[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-008179

Length: 1,102

Sequence [FASTA format sequence]
GTTCCCGGCA GTCGCGGCTG GCGATCCTAA CGGGCTCGGG AGGCGGCCCT GGGCGCCCCG
CCTTTCCCCC CGCCCTCCCC GGCTCCATCT TGCCAGCGAC CGAGCCGGAG TGTGTGTGAC
GCTGCTCCCC GGGTTCAGAA TGTCATACCC AGGCTATACC CCCACAGGCT ACCCACCTTT
CCCTGGATAT CCTCCTGCAG GTCAGGAGTC ATCTTTTCCC CCTCCTGGTC AGTATCCTTA
TCCTAGTGGT TTTCCTCCAA TGGGAGGAGG TGCCTACCCA CCAGCACCAA GTAGTGGCTA
CCCAGGAGCT GGAGGCTACC CTGCCCCTGG AGGTTATCCA GCCCCTGGAG GCTATCCTGG
TGCCCCACAG CCAGGGGGAG CTCCTTCCTA TCCTGGAGGT CAAGGATTTG GAGCTCCACC
AGGTGGAGCA GGCTTTTCTG GCTATCCACA GCCACCCTCA CAGTCTTATG GTGGTGGCCC
AGCACAGGTC CCAGTACCTG GTGGTTTTCC TGGAGGACCA ATGCCTTCTC AGTATCCTGG
AGGACAAACT CCTTACCCTA GTCAGCTTGC CACAGTGGCT CAAGGGACAA TCCGACCGGC
TGCCAACTTT GATGCCATGA GAGATGCAGA AATTCTTCGT AAAGCAATGA AGGGTTTTGG
GACAGACGAG CAGGCAATTA TAGATGTTGT GGCCAACCGT TCCAATGATC AAAGGCAAAA
AATTAAAGCA GCTTTTAAGA CCATGTATGG CAAGGATTTA ATCAAAGATC TTAAATCAGA
GTTAAGTGGA AATATGGAAG AACTGATCCT TGCCCTGTTC ATGCCATCTA CATATTATGA
TGCCTGGAGT TTACGGAATG CAATGAAGGG AGCAGGAACT CAGGAACGTG TATTAATTGA
AATTTTGTGC ACAAGAACAA ATCAGGAAAT CCGAGAAATT GTCCGATGTT ATCCATCAGA
ATTTGGACGA GATCTTGAAA AGGACATTAG GTCAGATACA TCAGGGCATT TTGAACGTTT
ACTTGTATCC ATGTGCCAGG GAAATCGCGA CGAGAACCAG AATGTTACCC CCAGATGGCT
CAGGAAGACG CTCACCGTCT TT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinANXA7annexin A7 isoform 1 [Homo sapiens]. 3301e-90O
Contig/Assembly ProteinANXA7annexin A7 isoform 2 [Homo sapiens]. 3217e-88O
Contig/Assembly ProteinANXA11annexin A11 [Homo sapiens]. 2093e-54O
Contig/Assembly ProteinANXA11annexin A11 [Homo sapiens]. 2093e-54O
Contig/Assembly ProteinANXA11annexin A11 [Homo sapiens]. 2093e-54O
Contig/Assembly ProteinANXA5annexin A5 [Homo sapiens]. 1826e-46O
Contig/Assembly ProteinANXA4annexin A4 [Homo sapiens]. 1811e-45O
Contig/Assembly ProteinANXA6annexin A6 isoform 2 [Homo sapiens]. 1811e-45
Contig/Assembly ProteinANXA6annexin A6 isoform 1 [Homo sapiens]. 1811e-45
Contig/Assembly ProteinANXA8annexin A8 [Homo sapiens]. 1702e-42O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAnxa7annexin A7 [Mus musculus]. 3255e-89O
Contig/Assembly ProteinAnxa7annexin A7 [Mus musculus]. 3255e-89O
Contig/Assembly ProteinAnxa11annexin A11 [Mus musculus]. 2072e-53O
Contig/Assembly ProteinAnxa6annexin A6 isoform a [Mus musculus]. 1772e-44
Contig/Assembly ProteinAnxa6annexin A6 isoform b [Mus musculus]. 1772e-44
Contig/Assembly ProteinAnxa5annexin A5 [Mus musculus]. 1732e-43O
Contig/Assembly ProteinAnxa4annexin A4 [Mus musculus]. 1732e-43O
Contig/Assembly ProteinAnxa8annexin A8 [Mus musculus]. 1672e-41O
Contig/Assembly ProteinAnxa13annexin A13 [Mus musculus]. 1549e-38O
Contig/Assembly ProteinAnxa2annexin A2 [Mus musculus]. 1486e-36O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479246PREDICTED: similar to annexin VII isoform 2 isoform 2 [Canis familiaris]. 3356e-92O
Contig/Assembly ProteinLOC479259PREDICTED: similar to annexin A11 (predicted) [Canis familiaris]. 2071e-53
Contig/Assembly ProteinLOC476094PREDICTED: similar to Annexin A5 (Annexin V) (Lipocortin V) (Endonexin II) (Calphobindin I) (CBP-I) (Placental anticoagulant protein I) (PAP-I) (PP4) (Thromboplastin inhibitor) (Vascular anticoagulant-alpha) (VAC-alpha) (Anchorin CII) [Canis familiaris]. 1863e-47O
Contig/Assembly ProteinLOC479325PREDICTED: similar to Annexin A6 (Annexin VI) (Lipocortin VI) (P68) (P70) (Protein III) (Chromobindin 20) (67 kDa calelectrin) (Calphobindin-II) (CPB-II) isoform 3 [Canis familiaris]. 1841e-46
Contig/Assembly ProteinLOC479325PREDICTED: similar to Annexin A6 (Annexin VI) (Lipocortin VI) (P68) (P70) (Protein III) (Chromobindin 20) (67 kDa calelectrin) (Calphobindin-II) (CPB-II) isoform 2 [Canis familiaris]. 1841e-46
Contig/Assembly ProteinLOC479246PREDICTED: similar to annexin VII isoform 1 isoform 3 [Canis familiaris]. 1841e-46O
Contig/Assembly ProteinLOC479325PREDICTED: similar to annexin VI isoform 2 isoform 1 [Canis familiaris]. 1841e-46
Contig/Assembly ProteinANXA4annexin A4 [Canis lupus familiaris]. 1727e-43O
Contig/Assembly ProteinLOC479270PREDICTED: similar to Annexin A8 (Annexin VIII) (Vascular anticoagulant-beta) (VAC-beta) isoform 1 [Canis familiaris]. 1632e-40O
Contig/Assembly ProteinLOC479270PREDICTED: similar to Annexin A8 (Annexin VIII) (Vascular anticoagulant-beta) (VAC-beta) isoform 3 [Canis familiaris]. 1632e-40O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinANXA7annexin A7 [Bos taurus]. 3423e-94O
Contig/Assembly ProteinANXA11annexin A11 [Bos taurus]. 2102e-54O
Contig/Assembly ProteinANXA6annexin A6 [Bos taurus]. 1864e-47
Contig/Assembly ProteinANXA4annexin A4 [Bos taurus]. 1811e-45O
Contig/Assembly ProteinANXA5annexin A5 [Bos taurus]. 1802e-45O
Contig/Assembly ProteinANXA8L1annexin A8 [Bos taurus]. 1689e-42O
Contig/Assembly ProteinANXA2annexin A2 [Bos taurus]. 1481e-35O
Contig/Assembly ProteinANXA10PREDICTED: annexin A10-like [Bos taurus]. 1471e-35O
Contig/Assembly ProteinANXA10annexin A10 [Bos taurus]. 1471e-35O
Contig/Assembly ProteinANXA1annexin A1 [Bos taurus]. 1394e-33O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinANXA7PREDICTED: annexin A7 [Sus scrofa]. 360e-100O
Contig/Assembly ProteinANXA7PREDICTED: annexin A7 isoform 1 [Sus scrofa]. 360e-100O
Contig/Assembly ProteinLOC100156481PREDICTED: annexin A11 [Sus scrofa]. 2092e-54O
Contig/Assembly ProteinLOC100625675PREDICTED: annexin A6-like [Sus scrofa]. 1832e-46
Contig/Assembly ProteinLOC100521982PREDICTED: annexin A5-like [Sus scrofa]. 1792e-45O
