[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  BFLT1_0064_D05

Library: BFLT1 (Brain (frontal lobe))
Individual: D2-14C, Duroc

Nucleotide sequence:   (length: 2,359)  [FASTA format sequence]
AGAGCTGACC GCGACGCAGA CAGGCCCTCC CTCCAGCCTG AGTCAGGCCA GCAGGACAAG
TCTGAGGAGG CTTGAGGCTG GACTCCCAAG AAGCAGGTGG AGCCAGGTGT AGATGCCTTG
CAGGGAGCTG CGGGCATTGG AGAAGAGCGT GAAAGGGCCA CAGGCCAGGA CTGGGCTTCT
TCAGCCTTAC CCGGCCAGGA GACGGCCTCG TGGAGGTGGT CTTTGAGCTG AGAGGGGCCA
CCGAGGAAAG CCAGGTGGAC C
ATGTGGACC CTGGTGAGCT GGGTGGCCTT GGTGACAGGG
CTGGTGGCTG GAACACAGTG CCCGGATGGT CAGCTCTGCC CCGTGGCCTG CTGCCTGGAC
CCGGGAGGAG CCAGCTACAG CTGCTGCAAT CCCGTTCCGG ACAAGTGGCC CAAGGCACTG
AGCCAGCATC TGGGCGTACC CTGCAAGACT AAAGCCCAGT GCCCTCCTGG CCACTCCTGC
ATCCTCACCA CCAATGAGAC CTCCAACTGC TGCCCGTTCC CAGAGGCCGT GTCATGCAGG
GATGGCCTCC ACTGCTGCCC GCAGGGCTTC CACTGCAGTG CTGATGGGTG GTCCTGCCTC
CGAAGACCAG ATACCAAGCC CTCGGATGAC ATCCTGTGCC CCAACAGCCA GTTCCATTGC
CCCAACTCCT CCACGTGCTG CACTATGCTT GACGGCTCCT GGGGCTGCTG CCCCATGCCC
CAGGCTTCCT GCTGTGGAGA CAAGGTGCAC TGCTGCCCCC ACGGCACCTC CTGTGACCTG
GCCCATTCCC GCTGCCTCAC AGTGACCAAC ACCCACCCCA TGGCAAAGAT CCCTTCACAA
GAGACTATAA AGACAGCCGT CCAGTGCCCA GATGCAGAGT CCCAGTGCCA CAATAATTCC
ACCTGCTGCA AGCTGTCCAG TGGAAAGTAT GGCTGCTGCC CGTTGCCCAA TGCCACCTGC
TGCTCCGATC ACATACACTG CTGCCCCCAC GGCTTTGTGT GTGACCCGGT CAAGAAGAAG
TGCTTCTCCA AGGAGAATGA AGCCATAGAC TTCTTCACCA AGTTGCCAGC GCACTCAGTG
CAGGAGGTGA AGTGTGACAC AGAGGTGAGC TGCCCGGACG ACTACACCTG CTGCCGCCTG
CAGTCCGGAA AATGGGGCTG CTGCCCTTTT GTCCAGGCTG TCTGCTGTAA CGACCACGTA
CACTGCTGCC CGACCGGATA TCAGTGTAAC ATAGAGAAGG GCACCTGTGA CCTGGAGACC
CAGTGGGTGC CCTGGAAGGA GAAGATCCCG GCCAGCCTCA GCCGGCCGGA CCTCCTAGCC
ATGGAGAGAG ATGTCCCCTG TGATAACGTC TCCAGCTGTC CCTCCTCCAG TACCTGCTGT
CCAGTCACGC CTGGAGAGTG GGGCTGCTGT CCTGCCCCAG AGGCTGTCTG CTGCTCGGAC
CACCAGTACT GCTGCCCCAA GGGCCACACG TGTGTCGGCA AGGGACACTG TAAGAGGAAG
AAGGACATGG TGACCGGACT GAACAAGATG CCCACCCGCC GGGCTTCCGC GTCCCAGCCC
GGAAACACCA CGGGCTGTGA CCAGCACACC AGTTGCCCGG TGGGGCAGAC CTGCTGCCCG
AGCCTGAGCA AGGGCTGGGC CTGCTGCCAG CTGCCCCACG CCGTGTGCTG TGAGGACCGC
CAGCACTGCT GCCCGGCTGG CTACACCTGC AACGTGAAGG CCCGAACATG TGAGAAGGAG
GAGGACTCTG CCCTCCCTGC CACCCACCTG GCCCGTGTGG GCGACGTGGC GTGTGGGGAA
CGGCGCTTCT GCCACAACAA CTATACCTGC TGCCGAGACA GTCTTGGAGG CTGGGCCTGC
TGTCCCTACC GCCAGGGCAT CTGTTGTGCA GACGGGCGTC ACTGCTGCCC GGCAGGCTTC
CGCTGTGGGG CCAGGGGCAC CAAGTGCTTG CACAAGGAGG CCCTGCGCTG GGACGCTCCT
CTGAGGGACC CGGCTCCAAG ACAGCTGCTG TGAGGAGGGC CCGAAGACAC TCCGCAGCCC
TCGGGACCCT GCTCGGAGGG TGCCCACTGC TCAGGCCTCC CCAGCACCTC TCCCTCACTG
AATTCTCCAG AACCCCCCTT CTGAGTTCCC CCCATCACCC TAGAAGGTGG GGCCTCAATT
TAAGGTCCTC CCTATTGGAA GGGGGGGCTG TGGCGAAGGC CACAGTTCAA GCTGCCATCC
CCTCCCCCCG ATTTTAGTGG ACCCCGTGGC CAGGTGCTCT TCCCTATCCA CGGGGGGTGG
TGTGTGTGCG TGTGTGTGTG TGTGTGTGTG TGCGCTGCAA TAAAGTTTGT ACACTTTCTT
AAAAAAAAAA AAAAAAAAA

