[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  LNG01_0056_E06

Library: LNG01 (Lung)
Individual: LWD3, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,142)  [FASTA format sequence]
CCCGTCCCGG CTCCTCCCGC TTGCCGCCGC AGTGACAGGG AAGCCGGGCC CGGTGGCAGA
GAGGAAGTGC GGGGCCGCCG CGCCGAGCCC GTCCCCGCCG AGGCCGGCTC CCCCAGGCGG
CTCGGGTGAC AGTGTCGCGG CCGCCGGGCG CAGCGCGGGG CACGCGCCGG GCAGAGCCAA
GGGCCAGGCG GACGCTTCAG CAGAGACGCG GGGAAA
ATGG CTGATGACTT TGGCTTCTTC
TCGTCATCGG AGAGCGGGGC CCCTGAGGTT GCCGAGGAGG ACCCGGCGGC TGCCTTCCTG
GCCCAGCAGG AGAGTGAAAT CGCGGGCATA GAGAATGACG AGGGCTTCGG GGCACCTGCC
GGCAGCCAGG CGGCCCTCGC GCAGCCGGGA CCAGCGAGTG GGGGTCCTGA GGACATGGGG
ACCACAGTCA ATGGAGATGT GTTTCAGGAT GCTAACGGTC CAGCTGATGG CTACGCTGCC
ATTGCCCAGG CGGACAGACT GACTCAGGAA CCCGAGAGCA TCCGCAAGTG GAGAGAGGAG
CAGCGGAAAC GGCTGCAAGA GCTGGATGCT GCCTCCAAAG TGACGGAACA AGAGTGGCGG
GAGAAGGCCA AGAAGGACTT GGAGGAATGG GACCAGCGCC AGAGTGAGCA AGTTGAGAAG
AACAAGATCA ATAACCGGGC ATCCGAGGAG GCTTTTGTGA AGGAATCCAA GGAGGAGACC
CCAGGTACAG AGTGGGAGAA GGTGGCCCAG CTGTGTGACT TCAACCCCAA GAGCAGCAAG
CAATGCAAAG ACGTGTCCCG CCTGCGCTCG GTGCTCATGT CCCTGAAGCA GACACCACTG
TCCCGCTAGG AGCCTGTCAC CAGCATGGCC GCCAAGCGGG GGCAGGGCCG GGCAGAGTAG
GAGCAGCTGC TTCGGCCAGG GTGGGGAAAA CGCCTCCTGT GGCTGCTACA CAGCCTATCC
CGTTCCTCCC CATCTCCCAG GGCTGGGAAG AGGGACGTTC ACCCCTCTCG CCCATCACTC
CCTCACAGCC CTATGGCCCA GCCCCTCACA TGTCCTCTCA GTCCACAAAA TTGACTGTCC
CTCCTGATGT ATTTTTTTTT TTCTTGGCTT AAAGGGTGTG TTGTTAAAAA AAAAAAAAAA
AA

Deduced amino acid sequence:  (length: 210) [FASTA format sequence]
MADDFGFFSS SESGAPEVAE EDPAAAFLAQ QESEIAGIEN DEGFGAPAGS QAALAQPGPA
SGGPEDMGTT VNGDVFQDAN GPADGYAAIA QADRLTQEPE SIRKWREEQR KRLQELDAAS
KVTEQEWREK AKKDLEEWDQ RQSEQVEKNK INNRASEEAF VKESKEETPG TEWEKVAQLC
DFNPKSSKQC KDVSRLRSVL MSLKQTPLSR


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCLTBclathrin light chain B isoform a [Homo sapiens]. 3523e-97O
Contig/Assembly ProteinCLTAclathrin light chain A isoform a [Homo sapiens]. 2362e-62O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCltbclathrin light chain B [Mus musculus]. 3432e-94O
Contig/Assembly ProteinCltaclathrin light chain A isoform a [Mus musculus]. 2354e-62O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC489104PREDICTED: similar to clathrin, light polypeptide isoform a isoform 5 [Canis familiaris]. 3556e-98O
Contig/Assembly ProteinLOC474765PREDICTED: similar to clathrin, light polypeptide A isoform a isoform 7 [Canis familiaris]. 1927e-49


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCLTBclathrin light chain B [Bos taurus]. 3531e-97O
Contig/Assembly ProteinCLTAclathrin light chain A [Bos taurus]. 2188e-57O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100525860PREDICTED: clathrin light chain B-like isoform 2 [Sus scrofa]. 363e-100
Contig/Assembly ProteinCLTAPREDICTED: clathrin light chain A isoform 1 [Sus scrofa]. 2378e-63


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-072904.1AGTTGAGAAGAACAAGATCAATAACCGGGCATCCGAGGAGGCTTTTGTGAAGGAATCCAA


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-00035718fwd
2003082620030826C-00044920fwd
2005032220050322C-00062427fwd
2006061120060611C-00054240fwd
2007080620070806C-00072338fwd
2008051520080515C-00024354fwd
2010100120101001C-00191350fwd
2011060120110601C-00745451fwd