Contig/Assembly ProteinANXA4annexin A4 [Sus scrofa]. 1793e-45O
Contig/Assembly ProteinANXA8annexin A8 [Sus scrofa]. 1646e-41O
Contig/Assembly ProteinANXA13PREDICTED: annexin A13 isoform 2 [Sus scrofa]. 1622e-40O
Contig/Assembly ProteinANXA13PREDICTED: annexin A13 isoform 1 [Sus scrofa]. 1622e-40O
Contig/Assembly ProteinLOC100625579PREDICTED: hypothetical protein LOC100625579 [Sus scrofa]. 1601e-39O


Assembly Members: 20      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10039C07BFLT1_0039_C07.bFS643168 
CLNT10085B04CLNT1_0085_B04.bFS663151 
DCI010013D09DCI01_0013_D09.bDB791458 
KDN010063D07KDN01_0063_D07.bFS675453 
KDN010083G04KDN01_0083_G04.bFS677050 
KDN010090A09KDN01_0090_A09.bFS677555 
LNG010013E03LNG01_0013_E03.bBP437100 
LVRM10074D11LVRM1_0074_D11.bBP139330 
OVRM10013A02OVRM1_0013_A02.bBP144947 
OVRM10155D01OVRM1_0155_D01.bBP457504 
OVRM10193B10OVRM1_0193_B10.bBP456340 AK236443
OVRT10058B06OVRT1_0058_B06.bFS691115 
OVRT10105A08OVRT1_0105_A08.bHX235159 
OVRT10113C11OVRT1_0113_C11.bHX235849 
OVRT10127B02OVRT1_0127_B02.bHX236948 
PBL010035A05PBL01_0035_A05.bBP155096 
PST010087C04PST01_0087_C04.bFS703717 
SPLT10038B03SPLT1_0038_B03.bHX242124 
SPLT10070G04SPLT1_0070_G04.bHX244670 
UTR010056D11UTR01_0056_D11.bBP463783 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
657C200.118WNTCT/S
T1320.882TTT/F
690C200.133WNGCG/A
T1300.867GTG/V


Alignment:      TOP

20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0193_B10.b : agttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_D01.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0013_A02.b :
DCI01_0013_D09.b : nnnaacatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0127_B02.b :
SPLT1_0038_B03.b :
SPLT1_0070_G04.b :
CLNT1_0085_B04.b :
UTR01_0056_D11.b :
OVRT1_0105_A08.b :
LNG01_0013_E03.b :
OVRT1_0113_C11.b :
OVRT1_0058_B06.b :
BFLT1_0039_C07.b :
LVRM1_0074_D11.b :
PST01_0087_C04.b :
KDN01_0083_G04.b :
KDN01_0063_D07.b :
KDN01_0090_A09.b :
PBL01_0035_A05.b :
20110601C-008179 : ..................GTTCCCGGCAGTCGCGGCTGGCGATCCTAACGGGCTCGGGAG
---------+---------+---------+---------+---------+---------+ 42
OVRM1_0193_B10.b : xxxxxxxxxxxxxxxxxxGTTCCCGGCAGTCGCGGCTGGCGATCCTAACGGGCTCGGGAG
OVRM1_0155_D01.b : xxxxxxxxxxxxxxxxxxGTTCCCGGCAGTCGCGGCTGGCGATCCTAACGGGCTCGGGAG
OVRM1_0013_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0127_B02.b : nnnncctatagcgntangxxxxxxxxxxxxx
SPLT1_0038_B03.b : nnncccgtattttnnnnggctagtacacgxxxxxxx
SPLT1_0070_G04.b : nnnnggcgagtagaxxxxxxxxxx
CLNT1_0085_B04.b : tttttcctatagctgtacgaggxxxxxxx
UTR01_0056_D11.b : gcatttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_A08.b : nnnnnctcagctgaggxxxxxxxxx
LNG01_0013_E03.b : tttgtggtgactxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_C11.b : ttttccgtcagcgnacgxxxxxxxxxx
OVRT1_0058_B06.b : nnnccccttnnnnggaaccgtatagcgnacgagtgxxxxxx
BFLT1_0039_C07.b : gggatcctttagcgnacgxxxxxxxxxx
LVRM1_0074_D11.b : agttgacxxxxxx
PST01_0087_C04.b :
KDN01_0083_G04.b :
KDN01_0063_D07.b :
KDN01_0090_A09.b :
PBL01_0035_A05.b :
20110601C-008179 : GCGGCCCTGGGCGCCCCGCCTTTCCCCCCGCCCTCCCCGGCTCCATCTTGCCAGCGACCG
---------+---------+---------+---------+---------+---------+ 102
OVRM1_0193_B10.b : GCGGCCCTGGGCGCCCCGCCTTTCCCCCCGCCCTCCCCGGCTCCATCTTGCCAGCGACCG
OVRM1_0155_D01.b : GCGGCCCTGGGCGCCCCGCCTTTCCCCCCGCCCTCCCCGGCTCCATCTTGCCAGCGACCG
OVRM1_0013_A02.b : xxxxxxxxxxxxxxxggtttTTTCCCCCCGCCCTCCCCGGCTCCATCTTGCCAGCGACCG
DCI01_0013_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCATCTTGCCAGCGACCG
OVRT1_0127_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCATCTTGCCAGCGACCG
SPLT1_0038_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCATCTTGCCAGCGACCG
SPLT1_0070_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCATCTTGCCAGCGACCG
CLNT1_0085_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtATCTTGCCAGCGACCG
UTR01_0056_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggATCTTGCCAGCGACCG
OVRT1_0105_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTGCCAGCGACCG
LNG01_0013_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTGCCAGCGACCG
OVRT1_0113_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTGCCAGCGACCG
OVRT1_0058_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTGCCAGCGACCG
BFLT1_0039_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTGCCAGCGACCG
LVRM1_0074_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTGCCAGCGACCG
PST01_0087_C04.b : nnnnncctgcgttggctatggcttgccGCGACCG
KDN01_0083_G04.b : nnnncctgcggtggctatggatttgccGCGACCG
KDN01_0063_D07.b : nnnnngctgcgttggctatggatttgccGCGACCG
KDN01_0090_A09.b : ttttcctgaggtggctacggnatttgccGCGACCG
PBL01_0035_A05.b : nnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-008179 : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
---------+---------+---------+---------+---------+---------+ 162
OVRM1_0193_B10.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
OVRM1_0155_D01.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
OVRM1_0013_A02.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
DCI01_0013_D09.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
OVRT1_0127_B02.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
SPLT1_0038_B03.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
SPLT1_0070_G04.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
CLNT1_0085_B04.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
UTR01_0056_D11.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
OVRT1_0105_A08.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
LNG01_0013_E03.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
