_0069_H12.b : CGTCCTGAAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
OVRT1_0037_C12.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
OVRT1_0143_E04.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
PST01_0063_A01.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
OVRM1_0013_E11.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
OVRM1_0042_A11.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
OVR01_0017_A06.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
OVR01_0037_C03.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
CLNT1_0085_E01.b : CGTCCTGGAGCGCGCCGCCTGCCTGCGGCGCTGCAAGCGTTCGCTGCCCGCCTTCCAGGT
PST01_0056_B08.b :
20110601C-008168 : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
---------+---------+---------+---------+---------+---------+ 887
PST01_0019_F02.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCA*AGCCGCCTGCCCTACCAGTACTT
OVRM1_0062_A03.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
OVRM1_0154_D01.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
PTG01_0076_B05.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
PTG01_0097_C10.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
BFLT1_0069_H12.b : GCCCTGCCCGCCGCGCTAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAATACTT
OVRT1_0037_C12.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
OVRT1_0143_E04.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
PST01_0063_A01.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
OVRM1_0013_E11.b : GCCCTACCCGCCGCGCCAGATGCTGAGCGACTTCCAGAGCCGCCTGTCCTACCAGTACTT
OVRM1_0042_A11.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
OVR01_0017_A06.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
OVR01_0037_C03.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
CLNT1_0085_E01.b : GCCCTACCCGCCGCGCCAGCTGCTGCGCGACTTCCAGAGCCGCCTGCCCTACCAGTACTT
PST01_0056_B08.b : nnnggtggctgtggctctgg
20110601C-008168 : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
---------+---------+---------+---------+---------+---------+ 946
PST01_0019_F02.b : GCACTACGCGCAGTTCAAGGCTA*CCGGCTGGGAAAAGCGGTGGCCGCGGGCTACACC*T
OVRM1_0062_A03.b : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
OVRM1_0154_D01.b : GCGCTACGCGCAGTTCAAGGCTAACCGGCTGGGAGAAGCGGTGGCCGCGGCCTACACC*T
PTG01_0076_B05.b : GCACTACGCGCAGTTTAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
PTG01_0097_C10.b : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
BFLT1_0069_H12.b : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACCTT
OVRT1_0037_C12.b : GCACTACGCGCGGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
OVRT1_0143_E04.b : GCACTACGCGCGGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
PST01_0063_A01.b : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
OVRM1_0013_E11.b : GCACTACGCGCAGTTTAAGGCTAACCGGCTTGAGAAGGCTGTGGACGCGGACTACACC*T
OVRM1_0042_A11.b : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
OVR01_0017_A06.b : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
OVR01_0037_C03.b : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
CLNT1_0085_E01.b : GCACTACGCGCAGTTCAAGGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