Deduced amino acid sequence:  (length: 583) [FASTA format sequence]
MWTLVSWVAL VTGLVAGTQC PDGQLCPVAC CLDPGGASYS CCNPVPDKWP KALSQHLGVP
CKTKAQCPPG HSCILTTNET SNCCPFPEAV SCRDGLHCCP QGFHCSADGW SCLRRPDTKP
SDDILCPNSQ FHCPNSSTCC TMLDGSWGCC PMPQASCCGD KVHCCPHGTS CDLAHSRCLT
VTNTHPMAKI PSQETIKTAV QCPDAESQCH NNSTCCKLSS GKYGCCPLPN ATCCSDHIHC
CPHGFVCDPV KKKCFSKENE AIDFFTKLPA HSVQEVKCDT EVSCPDDYTC CRLQSGKWGC
CPFVQAVCCN DHVHCCPTGY QCNIEKGTCD LETQWVPWKE KIPASLSRPD LLAMERDVPC
DNVSSCPSSS TCCPVTPGEW GCCPAPEAVC CSDHQYCCPK GHTCVGKGHC KRKKDMVTGL
NKMPTRRASA SQPGNTTGCD QHTSCPVGQT CCPSLSKGWA CCQLPHAVCC EDRQHCCPAG
YTCNVKARTC EKEEDSALPA THLARVGDVA CGERRFCHNN YTCCRDSLGG WACCPYRQGI
CCADGRHCCP AGFRCGARGT KCLHKEALRW DAPLRDPAPR QLL


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGRNgranulins precursor [Homo sapiens]. 9530.0
Contig/Assembly ProteinMEGF10multiple epidermal growth factor-like domains protein 10 precursor [Homo sapiens]. 65.92e-10
Contig/Assembly ProteinKRTAP10-11keratin-associated protein 10-11 [Homo sapiens]. 60.85e-09
Contig/Assembly ProteinLRP1prolow-density lipoprotein receptor-related protein 1 precursor [Homo sapiens]. 59.71e-08
Contig/Assembly ProteinLRP2low-density lipoprotein receptor-related protein 2 precursor [Homo sapiens]. 54.74e-07


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGrngranulins [Mus musculus]. 8720.0
Contig/Assembly ProteinMegf6multiple epidermal growth factor-like domains protein 6 precursor [Mus musculus]. 76.68e-14
Contig/Assembly ProteinMegf10multiple epidermal growth factor-like domains protein 10 precursor [Mus musculus]. 70.17e-12
Contig/Assembly ProteinMegf11multiple epidermal growth factor-like domains protein 11 isoform 1 [Mus musculus]. 60.18e-09
Contig/Assembly ProteinFbn2fibrillin-2 precursor [Mus musculus]. 54.73e-07


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480501PREDICTED: similar to granulin isoform 1 precursor [Canis familiaris]. 7000.0
Contig/Assembly ProteinLOC489619PREDICTED: similar to EGF-like-domain, multiple 3 [Canis familiaris]. 77.46e-14
Contig/Assembly ProteinLOC474665PREDICTED: similar to MEGF10 protein [Canis familiaris]. 70.57e-12
Contig/Assembly ProteinLOC481726PREDICTED: similar to Neurogenic locus notch homolog protein 4 precursor (Notch 4) (hNotch4) [Canis familiaris]. 678e-11
Contig/Assembly ProteinLOC476136PREDICTED: similar to Low-density lipoprotein receptor-related protein 1B precursor (Low-density lipoprotein receptor-related protein-deleted in tumor) (LRP-DIT) [Canis familiaris]. 523e-06


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGRNgranulins [Bos taurus]. 9660.0
Contig/Assembly ProteinMEGF10PREDICTED: multiple EGF-like-domains 10 [Bos taurus]. 72.81e-12
Contig/Assembly ProteinSSPOSCO-spondin precursor [Bos taurus]. 54.74e-07


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGRNgranulins [Sus scrofa]. 13060.0
Contig/Assembly ProteinLOC100624571PREDICTED: multiple epidermal growth factor-like domains protein 6-like [Sus scrofa]. 774e-14
Contig/Assembly ProteinMEGF10PREDICTED: multiple epidermal growth factor-like domains protein 10 [Sus scrofa]. 67.83e-11
Contig/Assembly ProteinLOC100621722PREDICTED: fibulin-2-like [Sus scrofa]. 60.54e-09
Contig/Assembly ProteinLOC100514839PREDICTED: prolow-density lipoprotein receptor-related protein 1-like [Sus scrofa]. 58.91e-08


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-002224.1AGTTCCCCCCATCACCCTAGAAGGTGGGGCCTCAATTTAAGGTCCTCCCTATTGGAAGGG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2010100120101001C-00645217fwd
2011060120110601C-00715916fwd