OVRT1_0113_C11.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
OVRT1_0058_B06.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
BFLT1_0039_C07.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
LVRM1_0074_D11.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
PST01_0087_C04.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
KDN01_0083_G04.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
KDN01_0063_D07.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
KDN01_0090_A09.b : AGCCGGAGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
PBL01_0035_A05.b : xxxxxgtGTGTGTGTGACGCTGCTCCCCGGGTTCAGAATGTCATACCCAGGCTATACCCC
20110601C-008179 : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
---------+---------+---------+---------+---------+---------+ 222
OVRM1_0193_B10.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
OVRM1_0155_D01.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
OVRM1_0013_A02.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
DCI01_0013_D09.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
OVRT1_0127_B02.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
SPLT1_0038_B03.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
SPLT1_0070_G04.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
CLNT1_0085_B04.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
UTR01_0056_D11.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
OVRT1_0105_A08.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
LNG01_0013_E03.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
OVRT1_0113_C11.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
OVRT1_0058_B06.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
BFLT1_0039_C07.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
LVRM1_0074_D11.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
PST01_0087_C04.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
KDN01_0083_G04.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
KDN01_0063_D07.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
KDN01_0090_A09.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
PBL01_0035_A05.b : CACAGGCTACCCACCTTTCCCTGGATATCCTCCTGCAGGTCAGGAGTCATCTTTTCCCCC
20110601C-008179 : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
---------+---------+---------+---------+---------+---------+ 282
OVRM1_0193_B10.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
OVRM1_0155_D01.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
OVRM1_0013_A02.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
DCI01_0013_D09.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
OVRT1_0127_B02.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
SPLT1_0038_B03.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
SPLT1_0070_G04.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
CLNT1_0085_B04.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
UTR01_0056_D11.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
OVRT1_0105_A08.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
LNG01_0013_E03.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
OVRT1_0113_C11.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
OVRT1_0058_B06.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
BFLT1_0039_C07.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
LVRM1_0074_D11.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
PST01_0087_C04.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
KDN01_0083_G04.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
KDN01_0063_D07.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
KDN01_0090_A09.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
PBL01_0035_A05.b : TCCTGGTCAGTATCCTTATCCTAGTGGTTTTCCTCCAATGGGAGGAGGTGCCTACCCACC
20110601C-008179 : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
---------+---------+---------+---------+---------+---------+ 342
OVRM1_0193_B10.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
OVRM1_0155_D01.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
OVRM1_0013_A02.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
DCI01_0013_D09.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
OVRT1_0127_B02.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
SPLT1_0038_B03.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
SPLT1_0070_G04.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
CLNT1_0085_B04.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
UTR01_0056_D11.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
OVRT1_0105_A08.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
LNG01_0013_E03.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
OVRT1_0113_C11.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
OVRT1_0058_B06.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
BFLT1_0039_C07.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
LVRM1_0074_D11.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
PST01_0087_C04.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
KDN01_0083_G04.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
KDN01_0063_D07.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
KDN01_0090_A09.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
PBL01_0035_A05.b : AGCACCAAGTAGTGGCTACCCAGGAGCTGGAGGCTACCCTGCCCCTGGAGGTTATCCAGC
20110601C-008179 : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
---------+---------+---------+---------+---------+---------+ 402
OVRM1_0193_B10.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
OVRM1_0155_D01.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
