[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  ITT01_0042_E12

Library: ITT01 (Intestine)
Individual: LWD2, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 2,752)  [FASTA format sequence]
CCTTGTCCGG CCCCCTCGCC CGGCCCCGCC CCGGCCCGCC CCGGCCCGCC CCGGCCATCC
GCCATCACTG CGCCGCTCTC AGCGGCATCC TCCGGATCAG TTTCGCGCCA AATTGTTTGG
CAAGCAAAAT GGAGCCCGGA AGGAGGCCAG GAGGCCTCCG CAGCCAATCC TCTTCGGCGG
CCGGCCCTGG GGGGCGGGAC TCGCGGGCGC AGAGCGGTCC AATCGCTGGT CGCGCAGCCC
TGGCGAACCA ATGAGGGCAC AGCAGCCGCG GCGTCCAAAC CGCAGCGTCT ATTTTTTCCC
GCGAAACTCA GCGGAGGACC GTGGGGGCTT GTGAATCTCT GGTTCCGGGA AGCGCGGGAA
GGGAGAGGTG CAGTC
ATGTC AGGCTTCGAC GACCCCGGCA TTTTCTACAG CGACAGCTTC
GGCGGGGACA ACGCGGCGGA TGAGGGGCAG GCCCGCAAGT CGCAGCTGCA GAGGCGCTTC
AAGGAGTTCC TGCGGCAGTA CCGCGTGGGC ACCGACCGCA CCGGCTTCAC CTTCAAGTAC
AGGGATGAAC TCAAGCGGCA TTATAACCTG GGGGAGTATT GGATCGAGGT GGAGATGGAG
GACCTGGCCA GCTTCGACGA GGACCTGGCC GACTACCTGT ACAAGCAGCC AGCTGAGCAT
TTGCAGCTGC TGGAGGAAGC TGCCAAGGAG GTGGCTGATG AGGTGACCCG GCCCCGGCCC
ACTGGCGATG AGGTGCTCCA GGACATCCAG GTCATGCTCA AGTCGGACGC CAGCCCGTCC
AGCATCCGGA GCCTGAAGTC GGACACGATG TCGCACCTGG TGAAGATCCC GGGCATCGTC
ATCGCCGCCT CCGGGGTCCG CGCCAAGGCC ACCCGCATCT CCATCCAGTG CCGCAGCTGC
CGAAACACCC TCACCAACAT CGCCATGCGC CCCGGCCTGG AGGGCTACGC CCTGCCCAGG
AAGTGCAACA CGGATCAGGC CGGGCGCCCC AAGTGCCCGC TGGACCCGTA CTTCATCATG
CCCGACAAGT GCAAGTGTGT GGACTTCCAG ACCCTGAAGT TGCAGGAGCT GCCGGACGCG
GTGCCTCACG GCGAGATGCC CAGACACATG CAGCTCTACT GCGACAGGTA CCTGTGTGAC
AAGGTCGTCC CTGGAAACAG GGTCACCATC ATGGGCATCT ACTCCATCAA GAAGTTTGGC
CTGACCTCCA ACAGGGGCCG CGACAGGGTG GGCGTGGGCA TCCGGAGCGC CTACATCCGG
GTCCTGGGCA TCCAGGTGGA CACGGATGGC TCTGGCCGCA GCTTTGCCGG GGCCGTGACC
CCGCAGGAGG AGGAGGAGTT CCGGCGGCTG GCCGCCCTCC CCAACGTCTA CGAGGTCGTC
TCCAAGAGCA TCGCCCCCTC CATCTTCGGA GGCACGGACA TGAAGAAGGC CATCGCCTGC
CTGCTCTTCG GGGGTTCCCG AAAGAGGCTC CCCGATGGCC TCACTCGCCG AGGAGACATC
AACCTGCTGA TGCTGGGGGA CCCGGGGACG GCCAAGTCCC AGTTGCTGAA GTTTGTGGAG
AAGTGCTCTC CCATCGGGGT GTACACGTCT GGGAAGGGCA GCAGCGCGGC TGGCCTGACC
GCCTCGGTGA TGAGGGACCC CTCGTCCCGG AACTTCATCA TGGAGGGCGG GGCCATGGTC
CTGGCCGATG GCGGTGTCGT CTGTATCGAT GAGTTTGACA AGATGCGCGA AGACGACCGT
GTGGCGATCC ACGAGGCCAT GGAGCAGCAG ACCATCTCCA TTGCCAAGGC CGGCATCACC
ACCACCCTCA ACTCGCGCTG CTCCGTCCTG GCCGCCGCCA ACTCGGTGTT CGGCCGCTGG
GATGAGACGA AGGGGGAGGA CAACATCGAC TTCATGCCCA CCATCCTGTC GCGCTTCGAC
ATGATCTTCA TCGTCAAGGA CGAGCACAAC GAGGAGAGGG ACGTGATGCT GGCCAAGCAT
GTCATCACTC TGCACGTGAG CGCACTGACG CAGACCCAGG CCGTGGAGGG CGAGATCGAC
CTGGCCAAGC TGAAGAAGTT CATCGCCTAC TGCCGCGCGA AGTGTGGTCC CCGGCTGTCG
GCCGAGGCCG CAGAGAAGCT CAAGAACCGG TACATCATCA TGCGGAGCGG GGCCCGTCAA
CACGAGAGGG ACAGCGACCG CCGCTCCAGC ATCCCCATCA CCGTGCGGCA GCTGGAGGCC
ATCGTGCGCA TTGCCGAGGC CTTCAGCAAG ATGAAGCTGC AGCCCTTCGC CACGGAGGCG
GACGTGGAGG AGGCCCTGAG GCTCTTCCAA GTGTCCACGC TGGACGCCGC CTTGTCGGGC
ACCCTGTCAG GGGTGGAGGG CTTCACCAGC CAGGAGGACC AGGAGTTGCT GAGCCGCATT
GAGAAGCAGC TCAAGCGCCG CTTTGCCATC GGCTCCCAGG TGTCAGAGCA CAGCATCATC
CAGGACTTCA CCAAGCAGAA GTACCCGGAG CACGCCATCC ACAGGGTTCT GCAGCTCATG
CTGCGGCGGG GCGAGCTCCA GCATCGCATG CAGCGCAAGG TCCTCTACCG CCTCAAGTGA
GCTGCACCAC CCGCCGCAGG AAACCACCTC TACCACCTCG AACCCTGTCC TGCACACTCT
CGCTGCTAGG TGCCTCCCTC GGCTGCTGGT CCAAGAAACG TGCTTTTGAA GTCACTGAAG
TAATAAAGCC ATGATGTGTT TGGAAAAAAA AAAAAAAAAA AAAAAAAAAA AA

