[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  LVRM1_0187_E10

Library: LVRM1 (Liver)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 1,343)  [FASTA format sequence]
GAGCGCCGAG TCCCGCGGGC GGCGCGGAAG CGGCGGCCGG GCAGCCATGT CGCCTTTGTC
TGCGGCGCGG GCGGCCCTGC GGGTCTACGC GGCGGGCGCG GCGGTGATCC TGGCGCAGCT
GCTGCGCCGC TGCCGCGGGG GCTTCGCGGA GCCAGTTTTC CCGCCACAAC CCGGGCGCGT
TGCCATAGTG ACCGGAGGGA CGGAGGGCAT CGGCTTTGCC ACCGCGAAGC ATCTGGCGAG
ACTGGGCATG CACGTGATCA TAGCTGGAAA CAATGACAGC AAAGCCCGGG AAGCGGTGAG
GAAGATCCGA GAGGAGACCC TGAATGACAA AGTGGAGTTT TTATATTGCG ACCTGGCGTC
CATGAAGTCT ATCCGGCAGT TTGTCCAGAA GTTCAAGATG AAGAAAATCC CTCTCCACGT
CCTGGTCAAT AACGCCGGCG TGATGATGGT GCCGCAGAGG GAGACGGAGG ACGGCTTCGA
GGAGCACTTT GGAGTGAACT ACCTGGGCCA CTTCCTGCTG ACCCACCTCC TCCTGGATGA
CCTGCAGGCG TCGGGCTCCC CCGGCCGCAG CGCCAGGGTG GTGACCGTGT CCTCGGCCAC
ACACTACGTT GGGGAGCTGG ACTTGGACGA CCTTCAGAGC AGCGGCGGCT ACTCCCCGCA
CGGCGCCTAC GCCCGCAGCA AGCTGGCCCT GGTCCTCTTC TCCCACCGGC TGCAGGCGCT
GCTGGCGGCC AAGGGCAGCC CGGTGACCGC CAATGTGGCC GACCCCGGCG TGGTCAACAC
CGACCTCTAC AGACACGTCT TCTGGGGCAC GCGGCTCCTC AAGAAGCTCT TCGGCTGGTG
GTTTTTCAAG ACCCCGGATG AAGGAGCCTG GACGTCTGTC TATGCTGCCG TCTCCCCGGC
GCTGGAAGGC GTGGGCGGCC GCTATCTTTA CAACGAGAAG GAGGCCAAGT CACTGGCGAT
CACGTACGAC CCGAAGCTTC AGCGACAGCT GTGGGCCCGG AGTTGCCAGA TGACCGGCAT
CGCTGACATG ACCCGGGACA CCTTGTGGGG ATAGCGGCCA CGCCGGGAGG ACCGCGTCGG
CCCAGCGCTC GCAGGTGCGT CTGCGCTGGA CCGCGCCTCT GCGTCCTTCC CGCCGCGCCC
TCCAGACTGT GTCGGTCCGC ATCTTCCGCC GGCTGCTGCC GTGCGCTTTG CGGGAAGTGA
AGAAGCAGAG GCGGCTGTGA GTGTGGCCCT GAGCCTCTGG TCCTCAGCCC CGAATTGCCT
GATTCCCCAA AGGATCGACG GTGCCGGGTG CCCTGTGTCA TTAAATCCTG CCAGCCCCGT
GAAAAAAAAA AAAAAAAAAA AAA

Deduced amino acid sequence:  (length: 335) [FASTA format sequence]
MSPLSAARAA LRVYAAGAAV ILAQLLRRCR GGFAEPVFPP QPGRVAIVTG GTEGIGFATA
KHLARLGMHV IIAGNNDSKA REAVRKIREE TLNDKVEFLY CDLASMKSIR QFVQKFKMKK
IPLHVLVNNA GVMMVPQRET EDGFEEHFGV NYLGHFLLTH LLLDDLQASG SPGRSARVVT
VSSATHYVGE LDLDDLQSSG GYSPHGAYAR SKLALVLFSH RLQALLAAKG SPVTANVADP
GVVNTDLYRH VFWGTRLLKK LFGWWFFKTP DEGAWTSVYA AVSPALEGVG GRYLYNEKEA
KSLAITYDPK LQRQLWARSC QMTGIADMTR DTLWG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRSXdehydrogenase/reductase SDR family member on chromosome X precursor [Homo sapiens]. 493e-139O
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Homo sapiens]. 1802e-45
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 isoform 1 [Homo sapiens]. 1789e-45
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Homo sapiens]. 1742e-43
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 isoform 2 [Homo sapiens]. 621e-09


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDhrsxdehydrogenase/reductase SDR family member on chromosome X homolog precursor [Mus musculus]. 3448e-95O
Contig/Assembly ProteinRdh14retinol dehydrogenase 14 [Mus musculus]. 1832e-46
Contig/Assembly ProteinRdh13retinol dehydrogenase 13 [Mus musculus]. 1781e-44
Contig/Assembly ProteinRdh12retinol dehydrogenase 12 [Mus musculus]. 1727e-43
Contig/Assembly ProteinCbr3carbonyl reductase 3 [Mus musculus]. 56.64e-08


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC609792PREDICTED: similar to dehydrogenase/reductase (SDR family) X-linked [Canis familiaris]. 481e-136O
Contig/Assembly ProteinLOC611373PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris]. 1825e-46
Contig/Assembly ProteinLOC482983PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis) isoform 1 [Canis familiaris]. 1772e-44
Contig/Assembly ProteinLOC490744PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis) [Canis familiaris]. 1764e-44
Contig/Assembly ProteinLOC610164PREDICTED: similar to Carbonyl reductase [NADPH] 1 (NADPH-dependent carbonyl reductase 1) (Prostaglandin-E(2) 9-reductase) (Prostaglandin 9-ketoreductase) (15-hydroxyprostaglandin dehydrogenase [NADP+]) [Canis familiaris]. 65.99e-11


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRSXPREDICTED: dehydrogenase/reductase (SDR family) X-linked [Bos taurus]. 362e-100O
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Bos taurus]. 1811e-45
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 [Bos taurus]. 1781e-44
Contig/Assembly ProteinMGC152281hypothetical protein LOC507942 [Bos taurus]. 1325e-31


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100516970PREDICTED: retinol dehydrogenase 14-like [Sus scrofa]. 1779e-45
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Sus scrofa]. 1762e-44
Contig/Assembly ProteinLOC100154684PREDICTED: retinol dehydrogenase 11 [Sus scrofa]. 1741e-43
Contig/Assembly ProteinLOC100513982PREDICTED: retinol dehydrogenase 12-like [Sus scrofa]. 79.34e-15
Contig/Assembly ProteinLOC100512990PREDICTED: carbonyl reductase [NADPH] 3-like [Sus scrofa]. 60.82e-09


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-096044.1ATGAAGTCTATCCGGCAGTTTGTCCAGAAGTTCAAGATGAAGAAAATCCCTCTCCACGTC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003082620030826C-0013675fwd
2005032220050322C-00115013fwd
2006061120060611C-00658213fwd
2007080620070806C-00809413fwd
2008051520080515C-00284415fwd
2010100120101001C-00286915fwd
2011060120110601C-00846215fwd