[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  ITT01_0066_D01

Library: ITT01 (Intestine)
Individual: LWD2, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,515)  [FASTA format sequence]
GAGGAAAACC CCGCTTGCGG AGCCCATAGG TGTGGCCCAC TGACGATCGG TGGGAGTCGT
GCGTGGGGTT GGGAGTTGAC TCCGGGTGTA CTTCTGTGTT TCTGCTCATC CTTTCCGTAG
ATGTCTCATA TGGAGCTGGG GTTGGACTCG GGTGACGATG ACTTGCTGGG CTTCCTGTTA
GAGGAAAGCG GAGGTCTGGG GGCGGCGCGG GACGAAGCCT TGGAGGCGCC CCTGGATTGG
GAGCTACCAC TTTCCGAGGC ATTGAGCGAT TGGGACGTAG AGGATTTCCT GAGCTGCCTG
TCGAGTCCCC CAGCATCGTT GACCGATTTT AGCCACTCTG ACCCCTATCT TGTCCACCAT
GATCACACCT ATTCCCTGTC ACAGGAGTAT GTCTCCATAG ATCTAGATAA TGAGGATTAT
GAGAAGGAAG GGGCCCAAAT GACTTCCCTG CGTGTGGAGG CGCCCGCAGA GCAGGAGATT
GGTGAGCTGA TACTGACGGA GGAGGAGAAG AGGCTTTTGG AGAAGGAGGG GCTTACTCTG
CCCGGGACAC TTCCTCTCAC TAAGATGGAG GAACAAGTTC TGAGACGAGT GCGAAGGAAG
ATTCGAAACA AAAAGTCTGC TCAAGAGAGC CGCAGGAAGA AGAAGGTGTA TGTGGGGAGT
TTAGAGAGCA GGGTCCTGAA ATACTCGGCC CAGAATCTGG AGCTACAGAA CAAAGTACAG
CTCCTGGAGG AGCAGAATCT GTCCCTTTTG GATCAGTTGA GGAGGCTGCA GTCCATGGTG
ATTCAGACGG CAAACAAAGC CAGCAGCAGC AGCACCTGCA TCTTGGTCCT GCTCTTCTCC
TTCTGTCTCC TCTTCGTACC TGCCATGTAC TCCTCGGACA CAAGGGGGAG CCCGCCAGCC
GAGCATGGAG TGTTGTCCCG CCAGCTTCGT GCCCTCCCCA GCGAGGACGT TCCCCAGCGG
GACCTGCCTG CACTGCAGTC AGAGGTACCA CAGGACAGCT CAACCCACGA GCTCCAGGCT
CCTGGCAACT CTTGCTGCCT GTTCCACCAC ATGGCTTGGG CTCCTGGGGC AGAATCGCCC
ATGAAGCTGC CACTGCCCGA CCGCTTCTCA AGGTCTTCTA GCCCAGGTCC CATCTTCCCC
CTGCATGCAA ATCTCACAAG AGAGGGAGGA TGGCTCCCTA CCCACAGCCC CATATCTGTT
ACCTTGCAGG GCAGGTACTC AGGCTAGATG TGAGAATGCA GGGGGCCTCA GCCAGAGCCT
GGTGCCCCCA GTCTGTGTTC AAAGGAAAAG GAATGGGAGA GGGTGAGCCT CAGGTCCTGT
CCCCTGTCAG GAAGCCTGAG GGCACAAACA CGCCACACTT ACTGGCTTTC TGGGGTTTTA
TTTGCACCCA TGTATGTCTG TTGTTCCATT AAGGGGCCTG GGAGAGTCCA CTGACTTCCT
TGAACATTTC ATGCAATGAG GGGATGGGGT GAAGAAAGAA ATAAATAAGT GATTCTGAAA
AAAAAAAAAA AAAAA