PST01_0056_B08.b : GCACTACGCGCAGTTCA*GGCTAACCGGCTGGAGAAGGCGGTGGCCGCGGCCTACACC*T
20110601C-008168 : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
---------+---------+---------+---------+---------+---------+ 1005
PST01_0019_F02.b : TCCTCCgaagaacccgaacacgaactccccgccaatacctccactactatcggggctgct
OVRM1_0062_A03.b : TCCTCCGGAGGAACCCGAAGCACGAGCTCACCGCCNAGTCACTCAACTACCATCGGGGGG
OVRM1_0154_D01.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
PTG01_0076_B05.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCNAGTACCTCAACTACTATCGGGGG*
PTG01_0097_C10.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
BFLT1_0069_H12.b : TCCTCCATAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGTGGG*
OVRT1_0037_C12.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
OVRT1_0143_E04.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
PST01_0063_A01.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
OVRM1_0013_E11.b : TCCTCCAGAGGAACCCTAAGCACtgatctcaccggcaagtaccttcatctactatccggg
OVRM1_0042_A11.b : TCCTCCAGAAGAACCCTAAGCCCGAGCTCACCGCCAAGTACATCAACTACTATCGGGGG*
OVR01_0017_A06.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
OVR01_0037_C03.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
CLNT1_0085_E01.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
PST01_0056_B08.b : TCCTCCAGAGGAACCCGAAGCACGAGCTCACCGCCAAGTACCTCAACTACTATCGGGGG*
20110601C-008168 : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGG*CCGT
---------+---------+---------+---------+---------+---------+ 1064
PST01_0019_F02.b : ggaacccccaagaaaccctccaggacttgaagcccaaccctacgaggcgggtcccccggg
OVRM1_0062_A03.b : CTGCTGGACGCCGCCCAGGAGCCCCTCACGGACTTGGAGGCCCAGTCCTACCAGG*CCGT
OVRM1_0154_D01.b : CTGCTGGACGCCGCCGAGGAGCCCCCCACGGACTGGGAGGCCCAGCCCTACGAGGGCCGT
PTG01_0076_B05.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGG*CCGT
PTG01_0097_C10.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGGCCGTG
BFLT1_0069_H12.b : CTGCTGGACGCCGCCCAGGAGCCCCTCCCGGACTTGGATGCCCAGCCCTACTAGGCCATG
OVRT1_0037_C12.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGG*CCGT
OVRT1_0143_E04.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGG*CCGT
PST01_0063_A01.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGG*CCGT
OVRM1_0013_E11.b : cgctggtggacgccagccgaggagccccttatggtcttggaggcccatttctacgtagcc
OVRM1_0042_A11.b : CTGCTGGACTACGCCCAGTAGCCCCCCAAGGACTTGGAcggacgacgcaacgatactgtg
OVR01_0017_A06.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGG*CCGT
OVR01_0037_C03.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCCACGAGG*CCGT
CLNT1_0085_E01.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGG*CCGT
PST01_0056_B08.b : CTGCTGGACGCCGCCGAGGAGCCCCTCACGGACTTGGAGGCCCAGCCCTACGAGG*CCGT
20110601C-008168 : GTTCCTCCGGGCTGTGAAGCTCTACAACAGCGGCGATTTCCGCGGCAGCACGGAGGACAT
---------+---------+---------+---------+---------+---------+ 1124
PST01_0019_F02.b : gttggaagctctaacagcggcaatttccccggcacccgaagaaatgaacgggccctggcc
OVRM1_0062_A03.b : GTTCCTCCCGGCTGTGAAGCTCTACTACAGCGGCAATTTCgcggcaggacgaaggactgg
OVRM1_0154_D01.b : GTTCCTCCGGGCTGTGAAGCTCTtacacagcgga
