[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  HTMT1_0093_E12

Library: HTMT1 (Hypothalamus)
Individual: D2-14C, Duroc

Nucleotide sequence:   (length: 2,042)  [FASTA format sequence]
GAGCGCCTCG CCCCGCCTGC CCCGCAGCCG GGTCGCGTAG ACATCAGCTC CGGGCACAGC
ACAGGTGGGC TGGGGAAGCC AGAGACCCAG GCGCTCCACC GCCACCGATC GGGATTGGAG
GTCTGCGCAA GGACC
ATGGG TGCGTCGCTG GGCAGCGGCG CGCGGGTGGC TCTCCTGCCC
CGCCAGGCCT GCGGCGCCGT CCGGCGCTGG GCACCCCCCG CGCCCGCCCG AGGCTGCCAC
TCCAAGACGG GCCTGCCGCG TCCTGTGCCC CTGAAGAAGC GCGGATACGA TGTCACCAGG
AATCCGCATC TCAACAAGGG TATGGCCTTC ACACTTGAAG AAAGGCTGCA GCTTGGAATC
CATGGCCTAA TCCCCCCCTG CTTCTTGAGC CAGGACGTCC AGCTCCTCCG GATCATGAGA
TACTACGAGC GGCAGCAGAG TGACCTGGAC AAGTACATCA TTCTGATGAC CCTCCAAGAC
CGGAACGAGA AGCTCTTCTA CCGAGTGCTG ACGTCCGACG TGGAGAAATT CATGCCCATC
GTGTACACGC CCACCGTGGG ACTGGCCTGT CAGCACTACG GCCTGACCTT CCGCAGGCCC
CGTGGGCTCT TTATCACCAT TCATGACAAG GGCCATCTTC CAACAATGCT GAACTCTTGG
CCAGAAGATG ATATTAAGGC TGTGGTGGTG ACCGATGGGG AGCGCATCCT GGGCCTGGGA
GACCTGGGCT GCTACGGCAT GGGCATCCCC GTGGGCAAGC TGGCCCTGTA CACGGCGTGT
GGAGGCGTCA ACCCTCGGCA GTGCCTCCCT GTCCTGCTGG ACGTCGGCAC CAACAACGAG
GAGCTGCTCC GAGACCCTCT GTACATCGGC CTGAAGCACC GGCGCGTGCG CGGCCAAGAT
TACGACGACC TTCTGGACGA GTTCATGCAG GCTGTGACGG ACAAGTTTGG AATAAATTGC
CTCATTCAGT TTGAAGACTT TGCCAACGCC AATGCCTTCC GCCTTCTCAA CAAATACCGC
AACAAGTACT GCATGTTCAA CGATGACATC CAAGGCACAG CCTCCGTCGC TGTGGCAGGG
ATCCTGGCTG CTCTGCGAAT CACCAAGAAC AAGCTCTCCA ACCACGTGTT TGTTTTCCAA
GGTGCCGGTG AGGCAGCCAT GGGCATCGCC CACCTCCTTG TCATGGCCCT AGAGAAAGAA
GGTGTACCCA AGGCAGAGGC CACAAGGAAG ATCTGGATGG TGGACTCCAG AGGGCTCATT
GTCAAGGGGA GGAGCCACCT GAACCATGAG AAGGAGATGT TTGCCCAGGA CCATCCTGAA
GTGAGCTCCC TCGAGGAGGT GGTGAGGCTG GTGAAGCCCA CGGCCATCAT AGGTGTTGCC
GCCATCGCAG GAGCCTTCAC GGAGCAGATT CTGAGGGACA TGGCCTCCTT CCACGAGCGC
CCTATCATCT TTGCCCTGAG CAACCCCACC AGCAAGGCCG AGTGCACGGC TGAGAAGTGC
TACCGGGTCA CCGAGGGCCG AGGGATCTTT GCCAGTGGAA GTCCTTTTAA AAGCGTGACC
CTGGAAGATG GCAGGACCTT CATTCCTGGG CAGGGCAACA ACGCCTACGT GTTCCCCGGA
GTGGCTCTGG GCGTCATCGC TGGTGGGATC CGGCACATCC CAGACGAGAT CTTCCTCCTG
ACAGCAGAGC AAATTGCCCA AGAGGTCTCG GAGCAGCATC TGTCACAGGG GAGACTGTAC
CCACCGCTCA GCACCATCCG AGACGTGTCT CTGAGAATCG CCATCAAAGT CCTCGACTAC
GCGTACAAAC ACAACCTGGC CTCCTACTAC CCAGAGCCCA AGGACAAGGA GGCTTTTGTA
AGATCCCTGG TCTATACTCC AGACTATGAC TCCTTTACGC TGGACAGCTA CACTTGGCCC
AAGGAAGCCA TGAATGTTCA GAATGTCTGA TGCAATTGCA GAGGTTCATG GGGGGCTGGA
TGAAGCCCAA AGTAACACTG GAACTATAAA TGGGATCCAA ACTGGCAAAA AAAAAAAAAA
AA