Deduced amino acid sequence:  (length: 368) [FASTA format sequence]
MSHMELGLDS GDDDLLGFLL EESGGLGAAR DEALEAPLDW ELPLSEALSD WDVEDFLSCL
SSPPASLTDF SHSDPYLVHH DHTYSLSQEY VSIDLDNEDY EKEGAQMTSL RVEAPAEQEI
GELILTEEEK RLLEKEGLTL PGTLPLTKME EQVLRRVRRK IRNKKSAQES RRKKKVYVGS
LESRVLKYSA QNLELQNKVQ LLEEQNLSLL DQLRRLQSMV IQTANKASSS STCILVLLFS
FCLLFVPAMY SSDTRGSPPA EHGVLSRQLR ALPSEDVPQR DLPALQSEVP QDSSTHELQA
PGNSCCLFHH MAWAPGAESP MKLPLPDRFS RSSSPGPIFP LHANLTREGG WLPTHSPISV
TLQGRYSG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCREB3cyclic AMP-responsive element-binding protein 3 [Homo sapiens]. 380e-105
Contig/Assembly ProteinCREB3L4cyclic AMP-responsive element-binding protein 3-like protein 4 [Homo sapiens]. 98.22e-20
Contig/Assembly ProteinCREB3L3cyclic AMP-responsive element-binding protein 3-like protein 3 [Homo sapiens]. 86.75e-17
Contig/Assembly ProteinCREB3L2cyclic AMP-responsive element-binding protein 3-like protein 2 [Homo sapiens]. 71.22e-12
Contig/Assembly ProteinCREB3L1cyclic AMP-responsive element-binding protein 3-like protein 1 [Homo sapiens]. 67.83e-11


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCreb3cyclic AMP-responsive element-binding protein 3 [Mus musculus]. 2733e-73
Contig/Assembly ProteinCreb3l4cyclic AMP-responsive element-binding protein 3-like protein 4 [Mus musculus]. 943e-19
Contig/Assembly ProteinCreb3l3cyclic AMP-responsive element-binding protein 3-like protein 3 [Mus musculus]. 84.72e-16
Contig/Assembly ProteinLOC638517PREDICTED: cyclic AMP-responsive element-binding protein 3-like protein 2-like [Mus musculus]. 71.22e-12
Contig/Assembly ProteinCreb3l2cyclic AMP-responsive element-binding protein 3-like protein 2 [Mus musculus]. 71.22e-12


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC611934PREDICTED: similar to cAMP responsive element binding protein 3 [Canis familiaris]. 400e-111
Contig/Assembly ProteinLOC612303PREDICTED: similar to cAMP responsive element binding protein 3-like 4 [Canis familiaris]. 95.12e-19
Contig/Assembly ProteinLOC485046PREDICTED: similar to cAMP responsive element binding protein 3-like 3 [Canis familiaris]. 85.51e-16
Contig/Assembly ProteinLOC491369PREDICTED: similar to cAMP responsive element binding protein 3-like 2 [Canis familiaris]. 71.22e-12
Contig/Assembly ProteinLOC483636PREDICTED: similar to cAMP responsive element binding protein 3-like 1 [Canis familiaris]. 67.83e-11


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCREB3cyclic AMP-responsive element-binding protein 3 [Bos taurus]. 441e-124
Contig/Assembly ProteinCREB3L4PREDICTED: cAMP responsive element binding protein 3-like 4-like [Bos taurus]. 98.69e-21
Contig/Assembly ProteinCREB3L3cyclic AMP-responsive element-binding protein 3-like protein 3 [Bos taurus]. 84.72e-16
Contig/Assembly ProteinCREB3L2cyclic AMP-responsive element-binding protein 3-like protein 2 [Bos taurus]. 71.22e-12


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCREB3cyclic AMP-responsive element-binding protein 3 [Sus scrofa]. 565e-161
Contig/Assembly ProteinLOC100627545PREDICTED: hypothetical protein LOC100627545 [Sus scrofa]. 1303e-30
Contig/Assembly ProteinCREB3L4cyclic AMP-responsive element-binding protein 3-like protein 4 [Sus scrofa]. 95.19e-20
Contig/Assembly ProteinLOC100522979PREDICTED: cyclic AMP-responsive element-binding protein 3-like protein 3-like isoform 2 [Sus scrofa]. 85.95e-17


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-003694.1CCTTGAACATTTCATGCAATGAGGGGATGGGGTGAAGAAAGAAATAAATAAGTGATTCTG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2005032220050322C-00082210fwd
2006061120060611C-00085114fwd
2007080620070806C-00757514fwd
2008051520080515C-00176616fwd
2010100120101001C-00692811fwd
2011060120110601C-00769511fwd