PTG01_0076_B05.b : GTTCCTCCGGGCTGTGAAGCTCTANCACAGCGGCGATTTCGGCGGCAGCACGGAGGACAT
PTG01_0097_C10.b : TTTCTTCGGGGCTGTGAAGCTCTACAACAGCGGCGATTTCCGCGGCAGCACGGAGGACAT
BFLT1_0069_H12.b : TTCCCTCCGGACTGTGAAACTCTACAACAGCGTAGATTTCCGCttcaccacggaagaaat
OVRT1_0037_C12.b : GTTCCTCCGGGCTGTGAAGCTCTACAACAGCGGCGATTTCCGCGGCAGCACGGAGGACAT
OVRT1_0143_E04.b : GTTCCTCCGGGCTGTGAAACTCTACAACAGCGGGGATTTCCGCGGGCACCCGGAAGAATG
PST01_0063_A01.b : GTTCCTCCGGGCTGTGAAGCTCTACAACAGCGGCGATTTCCGCGGCAGCACGGAGGACAT
OVRM1_0013_E11.b : tgtgttcttcggagtgagagcgtgtacacagtggcgcactccgcgcgctctcggcagatc
OVRM1_0042_A11.b : ctcctcccggtgcggaccttaccatccgggccaaatatctcgggcgaaatgcaaaactcg
OVR01_0017_A06.b : GTTCCTCCGGGCTGTGAAGCTCTACAACAGCGGCGATTTCCGCGGCAGCACGGAGGACAT
OVR01_0037_C03.b : GTTCCTCCGGGCTGTGAAGCTCTACAACAGCGGCGATTTCCGCGGCAGCACGGAGGACAT
CLNT1_0085_E01.b : GTTCCTCCGGGCTGTGAAGCTCTACAACAGCGGCGATTTCCGCGGCAGCACGGAGGACAT
PST01_0056_B08.b : GTTCCTCCGGGCTGTGAAGCTCTACAACAGCGGCGATTTCCGCGGCAGCACGGAGGACAT
20110601C-008168 : GGAGCGGGCCCTGGCCGAGTACCTGGCCG*TCTTTGCCCGGTGTCTGGCTGGCTGCGAGG
---------+---------+---------+---------+---------+---------+ 1183
PST01_0019_F02.b : aatacctggcctctttcccgggttcggctgcttcaagggcccccaaaaggggatttaggg
OVRM1_0062_A03.b : agcgggcctggc
OVRM1_0154_D01.b :
PTG01_0076_B05.b : GGAGCGGGCCCTGGCCGAGTACCTGGCCGTTCTTTGCCCGGTGTCTGGCTGGCTGCNAGG
PTG01_0097_C10.b : GGAGCGGGCCCTGGCCGAGTACCTGGCCC*TCTTTGCCCCGTGTCTGGCTGGCTGCAAGG
BFLT1_0069_H12.b : tgtaacgggcccctgccaaatacctggccttcttttccccggtgtctgggctggctgcca
OVRT1_0037_C12.b : GGAACGGGCCCTGGCCGAGTACCTGGCCG*TCTTTGCCCGGTGTCTGGCTGGCTGCCAGG
OVRT1_0143_E04.b : GAACCGGGCCCTGGCCGAGTACCTGGCCG*TCTTTGCCCAGTGTCTGGCTGGCTGCCAGG
PST01_0063_A01.b : GGAGCGGGCCCTGGCCGAGTACCTGGCCG*TCTTTGCCCGGTGTCTGGCTGGCTGCGAGG
OVRM1_0013_E11.b : ttgaagagtgctctagaccgagccccaggccagatttcgcctgcgtatggaggacgata
OVRM1_0042_A11.b : cgagaatcacgcatgacgtcgtatacatatactccgataatgctaacttcgacatctcct
OVR01_0017_A06.b : GGAGCGGGCCCTGGCCGAGTACCTGGCCG*TCTTTGCCCGGTGTCTGGCTGGCTGCGAGG
OVR01_0037_C03.b : GGAGCGGGCCCTGGCCGAGTACCTGGCCG*TCTTTGCCCGGTGTCTGGCTGGCTGCGAGG
CLNT1_0085_E01.b : GGAGCGGGCCCTGGCCGAGTACCTGGCCG*TCTTTGCCCGGTGTCTGGCTGGCTGCGAGG
PST01_0056_B08.b : GGAGCGGGCCCTGGCCGAGTACCTGGCCG*TCTTTGCCCGGTGTCTGGCTGGCTGCGAGG
20110601C-008168 : GGGCCCACGAGCAGGTGGACTTCAAGGACTTCTATCCATCCATAGCAGGTATCTCCTGAG
---------+---------+---------+---------+---------+---------+ 1243
PST01_0019_F02.b : cttatcctccataaaaactttccccaacccggcggggggggaacgggaacccttccccca
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : GGGCCCCCAACCAGGGGGACTTCAggaactctatcaattcataacaaaatctctcgccaa
PTG01_0097_C10.b : GGGCCCACGAGCAAGTGGACTTCAGGGACTTCTATCattcataacagatctcttcgccaa
BFLT1_0069_H12.b : aggggccccctaagcaagtgggacttcaagggaatttctatccctccaatgctagtaaac
OVRT1_0037_C12.b : GGGCCCACAAGCAGGTGGACTTCCAGGATTTCTATCCATCCATAGCAGGTATCTCCTGAA
OVRT1_0143_E04.b : GGGCCCACCAACAAGTGGACTCCAAGGACTTCTtccctcctatgagggatcctctgaccc
PST01_0063_A01.b : GGGCCCACGAGCAGGTGGACTTCAAGGACTTCTATCCATCCATAGCAGGTATCTCCTGAG
OVRM1_0013_E11.b :
OVRM1_0042_A11.b : tcctatcactgactatataaacccattctaaagttgcatattacaattacaaccgaataa
OVR01_0017_A06.b : GGGCCCACGAGCAGGTGGACTTCAAGGACTTCTATCCATCCATAGCAGGTATCTCCTGAG
