[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  BFLT1_0103_G03

Library: BFLT1 (Brain (frontal lobe))
Individual: D2-14C, Duroc

Nucleotide sequence:   (length: 1,550)  [FASTA format sequence]
GGGTCGGGTT TGCGAGCCAC CTCCGGCATC CAGGAGGAAA ACCCCGCTTG CGGAGCCCAT
AGGTGTGGCC CACTGACGAT CGGTGGGAGT CGTGCGTGGG GTTGGGAGTT GACTCCGGGT
GTACTTCTGT GTTTCTGCTC ATCCTTTCCG TAG
ATGTCTC ATATGGAGCT GGGGTTGGAC
TCGGGTGACG ATGACTTGCT GGGCTTCCTG TTAGAGGAAA GCGGAGGTCT GGGGGCGGCG
CGGGACGAAG CCTTGGAGGC GCCCCTGGAT TGGGAGCTAC CACTTTCCGA GGCATTGAGC
GATTGGGACG TAGAGGATTT CCTGAGCTGC CTGTCGAGTC CCCCAGCATC GTTGACCGAT
TTTAGCCACT CTGACCCCTA TCTTGTCCAC CATGATCACA CCTATTCCCT GTCACAGGAG
TATGTCTCCA TAGATCTAGA TAATGAGGAT TATGAGAAGG AAGGGGCCCA AATGACTTCC
CTGCGTGTGG AGGCGCCCGC AGAGCAGGAG ATTGGTGAGC TGATACTGAC GGAGGAGGAG
AAGAGGCTTT TGGAGAAGGA GGGGCTTACT CTGCCCGGGA CACTTCCTCT CACTAAGATG
GAGGAACAAG TTCTGAGACG AGTGCGAAGG AAGATTCGAA ACAAAAAGTC TGCTCAAGAG
AGCCGCAGGA AGAAGAAGGT GTATGTGGGG AGTTTAGAGA GCAGGGTCCT GAAATACTCG
GCCCAGAATC TGGAGCTACA GAACAAAGTA CAGCTCCTGG AGGAGCAGAA TCTGTCCCTT
TTGGATCAGT TGAGGAGGCT GCAGTCCATG GTGATTCAGA CGGCAAACAA AGCCAGCAGC
AGCAGCACCT GCATCTTGGT CCTGCTCTTC TCCTTCTGTC TCCTCTTCGT ACCTGCCATG
TACTCCTCGG ACACAAGGGG GAGCCCGCCA GCCGAGCATG GAGTGTTGTC CCGCCAGCTT
CGTGCCCTCC CCAGCGAGGA CGTTCCCCAG CGGGACCTGC CTGCACTGCA GTCAGAGGTA
CCACAGGACA GCTCAACCCA CGAGCTCCAG GCTCCTGGCA ACTCTTGCTG CCTGTTCCAC
CACATGGCTT GGGCTCCTGG GGCAGAATCG CCCATGAAGC TGCCACTGCC CGACCGCTTC
TCAAGGTCTT CTAGCCCAGG TCCCATCTTC CCCCTGCATG CAAATCTCAC AAGAGAGGGA
GGATGGCTCC CTACCCACAG CCCCATATCT GTTACCTTGC AGGGCAGGTA CTCAGGCTAG
ATGTGAGAAT GCAGGGGGCC TCAGCCAGAG CCTGGTGCCC CCAGTCTGTG TTCAAAGGAA
AAGGAATGGG AGAGGGTGAG CCTCAGGTCC TGTCCCCTGT CAGGAAGCCT GAGGGCACAA
ACACACCACA CTTACTGGCT TTCTGGGGTT TTATTTGCAC CCATGTATGT CTGTTGTTCC
ATTAAGGGGC CTGGGAGAGT CCACTGACTT CCTTGAACAT TTCATGCAAT GAGGGGATGG
GGTGAAGAAA GAAATAAATA AGTGATTCTG AAAAAAAAAA AAAAAAAAAA

