[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  MLN01_0019_G06

Library: MLN01 (Mesenteric lymph nodes)
Individual: LWD2, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,052)  [FASTA format sequence]
TCATTGCTCT ACAACTCCGA AGAGCAACAG CTGAGACCAC CTTGAGAAGA GCATGGTCCC
AGCGGCTATT ATACCCATGA ATTTGATGGC GACGAGGAAT TCTACGTGGA CCTGGGGAAG
AAGGAGACTG TCTGGCAGCT GCCTCTGTTT AGCAAATTTA GAAGTTTTGA CCCACAGGGT
GCACTGAGGA ACATAGCTAC GGCAAAACAT AATTTGAACA TCCTGATTAA ACGTTCCAAC
AACACCGCGG CTGTCAATCA GGTTCCTGAG GTGACTGTGT TTCCCAAGTC TCCAGTG
ATG
CTGGGTCAGC CCAACACCCT CATCTGTCAT GTGGACAACA TCTTTCCTCC TGTGATCAAC
ATCACGTGGT TGAAGAACGG GCACTCTGTC ACAGAAGGTT TTTCTGAGAC CAGCTTCCTC
TCCAAAAATG ATCATTCCTT CCTCAAGATC AGTTATCTCA CCTTCCTCCC TTCTGATGAT
GATTTTTATG ACTGCAAAGT GGAGCACTGG GGCCTGGATA AGCCACTTCT GAAACACTGG
GAACCTGAGA TTCCAGCCCC CATGTCAGAG CTGACAGAGA CAGTGGTCTG CGCCCTGGGA
TTGATCGTGG GCCTTGTGGG CATCGTGGTG GGCACTGTCT TCATCATTCA AGGCCTGCGC
TCAGGTGGTC CCTCTAGACA CCAAGGGTCC TTGTGAGTCA CACTCCAGAA GGGAAGGTGC
ACTGCCCGCC TACAAGAGCT GAAGAGTGGA TGTGCTCAAC GACCTAGAAC TATTTTCTGG
CCAAATTCAT CATATACCTT CTCTCTTCCT ACATTCTTCT TCTCACCTCT TCTCTGGAAC
TTAAGGTGCT GTGTCATCTC AGAATTCATA TGCCCTTGGA ATCCTCTTCC TGACCTTCTA
GGTTTTTTTT CTTTTCTCAG TTGTTACCTG TTATGGGATC TCTGAGATAT CCCACTCGGC
TACCTGATCC CTCAGTGACC CTAAACTAAT ATGTACATGG AAACAATAAA TCACTTCATG
AGGTTTTTGT ACTGAAAAAA AAAAAAAAAA AA

Deduced amino acid sequence:  (length: 132) [FASTA format sequence]
MLGQPNTLIC HVDNIFPPVI NITWLKNGHS VTEGFSETSF LSKNDHSFLK ISYLTFLPSD
DDFYDCKVEH WGLDKPLLKH WEPEIPAPMS ELTETVVCAL GLIVGLVGIV VGTVFIIQGL
RSGGPSRHQG SL


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 3 [Homo sapiens]. 3323e-91
Contig/Assembly ProteinHLA-DQA2HLA class II histocompatibility antigen, DQ alpha 2 chain precursor [Homo sapiens]. 3271e-89
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 4 [Homo sapiens]. 2848e-77


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2-Aahistocompatibility 2, class II antigen A, alpha precursor [Mus musculus]. 2954e-80
Contig/Assembly ProteinH2-Ea-pshistocompatibility 2, class II antigen E alpha precursor [Mus musculus]. 2171e-56
Contig/Assembly ProteinH2-Oahistocompatibility 2, O region alpha locus [Mus musculus]. 2101e-54
Contig/Assembly ProteinH2-DMaclass II histocompatibility antigen, M alpha chain precursor [Mus musculus]. 796e-15
Contig/Assembly ProteinH2-DMb2histocompatibility 2, class II, locus Mb2 [Mus musculus]. 63.53e-10


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha [Canis lupus familiaris]. 3331e-91
Contig/Assembly ProteinDLA-DRAMHC class II DR alpha chain [Canis lupus familiaris]. 2262e-59
Contig/Assembly ProteinLOC474869PREDICTED: similar to HLA class II histocompatibility antigen, DO alpha chain precursor (MHC class II antigen DOA) (MHC DZ alpha) (MHC DN-alpha) isoform 11 [Canis familiaris]. 2217e-58
Contig/Assembly ProteinHLA-DOBmajor histocompatibility complex, class II, DO beta [Canis lupus familiaris]. 60.53e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha 5 [Bos taurus]. 3262e-89
Contig/Assembly ProteinBOLA-DQA1major histocompatibility complex, class II, DQ alpha, type 1 [Bos taurus]. 3253e-89
Contig/Assembly ProteinLOC100336394PREDICTED: BOLA-DQA2 protein-like [Bos taurus]. 3225e-88
Contig/Assembly ProteinBOLA-DQA3major histocompatibility complex, class II, DQ alpha, type 3 [Bos taurus]. 3124e-85
Contig/Assembly ProteinLOC525727PREDICTED: MHC class II antigen-like [Bos taurus]. 2094e-54


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSLA-DQA1SLA class II histocompatibility antigen, DQ haplotype D alpha chain precursor [Sus scrofa]. 391e-109
Contig/Assembly ProteinSLA-DQASLA class II histocompatibility antigen, DQ haplotype C alpha chain precursor [Sus scrofa]. 364e-101
Contig/Assembly ProteinSLAsrc-like-adapter [Sus scrofa]. 2408e-64
Contig/Assembly ProteinSLA-DRAMHC class II DR-alpha [Sus scrofa]. 2246e-59
Contig/Assembly ProteinLOC100513292PREDICTED: DLA class II histocompatibility antigen, DR-1 beta chain-like [Sus scrofa]. 63.52e-10


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-073644.1ATCCCTCAGTGACCCTAAACTAATATGTACATGGAAACAATAAATCACTTCATGAGGTTT


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003082620030826C-003433188fwd
2004020420040204C-0002204fwd
2005032220050322C-0001966fwd
2006061120060611C-0001646fwd
2007080620070806C-0000226fwd
2008051520080515C-000329397fwd
2010100120101001C-001170425fwd
2011060120110601C-001518452fwd