Deduced amino acid sequence:  (length: 604) [FASTA format sequence]
MGASLGSGAR VALLPRQACG AVRRWAPPAP ARGCHSKTGL PRPVPLKKRG YDVTRNPHLN
KGMAFTLEER LQLGIHGLIP PCFLSQDVQL LRIMRYYERQ QSDLDKYIIL MTLQDRNEKL
FYRVLTSDVE KFMPIVYTPT VGLACQHYGL TFRRPRGLFI TIHDKGHLPT MLNSWPEDDI
KAVVVTDGER ILGLGDLGCY GMGIPVGKLA LYTACGGVNP RQCLPVLLDV GTNNEELLRD
PLYIGLKHRR VRGQDYDDLL DEFMQAVTDK FGINCLIQFE DFANANAFRL LNKYRNKYCM
FNDDIQGTAS VAVAGILAAL RITKNKLSNH VFVFQGAGEA AMGIAHLLVM ALEKEGVPKA
EATRKIWMVD SRGLIVKGRS HLNHEKEMFA QDHPEVSSLE EVVRLVKPTA IIGVAAIAGA
FTEQILRDMA SFHERPIIFA LSNPTSKAEC TAEKCYRVTE GRGIFASGSP FKSVTLEDGR
TFIPGQGNNA YVFPGVALGV IAGGIRHIPD EIFLLTAEQI AQEVSEQHLS QGRLYPPLST
IRDVSLRIAI KVLDYAYKHN LASYYPEPKD KEAFVRSLVY TPDYDSFTLD SYTWPKEAMN
VQNV


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME3NADP-dependent malic enzyme, mitochondrial precursor [Homo sapiens]. 11030.0
Contig/Assembly ProteinME1NADP-dependent malic enzyme [Homo sapiens]. 8160.0
Contig/Assembly ProteinME2NAD-dependent malic enzyme, mitochondrial isoform 1 precursor [Homo sapiens]. 6370.0


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMe3NADP-dependent malic enzyme, mitochondrial precursor [Mus musculus]. 10920.0
Contig/Assembly ProteinMe1NADP-dependent malic enzyme isoform 1 [Mus musculus]. 8130.0
Contig/Assembly ProteinMe2NAD-dependent malic enzyme, mitochondrial precursor [Mus musculus]. 629e-180
Contig/Assembly ProteinLOC100505264PREDICTED: NAD-dependent malic enzyme, mitochondrial-like [Mus musculus]. 583e-166


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC485151PREDICTED: similar to malic enzyme 3, NADP(+)-dependent, mitochondrial isoform 2 [Canis familiaris]. 10960.0


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME3NADP-dependent malic enzyme, mitochondrial [Bos taurus]. 10970.0
Contig/Assembly ProteinME1NADP-dependent malic enzyme [Bos taurus]. 7830.0
Contig/Assembly ProteinME2NAD-dependent malic enzyme, mitochondrial [Bos taurus]. 6360.0
Contig/Assembly ProteinLOC100299244PREDICTED: predicted protein-like, partial [Bos taurus]. 622e-09


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME3PREDICTED: LOW QUALITY PROTEIN: NADP-dependent malic enzyme, mitochondrial [Sus scrofa]. 11300.0
Contig/Assembly ProteinME1PREDICTED: NADP-dependent malic enzyme [Sus scrofa]. 8230.0
Contig/Assembly ProteinME2PREDICTED: NAD-dependent malic enzyme, mitochondrial [Sus scrofa]. 523e-148


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-050474.1TTCTCAACAAATACCGCAACAAGTACTGCATGTTCAACGATGACATCCAAGGCACAGCCT


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2010100120101001C-01232310fwd
2011060120110601C-00824510fwd