Deduced amino acid sequence:  (length: 368) [FASTA format sequence]
MSHMELGLDS GDDDLLGFLL EESGGLGAAR DEALEAPLDW ELPLSEALSD WDVEDFLSCL
SSPPASLTDF SHSDPYLVHH DHTYSLSQEY VSIDLDNEDY EKEGAQMTSL RVEAPAEQEI
GELILTEEEK RLLEKEGLTL PGTLPLTKME EQVLRRVRRK IRNKKSAQES RRKKKVYVGS
LESRVLKYSA QNLELQNKVQ LLEEQNLSLL DQLRRLQSMV IQTANKASSS STCILVLLFS
FCLLFVPAMY SSDTRGSPPA EHGVLSRQLR ALPSEDVPQR DLPALQSEVP QDSSTHELQA
PGNSCCLFHH MAWAPGAESP MKLPLPDRFS RSSSPGPIFP LHANLTREGG WLPTHSPISV
TLQGRYSG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCREB3cyclic AMP-responsive element-binding protein 3 [Homo sapiens]. 380e-105
Contig/Assembly ProteinCREB3L4cyclic AMP-responsive element-binding protein 3-like protein 4 [Homo sapiens]. 98.22e-20
Contig/Assembly ProteinCREB3L3cyclic AMP-responsive element-binding protein 3-like protein 3 [Homo sapiens]. 86.76e-17
Contig/Assembly ProteinCREB3L2cyclic AMP-responsive element-binding protein 3-like protein 2 [Homo sapiens]. 71.22e-12
Contig/Assembly ProteinCREB3L1cyclic AMP-responsive element-binding protein 3-like protein 1 [Homo sapiens]. 67.83e-11


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCreb3cyclic AMP-responsive element-binding protein 3 [Mus musculus]. 2733e-73
Contig/Assembly ProteinCreb3l4cyclic AMP-responsive element-binding protein 3-like protein 4 [Mus musculus]. 943e-19
Contig/Assembly ProteinCreb3l3cyclic AMP-responsive element-binding protein 3-like protein 3 [Mus musculus]. 84.72e-16
Contig/Assembly ProteinLOC638517PREDICTED: cyclic AMP-responsive element-binding protein 3-like protein 2-like [Mus musculus]. 71.22e-12
Contig/Assembly ProteinCreb3l2cyclic AMP-responsive element-binding protein 3-like protein 2 [Mus musculus]. 71.22e-12


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC611934PREDICTED: similar to cAMP responsive element binding protein 3 [Canis familiaris]. 400e-111
Contig/Assembly ProteinLOC612303PREDICTED: similar to cAMP responsive element binding protein 3-like 4 [Canis familiaris]. 95.12e-19
Contig/Assembly ProteinLOC485046PREDICTED: similar to cAMP responsive element binding protein 3-like 3 [Canis familiaris]. 85.51e-16
Contig/Assembly ProteinLOC491369PREDICTED: similar to cAMP responsive element binding protein 3-like 2 [Canis familiaris]. 71.22e-12
Contig/Assembly ProteinLOC483636PREDICTED: similar to cAMP responsive element binding protein 3-like 1 [Canis familiaris]. 67.83e-11


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCREB3cyclic AMP-responsive element-binding protein 3 [Bos taurus]. 441e-124
Contig/Assembly ProteinCREB3L4PREDICTED: cAMP responsive element binding protein 3-like 4-like [Bos taurus]. 98.69e-21
Contig/Assembly ProteinCREB3L3cyclic AMP-responsive element-binding protein 3-like protein 3 [Bos taurus]. 84.72e-16
Contig/Assembly ProteinCREB3L2cyclic AMP-responsive element-binding protein 3-like protein 2 [Bos taurus]. 71.22e-12


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCREB3cyclic AMP-responsive element-binding protein 3 [Sus scrofa]. 565e-161
Contig/Assembly ProteinLOC100627545PREDICTED: hypothetical protein LOC100627545 [Sus scrofa]. 1303e-30
Contig/Assembly ProteinCREB3L4cyclic AMP-responsive element-binding protein 3-like protein 4 [Sus scrofa]. 95.19e-20
Contig/Assembly ProteinLOC100522979PREDICTED: cyclic AMP-responsive element-binding protein 3-like protein 3-like isoform 2 [Sus scrofa]. 85.96e-17


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-003694.1CCTTGAACATTTCATGCAATGAGGGGATGGGGTGAAGAAAGAAATAAATAAGTGATTCTG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2010100120101001C-00692811fwd
2011060120110601C-00769511fwd