OVRM1_0013_A02.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
DCI01_0013_D09.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
OVRT1_0127_B02.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
SPLT1_0038_B03.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
SPLT1_0070_G04.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
CLNT1_0085_B04.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
UTR01_0056_D11.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
OVRT1_0105_A08.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
LNG01_0013_E03.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
OVRT1_0113_C11.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
OVRT1_0058_B06.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
BFLT1_0039_C07.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
LVRM1_0074_D11.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
PST01_0087_C04.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
KDN01_0083_G04.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
KDN01_0063_D07.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
KDN01_0090_A09.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
PBL01_0035_A05.b : CCCTGGAGGCTATCCTGGTGCCCCACAGCCAGGGGGAGCTCCTTCCTATCCTGGAGGTCA
20110601C-008179 : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
---------+---------+---------+---------+---------+---------+ 462
OVRM1_0193_B10.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
OVRM1_0155_D01.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
OVRM1_0013_A02.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
DCI01_0013_D09.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
OVRT1_0127_B02.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
SPLT1_0038_B03.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
SPLT1_0070_G04.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
CLNT1_0085_B04.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
UTR01_0056_D11.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
OVRT1_0105_A08.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
LNG01_0013_E03.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
OVRT1_0113_C11.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
OVRT1_0058_B06.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
BFLT1_0039_C07.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
LVRM1_0074_D11.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
PST01_0087_C04.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
KDN01_0083_G04.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
KDN01_0063_D07.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
KDN01_0090_A09.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
PBL01_0035_A05.b : AGGATTTGGAGCTCCACCAGGTGGAGCAGGCTTTTCTGGCTATCCACAGCCACCCTCACA
20110601C-008179 : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
---------+---------+---------+---------+---------+---------+ 522
OVRM1_0193_B10.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
OVRM1_0155_D01.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
OVRM1_0013_A02.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
DCI01_0013_D09.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
OVRT1_0127_B02.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
SPLT1_0038_B03.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
SPLT1_0070_G04.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
CLNT1_0085_B04.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
UTR01_0056_D11.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
OVRT1_0105_A08.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
LNG01_0013_E03.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
OVRT1_0113_C11.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
OVRT1_0058_B06.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
BFLT1_0039_C07.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
LVRM1_0074_D11.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
PST01_0087_C04.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
KDN01_0083_G04.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
KDN01_0063_D07.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
KDN01_0090_A09.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
PBL01_0035_A05.b : GTCTTATGGTGGTGGCCCAGCACAGGTCCCAGTACCTGGTGGTTTTCCTGGAGGACCAAT
20110601C-008179 : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
---------+---------+---------+---------+---------+---------+ 581
OVRM1_0193_B10.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
OVRM1_0155_D01.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTANTCAGCTTGCC*ACAGTGGCTC
OVRM1_0013_A02.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGACTC
DCI01_0013_D09.b : GCCTTCTCAGTATCCTGGAGGAACAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
OVRT1_0127_B02.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
SPLT1_0038_B03.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
SPLT1_0070_G04.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
CLNT1_0085_B04.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
UTR01_0056_D11.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
OVRT1_0105_A08.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
LNG01_0013_E03.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
OVRT1_0113_C11.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
OVRT1_0058_B06.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
BFLT1_0039_C07.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
LVRM1_0074_D11.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCCNACAGTGACTC
