[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  LVR01_0018_H02

Library: LVR01 (Liver)
Individual: LWD4, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 2,320)  [FASTA format sequence]
GTGCGCAGGC GCGAGCGTTC GGGACCCGCG GCGCGCGGCG CTCGGTTGTA GCAGGAGTGA
GTTCCTGGGC GCAGAGACCC GGCAGTGGGC TGTTGAGCGA GCGGGTGACC CGGCGCCTCC
TCTGCAGCC
A TGGCAGCTCT GCGCTACGCG GGCCTGGACG ACACGGACAG CGAGGACGAG
CTGCCGCCGG GCTGGGAGCA GAGAACCACC AAGGACGGCT GGGTTTACTA TGCCAATCAC
ACGGAGGAGA AGACGCAATG GGAACATCCG AAAACTGGGA AAAGAAAGCG AATAGCAGGA
GATTTGCCCT ATGGATGGGA GCAAGAAACC GATGAGAAAG GACAAGTGTT TTTTGTCGAC
CACATAAATA AGAGAACGAC CTACTTGGAC CCAAGACTGG CATTTACCGT GGACGAAAAT
CCTACGAAAC CGACCACCAG GCAGCGGTAC GACAGCAGCA CGACCGCCAT GGAAATACTC
CAGGGCCGGG ATTTCAGTGG CAAAGTGGTC GTGGTGACGG GCGCCAACTC AGGAATAGGG
TTTGAGGCCG CCAAATCTTT TGCCCTCCAT GGAGCACACG TGATCCTGGC CTGTAGGAAT
ATGACGAGAG CCAACGAAGC TGTGTCGCGC ATTTTAGGAG AATGGCACAA AGCCAAGGTA
GAAGCAATGA CCCTGGACCT CGCTGTGCTC CGTAGCGTGC AGCATTTTGC TCAAGCGTTC
AAGGCCAAGA ATGTGTTGCT TCACGTGCTT GTGTGCAACG CAGCGGTTTT TGCTCTTCCC
TGGAGCCTCA CGAAGGATGG CCTGGAGACC ACCTTCCAGG TCAACCACCT GGGGCACTTC
TACCTGGTCC AGCTTCTCCA GGACGTCCTG TGCCGCTCAG CCCCAGCCCG GGTCGTGGTG
GTCTCCTCGG AGTCACATAG GTTTACAGAT ATTAACGACT CTTCAGGAAA GCTCGACTTC
AGCCGCCTCT CCCCGTCGCA CAGCGACTAC TGGGCCATGC TGGCTTACAA CCGGTCCAAG
CTCTGCAACA TCCTCTTCTC CAACGAGCTG CATCGCCGCC TCTCGCCGCG CGGGGTCACG
TCCAACGCGG TGCATCCCGG CAACATGATG TTCTCCTCCC TCCATCGCGG CTGGTGGGTG
TACACGCTGC TCTTCACCTT GGCCAGACCC TTCACCAAGT CCATGCAACA AGGAGCTGCC
ACCACCGTCT ACTGCGCTGC TGCTCCAGAA CTGGAGGGTC TGGGAGGAAT GTATTTCAAC
AACTGTTGCC GTTGTATGCC CTCGACGGAA GCTCAGAGCG AAGAGACGGC CCGGGCCCTG
TGGGCACTCA GCGAGAGGTT GATCCAAGAG GGCCTTGGCA GCTCATCCGG CTAAGTGGGG
GCATCGGCAA GGATCGGCAC ACGCACGGCC TGTGTGCGTG CGTATGTGTA AATGCCAACC
CCTGGACCCT TTCCCACTTA CTATCCCGGG GCTTTCCAAG TCCCTCTGAT CCAGGTTTAC
CAGAGGCAAG GACATAAGAG TAGTCACAAC AGAGCCAAAA ATGTTAAGTA TCAATGGGAA
GCAGGGAATT CTGGGGTTCA GGGACAGTCT CTCTTTTCTG GGGGTGGGTT AGGCTTGGGT
CTCTCTGCAT CCCTGTTGAT GGCCTGTTTG AAAGTGAACC TTAGTTGACA GGCGGGTTCT
TTGTCTCAAT GTAGAAGCAC AAACAATTCT CACTTACTGT TTAGAATAGC CAGGTGTCCC
TGTCCCACCC AGCCACCACC ACCACAGCCT CCCATGGCCA CACTAGAGCC AAGAGCTGGC
TTCTTCCTAT TTAGGGAAGA GAGAGCCAGT GTTTATCCTT TGTTGCACTG ATCCAGGAGA
TAACTGTTTT CATTCATCCT CATCTCATCA GAGCGGGCTT GGCAAACTGG GCAGAGACGT
CTCTGAACCT TCTTCCAGTC AAGATGGAGG TGACACTTAG AAATGGGTGG AATAGACAGA
CACAACTAGT GAGTCGCAAA AGTCCTGGTC CACTGACTCC CTTGCCAAAG CTATACAAAA
GATCCTTTAG AGATTTATAA CAAATTTTGC AAATCATTCC CTTGGTACCT TGACAGGCAG
GACAGGAAGC ACTGTGTCCT TAAGAATGTA CAGGGTATTT TGGGGGGTGG GATAAAAAGT
TGTTCCCTTC ATTCTTCACT CACAGTCTTA AGAAGCAACC CGATCACGGA GGTTCCCAGC
CCCTCAGTGC ATCCATATAG CATCCTGCTC CACTTCCTCT TGTTCCTCCC ATCCTGCTGA
ATAAAAGAAC ATGCTTGAAT ATTAAAAAAA AAAAAAAAAA