Deduced amino acid sequence:  (length: 734) [FASTA format sequence]
MSGFDDPGIF YSDSFGGDNA ADEGQARKSQ LQRRFKEFLR QYRVGTDRTG FTFKYRDELK
RHYNLGEYWI EVEMEDLASF DEDLADYLYK QPAEHLQLLE EAAKEVADEV TRPRPTGDEV
LQDIQVMLKS DASPSSIRSL KSDTMSHLVK IPGIVIAASG VRAKATRISI QCRSCRNTLT
NIAMRPGLEG YALPRKCNTD QAGRPKCPLD PYFIMPDKCK CVDFQTLKLQ ELPDAVPHGE
MPRHMQLYCD RYLCDKVVPG NRVTIMGIYS IKKFGLTSNR GRDRVGVGIR SAYIRVLGIQ
VDTDGSGRSF AGAVTPQEEE EFRRLAALPN VYEVVSKSIA PSIFGGTDMK KAIACLLFGG
SRKRLPDGLT RRGDINLLML GDPGTAKSQL LKFVEKCSPI GVYTSGKGSS AAGLTASVMR
DPSSRNFIME GGAMVLADGG VVCIDEFDKM REDDRVAIHE AMEQQTISIA KAGITTTLNS
RCSVLAAANS VFGRWDETKG EDNIDFMPTI LSRFDMIFIV KDEHNEERDV MLAKHVITLH
VSALTQTQAV EGEIDLAKLK KFIAYCRAKC GPRLSAEAAE KLKNRYIIMR SGARQHERDS
DRRSSIPITV RQLEAIVRIA EAFSKMKLQP FATEADVEEA LRLFQVSTLD AALSGTLSGV
EGFTSQEDQE LLSRIEKQLK RRFAIGSQVS EHSIIQDFTK QKYPEHAIHR VLQLMLRRGE
LQHRMQRKVL YRLK


