[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  LVRM1_0083_F07

Library: LVRM1 (Liver)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 1,160)  [FASTA format sequence]
TTCCCGTCCC GGCTCCTCCC GCTTGCCGCC GCAGTGACAG GGAAGCCGGG CCCGGTGGTA
GAGAGGAAGT GCGGGGCCGC CGCGCCGAGC CCGTCCCCGC CGAGGCCGGC TCCCCCAGGC
GGCTCGGGTG ACAGTGTCGC GGCCGCCGGG CGCAGCGCGG GGCACGCGCC GGGCAGAGCC
AAGGGCCAGG CGGACGCTTC AGCAGAGACG CGGGGAAA
AT GGCTGATGAC TTTGGCTTCT
TCTCGTCATC GGAGAGCGGG GCCCCTGAGG TTGCCGAGGA GGACCCGGCG GCTGCCTTCC
TGGCCCAGCA GGAGAGTGAA ATCGCGGGCA TAGAGAATGA CGAGGGCTTC GGGGCACCTG
CCGGCAGCCA GGCGGCCCTC GCGCAGCCGG GACCAGCGAG TGGGGCAGGT CCTGAGGACA
TGGGGACCAC AGTCAATGGA GATGTGTTTC AGGATGCTAA CGGTCCAGCT GATGGCTACG
CTGCCATTGC CCAGGCGGAC AGACTGACTC AGGAACCCGA GAGCATCCGC AAGTGGAGAG
AGGAGCAGCG GAAACGGCTG CAAGAGCTGG ATGCTGCCTC CAAAGTGACG GAACAAGAGT
GGCGGGAGAA GGCCAAGAAG GACTTGGAGG AATGGAACCA GCGCCAGAGT GAGCAAGTTG
AGAAGAACAA GATCAATAAC CGGGCATCCG AGGAGGCTTT TGTGAAGGAA TCCAAGGAGG
AGACCCCAGG TACAGAGTGG GAGAAGGTGG CCCAGCTGTG TGACTTCAAC CCCAAGAGCA
GCAAGCAATG CAAAGACGTG TCCCGCCTGC GCTCGGTGCT CATGTCCCTG AAGCAGACAC
CACTGTCCCG CTAGGAGCCT GTCACCAGCA TGGCCGCCAA GCGGGGGCAG GGCCGGGCAG
AGTAGGAGCA GCTGCTTCGG CCAGGGTGGG GAAAACGCCT CCTGTGGCTG CTACACAGCC
TATCCCGTTC CTCCCCATCT CCCAGGGCTG GGAAGAGGGA CGTTCACCCC TCTCGCCCAT
CACTCCCTCA CAGCCCTATG GCCCAGCCCC TCACATGTCC TCTCAGTCCA CAAAATTGAC
TGTCCCTCCT GATGTATTTT TTTTTTTTCT TGGCTTAAAG GGTGTGTTGT TAAAAAAAAA
AAAAAAAAAA AAAAAAAAAA

Deduced amino acid sequence:  (length: 211) [FASTA format sequence]
MADDFGFFSS SESGAPEVAE EDPAAAFLAQ QESEIAGIEN DEGFGAPAGS QAALAQPGPA
SGAGPEDMGT TVNGDVFQDA NGPADGYAAI AQADRLTQEP ESIRKWREEQ RKRLQELDAA
SKVTEQEWRE KAKKDLEEWN QRQSEQVEKN KINNRASEEA FVKESKEETP GTEWEKVAQL
CDFNPKSSKQ CKDVSRLRSV LMSLKQTPLS R


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCLTBclathrin light chain B isoform a [Homo sapiens]. 3601e-99O
Contig/Assembly ProteinCLTAclathrin light chain A isoform a [Homo sapiens]. 2333e-61O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCltbclathrin light chain B [Mus musculus]. 3517e-97O
Contig/Assembly ProteinCltaclathrin light chain A isoform a [Mus musculus]. 2325e-61O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC489104PREDICTED: similar to clathrin, light polypeptide isoform a isoform 5 [Canis familiaris]. 363e-100O
Contig/Assembly ProteinLOC474765PREDICTED: similar to clathrin, light polypeptide A isoform a isoform 7 [Canis familiaris]. 1925e-49


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCLTBclathrin light chain B [Bos taurus]. 3532e-97O
Contig/Assembly ProteinCLTAclathrin light chain A [Bos taurus]. 2155e-56O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100525860PREDICTED: clathrin light chain B-like isoform 2 [Sus scrofa]. 371e-103
Contig/Assembly ProteinCLTAPREDICTED: clathrin light chain A isoform 1 [Sus scrofa]. 2349e-62


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-072904.1AGTTGAGAAGAACAAGATCAATAACCGGGCATCCGAGGAGGCTTTTGTGAAGGAATCCAA


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003082620030826S-0085631fwd
2004020420040204S-0085171fwd
2005032220050322S-0153991fwd
2006061120060611S-0229831fwd
2007080620070806S-0378331fwd
2010100120101001S-0621941fwd
2011060120110601S-0677681fwd