[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  LNG01_0073_F10

Library: LNG01 (Lung)
Individual: LWD3, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,199)  [FASTA format sequence]
GGACTTGGCC TACTGGATCA TTGCTCTACA ACTCCGAAGA GCAACAGCTG AGACCACCTT
GAGAAGAGC
A TGGTCCCAGG CCGAGTTCTG ATGTGGGGGG CCCTCGCCCT GACCGCCGTG
ATGAGCGCCT GTGGAGGTGA AGACATTGCG GCCGACCATG TTGCCTCCTA TGGCTTAAAT
GTCTACCAGT CTTACGGTCC CAGCGGCTAT TATACCCATG AATTTGATGG CGACGAGGAA
TTCTACGTGG ACCTGGGGAA GAAGGAGACT GTCTGGCAGC TGCCTCTGTT TAGCAAATTT
AGAAGTTTTG ACCCACAGGG TGCACTGAGG AACATAGCTA CGGCAAAACA TAATTTGAAC
ATCCTGATTA AACGTTCCAA CAACACCGCG GCTGTCAATC AGGTTCCTGA GGTGACTGTG
TTTCCCAAGT CTCCAGTGAT GCTGGGTCAG CCCAACACCC TCATCTGTCA TGTGGACAAC
ATCTTTCCTC CTGTGATCAA CATCACGTGG TTGAAGAACG GGCACTCTGT CACAGAAGGT
TTTTCTGAGA CCAGCTTCCT CTCCAAAAAT GATCATTCCT TCCTCAAGAT CAGTTATCTC
ACCTTCCTCC CTTCTGATGA TGATTTTTAT GACTGCAAAG TGGAGCACTG GGGCCTGGAT
AAGCCACTTC TGAAACACTG GGAACCTGAG ATTCCAGCCC CCATGTCAGA GCTGACAGAG
ACAGTGGTCT GCGCCCTGGG ATTGATCGTG GGCCTTGTGG GCATCGTGGT GGGCACTGTC
TTCATCATTC AAGGCCTACG CTCAGGTGGT CCCTCTAGAC ACCAAGGGTC CTTGTGAGTC
ACACTCCAGA AGGGAAGGTG CACTGCCCGC CTACAAGAGC TGAAGAGTGG ATGTGCTCAA
CGACCTAGAA CTATTTTCTG GCCAAATTCA TCATATACCT TCTCTCTTCC TACATTCTTC
TTCTCACCTC TTCTCTGGAA CTTAAGGTGC TGTGTCATCT CAGAATTCAT ATGCCCTTGG
AATCCTCTTC CTGACCTTCT AGGTTTTTTT TCTTTTCTCA GTTGTTACCT GTTATGGGAT
CTCTGAGATA TCCCACTCGG CTACCTGATC CCTCAGTGAC CCTAAACTAA TATGTACATG
GAAACAATAA ATCACTTCAT GAGGTTTTTG TAAAAAAAAA AAAAAAAAAA AAAAAAAAA

Deduced amino acid sequence:  (length: 255) [FASTA format sequence]
MVPGRVLMWG ALALTAVMSA CGGEDIAADH VASYGLNVYQ SYGPSGYYTH EFDGDEEFYV
DLGKKETVWQ LPLFSKFRSF DPQGALRNIA TAKHNLNILI KRSNNTAAVN QVPEVTVFPK
SPVMLGQPNT LICHVDNIFP PVINITWLKN GHSVTEGFSE TSFLSKNDHS FLKISYLTFL
PSDDDFYDCK VEHWGLDKPL LKHWEPEIPA PMSELTETVV CALGLIVGLV GIVVGTVFII
QGLRSGGPSR HQGSL


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 2 [Homo sapiens]. 394e-109
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 3 [Homo sapiens]. 385e-107


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2-Aahistocompatibility 2, class II antigen A, alpha precursor [Mus musculus]. 3401e-93O
Contig/Assembly ProteinH2-Oahistocompatibility 2, O region alpha locus [Mus musculus]. 2324e-61
Contig/Assembly ProteinH2-Ea-pshistocompatibility 2, class II antigen E alpha precursor [Mus musculus]. 2171e-56
Contig/Assembly ProteinH2-DMaclass II histocompatibility antigen, M alpha chain precursor [Mus musculus]. 797e-15
Contig/Assembly ProteinH2-DMb2histocompatibility 2, class II, locus Mb2 [Mus musculus]. 63.53e-10


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha [Canis lupus familiaris]. 386e-107O
Contig/Assembly ProteinLOC474869PREDICTED: similar to HLA class II histocompatibility antigen, DO alpha chain precursor (MHC class II antigen DOA) (MHC DZ alpha) (MHC DN-alpha) isoform 11 [Canis familiaris]. 2332e-61
Contig/Assembly ProteinDLA-DRAMHC class II DR alpha chain [Canis lupus familiaris]. 2271e-59
Contig/Assembly ProteinHLA-DOBmajor histocompatibility complex, class II, DO beta [Canis lupus familiaris]. 60.53e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha 5 [Bos taurus]. 376e-104
Contig/Assembly ProteinBOLA-DQA1major histocompatibility complex, class II, DQ alpha, type 1 [Bos taurus]. 371e-103
Contig/Assembly ProteinLOC100336394PREDICTED: BOLA-DQA2 protein-like [Bos taurus]. 367e-102
Contig/Assembly ProteinBOLA-DQA3major histocompatibility complex, class II, DQ alpha, type 3 [Bos taurus]. 3587e-99
Contig/Assembly ProteinBOLA-DRAmajor histocompatibility complex, class II, DR alpha [Bos taurus]. 2288e-60


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSLA-DQA1SLA class II histocompatibility antigen, DQ haplotype D alpha chain precursor [Sus scrofa]. 474e-134
Contig/Assembly ProteinSLA-DQASLA class II histocompatibility antigen, DQ haplotype C alpha chain precursor [Sus scrofa]. 446e-125
Contig/Assembly ProteinSLAsrc-like-adapter [Sus scrofa]. 2623e-70
Contig/Assembly ProteinSLA-DRAMHC class II DR-alpha [Sus scrofa]. 2263e-59
Contig/Assembly ProteinLOC100513292PREDICTED: DLA class II histocompatibility antigen, DR-1 beta chain-like [Sus scrofa]. 63.52e-10


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-074694.1CCTCAGTGACCCTAAACTAATATGTACATGGAAACAATAAATCACTTCATGAGGTTTTTG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-000058158fwd
2003082620030826C-003433188fwd
2004020420040204C-000223213fwd
2005032220050322C-000197384fwd
2006061120060611C-000165389fwd
2007080620070806C-000038388fwd
2008051520080515C-000329397fwd
2010100120101001C-001170425fwd
2011060120110601C-001518452fwd