PST01_0087_C04.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
KDN01_0083_G04.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
KDN01_0063_D07.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
KDN01_0090_A09.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
PBL01_0035_A05.b : GCCTTCTCAGTATCCTGGAGGACAAACTCCTTACCCTAGTCAGCTTGCC*ACAGTGGCTC
20110601C-008179 : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
---------+---------+---------+---------+---------+---------+ 641
OVRM1_0193_B10.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
OVRM1_0155_D01.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
OVRM1_0013_A02.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
DCI01_0013_D09.b : AAGGGACAATCCGACCGGCTGCCNACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
OVRT1_0127_B02.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
SPLT1_0038_B03.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
SPLT1_0070_G04.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
CLNT1_0085_B04.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
UTR01_0056_D11.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
OVRT1_0105_A08.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
LNG01_0013_E03.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
OVRT1_0113_C11.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
OVRT1_0058_B06.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
BFLT1_0039_C07.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
LVRM1_0074_D11.b : *AGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
PST01_0087_C04.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
KDN01_0083_G04.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
KDN01_0063_D07.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
KDN01_0090_A09.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCATGAGAGATGCAGAAATTCTTCGTA
PBL01_0035_A05.b : AAGGGACAATCCGACCGGCTGCCAACTTTGATGCCACGAGAGATGCAGAAATTCTTCGTA
20110601C-008179 : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
---------+---------+---------+---------+---------+---------+ 701
OVRM1_0193_B10.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCNATTATAGATGTTGTGGCCAATCGTT
OVRM1_0155_D01.b : AAGCAATGAAAGGTTTTGGGACANACGAACAGGCAATTATAAATGTTGTGGCCAACCGTT
OVRM1_0013_A02.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
DCI01_0013_D09.b : AAGCAATGAAGGGTTTTTGGACAGACGAGCAGGCAATTATAGATGTTGTGGCAAACCGTC
OVRT1_0127_B02.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
SPLT1_0038_B03.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
SPLT1_0070_G04.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
CLNT1_0085_B04.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
UTR01_0056_D11.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
OVRT1_0105_A08.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
LNG01_0013_E03.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
OVRT1_0113_C11.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
OVRT1_0058_B06.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
BFLT1_0039_C07.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
LVRM1_0074_D11.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCNATTATAGATGTTGTGGCCAACCGTT
PST01_0087_C04.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
KDN01_0083_G04.b : AAGCAATGAAGGGTTCTGGGACAGACGAGCAGGCAATTATAGATGTTGCGGCCAACCGTT
KDN01_0063_D07.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
KDN01_0090_A09.b : AAGCAATGAAGGGTTCTGGGACAGACGAGCAGGCAATTATAGATGTTGCGGCCAACCGTT
PBL01_0035_A05.b : AAGCAATGAAGGGTTTTGGGACAGACGAGCAGGCAATTATAGATGTTGTGGCCAACCGTT
20110601C-008179 : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
---------+---------+---------+---------+---------+---------+ 761
OVRM1_0193_B10.b : CCAATGATCAAAGGC*AAAAAATAAAGCAGCTTTTtagaacatgt
OVRM1_0155_D01.b : CCCATGATCACAGGCCAAAAATTAAAGCAGCTTTCAAGACCATGTATGGa
OVRM1_0013_A02.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAN
DCI01_0013_D09.b : CC*ATGATCAAAGGCAAAAAAT*AAAGCAGCTTTTAAGAACATGTATGGCAAGatttnat
OVRT1_0127_B02.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
SPLT1_0038_B03.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
SPLT1_0070_G04.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
CLNT1_0085_B04.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
UTR01_0056_D11.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
OVRT1_0105_A08.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
LNG01_0013_E03.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
OVRT1_0113_C11.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
OVRT1_0058_B06.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
BFLT1_0039_C07.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
LVRM1_0074_D11.b : CCCATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
PST01_0087_C04.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
KDN01_0083_G04.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
KDN01_0063_D07.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
KDN01_0090_A09.b : CCAATGATCAAAGGCAAAAAATTAAAGCAGCTTTTAAGACCATGTATGGCAAGGATTTAA
PBL01_0035_A05.b : CCAATGATNCAAGGCAAAAAATTAAAGCAGCTTTTAAGAACATGTATGGGCAGGATTTNA
20110601C-008179 : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
---------+---------+---------+---------+---------+---------+ 820
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGT
DCI01_0013_D09.b : caagatcttaatcaaagttagtggaatatggaagactgatcctgccctgtcatgccatca
OVRT1_0127_B02.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