OVR01_0037_C03.b : GGGCCCACGAGCAGGTGGACTTCAAGGACTTCTATCCATCCAAAGCAGGTATCTCCTGAG
CLNT1_0085_E01.b : GGGCCCACGAGCAGGTGGACTTCAAGGACTTCTATCCATCCATAGCAGGTATCTCCTGAG
PST01_0056_B08.b : GGGCCCACGAGCAGGTGGACTTCAAGGACTTCTATCCATCCATAGCAGGTATCTCCTGAG
20110601C-008168 : CCAGATTCCGGTGGGCA*TCCCTCTCAGCCACAGGTCCCTGCTTCCCAGAACTCCTGCAG
---------+---------+---------+---------+---------+---------+ 1302
PST01_0019_F02.b : cggggggtctcctggaaaatgggcccaataccaaccggatgcccaaaagtaaaagggccg
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : atcctgcnatggaaggtggactgtaaaacaacttgacccccaacgggggtgctacttctg
PTG01_0097_C10.b : tccctgcaatgcaaggtggaatgggaaaccaacttggacccccacggggggtgccacttc
BFLT1_0069_H12.b : tcccggaaccctattcctgtgggcatcccctctcataaacaaggccctagctttccccaa
OVRT1_0037_C12.b : CCAAGATCCGGGTGGCATTCCCTCTTAGCCCAAGGTCCCTGCTTCCCAAAACTCCGGCAG
OVRT1_0143_E04.b : aaattcggtgggctccctctcaccaaagggcctttttcccaaattctgggcttcttaaca
PST01_0063_A01.b : CCAGATTCCGGTGGGCA*TCCCTCTCAGCCACAGGGTCCTGCTTCCCAGAACTCCTGCAG
OVRM1_0013_E11.b :
OVRM1_0042_A11.b : tatctccgctaatgcggctacgtttccaatataaatatagtccgcactgatatataatat
OVR01_0017_A06.b : CCAGATTCCGGTGGGCA*TCCCTCTCAGCCACAGGTCCCTGCTTCCCAGAACTCCTGCAG
OVR01_0037_C03.b : CCAGATTCCGGTGGGCA*TCCCTCTCAGCCACAGGTCCCTGCTTCCCAGAACTCCTGCAG
CLNT1_0085_E01.b : CCAGATTCCGGTGGGCA*TCCCTCTCAGCCACAGGTCCCTGCTTCCCAGAACTCCTGCAG
PST01_0056_B08.b : CCAGATTCCGGTGGGCA*TCCCTCTCAGCCACAGGTCCCTGCTTCCCAGAACTCCTGCAG
20110601C-008168 : CTCCTTAACACAACATTCATCAGGTACACGATTATGGCGCACCTACTAAGTGCTTGGGAG
---------+---------+---------+---------+---------+---------+ 1362
PST01_0019_F02.b : gcgcgggggccccattgtttccccgaagggagaaaccgggttcc
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : ggaaaaattccgtggccccatgtaccataaccggcatttggctaataaattttaaacaaa
PTG01_0097_C10.b : ctggaaaaattctgggcccccaggtaccactacgggcgtttgcctataaaagttgaaagc
BFLT1_0069_H12.b : aatactggagattcctttatatcaacatttactaggtaacccaattatggggtcacccaa
OVRT1_0037_C12.b : CTCTTTAAaacacattctttcgggtacccaatttatgcgcacctactaaatgctttggaa
OVRT1_0143_E04.b : atattcttcggaacttttttgccccctactatttttgggaggcaacagagaggtctttcc
PST01_0063_A01.b : CTCCTTAACACAACATTCATCAGGTACACGATTATGGCGCACCTACTAAGTGCTTGGGAG
OVRM1_0013_E11.b :
OVRM1_0042_A11.b : ctaccccacaacaacataataattcccttgtattaattttttttaa
OVR01_0017_A06.b : CTCCTTAACACAACATTCATCAGGTACACGATTATGGCGCACCTACTAAGTGCTTGGGAG
OVR01_0037_C03.b : CTCCTTAACACAACATTCATCAGGTACACGATTATGGCGCACCTACTAAGTGCTTGGGAG
CLNT1_0085_E01.b : CTCCTTAACACAACATTCATCAGGTACACGATTATGGCGCACCTACTAAGTGCTTGGGAG
PST01_0056_B08.b : CTCCTTAACACAACATTCATCAGGTACACGATTATGGCGCACCTACTAAGTGCTTGGGAG
20110601C-008168 : GCAGACAGGAGGAAGGCGTTATCCAGACTCGCAGCGCTTTCAGTCTCC*TGAGAGAGGCT
---------+---------+---------+---------+---------+---------+ 1421
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : gggcccaggcccccccaatgccccccattaattgtttttcaaacctgaaaaaggtggagc
PTG01_0097_C10.b : aatggccccagcccccgccaaggcccccgctaattgtctttcacccggaaaaagggtggt
BFLT1_0069_H12.b : taaattgtctcggtaactcaaaaacgaaaataaggttttttccaattatttcccccctat
OVRT1_0037_C12.b : ggcaaacaggaggaaaggctttatccaaaatcccggcgctttttttatctggaaaagggt
OVRT1_0143_E04.b : gaccccgcctttccttctgggaaagataaaaatccctcctgggggagaggctcatgggaa
