[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  ADR01_0062_C03

Library: ADR01 (Adrenal gland)
Individual: LWD2, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 2,035)  [FASTA format sequence]
GAGCCAGGCT GTTGCTGAGC ACCCAGGATC GAGAAGAGAC AGAGGAAAGG GAAGCAGAGA
GAAGCAGCCA AGAGTTGGAG CCAGACCAGG AGGAGCCCGA GTGGAGTTGA AGTTCCTTTT
GCAGAGGCGG CAGCAAGTAA AGCAGTTGAA ACG
ATGCTGG CTGTCTTGGG ACTGCTCACC
TCCTTCCTTT TTTTCCTGTA TGTGACAGCT CCATCCATCA GGAAGTTCTT TGCTGGTGGG
GTTTGTAGGA CAAACATGCA GCTTCCCGGG AAGGTGGTGG TGATCACGGG TGCCAACACG
GGCATTGGCA AGGAGACAGC CAGAGAGCTC GCTCGCAGAG GAGCCCGAGT ATACATTGCC
TGCCGAGATG TACTGAAGGG GGAGTCTGCT GCCAGTGAAA TCCGAGCTGA TACAAAGAAC
TCCCAGGTGC TGGTGCGGAA ACTGGACCTC TCTGATACCA AATCCATCCG AGCCTTTGCT
GAGGGCTTTC TGACAGAGGA AAAGCAGCTC CATATTCTGA TCAACAATGC TGGAGTGATG
TTGTGTCCAT ATTCCAAGAC AGCGGATGGC TTTGAGACCC ACCTGGGAGT CAACCACCTG
GGCCACTTCC TTCTCACGCA CTTGCTCTTG GAGCAGCTGA AGGCATCTGC TCCCGCACGG
GTGGTGAACC TGTCATCCGT GGTCCACCAT GCTGGCAAGA TTCGCTTCCA CGACCTCCAG
GGTGAGAAGC ACTACAACCG GGGTTTTGCT TATTGCCACA GCAAGCTGGC CAACGTGCTC
TTTACTCGGG AACTGGCCAA GAGGCTCCAA GGCACGGGGG TCACCACGTA CGCAGTGCAC
CCAGGCATCG TCCAGTCTGA GCTGGTCCGG CATTCCTTCC TGCTGTGCCT GCTCTGGCGG
CTCTTCTCCC GCTTCCTCAA AACAGCGCGG GAGGGGGCCC AGACCAGCCT GCACTGCGCC
CTGGCCGAGG GCCTGGAGCC CCTGAGCGGC AAGTACTTCA GTGACTGCAA GAGGGCCTGG
GTGTCGCCAA GGGCCCGGAA TAACAAAACG GCCGAGCGCT TGTGGAACGT CAGCTGCGAG
CTCCTGGGAA TCCAGTGGGA GTAGAGCTGC TGGAAGATGC GCGGCTGTAT CAAGCCTGGT
CCAGGCCATA ACGCAGACCG GGGAGATGGC CCACCCCGAA GGACTGACCT GGCTGGCTGC
TGTCCCAAAC ACTTCCCTGC TTTGATTCTC CTGATCCTTG GAAAACCTCC CCACACCTAA
CCCTCTTACC AGGCTGATTC TCGGCATAAG AGGTTCATAC CTGGAGAGCA TCGTCCTTGA
AGACTTGCAG AGTCGGCCAC CTTCTCGGGG CAGGAGGACT GGGCAGATGC CAGGCTGGGC
ACAGGGATGG CAGAGGAACC TGGGAAATTG AGTCAATTTC CTCACCAATA CCAGAAACCC
CAGCCAGCAC CCTCGGGAGG TGTCAGTGTT ACATATTTTC AGGGACATAG ACTCAAACAC
CTGACCGATC TCTTTCCTCT TTGAAATATT AGTCTGCAGT CTGGACTATG TGGACTTAAA
AAATGCACAA CCCGAGAGTT AAGTTTTATG GGGGGCAAAA TTAGGACATA AGCCCAAGAG
ACAGCATCTC AGGTAGCCCT GAGAAACCAC TCTGGGGTGA GGGGGGAAGC TAGGATATGT
GAGTTTTTGC AACAAAGGGA AGATAGTAGA AACAGAAGAT TTATAGATAA CCAGATTTGC
AGAAGATTTA TACAAAACCA GTTTCTCTGG GAAGATGTAA AAGTCTGGGC TTCCCAGAGT
TCCCTTTATG GCTCAGCAGT TAAGGAACCC AACTAGGATC CATGAGGATG TGGGTTTGAT
CCCTGGCTCT GCTCAGTGGG TTGGGGATTC GGCATTGCCG TGAGCTGTGG TGTAGGTCAC
AGATGCAGCT TGCTTGGATC CCGCTTGGCA ACGGCTGTGG TGTAGGCGGG CAGGTGCAGC
TCTGATTCAA CCCCTAGCCT GGTTCCACCC TAAAAAGCAA AAAAAAAAAA AAAAA

