[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  LVRM1_0079_H01

Library: LVRM1 (Liver)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 2,768)  [FASTA format sequence]
GTGCATTTCC TCTCCTGGAA AGTCAATAAT ATCTTGGGAT TGAGACACCA CTTTCCGGAC
ACTGCTGGCC AGTCCCAAA
A TGGACCATAA AGAGGTAGTT CTTCTCCTTC TTTTATTTCT
GAAATCAGGT CTCGGGGACT CTCTGGATGA CTATGTCAAT ACTCAAGGAG CTTTCCTGTT
CAGTTTGTCT CGGAAGCAGG TGGCAGCCAG GAGCGTGGAA GAATGTGCAG CCAAGTGTGA
GGCGGAAACA AACTTCATTT GCAGGGCTTT CCAGTATCAC AGTAAAGATC AGCAGTGTGT
GGTGATGGCC GAGAACAGCA AGACCTCTCC CATCGCTAGG ATGAGAGACG TGGTTCTATT
CGAGAAGAGA ATCTATCTCT CCGAGTGCAA GACTGGAAAT GGGAAGAACT ACAGAGGGAC
CACGTCCAAA ACGAAAAGTG GTGTCATCTG TCAAAAATGG AGTGTCAGCT CTCCGCACAT
ACCCAAGTAT TCACCTGAAA AGTTTCCTTT AGCGGGACTG GAGGAGAACT ACTGCAGGAA
CCCAGACAAC GATGAAAAGG GACCCTGGTG TTACACCACT GACCCAGAGA CCCGATTCGA
CTACTGCGAC ATCCCTGAGT GTGAAGATGA ATGCATGCAC TGCAGTGGAG AACATTATGA
GGGCAAAATT TCCAAGACCA TGTCGGGGAT TGAATGCCAG TCTTGGGGCT CTCAGAGCCC
ACATGCTCAC GGATACCTTC CTTCCAAATT TCCAAACAAG AATCTGAAGA TGAATTACTG
CCGTAACCCG GACGGGGAGC CCCGCCCATG GTGCTTCACC ACAGATCCCA ACAAACGCTG
GGAATTCTGT GACATCCCGA GATGCACCAC ACCCCCACCA ACTTCCGGGC CAACGTATCA
GTGTCTGAAG GGAAGAGGTG AAAACTACCG AGGGACAGTG TCTGTCACTG CATCTGGGCA
CACCTGTCAA CGCTGGAGTG CGCAGAGCCC CCACAAGCAC AACAGGACCC CCGAAAACTT
TCCCTGCAAA AATCTGGAGG AGAACTACTG CCGTAACCCT GATGGAGAAA CGGCTCCGTG
GTGCTACACA ACCGACAGCG AGGTGAGGTG GGATTACTGC AAGATACCGT CCTGTGGGTC
CTCCACGACA TCCACGGAGC ATCTGGATGC CCCCGTGCCA CCCGAGCAAA CCCCTGTCGC
CCAGGACTGC TACAGAGGCA ATGGGGAGAG TTATCGAGGC ACGTCTTCCA CAACCATCAC
GGGAAGAAAA TGTCAGTCCT GGGTATCCAT GACGCCACAC CGGCATGAGA AGACCCCAGG
AAACTTCCCA AATGCTGGCT TGACAATGAA CTACTGCAGG AACCCAGACG CTGATAAAAG
CCCTTGGTGC TACACCACCG ATCCAAGAGT GAGATGGGAG TACTGCAACC TGAAGAAATG
CTCAGAGACA GAACAGCAGG TCACAAACTT TCCAGCTATT GCGCAGGTTC CCAGTGTAGA
GGATCTTTCG GAAGACTGCA TGTTCGGGAA TGGGAAAAGG TACCGGGGCA AGAGGGCCAC
CACGGTGGCC GGCGTCCCCT GCCAGGAGTG GGCTGCCCAG GAGCCCCACA GACACAGCAT
CTTCACTCCA GAGACAAATC CACGGGCAGG TCTGGAGAAA AATTACTGCC GTAATCCTGA
CGGCGACAAC AACGGTCCCT GGTGCTACAC GACAAACCCA CAAAAGCTCT TTGACTACTG
CGACGTCCCT CAGTGTGTAA CCTCTTCATT TGATTGCGGG AAGCCCAAGG TGGAGCCAAA
GAAGTGTCCT GCGAGGGTGG TAGGTGGGTG CGTGTCCATC CCACACTCCT GGCCCTGGCA
AATTAGCCTT CGATACAGGT ACGGAGGGCA CTTCTGCGGA GGCACTTTAA TATCCCCGGA
GTGGGTGCTG ACTGCTAAGC ACTGCCTGGA AAAGTCCTCA AGTCCTTCAT CATACAAGGT
CATTTTGGGT GCACACGAAG AGCACCACCT TGGAGAAGGA GTTCAGGAGA TAGACGTGTC
CAAGCTGTTC AAGGAGCCCT CTGGGGCGGA CATAGCCTTG CTCAAGCTGA GCAGCCCTGC
CGTCATCACT GACCAGGTAA TCCCGGCTTG TCTGCCAACC CCGAACTATG TGGTCGCCGA
CCGGACAGCG TGTTACATCA CTGGCTGGGG AGAAACCAAA GGCACGTACG GCGCTGGCTT
ACTCAAGGAA GCCCGGCTGC CCGTGATTGA GAACAAAGTG TGTAATCGCT ACGAGTATCT
GGGCGGGAAG GTCAGCCCCA ACGAGCTGTG TGCGGGGCAT CTGGCTGGAG GCATCGACAG
CTGCCAGGGT GACAGCGGAG GGCCTCTGGT GTGCTTTGAG AAGGACAAAT ACATTTTACA
AGGAGTCACT TCTTGGGGTC TTGGCTGTGC GCTCCCCAAT AAGCCTGGTG TGTATGTCCG
TGTTTCAAGG TTTGTTACTT GGATTGAGGA AATAATGAGA AGAAATTAAT CCGATGGGAA
ACAGCGGGAA GTCTCAAGGG ATCTGGAAGC TGGACCTTGC GCAGGGAATT CAGCTCAGAA
ATAATTGACA CTAATCTAAA TGAGGCACTG TCCTTAGCTA CCATCTACTG GCACATTTGT
GTGTGTGTGT ATTGTTGTGG ATAACTTTTT CCTGCCCATG GACTGCTGGA TTCTCTAATA
ATAAGGCAAT GCAGCTATGC CACTTGTTGA AAAGAAACTG TACTTCCTTT AAAAAAAAAA
AAAAAAAA