SPLT1_0038_B03.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
SPLT1_0070_G04.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
CLNT1_0085_B04.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
UTR01_0056_D11.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
OVRT1_0105_A08.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
LNG01_0013_E03.b : TTCAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
OVRT1_0113_C11.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
OVRT1_0058_B06.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
BFLT1_0039_C07.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
LVRM1_0074_D11.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGNCCTGTTC
PST01_0087_C04.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
KDN01_0083_G04.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
KDN01_0063_D07.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
KDN01_0090_A09.b : T*CAAAGATCTTAAATCAGAGTTAAGTGGAAATATGGAAGAACTGATCCTTGCCCTGTTC
PBL01_0035_A05.b : A*TCAAGATCTTAAATCAGAGTTAAGTGGAAAATATGAAGAACTGATCCNTGCCCTGNTC
20110601C-008179 : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
---------+---------+---------+---------+---------+---------+ 880
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b : ctatatgatgctggagttacggatgcatggaggagcagaactccggacgtgttttattgg
OVRT1_0127_B02.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAAGGAGCAGGAACT
SPLT1_0038_B03.b : ATGCCATCTACATATTATGATGCCTGNAGTTTACGGAATGCAATGAAAGGAGCAGGAACT
SPLT1_0070_G04.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
CLNT1_0085_B04.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
UTR01_0056_D11.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
OVRT1_0105_A08.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAAGGAGCAGGAACT
LNG01_0013_E03.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
OVRT1_0113_C11.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACNGAATGCAATGAAGGGAGCAGGAACT
OVRT1_0058_B06.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
BFLT1_0039_C07.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACNGAATGCAATGAANGGAGCAGGAACT
LVRM1_0074_D11.b : ATGCCATCTACATATTATGATGCCTGGNAGTTACGG
PST01_0087_C04.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
KDN01_0083_G04.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
KDN01_0063_D07.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
KDN01_0090_A09.b : ATGCCATCTACATATTATGATGCCTGGAGTTTACGGAATGCAATGAAGGGAGCAGGAACT
PBL01_0035_A05.b : ATGCCATCTACATATTATGATGCCTGGAGGTTACNGAATGCAATGAAGGNAGCAGGAACT
20110601C-008179 : CAGGAACGTGTATTAATTGAAATTTTGTGCACAAGAACAAATCAGGAAATCCGAGAAATT
---------+---------+---------+---------+---------+---------+ 940
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b : aatttgtgcccaaacaaatccggaaatcgaaaattgcccaagtttcatccaatttgaaca
OVRT1_0127_B02.b : CANGAACGTGTATTA*TTGAAAATTTGTGCACAAGAACAAATCAAGAAATCCCAAAAATT
SPLT1_0038_B03.b : CANGAACGTGTATTAATTGAAAATTTGTGCACAAAAACAAATCAGGAAATCCAAGAAATT
SPLT1_0070_G04.b : CANGAACGTGTATTAATTGAAATTTTGTGCACAAGAACAAATCAGGAAATCCGAGAAATT
CLNT1_0085_B04.b : CANGAACGTGTATTAATTGAAATTTTGTGCACAAGAACAAATCAGGAAATCCGAGAAAT*
UTR01_0056_D11.b : CAGGAACGTGTATTAATTGAAATTTTGTGCACAAGAACAAATCAGGAAATCCGAAGAATT
OVRT1_0105_A08.b : CANGACCGTGTATTAATTGAAATTTTGTGCACAGAAACAAtcaggaaatccaagaattgt
LNG01_0013_E03.b : CAGGAACGTGTATTAATTGAAATTTTtgtgcacaagaaacaaaatcaaggaaatcccaag
OVRT1_0113_C11.b : CAGGAACGTGTATTATTTGAA*TTTTGTGCACCAGAACAAATCAGGAAATCCGAAAAATT
OVRT1_0058_B06.b : CANGAACGTGTATTA*TTGAAATTTTGTGCACAAGACCAAATCANGAAATCCGAGAAATT
BFLT1_0039_C07.b : CANGAACGTGTATTAATTGAAATTTTGTGCACAAGAAACAATCAGGAAATCCGAGAAATT
LVRM1_0074_D11.b :
PST01_0087_C04.b : CAGGAACGTGTATTAATTGAAATTTTGTGCACAAGAACAAATCAGGAAATCCGAGAAATT
KDN01_0083_G04.b : CAGGAACGTGTATTAATTGAAATTTTGTGCACAAGAACAAATCANGAAATCCGAGAAATT
KDN01_0063_D07.b : CAGGAGCGTGTATTAATTGAAATTTTGTGCACAAGAACAAATCANGAAATCCGAGAAATT
KDN01_0090_A09.b : CANGAACGTGTATTAATTGAAATTTTGTGCACAAGAACAAATCAAGAAATCCGAGAAATT
PBL01_0035_A05.b : CAGGAACGTGTATTAATTGAA*TTTTGTGCACCAGAACAAATCAGGGAATCCGAGAAATT
20110601C-008179 : GTCCGATGTTATCCATCAGAATTTGGACGAGATCTTGAAAAGGACATTAGGTCAGATACA
---------+---------+---------+---------+---------+---------+ 1000
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b : aatctgaaaggacattgggcaatcatcgggcttttgaagtaactgaatcctgtgccggaa
OVRT1_0127_B02.b : GTCCGATGTTATCAATCAGAATTTGGACGAGATCTTGAAAggacattaggtcggatactc
SPLT1_0038_B03.b : GTCCGATGTTATTCATCAAAATTTGAACAAAATCTTGAAAA*GACATTTAGTCAAATACA
SPLT1_0070_G04.b : GTCGGATGTTATNCATCAGAATTTGGACGAGATCTTGAAAAAGACATTAGGTCAGATACA
CLNT1_0085_B04.b : GTCCGATGTTATCAATCAGAAATTGGACGAGATCTTGAAAA*GACATTAGGTCAGA*ACA
UTR01_0056_D11.b : GTCCGATGTTATCAATCAGAATTTGGACGAGATCTTGAAAAGGACATTAGGTCAGATACC
OVRT1_0105_A08.b : ccgatgtatcaatcgaatttggacgagatcttgaaaggacataggtcaaatcctcagggc
LNG01_0013_E03.b : aaattgtccaatgttatcaatccaaattttggacgagatctttgaaaaaggactttaggt
OVRT1_0113_C11.b : GTCGAATGT*ATCAATCAGAATTTTGGACAGATCTTGAAAAGGACATTAAGTCAAAAACA
OVRT1_0058_B06.b : TGTCGATGTTATCAATCAAAATTTGGACGAGATCTTTGAAAAGACATAN*GTCAGATACA
BFLT1_0039_C07.b : GCCCGATGTTTATCATCAAAATTTGGACGAGAT*TTGAAAAGGACATTAGGTCAGATACA
LVRM1_0074_D11.b :
PST01_0087_C04.b : GTCCGATGTTATCAATCAGAATTTGGACGAGATCTTGAAAAGGACATTANGTCAGATACA
KDN01_0083_G04.b : GTCCGATGTTTATCATCAGAATTTGGACGAGATCTTTGAAAGGACATTAGGTCAGATACA
KDN01_0063_D07.b : GTCCGATGTTTATCATCAGAATTTGGACGAGATCTTGAGAAGGACATTANGTCAGATACA
KDN01_0090_A09.b : GTCCGATGTTTATCATCAGAATTTGGACGAGATCTTTGAAAGGACATTANGTCAGATACA
PBL01_0035_A05.b : GTCGAATGTTATcatcagatttggacgagatctgaaaaggacattagtccaatcatcagg
