[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  LVRM1_0151_G04

Library: LVRM1 (Liver)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 2,212)  [FASTA format sequence]
CTCTCGCCAC CCACGCCCGC CCCCAGCCGC CGGCCCTTTC CCCGCGCTGC CGCCGCCGCC
GCCGCCGCAG TCAGCTCGGG CGCCCCGGCA GCATCCGACC GCTCAGCCCA GTGCCACCGC
GCCAGCGCCA GCCCGCC
ATG GAGCCCCGAG CCCCCCGCCG CCGCCACACG CTCCAGCGCG
GCTATGCCGT GACGCGGATC CCCCATCTCA ACAAGGACTT GGCTTTCACC CTGGAAGAGA
GGCAGCAGTT GAACATTCAT GGATTGTTAC CACCTTGCTT CATCAGTCAG GACATCCAGG
TCCTTAGAGT AATTAAAAAT TTTGAGCGTC TGAACTCTGA TTTTGACAGG TATCTTCTCT
TAATGGACCT TCAAGATAGA AATGAAAAGC TCTTTTATAA AGTGCTAATG TCTGACATTG
AGAAATTCAT GCCTATCGTT TATACTCCCA CTGTGGGTCT GGCTTGCCAG CAATACAGTT
TAGCATTTCG GAAGCCAAGA GGTCTCTTTA TTAGTATCCA TGATCGAGGG CATGTTGCTT
CAGTTCTTAA TGCATGGCCA GAAGATGTCA TCAAGGCTGT CGTGGTGACT GATGGAGAAC
GTATTCTTGG CCTGGGAGAC CTTGGCTGTA ACGGGATGGG CATCCCTGTG GGTAAACTGG
CACTCTATAC AGCATGTGGA GGGGTAAATC CCCAAGAATG TCTGCCTGTC ATCCTGGACG
TGGGAACAGA AAATGAGGAG TTACTTAAAG ATCCACTGTA CATTGGACTG CGGCAGAGAA
GAGTGAGAGG TCCTGAATAT GATGATTTTT TGGATGAATT CATGGAGGCA GTTTCTTCCA
AGTATGGCAT GAATTGCCTT ATTCAGTTTG AAGATTTTGC CAATATAAAT GCATTTCGTC
TCCTGAAAAA GTATCAGAAT CAGTATTGCA CATTCAACGA TGATATTCAA GGAACGGCAT
CTGTTGCGGT TGCTGGCATC CTTGCAGCCC TTCGAATCAC CAAGAACAAG CTTTCTGATC
AAACGATACT GTTCCAAGGA GCTGGAGAGG CTGCCTTAGG GATTGCACAC CTGATTGTTA
TGGCCATGGA AAAAGAAGGT GTCCCAAAAG AGAAAGCCAT AAAGAAGATA TGGTTGGTTG
ACTCAAAAGG ATTAATAGTT AAGGGACGGG CTGCCTTAAC AAACGAGAAA GAGGAATTTG
CCCATGAACA TGAAGAAATG AAGAACCTAG AAGCCATTGT TCAAGATATA AAACCAACAG
CCCTCATAGG AGTTGCTGCG ATTGGTGGTG CATTTTCAGA ACAAATTCTC AAAGACATGG
CTGCCTTCAA TGAACGGCCT ATTATTTTTG CTTTGAGTAA TCCAACCAGC AAAGCAGAAT
GTACTGCAGA GCAGTGCTAC ACACTGACAC AGGGTCGTGC AATTTTTGCC AGTGGCAGTC
CTTTTGATCC GGTCACTCTT CCAAGTGGGC AGACCCTGTA TCCTGGCCAA GGCAACAATT
CCTATGTGTT TCCTGGAGTT GCCCTTGGTG TTGTGGCCTG TGGACTGAGG CATATCACGG
ATAAGATCCT TCTCACTACT GCTGAGGTTA TAGCTCAGCA AGTATCAGAT AAACACTTGG
AAGAAGGCCG GCTTTATCCT CCTCTGAACA CCATTAGAGA TGTTTCTCTG AAAATCGCAG
AAAAGATTGT GAGAGATGCA TACCAAGAAA AGACAGCCAC CATTTATCCT GAACCCTCAA
ACAAGGAAGC ATTTGTCCGC TCTCAGATGT ATAGCACTGA TTATGACCAG ATTCTACCTG
ATGGCTATTC TTGGCCTGAA GAGGCCCAGA AAATACAGAC CAAACTTGAC TAATAGCGTA
ATAGCCTACA TTTCTAACTC CATTCATGAG ATCTGGAAGT CTTCCATAAT TTTTAAATAT
TGGGATCTTT TATAATGATT CATAATGTGC TAGATTAAGA TAATTTCCCC TTAACACTCT
AAACATTTAT GGACGATTAT TGTTATACTT TAGGGTAAAC ATCACAGTAG ACAATTTTGC
TTCATTTACT TTCTTGTTAT TTATGGTTTC TGTCTTAATT ATTTTGCCCA AGTTCTCTTT
AAAAGCTATT GTAACTGCTA CTGAGAAACC CTTTTCATAG AGGAAACTAA GGGGAAGACC
AAAATTAGTA ATAAAATGGT ATGATCAGTA TTAAAAAAAA AAAAAAAAAA AA