Deduced amino acid sequence:  (length: 414) [FASTA format sequence]
MAALRYAGLD DTDSEDELPP GWEQRTTKDG WVYYANHTEE KTQWEHPKTG KRKRIAGDLP
YGWEQETDEK GQVFFVDHIN KRTTYLDPRL AFTVDENPTK PTTRQRYDSS TTAMEILQGR
DFSGKVVVVT GANSGIGFEA AKSFALHGAH VILACRNMTR ANEAVSRILG EWHKAKVEAM
TLDLAVLRSV QHFAQAFKAK NVLLHVLVCN AAVFALPWSL TKDGLETTFQ VNHLGHFYLV
QLLQDVLCRS APARVVVVSS ESHRFTDIND SSGKLDFSRL SPSHSDYWAM LAYNRSKLCN
ILFSNELHRR LSPRGVTSNA VHPGNMMFSS LHRGWWVYTL LFTLARPFTK SMQQGAATTV
YCAAAPELEG LGGMYFNNCC RCMPSTEAQS EETARALWAL SERLIQEGLG SSSG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinWWOXWW domain-containing oxidoreductase isoform 1 [Homo sapiens]. 7640.0O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Homo sapiens]. 1982e-50
Contig/Assembly ProteinRDH11retinol dehydrogenase 11 [Homo sapiens]. 1844e-46
Contig/Assembly ProteinNT5C1B-RDH14NT5C1B-RDH14 protein isoform 1 [Homo sapiens]. 1313e-30


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinWwoxWW domain-containing oxidoreductase [Mus musculus]. 7490.0O
Contig/Assembly ProteinRdh12retinol dehydrogenase 12 [Mus musculus]. 2096e-54
Contig/Assembly ProteinRdh11retinol dehydrogenase 11 [Mus musculus]. 1842e-46
Contig/Assembly ProteinRdh13retinol dehydrogenase 13 [Mus musculus]. 1805e-45
Contig/Assembly ProteinWwp2NEDD4-like E3 ubiquitin-protein ligase WWP2 [Mus musculus]. 75.52e-13


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC610120PREDICTED: similar to WW domain-containing oxidoreductase isoform 1 [Canis familiaris]. 6660.0O
Contig/Assembly ProteinLOC490744PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis) [Canis familiaris]. 1991e-50
Contig/Assembly ProteinLOC611373PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris]. 1913e-48
Contig/Assembly ProteinLOC480366PREDICTED: similar to Retinol dehydrogenase 11 (Retinal reductase 1) (RalR1) (Prostate short-chain dehydrogenase/reductase 1) (Androgen-regulated short-chain dehydrogenase/reductase 1) (HCV core-binding protein HCBP12) [Canis familiaris]. 1813e-45
Contig/Assembly ProteinLOC610010PREDICTED: similar to WW domain-containing oxidoreductase isoform 4 [Canis familiaris]. 1152e-25


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinWWOXWW domain-containing oxidoreductase [Bos taurus]. 7710.0
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Bos taurus]. 1961e-49O
Contig/Assembly ProteinRDH11PREDICTED: retinol dehydrogenase 11-like [Bos taurus]. 1797e-45
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 [Bos taurus]. 77.84e-14


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100519844PREDICTED: WW domain-containing oxidoreductase-like, partial [Sus scrofa]. 2951e-79
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Sus scrofa]. 1966e-50
Contig/Assembly ProteinLOC100154684PREDICTED: retinol dehydrogenase 11 [Sus scrofa]. 1903e-48
Contig/Assembly ProteinLOC100516970PREDICTED: retinol dehydrogenase 14-like [Sus scrofa]. 1767e-44
Contig/Assembly ProteinLOC100154192PREDICTED: e3 ubiquitin-protein ligase NEDD4-like [Sus scrofa]. 674e-11


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-078934.1GATAAAAAGTTGTTCCCTTCATTCTTCACTCACAGTCTTAAGAAGCAACCCGATCACGGA


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531S-0061161fwd
2003082620030826S-0047621fwd
2004020420040204C-0068302fwd
2005032220050322C-0079242fwd
2006061120060611C-0040252fwd
2007080620070806C-0065542fwd
2008051520080515C-0084402fwd
2010100120101001C-0140194fwd
2011060120110601C-0100484fwd