PST01_0063_A01.b : GCAGACAGGAGGAAGGCGTTATCCAGACTCGCAGCGCTTTCATTCTCC*TGAGAGAGGCT
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b : GCAGACAGGAGGAAGGCGTTATCCAGACTCGCAGCGCTTTCAGTCTCC*TGAGAGAGGCT
OVR01_0037_C03.b : GCAGACAGGAGGAAGGCGTTATCCAGACTCGCAGCGCTTTCAGTCTCCCTGAGAGAGGCT
CLNT1_0085_E01.b : GCAGACAGGAGGAAGGCGTTATCCAGACTCGCAGCGCTTTCAGTCTCC*TGAGAGAGGCT
PST01_0056_B08.b : GCAGACAGGAGGAAGGCGTTATCCAGACTCGCAGCGCTTTCAGTCTCC*TGAGAGAGGCT
20110601C-008168 : AACAGATCACCTGCCACTGGGTGCAGAGGGCTACAGTGGGCAATGTCCAAGGTGCTGGGC
---------+---------+---------+---------+---------+---------+ 1481
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : cccaaaacctggggtttcccctttcccaaacttcccggggccctgggagaaagaatttcc
PTG01_0097_C10.b : gcacaaacccggtgtttaccgtttcccaaaattccgggggccgggggaaggggactcccc
BFLT1_0069_H12.b : ttaattctccttgaaaaatagctaaccaaaaaaccctgcccctttcgtctctaatggcca
OVRT1_0037_C12.b : taaaaatcccctgccacggggtgcaaagggctaccgggggacgtgcccaagtggctggcc
OVRT1_0143_E04.b : attcagaggcaggctccctgcaagggaatacccccgaggggggggcgagctctcttcttc
PST01_0063_A01.b : AACAGATCACCTGGCACTGGGggcaaagaggctaaggtgggcaaggtccaaggtgcgggg
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b : AACAGATCACCTGCCACTGGGTGCAGAGGGCTACAGTGGGCAATGTCCAAGGTGCTGGGC
OVR01_0037_C03.b : AACAGATCACCTGCCACTGGGTGCAGAGGGCTACAGTGGGCATTGGTCCAAGTGCTGGGC
CLNT1_0085_E01.b : AACAGATCACCTGCCACTGGGTGCAGAGGGCTACAGTGGGCAATGTCCAAGGTGCTGGGC
PST01_0056_B08.b : AACAGATCACCTGCCACTGGGTGCAGAGGGCTACAGTGGGCAATGTCCAAGGTGCTGGGC
20110601C-008168 : ATCAGTGCAGAGAGGATGTGACACCCCAGAGGGGTCTGGGGAGCCTGGATTCTCAGGTCT
---------+---------+---------+---------+---------+---------+ 1541
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : ccccccaaagaggggcgtttttccccaaccaaaacccaaagggggggagggggaattttc
PTG01_0097_C10.b : cccaaaagaaggggttttcttccaaaccaaaacccaaattgggggatgggggttttcccc
BFLT1_0069_H12.b : atagtggtacaacgttcaaagggttcgggctcactcgtgcaaaaacgatgtgttacacct
OVRT1_0037_C12.b : attcttgcaaaaggatagtgaaccccccaagggtttgggggaacctggttttccaggttc
OVRT1_0143_E04.b : tccagggtctccgctcggcgtaataaaccccccagcgcaaatatttgttcacccccatgg
PST01_0063_A01.b : catccntgcaaagaggatggaccccccaaaagggtccgggggagccggaatctccagcct
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b : ATCAGTGCAGAGAGGATGTGACACCCCAAAGGGGTCTGGGGAGCCTGGATTCTCAGGTCT
OVR01_0037_C03.b : ATCAgtgcagagaggatgtgacaccccagagggggtctggggaacctgggattctcaggg
CLNT1_0085_E01.b : ATCAatgcaaagaggatgtgacaccccagaaggggtctggggagcctggattctcaggtc
PST01_0056_B08.b : ATCAGTGCAGAGAGGATGTGACACCCCAGAGGGGTCTGGGGAGCCTGGATTCTCAGGTCT
20110601C-008168 : TCCAGGCTGAGGGTGCTTCAGGTGCCAAGGTGCCAA*GGTGAGAAACAGCCCAGCAGGTG
---------+---------+---------+---------+---------+---------+ 1600
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : cccattctccgcgcccaaagaaaaagggagcggggaaacaaacccccgggggccggagac
PTG01_0097_C10.b : agttcccggaccaaagaaaaggggggggggaaccaaaaccccccggggcgggaccccctc
BFLT1_0069_H12.b : ccttaggtgcttgggtatacttgaaatcttctggtttctctcatttaaaggtcccttacg
OVRT1_0037_C12.b : tccgccataaggttctcttgggccaaaggttccaaggtgaaaaccccccccgggggtgcc
OVRT1_0143_E04.b : accctggggaagaaggagttattatctcataggactattaaagaggactattgtggggtg