Deduced amino acid sequence:  (length: 571) [FASTA format sequence]
MEPRAPRRRH TLQRGYAVTR IPHLNKDLAF TLEERQQLNI HGLLPPCFIS QDIQVLRVIK
NFERLNSDFD RYLLLMDLQD RNEKLFYKVL MSDIEKFMPI VYTPTVGLAC QQYSLAFRKP
RGLFISIHDR GHVASVLNAW PEDVIKAVVV TDGERILGLG DLGCNGMGIP VGKLALYTAC
GGVNPQECLP VILDVGTENE ELLKDPLYIG LRQRRVRGPE YDDFLDEFME AVSSKYGMNC
LIQFEDFANI NAFRLLKKYQ NQYCTFNDDI QGTASVAVAG ILAALRITKN KLSDQTILFQ
GAGEAALGIA HLIVMAMEKE GVPKEKAIKK IWLVDSKGLI VKGRAALTNE KEEFAHEHEE
MKNLEAIVQD IKPTALIGVA AIGGAFSEQI LKDMAAFNER PIIFALSNPT SKAECTAEQC
YTLTQGRAIF ASGSPFDPVT LPSGQTLYPG QGNNSYVFPG VALGVVACGL RHITDKILLT
TAEVIAQQVS DKHLEEGRLY PPLNTIRDVS LKIAEKIVRD AYQEKTATIY PEPSNKEAFV
RSQMYSTDYD QILPDGYSWP EEAQKIQTKL D


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME1NADP-dependent malic enzyme [Homo sapiens]. 10450.0O
Contig/Assembly ProteinME3NADP-dependent malic enzyme, mitochondrial precursor [Homo sapiens]. 8350.0O
Contig/Assembly ProteinME2NAD-dependent malic enzyme, mitochondrial isoform 1 precursor [Homo sapiens]. 6440.0


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMe1NADP-dependent malic enzyme isoform 1 [Mus musculus]. 10090.0O
Contig/Assembly ProteinMe3NADP-dependent malic enzyme, mitochondrial precursor [Mus musculus]. 8370.0
Contig/Assembly ProteinMe2NAD-dependent malic enzyme, mitochondrial precursor [Mus musculus]. 6390.0
Contig/Assembly ProteinLOC100505264PREDICTED: NAD-dependent malic enzyme, mitochondrial-like [Mus musculus]. 598e-171


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME1PREDICTED: similar to NADP-dependent malic enzyme (NADP-ME) (Malic enzyme 1) [Canis familiaris]. 10140.0O
Contig/Assembly ProteinLOC485151PREDICTED: similar to malic enzyme 3, NADP(+)-dependent, mitochondrial isoform 2 [Canis familiaris]. 8400.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME1NADP-dependent malic enzyme [Bos taurus]. 10120.0
Contig/Assembly ProteinME3NADP-dependent malic enzyme, mitochondrial [Bos taurus]. 8380.0
Contig/Assembly ProteinME2NAD-dependent malic enzyme, mitochondrial [Bos taurus]. 6590.0O
Contig/Assembly ProteinLOC100299244PREDICTED: predicted protein-like, partial [Bos taurus]. 67.45e-11


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME1PREDICTED: NADP-dependent malic enzyme [Sus scrofa]. 11080.0
Contig/Assembly ProteinME3PREDICTED: LOW QUALITY PROTEIN: NADP-dependent malic enzyme, mitochondrial [Sus scrofa]. 8190.0
Contig/Assembly ProteinME2PREDICTED: NAD-dependent malic enzyme, mitochondrial [Sus scrofa]. 538e-153


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-094074.1GCGTAATAGCCTACATTTCTAACTCCATTCATGAGATCTGGAAGTCTTCCATAATTTTTA


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531S-0090181fwd
2003082620030826S-0102961fwd
2004020420040204S-0102481fwd
2005032220050322S-0170591fwd
2006061120060611S-0246171fwd
2007080620070806S-0394701fwd
2008051520080515C-0089482fwd
2010100120101001C-0151032fwd
2011060120110601C-0109972fwd