20110601C-008179 : TCAGGGCATTTT*GAACGTTTACTTGTATCCATGTGCCAGGGAAATCGCGACGAGAACCA
---------+---------+---------+---------+---------+---------+ 1059
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b : atccgacgaaaccaatgttacccaaatgctcagaaacctcacgcttatccctggcaagga
OVRT1_0127_B02.b : aggccattttgaagtttacctgtatccatgtgcaaggaaatcccaacaagaccaaaatgt
SPLT1_0038_B03.b : TCAGGGCCTTTT*GAACGTTTACTgtattcctgtgccaggaaatcccgacaaaaaccgaa
SPLT1_0070_G04.b : TCAGGGCATTTT*GAACGTTTACTTGTATCC*TGTGCCAGGGAAATCGCGACGAGAACCA
CLNT1_0085_B04.b : TCAGGGCATTTT*GAAAGTTTACTTGTAT*CATGTGCCAGGGAAATCGCGACaaaaccag
UTR01_0056_D11.b : TCAAGGCATTTTTGACCGTTTACTTGTATCCATGTGCCAGGGAAATcgcgaacaagaaca
OVRT1_0105_A08.b : ttttgaacgttactgtatcatgtgcagggaatccgacgagaccaaatgtaaccccgaagg
LNG01_0013_E03.b : caaatacattcagggctttttgaaacgtttacttgtatcccatggggccagggaaatcgc
OVRT1_0113_C11.b : TCAGGGCAATTT*GAACGTTTACTTGTATCCATGTGCCAGGGAAATCccgaacaaaaacc
OVRT1_0058_B06.b : TCAGGGCATTTT*GA*CGTTTACTTGTATCCATGTGcaggggaatcgcgaccaaaaccaa
BFLT1_0039_C07.b : TCAGGGCATTTT*GAACGTTTACTTGGATCCATGTGCCAGGGAAATCGCCACGAGAACCA
LVRM1_0074_D11.b :
PST01_0087_C04.b : TCAGGGCATTTT*GAACGTTTACTTGTATCCATGTGCCAGGGAAATCGCGACGAAGAACA
KDN01_0083_G04.b : TCAGGGCATTTT*GAAACGTTACTTGTATCCATGTGCCCAGGAAATCGCGACGAGAACCA
KDN01_0063_D07.b : TCAGGGCATTTT*GAACGTTTACTTGTATCCATGTGCCAGGGAAATCGCGACGAGAACCA
KDN01_0090_A09.b : TCAGGNCATTTT*GAACGTTTACTTGTATCCATGTGGCAGGGAAATCGCGACGAGAACCA
PBL01_0035_A05.b : gcatttggacgttaactttatccatgggccagggaatcgcgacaaaaaacagatggtaac
20110601C-008179 : GAATGTTA*CCCCCAGATGGCTCAGGAAGACGCTCACCGTCTTT................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b : gttaggaaaaaacttgtttaaatattcgcccaaagcttctcccaaactccgggggctttc
OVRT1_0127_B02.b : taacccccaatggtcaggaaaacctccacttcttatcagctggcaaaggaggttaggaaa
SPLT1_0038_B03.b : agttaaccccagatgctcaggaaaacctcacctttttatcaacttgcaagggaggttagg
SPLT1_0070_G04.b : GAATGTTAaccccagatggctcaggaaaacctcaacgtcttataaactggcaaaggaagt
CLNT1_0085_B04.b : aaggttacccccaaatggctcaggaagagctcagcgtctttacaaactggcaaggaaggt
UTR01_0056_D11.b : gaaatgttaaccccccaaaatggctcaaggaaaacccttcaccgtcttttttcaagcctg
OVRT1_0105_A08.b : ctaagaaacctcacgtcttttcagctggcaagggagtaaggaaaaaaaacttgcttaaat
LNG01_0013_E03.b : caacaaaaaccagaaatggttaaccccccaaatggctttagggaaaaagcctccagccgt
OVRT1_0113_C11.b : aaaatgttaccccccgaatgctcaaggaaaaccttagctcctttatcaacctggccaagg
OVRT1_0058_B06.b : atggtaaccccagatgctcaggaagaactcaacgtcttatcacctggcaaaggagttagg
BFLT1_0039_C07.b : GAATGTTAACCCccagaaggctcaagaagacccccaccttctttatcaaccttgccaaag
LVRM1_0074_D11.b :
PST01_0087_C04.b : GAATGTTAacccccagatggctcaggaagacgctcagcgtcttttatcagctgggcgaag
KDN01_0083_G04.b : GAATGTTA*CCCCCAGATGGCTCAGGaggacgctcagcgtcttatcaagctgcgaaagaa
KDN01_0063_D07.b : GAATGGTAACCCCCAGATGGCTCAGGAAGACGCTCAGCGTCTTTtatcagctggcgaagg
KDN01_0090_A09.b : GAATGTTA*CCCCCAGATGGCTCANGAAGACGCTCACCGTCTTTatcaagctggcgaaag
PBL01_0035_A05.b : cccaaaaggctcaggaaaacgctaactcttaacaaactggcaagggaagtagggacaata
20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b : gaagggaacaatttttacgggtgccgattttgaaatcaaggtttaaatttgggggcggcc
OVRT1_0127_B02.b : aaaatcttgcttaaatgattccccccaaaaactttcccactaaagcccccgggaggtttt
SPLT1_0038_B03.b : acaataatcttgctttaaagattccccccaaaaactttcctcctgaaactcctggagcct
SPLT1_0070_G04.b : agggaaaaagaatctgctttaactgatccccccacaaaactttcctcgctgaaactactg
CLNT1_0085_B04.b : aggaaaaataatcttgcttaactgatcccgccccaaaagctttctcacctgaagctaccg
UTR01_0056_D11.b : gcgaagggggaggttaggggaaaaaaataaatctttggttttaacattaatttctcgccc
OVRT1_0105_A08.b : gattcccccaaaaaccttcccccctgaagccctggagggttttccgagggcaaccaattt
LNG01_0013_E03.b : cttttatcaaacctggggaaaaggggaagggtaggggcccaaaaggaacacccccccccc
OVRT1_0113_C11.b : gaggttagggaaaaaaaaacttgtgttaacatgatttctcccccaaaaacctttcctccc
OVRT1_0058_B06.b : aaaaatgattctgctttacatgattccgcccaaaaaactttcctcacgaagctccctgga
BFLT1_0039_C07.b : gaggttagggaacggataaatctggctttaaatgaatttggcccaaaaaacttccttact
LVRM1_0074_D11.b :
PST01_0087_C04.b : gaagttaaggacaaaatgatcttgctttaacatgaatctcgccacaaaaagctttcctca
KDN01_0083_G04.b : ggtaaggacgatgaatctgctttacatgatctcgcccagagctttctcacctgaaactac
KDN01_0063_D07.b : gaggttagggacgatgaaatctgctttacatgattctcgcaacagaagctttctcagctg
KDN01_0090_A09.b : gagttaggnacaaaatgaatctgctttacatgattctcgcacaagaagctttctcaactg
PBL01_0035_A05.b : atctgcctaaaatgatcccccacagagctttcctgcttaagctccaggaagcttatcagg
20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b : ccctttctaaggtctttttaagggggcgaaacccccgggggttcgggaggtttttaaaaa
OVRT1_0127_B02.b : ccggagggcaacaaatttttacaggttggccgtgtttctgaatgtaagaggttaaacaat
SPLT1_0038_B03.b : attcggatggcaacgaaatttttaccgtttgggcggatttttcgaaattcaaagtgggta
SPLT1_0070_G04.b : gagcttatccggaggctaatcaatttttaacatgtggcctaatttttggaatgccaagtc
CLNT1_0085_B04.b : ggggcttttccggaggctaatcaattgttaacaggttggcgtgagtttccgaaagtcaag
UTR01_0056_D11.b : ccaaaaaaaaccttttcctccagc
OVRT1_0105_A08.b : ttaacggttgcccgatttttgaaattaaaaggtgaaaaaacttgggtgcccaaaccctct
LNG01_0013_E03.b : tgggtccaggggatttgggggggttttccccccccggaaaggggaaaaaattggaattct
OVRT1_0113_C11.b : cggaaactccctggagggcttttccagaagggtaaacagaatttttaaccaggttgggcc
OVRT1_0058_B06.b : ggcttttccggaggctaaccaaattttaaccgttgggcggagtttcggaaagcgcaaggg
BFLT1_0039_C07.b : gaaagctacatggaagctttttccagagtgcttatccaaattgttaacattgttggccga
LVRM1_0074_D11.b :
PST01_0087_C04.b : gctgaaagctacaatgggaggctatttccagaatgctaatcaaaatttgtaaccatggtt
KDN01_0083_G04.b : atggagcttatcaggatgctatcaaattgtagcactgtggctgaattctgaaatgcaaat
KDN01_0063_D07.b : aagctacatggaggctattcaggatggctatcagattgttaacaggttggcgtaattttc
KDN01_0090_A09.b : aagctacatggaggctatccaggatgctatcaaaatttgtaccatgttgccgtgatttct
PBL01_0035_A05.b : atgctatcgaaattgtaccatgttgccgtatttttggatgtccaatggctgaaacttctg
