[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  MLN01_0069_F02

Library: MLN01 (Mesenteric lymph nodes)
Individual: LWD2, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,161)  [FASTA format sequence]
ATCTTTGTTG GGGGCAGCAG GGCCGGGCGT CTGGAGATGC CGAAGTCGTG CGCTGCCCGG
CAGTGTTGCA ACCGCTACAG CAGTCGCAGG AAGCAGCTCA CCTTCCACCG GTTCCCGTTC
AGCCGCCCAG AGCTGCTAAA GGAATGGGTG CTGAACATCG GCCGAGGCGA CTTCGAGCCC
AAGCAGCACA CGGTCATCTG CTCGGAGCAC TTCCGCCCCG AGTGCTTCAG CGCCTTTGGG
AACCGCAAGA ACCTGAAGCA CAACGCGGTG CCCACGGAGT TCACCTTCCA GGGGCCCCCG
CAGCTGGTGC GGGAGACGGC TGACCCTGAT GGCCAGATCG GGGCCGCCTC TGAGAAGGGA
GAGGTCCACC CTGAGACGGG GCCCAGCGAG TGTGGCCCGG GGAGGAAGAG GGACACGGCA
CTCGAGGTGC GGCAGCCGCC CCCGGACGCC GGGGGCCCCC GAGCACAGGG CCAGCCTGGC
AGAACAGGAG CCGTGGCCAA GGCCCCGGGG CAGCCGGCCA GCCCCCCGGG GTCCGGAAGA
CCGCCGTCCA CGCAGCCACC GGACCACAGC TATGCCCTTC TGGACTTGGA CGCCTTAAAA
AAGAAACTCT TCCTGACTCT GCGGGAGAAC GAGAGGCTCC GCAGGCGCTT GCGGGCCCAG
AGGCTGGTGA TGCGGAGGAT GGCCAGCCAC CTCCAAGCCT GCCGGGCCGG GTCGCGGCCA
GAGCAGCAGA GCTGAGCCTG ACATCCGGGC TTCCTCCCCG GAGCCCCTGG CCCTGGCGTC
GCCAAGAGCC CAGCGCTGCG GCCGCAGGTG AAGGTCAGCG GCATCGGGCA TGGAGGGGGC
AGGGCCGGGA GCAGACCCCC AGGGTCCCCG CTGTCCCCCC AACACAAGCT GGGCCAGCGT
CTGGGGAACA CCCCAAGCCA CACGGGCAGG TGCTCCCAAG AGGGGTAGCG GGCGTGGGGT
GGCCGGTGGG GGCGCCGGCC GACTCTGGGG CAGCTGAGCC GTCCCCTCTG TCGCCTGGAC
AGCCCGCTGG CGCTCTGGGG CCGACACTGG CTTCTGTTCT AAGGAGCAGC CCCGGCTGGC
CAGGGTCGCG CCCACGGCGT AATAAAGCAT CTTCCTAGGC AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAAAAAAAA A

Deduced amino acid sequence:  (length: 232) [FASTA format sequence]
MPKSCAARQC CNRYSSRRKQ LTFHRFPFSR PELLKEWVLN IGRGDFEPKQ HTVICSEHFR
PECFSAFGNR KNLKHNAVPT EFTFQGPPQL VRETADPDGQ IGAASEKGEV HPETGPSECG
PGRKRDTALE VRQPPPDAGG PRAQGQPGRT GAVAKAPGQP ASPPGSGRPP STQPPDHSYA
LLDLDALKKK LFLTLRENER LRRRLRAQRL VMRRMASHLQ ACRAGSRPEQ QS


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTHAP3THAP domain-containing protein 3 isoform 3 [Homo sapiens]. 2281e-59
Contig/Assembly ProteinTHAP1THAP domain-containing protein 1 isoform 1 [Homo sapiens]. 90.92e-18
Contig/Assembly ProteinTHAP7THAP domain-containing protein 7 isoform 1 [Homo sapiens]. 53.93e-07


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinThap3THAP domain-containing protein 3 isoform 1 [Mus musculus]. 1941e-49
Contig/Assembly ProteinThap1THAP domain-containing protein 1 [Mus musculus]. 90.13e-18
Contig/Assembly ProteinThap2THAP domain-containing protein 2 [Mus musculus]. 75.96e-14
Contig/Assembly ProteinThap4THAP domain-containing protein 4 [Mus musculus]. 55.86e-08


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC607727PREDICTED: similar to THAP domain protein 3 isoform 1 [Canis familiaris]. 2133e-55
Contig/Assembly ProteinLOC475569PREDICTED: similar to THAP domain protein 1 isoform 2 [Canis familiaris]. 89.46e-18
Contig/Assembly ProteinLOC484566PREDICTED: similar to CLIP-170-related protein [Canis familiaris]. 64.72e-10


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTHAP3THAP domain-containing protein 3 [Bos taurus]. 2471e-65
Contig/Assembly ProteinTHAP1THAP domain-containing protein 1 [Bos taurus]. 86.74e-17
Contig/Assembly ProteinTHAP8THAP domain-containing protein 8 [Bos taurus]. 62.47e-10
Contig/Assembly ProteinTHAP4THAP domain-containing protein 4 [Bos taurus]. 56.25e-08
Contig/Assembly ProteinTHAP7THAP domain-containing protein 7 [Bos taurus]. 50.82e-06


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100621925PREDICTED: THAP domain-containing protein 1-like [Sus scrofa]. 87.41e-17
Contig/Assembly ProteinLOC100152778PREDICTED: LOW QUALITY PROTEIN: THAP domain-containing protein 2-like [Sus scrofa]. 76.62e-14
Contig/Assembly ProteinLOC100521761PREDICTED: THAP domain-containing protein 5-like [Sus scrofa]. 59.73e-09
Contig/Assembly ProteinLOC100522440PREDICTED: THAP domain-containing protein 8-like [Sus scrofa]. 59.34e-09
Contig/Assembly ProteinLOC100526013PREDICTED: THAP domain-containing protein 7-like isoform 1 [Sus scrofa]. 526e-07


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-004244.1TTAAAAAAGAAACTCTTCCTGACTCTGCGGGAGAACGAGAGGCTCCGCAGGCGCTTGCGG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003082620030826C-0049894fwd
2004020420040204C-00449910fwd
2005032220050322C-0056035fwd
2006061120060611C-0011154fwd
2007080620070806C-0012994fwd
2008051520080515C-0023526fwd
2010100120101001C-0025864fwd
2011060120110601C-0081674fwd