Deduced amino acid sequence:  (length: 809) [FASTA format sequence]
MDHKEVVLLL LLFLKSGLGD SLDDYVNTQG AFLFSLSRKQ VAARSVEECA AKCEAETNFI
CRAFQYHSKD QQCVVMAENS KTSPIARMRD VVLFEKRIYL SECKTGNGKN YRGTTSKTKS
GVICQKWSVS SPHIPKYSPE KFPLAGLEEN YCRNPDNDEK GPWCYTTDPE TRFDYCDIPE
CEDECMHCSG EHYEGKISKT MSGIECQSWG SQSPHAHGYL PSKFPNKNLK MNYCRNPDGE
PRPWCFTTDP NKRWEFCDIP RCTTPPPTSG PTYQCLKGRG ENYRGTVSVT ASGHTCQRWS
AQSPHKHNRT PENFPCKNLE ENYCRNPDGE TAPWCYTTDS EVRWDYCKIP SCGSSTTSTE
HLDAPVPPEQ TPVAQDCYRG NGESYRGTSS TTITGRKCQS WVSMTPHRHE KTPGNFPNAG
LTMNYCRNPD ADKSPWCYTT DPRVRWEYCN LKKCSETEQQ VTNFPAIAQV PSVEDLSEDC
MFGNGKRYRG KRATTVAGVP CQEWAAQEPH RHSIFTPETN PRAGLEKNYC RNPDGDNNGP
WCYTTNPQKL FDYCDVPQCV TSSFDCGKPK VEPKKCPARV VGGCVSIPHS WPWQISLRYR
YGGHFCGGTL ISPEWVLTAK HCLEKSSSPS SYKVILGAHE EHHLGEGVQE IDVSKLFKEP
SGADIALLKL SSPAVITDQV IPACLPTPNY VVADRTACYI TGWGETKGTY GAGLLKEARL
PVIENKVCNR YEYLGGKVSP NELCAGHLAG GIDSCQGDSG GPLVCFEKDK YILQGVTSWG
LGCALPNKPG VYVRVSRFVT WIEEIMRRN


