[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  HTMT1_0065_A07

Library: HTMT1 (Hypothalamus)
Individual: D2-14C, Duroc

Nucleotide sequence:   (length: 930)  [FASTA format sequence]
AAGAGGGTCA TCATCTCTGC CCCTTCTGCC GATGCCCCCA TGTTTGTGAT GGGCGTGAAC
CATGAGAAGT ATGACAACTC CCTCAAGATC GTCAGCAATG CCTCCTGCAC CACCAACTGC
TTGGCACCCC TGGCCAAGGT CATCCATGAC CACTTCGGCA TCGTGGAGGG ACTCATGACC
ACGGTCCATG CCATCACTGC CACCCAGAAG ACTGTGGATG GCCCGTCTGG GAAGCTGTGG
CGTGATGGCC GAGGGGCTGC CCAGAACATC ATCCCTGCTT CTACCGGCGC TGCCAAGGCT
GTGGGCAAGG TCATCCCTGA GCTCAACGGG AAGCTCACTG GCATGGCCTT CCGTGTCCCC
ACCCCCAACG TGTCGGTTGT GGATCTGACC TGCCGCCTGG AGAAACCTGC AAAATATGAT
GACATCAAGA AGGTGGTGAA GCAGGCGTCC GAGGGCCCCC TCAAGGGCAT CCTGGGCTAC
ACTGAGGACC AGGTTGTGTC CTGTGACTTC AACAGTGACA CTCACTCTTC CACTTTTGAT
GCTGGGGCTG GCATTGCCCT CAACGACCAC TTCGTCAAGC TCATTTCCTG GTACGACAAT
GAATTTGGCT ACAGCAACAG GGTGGTGGAC CTCATGGTCC ACATGGCCTC CAAGGAGTAA
GAGCCCCTGG ACCACCAACC CCAGCAAGAG CACGCGAGGA GGAGAGAGGC CCTCAGCTGC
TGGGGAGTCA CAGCCCCAAC TCGATCCCCC AACACACCGA GCATCTCCTG ACTTCCAGTT
TCCATCCCAG ACCCCCGGAA GAAGGGGAGG GGCTTAGGGA GACCTGCCTC GTCATGTACC
ATCAATAAAG TACACTGTAC CCAGCAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA

Deduced amino acid sequence:  (length: 206) [FASTA format sequence]
MFVMGVNHEK YDNSLKIVSN ASCTTNCLAP LAKVIHDHFG IVEGLMTTVH AITATQKTVD
GPSGKLWRDG RGAAQNIIPA STGAAKAVGK VIPELNGKLT GMAFRVPTPN VSVVDLTCRL
EKPAKYDDIK KVVKQASEGP LKGILGYTED QVVSCDFNSD THSSTFDAGA GIALNDHFVK
LISWYDNEFG YSNRVVDLMV HMASKE


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGAPDHglyceraldehyde-3-phosphate dehydrogenase [Homo sapiens]. 426e-119
Contig/Assembly ProteinGAPDHSglyceraldehyde-3-phosphate dehydrogenase, testis-specific [Homo sapiens]. 3408e-94


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100042025PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like isoform 2 [Mus musculus]. 429e-120
Contig/Assembly ProteinGapdhglyceraldehyde-3-phosphate dehydrogenase [Mus musculus]. 429e-120
Contig/Assembly ProteinLOC100048117PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like isoform 1 [Mus musculus]. 427e-120
Contig/Assembly ProteinLOC100505181PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Mus musculus]. 426e-119
Contig/Assembly ProteinLOC100504897PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Mus musculus]. 415e-116


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGAPDHglyceraldehyde-3-phosphate dehydrogenase [Canis lupus familiaris]. 436e-122
Contig/Assembly ProteinLOC610978PREDICTED: similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) [Canis familiaris]. 424e-119
Contig/Assembly ProteinLOC478030PREDICTED: similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) [Canis familiaris]. 421e-118
Contig/Assembly ProteinLOC610683PREDICTED: similar to glyceraldehyde-3-phosphate dehydrogenase [Canis familiaris]. 417e-117
Contig/Assembly ProteinLOC476969PREDICTED: similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) [Canis familiaris]. 393e-109


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGAPDHglyceraldehyde-3-phosphate dehydrogenase [Bos taurus]. 438e-123
Contig/Assembly ProteinGAPDHPREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like isoform 2 [Bos taurus]. 438e-123
Contig/Assembly ProteinGAPDHSglyceraldehyde-3-phosphate dehydrogenase, testis-specific [Bos taurus]. 3431e-94
Contig/Assembly ProteinLOC616200PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Bos taurus]. 2501e-66


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGAPDHglyceraldehyde-3-phosphate dehydrogenase [Sus scrofa]. 442e-125
Contig/Assembly ProteinLOC100517097PREDICTED: glyceraldehyde-3-phosphate dehydrogenase, testis-specific-like [Sus scrofa]. 2761e-74
Contig/Assembly ProteinLOC100627835PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like, partial [Sus scrofa]. 2376e-63
Contig/Assembly ProteinLOC100622051PREDICTED: glyceraldehyde-3-phosphate dehydrogenase, testis-specific-like [Sus scrofa]. 1883e-48


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-047244.1AGGGGAGGGGCTTAGGGAGACCTGCCTCGTCATGTACCATCAATAAAGTACACTGTACCC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2010100120101001C-00036852fwd
2011060120110601C-00026456fwd