Deduced amino acid sequence:  (length: 316) [FASTA format sequence]
MLAVLGLLTS FLFFLYVTAP SIRKFFAGGV CRTNMQLPGK VVVITGANTG IGKETARELA
RRGARVYIAC RDVLKGESAA SEIRADTKNS QVLVRKLDLS DTKSIRAFAE GFLTEEKQLH
ILINNAGVML CPYSKTADGF ETHLGVNHLG HFLLTHLLLE QLKASAPARV VNLSSVVHHA
GKIRFHDLQG EKHYNRGFAY CHSKLANVLF TRELAKRLQG TGVTTYAVHP GIVQSELVRH
SFLLCLLWRL FSRFLKTARE GAQTSLHCAL AEGLEPLSGK YFSDCKRAWV SPRARNNKTA
ERLWNVSCEL LGIQWE


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Homo sapiens]. 550e-156
Contig/Assembly ProteinRDH11retinol dehydrogenase 11 [Homo sapiens]. 430e-120
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 isoform 1 [Homo sapiens]. 2621e-69
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Homo sapiens]. 2481e-65
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 isoform 2 [Homo sapiens]. 65.91e-10


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRdh12retinol dehydrogenase 12 [Mus musculus]. 509e-144
Contig/Assembly ProteinRdh11retinol dehydrogenase 11 [Mus musculus]. 416e-116
Contig/Assembly ProteinRdh13retinol dehydrogenase 13 [Mus musculus]. 2581e-68
Contig/Assembly ProteinRdh14retinol dehydrogenase 14 [Mus musculus]. 2494e-66
Contig/Assembly ProteinCbr3carbonyl reductase 3 [Mus musculus]. 63.56e-10


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC490744PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis) [Canis familiaris]. 525e-149
Contig/Assembly ProteinLOC480366PREDICTED: similar to Retinol dehydrogenase 11 (Retinal reductase 1) (RalR1) (Prostate short-chain dehydrogenase/reductase 1) (Androgen-regulated short-chain dehydrogenase/reductase 1) (HCV core-binding protein HCBP12) [Canis familiaris]. 403e-112
Contig/Assembly ProteinLOC611373PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris]. 2703e-72
Contig/Assembly ProteinLOC482983PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis) isoform 1 [Canis familiaris]. 2482e-65


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Bos taurus]. 549e-156
Contig/Assembly ProteinRDH11PREDICTED: retinol dehydrogenase 11-like [Bos taurus]. 410e-114
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 [Bos taurus]. 2643e-70
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 [Bos taurus]. 1104e-24


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Sus scrofa]. 597e-171
Contig/Assembly ProteinLOC100154684PREDICTED: retinol dehydrogenase 11 [Sus scrofa]. 425e-119
Contig/Assembly ProteinLOC100516970PREDICTED: retinol dehydrogenase 14-like [Sus scrofa]. 2518e-67
Contig/Assembly ProteinLOC100513982PREDICTED: retinol dehydrogenase 12-like [Sus scrofa]. 1066e-23
Contig/Assembly ProteinLOC100519223PREDICTED: dehydrogenase/reductase SDR family member 9-like isoform 1 [Sus scrofa]. 58.22e-08


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-004164.1TTTGCAGAAGATTTATACAAAACCAGTTTCTCTGGGAAGATGTAAAAGTCTGGGCTTCCC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2006061120060611C-00032575fwd
2007080620070806C-00698175fwd
2008051520080515C-00086275fwd
2010100120101001C-01136074fwd
2011060120110601C-00208574fwd