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPLGplasminogen isoform 1 precursor [Homo sapiens]. 14170.0
Contig/Assembly ProteinLPAapolipoprotein(a) precursor [Homo sapiens]. 9910.0
Contig/Assembly ProteinHGFhepatocyte growth factor isoform 1 preproprotein [Homo sapiens]. 506e-143
Contig/Assembly ProteinMST1hepatocyte growth factor-like protein precursor [Homo sapiens]. 495e-139
Contig/Assembly ProteinHPNserine protease hepsin [Homo sapiens]. 2136e-55


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPlgplasminogen [Mus musculus]. 13730.0
Contig/Assembly ProteinHgfhepatocyte growth factor precursor [Mus musculus]. 508e-143
Contig/Assembly ProteinMst1hepatocyte growth factor-like protein [Mus musculus]. 504e-142
Contig/Assembly ProteinPlattissue-type plasminogen activator preproprotein [Mus musculus]. 2373e-62
Contig/Assembly ProteinHabp2hyaluronan-binding protein 2 [Mus musculus]. 1997e-51


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPLGPREDICTED: similar to Plasminogen precursor [Canis familiaris]. 14450.0
Contig/Assembly ProteinHGFhepatocyte growth factor precursor [Canis lupus familiaris]. 501e-141
Contig/Assembly ProteinLOC484768PREDICTED: similar to macrophage stimulating 1 (hepatocyte growth factor-like) [Canis familiaris]. 496e-140
Contig/Assembly ProteinLOC482840PREDICTED: similar to Tissue-type plasminogen activator precursor (tPA) (t-PA) (t-plasminogen activator) [Canis familiaris]. 2575e-68
Contig/Assembly ProteinHGFACPREDICTED: hepatocyte growth factor activator isoform 1 [Canis familiaris]. 1982e-50


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPLGplasminogen precursor [Bos taurus]. 14250.0
Contig/Assembly ProteinHGFhepatocyte growth factor precursor [Bos taurus]. 497e-140
Contig/Assembly ProteinMST1hepatocyte growth factor-like protein [Bos taurus]. 431e-120
Contig/Assembly ProteinPLATtissue-type plasminogen activator precursor [Bos taurus]. 2421e-63
Contig/Assembly ProteinPRSS33PREDICTED: protease, serine, 33-like [Bos taurus]. 1938e-49


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPLGplasminogen precursor [Sus scrofa]. 17080.0
Contig/Assembly ProteinMST1PREDICTED: hepatocyte growth factor-like protein [Sus scrofa]. 504e-143
Contig/Assembly ProteinLOC100623361PREDICTED: hepatocyte growth factor-like protein-like [Sus scrofa]. 504e-143
Contig/Assembly ProteinLOC100525120PREDICTED: hepatocyte growth factor-like [Sus scrofa]. 502e-142
Contig/Assembly ProteinLOC100621820PREDICTED: chymotrypsinogen 2-like [Sus scrofa]. 1895e-48


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-089154.1GCTGGATTCTCTAATAATAAGGCAATGCAGCTATGCCACTTGTTGAAAAGAAACTGTACT


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-00017537fwd
2003082620030826C-00352857fwd
2004020420040204C-00033955fwd
2005032220050322C-00497060fwd
2006061120060611C-00040860fwd
2007080620070806C-00710260fwd
2008051520080515C-00111559fwd
2010100120101001C-00671658fwd
2011060120110601C-00743858fwd