[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  LVRM1_0110_B08

Library: LVRM1 (Liver)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 1,546)  [FASTA format sequence]
GTACAGGTGG CTGCCTTAGC TCCGGGAGCG CGGCGGCTCC GGAAATCCTG CGAGGGGGAC
GGTGGGCCCT CGGCCCGGGC GGCT
ATGGCA GTGGCTACAG TGGCGGCATT TCTGGCCGCA
CTGGGTGGGG CCCTGTGGCT GGCGGCCCGA CGGTTTGTGG GGCCTAGTGT CCAGCGGTTG
CACCGAGGCG GGGACTCCGG CCTCATGCAC GGGAAGACCG TGCTGATCAC GGGGGCTAAC
AGCGGCCTGG GCCGCGCCAC GGCCGCCGAG CTGCTACGCT TGGGGGCGCG AGTGATCATG
GGCTGCCGGG ACCGCGCGCG CGCCGAGGAG GCGGCGGGTC AGCTCCGCCG CGAGCTCCGC
CAGACCGAGG GCCCCGAGGA GGGGCCCAAC TCCGGAGGGG CCGGCGAGCT CGTCGTCCGG
GAGTTGGACC TCGCCTCGCT GCGCTCGGTG CGCGCCTTCT GTCAGGAGAT GCTCCAGGAA
GAGCCTAGAC TGGATGTTCT GATCAATAAT GCAGGGATCT TCCAGTGCCC TTACATGAAG
ACCGAAGATG GGTTTGAGAT GCAGTTTGCA GTGAACCATC TGGGGCACTT CCTACTCACC
AATCTTCTCC TTGGACTCCT TAAAAGTTCA GCTCCCAGCA GGATTGTGGT AGTTTCTTCC
AAACTTTATA AATATGGAGA CATCAACTTT GAAGACTTGA ACAGTGAACA AAGCTATAAT
AAAAGCTTCT GTTACAGTCG GAGCAAACTG GCTAACATTC TTTTTACCAG AGAACTAGCC
CGCCGCTTAG AAGGCACAAA TGTCACTGTC AACGTATTGC ACCCCGGCAT CGTGCGGACT
AACCTGGGGA GGCACATACA CATCCCACTC TTAGTCAAGC CACTTTTCAA TTTAGTGTCA
TGGGCTTTTT TCAAAACTCC AGCAGAAGGG GCCCAGACTT CGGTTTATTT AGCCTCTTCA
CCTGAGGTAG AAGGTGTGTC AGGAAAGTAC TTTGGGGACT GCAAAGAGGA AGAACTCTTG
CCCAAAGCTA TGGATGACTC TGTTGCAAGA AAACTCTGGG ATATCAGTGA AGTCATGGTA
GGCATATTAA AATAGGAATG AGGTGTGGCA GCTATTTATA AAACTGGATC TCAGCTCTAT
CTTTGATCAG GAATAGTGTG GGTTGGGCAT TTACTACTTG AAAATGCAAT TCTAGTTTTA
CAATTGTACT GCTGAGAGGT ACATAGGGAT ATTTGAAGTT ACTGAAAAGT TATTTTTTGG
AGAACATAAA ATTTCAGAAA AATGTTTAAA TATGTATAAT GAGCATATCA ATGAGTGATA
CAATTATGGT TTTAAATTAT AATTGAACAA GCATGGATTA CAAATATTAA AGAATGCACT
GACTTAAAAC AGACACCTTG AGAAATTTTT CATATATTTT TGAGTTTCGT GATATGTTTA
AAGTGTTAAA TAGTTTAATT ATAATACTGG TTTTTGTGTA GAAATAATAT GCCTGGTGTG
ACTACACAGT GGAATAAATT TACTGATGCA AAAAAAAAAA AAAAAA

Deduced amino acid sequence:  (length: 336) [FASTA format sequence]
MAVATVAAFL AALGGALWLA ARRFVGPSVQ RLHRGGDSGL MHGKTVLITG ANSGLGRATA
AELLRLGARV IMGCRDRARA EEAAGQLRRE LRQTEGPEEG PNSGGAGELV VRELDLASLR
SVRAFCQEML QEEPRLDVLI NNAGIFQCPY MKTEDGFEMQ FAVNHLGHFL LTNLLLGLLK
SSAPSRIVVV SSKLYKYGDI NFEDLNSEQS YNKSFCYSRS KLANILFTRE LARRLEGTNV
TVNVLHPGIV RTNLGRHIHI PLLVKPLFNL VSWAFFKTPA EGAQTSVYLA SSPEVEGVSG
KYFGDCKEEE LLPKAMDDSV ARKLWDISEV MVGILK


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Homo sapiens]. 544e-154O
Contig/Assembly ProteinNT5C1B-RDH14NT5C1B-RDH14 protein isoform 1 [Homo sapiens]. 368e-102
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Homo sapiens]. 2459e-65
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 isoform 1 [Homo sapiens]. 2426e-64
Contig/Assembly ProteinCBR1carbonyl reductase [NADPH] 1 [Homo sapiens]. 57.44e-08


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRdh14retinol dehydrogenase 14 [Mus musculus]. 513e-145O
Contig/Assembly ProteinRdh12retinol dehydrogenase 12 [Mus musculus]. 2381e-62
Contig/Assembly ProteinRdh13retinol dehydrogenase 13 [Mus musculus]. 2381e-62
Contig/Assembly ProteinRdh11retinol dehydrogenase 11 [Mus musculus]. 2194e-57
Contig/Assembly ProteinRdh10retinol dehydrogenase 10 [Mus musculus]. 52.41e-06


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC482983PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis) isoform 1 [Canis familiaris]. 550e-156O
Contig/Assembly ProteinLOC490744PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis) [Canis familiaris]. 2389e-63
Contig/Assembly ProteinLOC611373PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris]. 2363e-62
Contig/Assembly ProteinLOC610120PREDICTED: similar to WW domain-containing oxidoreductase isoform 1 [Canis familiaris]. 1258e-29


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Bos taurus]. 544e-155O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Bos taurus]. 2441e-64
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 [Bos taurus]. 2341e-61
Contig/Assembly ProteinRDH11PREDICTED: retinol dehydrogenase 11-like [Bos taurus]. 2266e-59O
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 [Bos taurus]. 97.14e-20


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100516970PREDICTED: retinol dehydrogenase 14-like [Sus scrofa]. 585e-167
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Sus scrofa]. 2462e-65
Contig/Assembly ProteinLOC100154684PREDICTED: retinol dehydrogenase 11 [Sus scrofa]. 2232e-58
Contig/Assembly ProteinLOC100513982PREDICTED: retinol dehydrogenase 12-like [Sus scrofa]. 928e-19
Contig/Assembly ProteinLOC100519844PREDICTED: WW domain-containing oxidoreductase-like, partial [Sus scrofa]. 78.69e-15


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-091164.1GTTTTTGTGTAGAAATAATATGCCTGGTGTGACTACACAGTGGAATAAATTTACTGATGC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0037305fwd
2003082620030826C-0011506fwd
2004020420040204C-0015145fwd
2005032220050322C-0062647fwd
2006061120060611C-0017488fwd
2007080620070806C-0086318fwd
2008051520080515C-0038528fwd
2010100120101001C-00319810fwd
2011060120110601C-00374710fwd