20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b : ttttttaaaccgg
OVRT1_0127_B02.b : ttgggtgccgacaccccccttcctaaaggttcattctaagggcgccaaaaacccctgggg
SPLT1_0038_B03.b : aaactttttggtgtgcccaacccctctctttctgaaaggtcatattcgaaagaggcgccc
SPLT1_0070_G04.b : ttaaacattttgatgcccaaacccctcctttcctaaagcctctttcctaagggcgcaaat
CLNT1_0085_B04.b : gggttgaaaaaccttgatgggccggacccccgcttttccaaagggcctatcccggaaggg
UTR01_0056_D11.b :
OVRT1_0105_A08.b : cttccaagagctttaccaaagaggggaaaaaccccccccggagggttcccgaaatttttt
LNG01_0013_E03.b : ttttttttataaaaaataaaaaaaaaaaaaaaaaatgtttttctccacttccctccaaaa
OVRT1_0113_C11.b : ggattttcggaaatatcaaaaggggtggaaaaaatttggagggtgcccaacccccctctc
OVRT1_0058_B06.b : ttgaaaactttgaagggcccgaacccggcttttccaaaaggtcttttcccaaaggcccgc
BFLT1_0039_C07.b : aatttttggaattgtcaaagggcttgaaaacaaccggaaaaacttttggttcccttggtt
LVRM1_0074_D11.b :
PST01_0087_C04.b : gcccgggaattttcggaaatgtcaaagtggctgaaaaacatttggaggtggcccgaaccg
KDN01_0083_G04.b : ggttgaaacatttcatgtgccgaaccccgcttttcctaaagtctttttctaagggcggca
KDN01_0063_D07.b : tgaatgtcaaagggctgaaacatcttgaggtgcctgaacgcctgcttttcctgaggcttt
KDN01_0090_A09.b : gaaatgtcaaagtgctgaaacatttgaaggtgcctgaacgcctgctttttcctgaagctt
PBL01_0035_A05.b : catgggctgacccctgcctcttctaaggctaaattctgaaggccgccaataaccccttcg
20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b :
OVRT1_0127_B02.b : gtggtcgggggttttttaaaaaaatttttaattaacaccccgtattaacaagaaatagcc
SPLT1_0038_B03.b : aaaaccccccggcaggatttttcccgaaaaatatttttaaaaaaaaaattttcaaaaata
SPLT1_0070_G04.b : atcccctgtagagtggttccgaaaatttcttttaaaaaaagtcccaaattaaaccctggc
CLNT1_0085_B04.b : cgcgcaaaccccccgcgattgggttccgggaaaatttttcaaaaaaagtttctcaattta
UTR01_0056_D11.b :
OVRT1_0105_A08.b : aaaaaaatttctaataaaacacgccattgagaaagaaacaacctcctcgggggaattttt
LNG01_0013_E03.b : aatatgttttttattcttacaaaaaaaaaaaaaaaacaacc
OVRT1_0113_C11.b : ttctcgagggctccttttttaaaaggggcggcaaaaaacaccccctttgaaattgtttcc
OVRT1_0058_B06.b : caaaacccccggcggggggtttccgagagatatttaaaaaaaattttctaatttaaaccg
BFLT1_0039_C07.b : ttgtggagagagactttgaaattacactcttaagggggagaagagagaaaaaaatttctc
LVRM1_0074_D11.b :
PST01_0087_C04.b : ccctgcttttttccttgaaggcttaatattcatgaaagggcccggcaaaataaatcccct
KDN01_0083_G04.b : ataatccctgcagatgtgttccagggatatttgaaaaaaaattcccaatttcaaactggc
KDN01_0063_D07.b : acatccggaagggcggcaaataacccctggccgatgggtcccgaggaattatttgaataa
KDN01_0090_A09.b : aaatctctgaagggccgcaaataatcccccggcagaattggttcccaaggaattatttta
PBL01_0035_A05.b : gatgggttccgaggatgacttttaaaaaaattttcaatttaaacccgccagtgtgggaag
20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b :
OVRT1_0127_B02.b : cccggggggaaatttttttagaaaatcataagagtcggccccccaatatagggtgttttt
SPLT1_0038_B03.b : aaaccgcgcccattttgaaacaggaaatcaagccctttcgtttggaa
SPLT1_0070_G04.b : atttggtcaaggaatacagctttctctgggccaaaatttttttagaatttcttttaaaag
CLNT1_0085_B04.b : aaccgcgcatgttgggacaggaatacggctctggctggcgaaaaatttttttagaactca
UTR01_0056_D11.b :
OVRT1_0105_A08.b : taggaaattaaaaggcgccccccaaaaagagggtgtggcttttttcataataaaaaaaaa
LNG01_0013_E03.b :
OVRT1_0113_C11.b : aaagatatttttttaaaaaaaaaaatatttaaataaaaaaaaccgccatgtttgtgaaag
OVRT1_0058_B06.b : gcattttggcacaagaaaaaccctcttcgtgcc
BFLT1_0039_C07.b : cttatgggcgccccccgccataaagaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0074_D11.b :
PST01_0087_C04.b : gtccagaatttggttacccgaaagaaattaccttgtaaataaaacaatgttcccaaattt
KDN01_0083_G04.b : agattaggaaaaggaacaggtttcgcttggccggaattttttaagagattattttaaaag
KDN01_0063_D07.b : acaagtcccaaggtcaaaacgggcaatttgggacaaggaaatcaggcttggcttgcccaa
KDN01_0090_A09.b : ataaaaaatttcccaatttcaaaactggcactgttaggccaaggaattcaagttttgcct
PBL01_0035_A05.b : gaatcaagtttgcctggccaaaattttttgaaagctaaataaaagaggtgccccccccaa
20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b :
OVRT1_0127_B02.b : ttta
SPLT1_0038_B03.b :
SPLT1_0070_G04.b : gtgggccccccccaaaattaaaaagggtgtgttgttttttttttttccccccgggaaaaa
CLNT1_0085_B04.b : aaataaagagggcgccaccccaaaatttagtgg
UTR01_0056_D11.b :
OVRT1_0105_A08.b : c
LNG01_0013_E03.b :
OVRT1_0113_C11.b : t
OVRT1_0058_B06.b :
BFLT1_0039_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0074_D11.b :
PST01_0087_C04.b : tcaaaacctcggccaaagttgtgagaccaagggtatatccagagtctttggcctttgggc
KDN01_0083_G04.b : tgggcccaccccaaaattaaacggtgggttggttttgtttctaaacaaaaaa
KDN01_0063_D07.b : gaattttttgagagttagtataaagagggtggcacccccaaaatataacggggggggggg
KDN01_0090_A09.b : tgggcagaaaattttttttagaggtttaatttttaaaggtttggccacaccccacaattt
PBL01_0035_A05.b : ttaaagggggggtggtttttttttttataaaaaaaaaaccccccccctccttctccccct
20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b :
OVRT1_0127_B02.b :
SPLT1_0038_B03.b :
SPLT1_0070_G04.b : aaaaaaaaccctnnnnnnacttattactctctgttctcccccnnnnnnnnnnnnnnnnnn
CLNT1_0085_B04.b :
UTR01_0056_D11.b :
OVRT1_0105_A08.b :
LNG01_0013_E03.b :
OVRT1_0113_C11.b :
OVRT1_0058_B06.b :
BFLT1_0039_C07.b :
LVRM1_0074_D11.b :
PST01_0087_C04.b : cagaaaaatttttttatagagaacttccaccttctc
KDN01_0083_G04.b :
KDN01_0063_D07.b : gnnngtttttnaatcaaaaaaaaannnnnnnnnnnatattgtttctttgtatgctgcggt
KDN01_0090_A09.b : taa
PBL01_0035_A05.b :
20110601C-008179 : ............................................................
---------+---------+---------+---------+---------+---------+ 1102
OVRM1_0193_B10.b :
OVRM1_0155_D01.b :
OVRM1_0013_A02.b :
DCI01_0013_D09.b :
OVRT1_0127_B02.b :
SPLT1_0038_B03.b :
SPLT1_0070_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CLNT1_0085_B04.b :
UTR01_0056_D11.b :
OVRT1_0105_A08.b :
LNG01_0013_E03.b :
OVRT1_0113_C11.b :
OVRT1_0058_B06.b :
BFLT1_0039_C07.b :
LVRM1_0074_D11.b :
PST01_0087_C04.b :
KDN01_0083_G04.b :
KDN01_0063_D07.b : cnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
KDN01_0090_A09.b :
PBL01_0035_A05.b :