PST01_0063_A01.b : tccagctgaggggcttccagggccaggggccagggggagaaccccccccgggggtgcccg
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b : TCCAGGCTGAGGGTGCTTCAGGTGGCAAGGTGCCAAAGGTGAGAAACAGCCCAGCAGGTG
OVR01_0037_C03.b : tcttccaggttgaagggggctttcaggtgccaagggggccaaggtggagaaaacagccca
CLNT1_0085_E01.b : tcccaggctgagggtgcttcaggtgcccaggtggccaagtgagaaaacgcccaacaggtg
PST01_0056_B08.b : TCCAGGCTGAGGGTGCTTCAGGTGCCAAGGTGCCAA*GGTGAGAAACAGCCCAGCAGGTG
20110601C-008168 : TGCGCAGAAAGCAGTTTGTGGCCAGAAATCACCCCGAGTCTGGAGATCCCTCAGTTGGGG
---------+---------+---------+---------+---------+---------+ 1660
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : cccctttgtgccttttttagggggggcaacaaaaaaatctcttcccgggggggggccccc
PTG01_0097_C10.b : ttgggcattttgggggagggccaacaagaaatcctctcccgggtgggggcgccccccggt
BFLT1_0069_H12.b : ggtccacgttttcgctgatataataattcgcaataactgtgttgccacaataaatttttg
OVRT1_0037_C12.b : aaaacaatttgtgtgcgaaaaaacaccccatggggagacctctcttgggggaaaaaaagc
OVRT1_0143_E04.b : gaagattctnctaaatacaccattcgngagannnnnnntcgctcaccaagtacggccgcg
PST01_0063_A01.b : aaaccatttgtggccaaaatcccccaatctgggaaccccccttggaggaaaaagcatggc
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b : TGCGCAAAAAGCAGTTTGTGGCCGGAAATCACCCCcaagttctggaaattccctcagttg
OVR01_0037_C03.b : gcagggtgtggcgcaaaaaagcaattttgggggccccaaaaattccccccgagattcggg
CLNT1_0085_E01.b : tgcgcaaaagcagtttggggccgaaaatcaccccgagtcgggaatccctcattgggggga
PST01_0056_B08.b : TGCGCAGAAAGCAGTTTGTGGCCAGAAATCACCCCGAGTCTGGAGATCCCTCAGTTGGGG
20110601C-008168 : GAAAAAGGACTGGCCTGAGCTTCTTTATCTGGGCCTCAGTCCCACCTCCCAACCTCATCT
---------+---------+---------+---------+---------+---------+ 1720
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : cccggtgtgagggtgtccccccccccctccccctaaaaagggggtaattttggttcccga
PTG01_0097_C10.b : ggagaggttaccccccctcctcctcctaaaaagggggaaatttagatccgccgggccacc
BFLT1_0069_H12.b : tgggacaaaaccctcccctcctgtaacgtattcctctagagaaa
OVRT1_0037_C12.b : gctgactctttattggcgcaccccccccn
OVRT1_0143_E04.b : acccc
PST01_0063_A01.b : ggactttttttttgggccctacccacccccacctatttggattcttaaaagggcgggttc
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b : ggggggaaaaaggggattgggcctggacctttttttttttttgggggccttcagttcccc
OVR01_0037_C03.b : agaatcccttcagtttgggggggaaaaagggaatggggcctggagctttttttttttttg
CLNT1_0085_E01.b : aaagggctggccggacttctttatctgggcccaatcccccctcaaacctttttggcattc
PST01_0056_B08.b : GAAAAAGGACTGGCCTGAGCTTCTTTATCTGGGCCTCAGTCCCACCTCCCAACCTCATCT
20110601C-008168 : GCCATTCCTTCAGAGTGCCCTGGCTTCCTCTGGCTTCGGGGTGGCGGCTGAACTGTGGGG
---------+---------+---------+---------+---------+---------+ 1780
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : cccccccccccggggggaaaatatatattgtaagggggagaggccccccccggggggggc
PTG01_0097_C10.b : ccgcggggggaaatttttatttggggggggggggccccctcctcggtggcgccaccctcc
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b : cttggtttgggtggcgcgaacaggg
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b : cccttcccccaacccccctttttggccctttttcctttttaaaaaggtggccccttgggg
OVR01_0037_C03.b : ggggcccttcactccccccccttcccccacccctcctttttgccccctttttctctttcc
CLNT1_0085_E01.b : ctttaaaggcccggcttcctcggccccgggggggcgcgaactgtggggggtctgcccacc
PST01_0056_B08.b : GCCATTCCTTCAGAGTGCCCTGGCTTCCTCTGGCTTCGGGGTGGCGGCTGAACTGTGGGG