SNP mapping information
SNP IDRel.Chr.Location (cM)
SNPF020690.91b531.3


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMCM5DNA replication licensing factor MCM5 [Homo sapiens]. 14230.0O
Contig/Assembly ProteinMCM4DNA replication licensing factor MCM4 [Homo sapiens]. 3304e-90O
Contig/Assembly ProteinMCM2DNA replication licensing factor MCM2 [Homo sapiens]. 3275e-89
Contig/Assembly ProteinMCM8DNA replication licensing factor MCM8 isoform 2 [Homo sapiens]. 2452e-64


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMcm5DNA replication licensing factor MCM5 [Mus musculus]. 13890.0O
Contig/Assembly ProteinMcm2DNA replication licensing factor MCM2 [Mus musculus]. 3251e-88O
Contig/Assembly ProteinMcm4DNA replication licensing factor MCM4 [Mus musculus]. 3203e-87O
Contig/Assembly ProteinMcm7DNA replication licensing factor MCM7 [Mus musculus]. 3066e-83O
Contig/Assembly ProteinMcm6DNA replication licensing factor MCM6 [Mus musculus]. 2928e-79O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC610519PREDICTED: similar to DNA replication licensing factor MCM5 (CDC46 homolog) (P1-CDC46) [Canis familiaris]. 11520.0O
Contig/Assembly ProteinLOC484622PREDICTED: similar to minichromosome maintenance protein 2 [Canis familiaris]. 3303e-90
Contig/Assembly ProteinLOC477871PREDICTED: similar to minichromosome maintenance protein 4 [Canis familiaris]. 3268e-89
Contig/Assembly ProteinLOC479737PREDICTED: similar to DNA replication licensing factor MCM7 (CDC47 homolog) (P1.1-MCM3) isoform 3 [Canis familiaris]. 3038e-82O
Contig/Assembly ProteinLOC477163PREDICTED: similar to minichromosome maintenance protein 8 isoform 1 isoform 1 [Canis familiaris]. 2482e-65


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMCM5DNA replication licensing factor MCM5 [Bos taurus]. 14310.0O
Contig/Assembly ProteinMCM4DNA replication licensing factor MCM4 [Bos taurus]. 3229e-88
Contig/Assembly ProteinMCM7DNA replication licensing factor MCM7 [Bos taurus]. 3073e-83
Contig/Assembly ProteinMCM2PREDICTED: KIAA0030-like [Bos taurus]. 3003e-81O
Contig/Assembly ProteinMCM8PREDICTED: minichromosome maintenance complex component 8 isoform 1 [Bos taurus]. 2491e-65


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMCM3PREDICTED: DNA replication licensing factor MCM3 [Sus scrofa]. 2851e-76
Contig/Assembly ProteinMCM2PREDICTED: DNA replication licensing factor MCM2 [Sus scrofa]. 2842e-76
Contig/Assembly ProteinLOC100624915PREDICTED: DNA replication licensing factor MCM5-like, partial [Sus scrofa]. 2834e-76
Contig/Assembly ProteinMCM8PREDICTED: DNA replication licensing factor MCM8 [Sus scrofa]. 2473e-65
Contig/Assembly ProteinLOC100624302PREDICTED: DNA replication licensing factor MCM7-like [Sus scrofa]. 2303e-60


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-055994.1TGCTGGTCCAAGAAACGTGCTTTTGAAGTCACTGAAGTAATAAAGCCATGATGTGTTTGG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2005032220050322C-0013587fwd
2006061120060611C-00670910fwd
2007080620070806C-00168110fwd
2008051520080515C-00329011fwd
2010100120101001C-00304111fwd
2011060120110601C-00355811fwd