20110601C-008168 : GTGGTCTGCCCAGCCCACCAGTAGCTTCCCTCAGCATCGCTCGTCACTTTATACGCCTTA
---------+---------+---------+---------+---------+---------+ 1840
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b : cccccctccttgtaggaaaaacacccccgccccacagataaaaat
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b : ctttttcccctttcgtggggctttttcttggggggggggggggggggggcggggg
OVR01_0037_C03.b : aaaaagggggcccccggggctttttttcctcctgtgggggtttttttttcgggtgggtgg
CLNT1_0085_E01.b : cccataaactcccccaatgcgccgcccttttacccttacgcaaaaacacggggaagaaaa
PST01_0056_B08.b : GTGGTCTGCCCAGCCCACCAGTAGCTTCCCTCAGCATCGCTCGTCACTTTATACGCCTTA
20110601C-008168 : TCGCATANGATCAGCTGG..........................................
---------+---------+---------+---------+---------+---------+ 1858
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b : gggggggggggcggggttggttaggaacacttgttggt
CLNT1_0085_E01.b : ccccccaaaccccgggggccctcgggaaagccgcggtaccccggagagaggggggaaacc
PST01_0056_B08.b : TCGCATANGATCAGCTGGgatttagagtcatctcctagagctcccgctgtggctcctcag
20110601C-008168 : ............................................................
---------+---------+---------+---------+---------+---------+ 1858
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b : cgaattctcggggtaaagag
PST01_0056_B08.b : tttaggacctgatgtagtctcgtggagatgtgggttggatccctggactgctctgtggct
20110601C-008168 : ............................................................
---------+---------+---------+---------+---------+---------+ 1858
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b : taggatctggtgtagtcataaaggcggctggatctgggtggctgcggctgcggcaaggcc
20110601C-008168 : ............................................................
---------+---------+---------+---------+---------+---------+ 1858
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b : ggttactgcacttgattcacccctagtctggaactccataccctcgagggctggttaatg
20110601C-008168 : ............................................................
---------+---------+---------+---------+---------+---------+ 1858
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b : aaaaaaaaaaaaaaggccattgtccaattgaggccggccctaaaaattagaaaaaccccc
20110601C-008168 : ............................................................
---------+---------+---------+---------+---------+---------+ 1858
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b : acctcctgaccgaaaaaaagagaatgttggtactttttgtcctaaggtcaaaaaaaaccc
20110601C-008168 : ............................................................
---------+---------+---------+---------+---------+---------+ 1858
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b : cattcacaaatttttccgctatgggggtgcaccagattatttgggccgggaccttattct
20110601C-008168 : ............................................................
---------+---------+---------+---------+---------+---------+ 1858
PST01_0019_F02.b :
OVRM1_0062_A03.b :
OVRM1_0154_D01.b :
PTG01_0076_B05.b :
PTG01_0097_C10.b :
BFLT1_0069_H12.b :
OVRT1_0037_C12.b :
OVRT1_0143_E04.b :
PST01_0063_A01.b :
OVRM1_0013_E11.b :
OVRM1_0042_A11.b :
OVR01_0017_A06.b :
OVR01_0037_C03.b :
CLNT1_0085_E01.b :
PST01_0056_B08.b : cctcctt